Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/12—Viral antigens
  • A61K39/29—Hepatitis virus
  • A61K39/292—Serum hepatitis virus, hepatitis B virus, e.g. Australia antigen
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/12—Viral antigens
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/20—Antivirals for DNA viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P33/00—Antiparasitic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
  • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
  • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
  • A61K2039/53—DNA (RNA) vaccination
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
  • A61K2039/55505—Inorganic adjuvants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
  • A61K2039/55511—Organic adjuvants
  • A61K2039/5555—Muramyl dipeptides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
  • A61K2039/55511—Organic adjuvants
  • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2730/00—Reverse transcribing DNA viruses
  • C12N2730/00011—Details
  • C12N2730/10011—Hepadnaviridae
  • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
  • C12N2730/10134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

• This invention relates to generally to adjuvants, and specifically to the use of oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) as an adjuvant.
• CpG ODN unmethylated CpG dinucleotide
• PBMC peripheral blood mononuclear cells
• This lymphocyte activation is due to unmethylated CpG dinucleotides, which are present at the expected frequency in bacterial DNA (1/16), but are under-represented (CpG suppression, 1/50 to 1/60) and methylated in vertebrate DNA.
• Activation may also be triggered by addition of synthetic oligodeoxynucleotides (ODN) that contain an unmethylated CpG dinucleotide in a particular sequence context. It appears likely that the rapid immune activation in response to CpG DNA may have evolved as one component of the innate immune defense mechanisms that recognize structural patterns specific to microbial molecules.
• ODN synthetic oligodeoxynucleotides
• CpG DNA induces proliferation of almost all (>95%) B cells and increases immunoglobulin (Ig) secretion.
• This B cell activation by CpG DNA is T cell independent and antigen non-specific.
• B cell activation by low concentrations of CpG DNA has strong synergy with signals delivered through the B cell antigen receptor for both B cell proliferation and Ig secretion (Krieg et al., 1995). This strong synergy between the B cell signaling pathways triggered through the B cell antigen receptor and by CpG DNA promotes antigen specific immune responses.
• CpG DNA In addition to its direct effects on B cells, CpG DNA also directly activates monocytes, macrophages, and dendritic cells to secrete a variety of cytokines, including high levels of IL-12 (Klinman et al., 1996; Halpern et al, 1996; Cowdery et al., 1996). These cytokines stimulate natural killer (NK) cells to secrete g-interferon (IFN-g) and have increased lytic activity (Klinman et al., 1996, supra', Cowdery et al, 1996, supra; Yamamoto et al, 1992; Ballas et al, 1996).
• NK natural killer
• IFN-g g-interferon
• CpG DNA induces a Thl like pattern of cytokine production dominated by IL-12 and IFN-g with little secretion of Th2 cytokines (Klinman et al, 1996).
• a DNA vaccine induces immune responses against an antigenic protein expressed in vivo from an introduced gene.
• the DNA vaccine is most often in the form of a plasmid DNA expression vector produced in bacteria and then purified and delivered to muscle or skin (see Vogel and Sarver, 1995; Brazolot Millan and Davis, 1997; Donnelly eta , 1996).
• DNA vaccines have been demonstrated to show efficacy against numerous viral, bacterial and parasitic diseases in animal models. Almost all studies show induction of very strong and long-lasting humoral and cell-mediated immune responses, and protection against live pathogen challenge (where it could be evaluated).
• the efficacy of DNA vaccines is attributed, at least in part, to the continuous in vivo synthesis of antigen that leads to efficient antigen presentation.
• CTL cytotoxic T lymphocytes
• HBV Hepatitis B virus
• the current HBV vaccines are subunit vaccines containing particles of HBV envelope protein(s) which include several B and T cell epitopes known collectively as HBV surface antigen (HBsAg).
• HBsAg particles may be purified from the plasma of chronically infected individuals or more commonly are produced as recombinant proteins.
• These vaccines induce antibodies against HBsAg (anti-HBs), which confer protection if present in titers 10 milli-International Units per milliliter (mlU/ml) (Ellis, 1993). While the subunit vaccines are safe and generally efficacious, they fail to meet all current vaccination needs.
• the present invention is based on the finding that nucleic acids containing at least one unmethylated cytosine-guanine (CpG) dinucleotide affect the immune response in a subject by activating natural killer cells (NK) or redirecting a subject's immune response from a Th2 to a Thl response by inducing monocytic and other cells to produce Thl cytokines.
• CpG cytosine-guanine
• NK natural killer cells
• These nucleic acids containing at least one unmethylated CpG can be used as an adjuvant, specifically to induce an immune response against an antigenic protein.
• the invention provides a method of inducing an immune response in a subject by administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic protein and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
• the invention provides a method for treating a subject having or at risk of having a virally mediated disorder by administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
• the invention provides a method for treating a subject having or at risk of having a chronic viral infection by administering to the subject an effective amount of an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
• a pharmaceutical composition containing an immumostimulatory CpG oligonucleotide and a nucleic acid encoding an antigenic protein in a pharmaceutically acceptable carrier is provided.
• FIG. 1 is a graph illustrating humoral responses in BALB/c mice immunized with
• HBsAg protein 1 g recombinant HBsAg protein alone, adsorbed onto alum (25 mg Al 3+ /mg HBsAg), with 100 g of immunostimulatory CpG ODN, or with both alum and CpG ODN.
• the upper graph shows results on a linear scale and the lower graph shows results on a logarithmic scale (log 10 ).
• FIG. 2 is a graph illustrating humoral responses in BALB/c mice immunized with 1 g recombinant HBsAg protein with alum and with 0, 10, 100 or 500 g of CpG ODN added.
• IgGl and IgG2a isotypes as determined by end-point dilution ELISA assay.
• FIG. 1 1 is a graph of humoral responses in BALB/c mice primed with 10 g HBsAg-expressing DNA vaccine (pCMV-S) and given 2 g recombinant HBsAg protein at the same time in the same or a different muscle or given the HBsAg 2 or 8 weeks later.
• oligodeoxyribonucleotide as used herein is a deoxyribonucleic acid sequence from about 3-50 bases in length. Lymphocyte oligodeoxyribonucleotide uptake has been shown to be regulated by cell activation (Krieg, A.M., et al, Antisense Research and Development 161 , 1991 ). The present invention is based on the finding that certain oligonucleotides (ODN) containing at least one unmethylated cytosine-guanine (CpG) dinucleotide activate the immune response.
• ODN oligonucleotides
• CpG unmethylated cytosine-guanine
• the invention provides a method for stimulating an immune response in a subject by administering a therapeutically effective amount of a nucleic acid sequence containing at least one unmethylated CpG.
• nucleic acid or
• oligonucleotide refers to a polymeric form of nucleotides at least five bases in length.
• the nucleotides of the invention can be deoxyribonucleotides, ribonucleotides, or modified forms of either nucleotide.
• double-stranded molecules are more stable in vivo, while single-stranded molecules have increased activity.
• the nucleic acid molecule can include the use of phosphorothioate or phosphorodithioate rather than phosphodiesterase linkages within the backbone of the molecule, or methylphosphorothioate terminal linkages (Krieg, A.M., et al, Antisense and Nucl Acid Drug Dev 6: 133-9, 1996; Boggs, R.T., et al. , Antisense and Nucl Acid Drug Dev, 7:461-71, 1997).
• the phosphate backbone modification can occur at the 5' end of the nucleic acid, for example at the first two nucleotides of the 5' end of the nucleic acid.
• the phosphate backbone modification may occur at the 3' end of the nucleic acid, for example at the last five nucleotides of the 3' end of the nucleic acid.
• International Patent Application WO 95/26204 entitled “Immune stimulation by phosphorothioate oligonucleotide analogs” reports the nonsequence-specific immunostimulatory effect of phosphorothioate modified oligonucleotides.
• Nontraditional bases such as inosine and queosine, as well as acetyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine can also be included, which are not as easily recognized by endogenous endonucleases.
• nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl- phosphonates (in which the charged oxygen moiety is alkylated). Nucleic acid molecules which contain a diol, such as tetrahyleneglycol or hexaethyleneglycol, at either or both termini are also included.
• oligonucleotide includes both single and double- stranded forms of DNA.
• CpG or "CpG motif refers to a nucleic acid having a cytosine followed by a guanine linked by a phosphate bond.
• methylated CpG refers to the methylation of the cytosine on the pyrimidine ring, usually occurring the 5-position of the pyrimidine ring.
• unmethylated CpG refers to the absence of methylation of the cytosine on the pyrimidine ring. Methylation, partial removal, or removal of an unmethylated CpG motif in an oligonucleotide of the invention is believed to reduce its effect.
• Methylation or removal of all unmethylated CpG motifs in an oligonucleotide substantially reduces its effect.
• the effect of methylation or removal of a CpG motif is "substantial" if the effect is similar to that of an oligonucleotide that does not contain a CpG motif.
• the CpG oligonucleotide is in the range of about 8 to 30 bases in size.
• the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art.
• the b-cyanoethyl phosphoramidite method eaucage, S.L., and Caruthers, M.H., 7et. Let. 22:1859, 1981
• nucleoside H-phosphonate method Gagg et al, Tet. Let. 27:4051-4054, 1986; Froehler et al, Nucl Acid. Res. 14:5399-5407, 1986, ; Garegg et al, Tet. Let. 22:4055-4058, 1986,
• oligonucleotide synthesizers available in the market.
• CpG dinucleotides can be produced on a large scale in plasmids, (see Sambrook, T., et al, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor laboratory Press, New York, 1989) which after being administered to a subject are degraded into oligonucleotides.
• Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
• nucleic acids are preferably relatively resistant to degradation (e.g. , via endo-and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
• Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and
• nucleic acids may be associated with a molecule that results in higher affinity binding to target cell (e.g., B-cell, monocytic cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells to form a "nucleic acid delivery complex.”
• target cell e.g., B-cell, monocytic cell and natural killer (NK) cell
• Nucleic acids can be ionically or covalently associated with appropriate molecules using techniques which are well known in the art.
• a variety of coupling or cross-linking agents can be used, e.g., protein A, carbodiimide, and N-succinimidyl- 3-(2-pyridyldithio) propionate (SPDP).
• SPDP N-succinimidyl- 3-(2-pyridyldithio) propionate
• Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.
• the nucleic acid sequences useful in the methods of the invention are represented by the formula: wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or thymidine; X 2 is cytosine or thymine, N is any nucleotide and N, + N 2 is from about 0-26 bases. In a preferred embodiment, N, and N 2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
• nucleic acids of any size can be used in the invention if CpGs are present, as larger nucleic acids are degraded into oligonucleotides inside cells.
• Preferred synthetic oligonucleotides do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome.
• a "palindromic sequence” or "palindrome” means an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A', in which A and A' are bases capable of forming the usual Watson-Crick base pairs.
• the method of the invention includes the use of an oligonucleotide which contains a CpG motif represented by the formula: 5' N ⁇ .X GX ⁇ y (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X
• CpG ODN are also preferably in the range of 8 to 30 bases in length, but may be of any size (even many kb long) if sufficient motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells.
• Preferred synthetic oligonucleotides of this formula do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' and/or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome.
• Other CpG oligonucleotides can be assayed for efficacy using methods described herein.
• An exemplary nucleic acid sequence of the invention is S'-TCCATGACGTTCCTGACGTT-S' (SEQ ID NO:3).
• a prolonged effect can be obtained using stabilized oligonucleotides, where the oligonucleotide incorporates a phosphate backbone modification (e.g. , a phosphorothioate or phbsphorodithioate modification). More particularly, the phosphate backbone modification occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic acid. Further, the phosphate backbone modification may occur at the 3' end of the nucleic acid for example, at the last five nucleotides of the 3* end of the nucleic acid.
• a phosphate backbone modification e.g. , a phosphorothioate or phbsphorodithioate modification.
• the phosphate backbone modification occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic acid.
• the phosphate backbone modification
• Preferred nucleic acids containing an unmethylated CpG have a relatively high stimulation with regard to B cell, monocyte, and/or natural killer cell responses (e.g., induction of cytokines, proliferative responses, lytic responses, among others).
• Nucleic acids containing an unmethylated CpG can be effective in any mammal, preferably a human. Different nucleic acids containing an unmethylated CpG can cause optimal immune stimulation depending on the mammalian species. Thus an oligonucleotide causing optimal stimulation in humans may not cause optimal stimulation in a mouse. One of skill in the art can identify the optimal oligonucleotides useful for a particular mammalian species of interest.
• the "stimulation index" is a measure of a CpG ODN to effect an immune response which can be tested in various immune cell assays.
• the stimulation of the immune response can be assayed by measuring various immune parameters, e.g., measuring the antibody- forming capacity, number of lymphocyte subpopulations, mixed leukocyte response assay, lymphocyte proliferation assay.
• the stimulation of the immune response can also be measured in an assay to determine resistance to infection or tumor growth. Methods for measuring a stimulation index are well known to one of skill in the art.
• one assay is the incorporation of 3 H uridine in a murine B cell culture, which has been contacted with a 20 ⁇ M of oligonucleotide for 20h at 37°C and has been pulsed with 1 ⁇ Ci of 3 H uridine; and harvested and counted 4h later.
• the induction of secretion of a particular cytokine can also be used to assess the stimulation index.
• the CpG ODN for use in vivo, for example to treat a subject at risk of exposure to a hepatitis virus, it is important that the CpG ODN be capable of effectively inducing cytokine secretion by monocytic cells and/or Natural Killer (NK) cell lytic activity.
• the stimulation index of the CpG ODN with regard to B-cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20, while recognizing that there are differences in the stimulation index among individuals.
• the CpG ODN of the invention stimulate cytokine production (e.g., IL-6, IL-12,
• Exemplary sequences include:
• TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:6).
• the CpG ODN of the invention are also useful for stimulating natural killer cell (NK) lytic activity in a subject such as a human.
• NK natural killer cell
• Specific, but nonlimiting examples of such sequences include:
• TCGTCGTCGTCGTT SEQ ID NO: 12
• the nucleic acid sequences of the invention are also useful for stimulating B cell proliferation. Specific, but nonlimiting examples of such sequences include:
• TCGTCGCTGTCTGCCCTTCTT SEQ ID NO: 15
• TCGTCGCTGTTGTCGTTTCTT SEQ ID NO: 16
• Preferred CpG ODN can effect at least about 500 pg/ml of TNF- ⁇ , 15 pg/ml IFN- ⁇ , 70 pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic indication.
• These cytokines can be measured by assays well known in the art.
• the ODNs listed above or other preferred CpG ODN can effect at least about 10%, more preferably at least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least about 30%, more preferably at least about 35%, and most preferably at least about 40% 2C11 cell specific lysis, in assays well known in the art.
• an "antigenic polypeptide” is any polypeptide that can, under appropriate - conditions, induce an immune response.
• Antigenic polypeptides include, but are not limited to, viral proteins, or fragments thereof. Minor modifications of the primary amino acid sequences of a viral polypeptide may also result in a polypeptide which have substantially equivalent antigenic activity as compared to the unmodified counte ⁇ art polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as antigenicity still exists.
• An antigenic viral polypeptide is the hepatitis B surface antigen.
• substantially purified refers to a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
• One skilled in the art can purify viral polypeptides using standard techniques for protein purification.
• the substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel.
• the purity of the viral polypeptide can also be determined by amino-terminal amino acid sequence analysis.
• the invention utilizes polynucleotides encoding the antigenic polypeptides.
• These polynucleotides include DNA, cDNA and RNA sequences which encode an antigenic polypeptide.
• Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated polynucleotides. For example, polynucleotide enocing an antigenic polypeptide may be subjected to site-directed mutagenesis, so long as the polypeptide remains antigenic.
• polynucleotide or “nucleic acid sequence” refers to a polymeric form of nucleotides at least 10 bases in length.
• isolated polynucleotide is meant a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
• the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g. a cDNA) independent of other sequences.
• the nucleotides of the invention can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide.
• the term includes single and double forms of DNA.
• the polynucleotide sequences encoding an antigenic polypeptide may be inserted into an expression vector.
• expression vector refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the genetic sequences encoding the antigenic polypeptide.
• Polynucleotide sequence which encode the antigenic polypeptide can be operatively linked to expression control sequences. "Operatively linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. An expression control sequence operatively linked to a coding sequence is ligated such that expression of the coding sequence is achieved under conditions compatible with the expression control sequences.
• expression control sequences refers to nucleic acid sequences that regulate the expression of a nucleic acid sequence to which it is operatively linked. Expression control sequences are operatively linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence.
• expression control sequences can include appropriate promoters, enhancers, transcription terminators, as start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons.
• control sequences is intended to included, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. Expression control sequences can include a promoter.
• promoter minimal sequence sufficient to direct transcription. Also included in the invention are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the gene. Both constitutive and inducible promoters, are included in the invention (see e.g., Bitter et al, 1987, Methods in Enzymology 153:516-544).
• Promoters derived from the genome of mammalian cells e.g., metallothionein promoter
• mammalian viruses e.g., the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 7.5K promoter
• Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the nucleic acid sequences of the invention.
• terapéuticaally effective amount is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest symptoms in a subject.
• a subject is any mammal, preferably a human. Amounts effective for therapeutic use will, of course, depend on the severity of the disease and the weight and general state of the subject. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders.
• oligonucleotide containing at least one unmethylated CpG can be used alone to activate the immune response or can be administered in combination with another adjuvant.
• adjuvant is any molecule or compound which can stimulate the humoral and/or cellular immune response.
• the oligonucleotide containing at least one unmethylated CpG when administered in conjunction with another adjuvant, the oligonucleotide can be administered before, after, and/or simultaneously with the other adjuvant.
• the oligonucleotide containing at least one unmethylated CpG can have an additional efficacy (e.g., through antisense or other means) in addition to its ability to activate the immune response.
• the invention further provides a method of modulating the level of a cytokine.
• modulate envisions the suppression of expression of a particular cytokine when it is overexpressed, or augmentation of the expression of a particular cytokine when it is underexpressed. Modulation of a particular cytokine can occur locally or systemically. It is believed that the CpG oligonucleotides do not directly activate purified NK cells, but rather render them competent to respond to IL-l 2 with a marked increase in their IFN- ⁇ production. By inducing IL-12 production and the subsequent increased IFN- ⁇ secretion by NK cells, the immunostimulatory nucleic acids also promote a Thl type immune response. No direct activation of proliferation or cytokine secretion by highly purified T cells has been found. Cytokine profiles determine T cell regulatory and effector functions in immune responses.
• Cytokines also play a role in directing the T cell response.
• Helper (CD4 + ) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells.
• Most mature CD4 + T helper cells express one of two cytokine profiles: Thl or Th2.
• Thl cells secrete IL-2, IL-3, IFN- ⁇ , TNF- ⁇ , GM-CSF and high levels of TNF- ⁇ .
• Th2 cells express IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF and low levels of TNF- ⁇ .
• the Thl subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG 2a .
• the Th2 subset induces humoral immunity by activating B cells, promoting antibody production, and inducing class switching to IgG, and IgE.
• IL-12 and IFN- ⁇ are positive Thl and negative Th2 regulators.
• IL-12 promotes IFN- ⁇ production, and IFN- ⁇ provides positive feedback for IL-12.
• IL-4 and IL-10 appear to be required for the establishment of the Th2 cytokine profile and to down-regulate Thl cytokine production; the effects of IL-4 are in some cases dominant over those of IL-12.
• IL-13 was shown to inhibit expression of inflammatory cytokines, including IL-12 and TNF- ⁇ by LPS-induced monocytes, in a way similar to IL-4.
• the IL-12 p40 homodimer binds to the IL-12 receptor and antagonizes IL-12 biological activity; thus it blocks the pro-Thl effects of IL-12.
• This invention further provides administering to a subject having or at risk of having an virally mediated disorder, a therapeutical ly effective dose of a pharmaceutical composition containing the compounds of the present invention and a pharmaceutically acceptable carrier.
• administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.
• compositions according to the invention are in general administered topically, intravenously, orally, parenterally or as implants, and even rectal use is possible in principle.
• suitable solid or liquid pharmaceutical preparation forms are, for example, granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, aerosols, drops or injectable solution in ampule form and also preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
• the pharmaceutical compositions are suitable for use in a variety of drug delivery systems.
• the pharmaceutical compositions are preferably prepared and administered in dose units. Solid dose units are tablets, capsules and suppositories.
• dose units are tablets, capsules and suppositories.
• different daily doses are necessary. Under certain circumstances, however, higher or lower daily doses may be appropriate.
• the administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals.
• compositions according to the invention may be administered locally or systemically.
• therapeutically effective dose is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest the symptoms of the disorder and its complications. Amounts effective for this use will, of course, depend on the severity of the disease and the weight and general state of the patient.
• dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders.
• Various considerations are described, e.g., in Gilman et al, eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics. 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences. 17th ed., Mack Publishing Co., Easton, Pa., 1990, each of which is herein inco ⁇ orated by reference.
• CpG ODN as an adjuvant for immunization of mice against hepatitis B virus surface antigen (HbsAg) given as a recombinant protein or expressed in vivo from a DNA vaccine.
• HbsAg hepatitis B virus surface antigen
• CpG ODN Compared with the recombinant protein vaccine alone, addition of either CpG ODN or alum alone resulted in a 10-100 fold increase in the level of antibodies against HBsAg (anti-HBs). However when used together, these two adjuvants resulted in 500-1000 times higher levels of anti-HBs, indicating a strong synergistic response. Immunization with HBsAg alone or with alum resulted in a strong Th2-type response with almost all IgG being of the IgGl isotype. CpG ODN induced a high proportion of IgG2a, indicative of a Thl-type response, even in the presence of alum.
• DNA "vaccines” also induce potent Thl-type immune responses and this is likely due in large part to the presence of CpG motifs in the bacterial ly-derived plasmid DNA.
• CpG ODN was able to induce anti-HBs in mice injected on the day of birth.
• a combination approach of DNA prime and protein boost appears to be particularly effective for vaccination pu ⁇ oses, although a sufficient period (>2 weeks) must elapse before a boosting response is seen.
• mice were carried out using female BALB/c (H-2 d , good responder), C57BL/6 (B 10, H-2 b , fair responder) and B10.S (H-2 S ,MHC-restricted hypo-responder to HBsAg) mice (Charles River, Montreal, QC) at 6-8 weeks of age. Mice with class II MHC deficiency (C2D, H-2 b , GenPharm, Mountain View, CA) due to gene knockout were used as a model of a non-responder. Newborn mice were obtained through breeding male and female BALB/c mice (Charles River) in our own animal facility (Loeb Research Institute, Ottawa Civic Hospital, Ottawa, ON). Pregnant females were monitored daily to ensure accurate recording of the date of birth. Both male and female neonates were used for immunization.
• the subunit vaccine consisted of HBsAg (ay subtype) which had been produced as a recombinant protein in yeast cells (Medix Biotech #ABH0905). This was diluted in saline for use without adjuvant.
• HBsAg was also formulated with alum and/or CpG ODN as adjuvant.
• HBsAg protein was mixed with aluminum hydroxide (Alhydrogel 85, [Al 2 O 3 ],
• oligodeoxynucleotide (ODN #1826) of the sequence TCCATGACGTTCCTGACGTT synthesized with a phosphorothioate backbone (Oligos Etc. & Oligo Therapeutics, Wilsonville, OR) was added alone or with alum to HBsAg on the day of injection.
• ODN #1826 synthetic oligodeoxynucleotide
• TCCATGACGTTCCTGACGTT synthesized with a phosphorothioate backbone
• mice were immunized within 24 hours of birth or 7 days after birth by bilateral injection of a total of 1 g HBsAg into the posterior thigh muscles (2 x 10 1 @ 0.05 mg/ml). All injections were carried out with a 0.3 ml insulin syringe which has a fused 29G needle (Becton Dickenson, Franklin Lakes, NJ). For injection of adults, the needle was fitted with a collar of polyethylene (PE) tubing to limit penetration of the needle to about 3 mm. All intramuscular injections were carried out through the skin (unshaved) and under general anesthesia (Halothane, Halocarbon Laboratories, River Edge, NJ). DNA-based immunization of mice
• mice were immunized against HBsAg using plasmid constructs encoding the major protein (S) of the HBV envelope.
• the plasmid pCPIO containing two copies of the HBV genome (ayw subtype; GeneBank reference HPBAYW) as a head-to-tail fusion (Dubois et al, 1980), was the source of the envelope coding sequences and the 3' untranslated sequences which include the viral polyadenylation signal.
• a 1.9 kb J hol-BglTl restriction fragment from pCPIO (containing the S coding sequences) was cloned into the corresponding sites of a modified p Bluescript SK vector containing extra restriction sites in the polylinker (kindly provided by Dr.
• DNA was purified on Qiagen anion-exchange chromatography columns (Qiagen GmbH, Hilden, Germany). This method, which yields predominantly supercoiled, double-stranded, closed circular DNA, results in virtually no contamination with chromosomal DNA, RNA or protein and very low contamination with endotoxin.
• the DNA was resuspended in sterile saline (0.15M NaCl, BDH) and the concentration of DNA was calculated based on absorbance of ultraviolet light (OD 260). The final concentration was adjusted to 0.1 to 1 mg/ml and the DNA solutions were stored at -20C until required for injection.
• Direct gene transfer in adult mice was carried out by unilateral or bilateral IM injection into the TA muscle of DNA in 50 1 such that each animal received a total of 1, 10 or 100 g DNA.
• Newborn mice received a total of 10 g DNA by bilateral injection into the posterior thigh muscles (2 x 10 1 @ 0.5 mg/ml).
• Injections were with a 0.3 ml insulin syringe which has a fused 29G needle, and for injection of adults the needle was fitted with a collar of PE tubing to limit penetration of the needle to about 2 mm. All intramuscular injections were carried out (through shaved skin for adults) under general anesthesia (Halothane)
• Heparinized blood was collected by retrobulbar puncture of lightly anaesthetized mice as described elsewhere (Michel et al. , 1995). Plasma was recovered by centrifugation
• the bound antibodies were then detected by incubation for 1 hr at 37C with HRP-conjugated goat anti-mouse IgG, IgM, IgGl or IgG2a (1 :4000 in PBS-Tween, 10% FCS; 100 1/well, Southern Biotechnology Inc., Birmingham, AL), followed by incubation with OPD solution (100 1/well, Sigma, St. Louis, MO) for 30 minutes at RT in the dark. The reaction was stopped by the addition of sulfuric acid (50 1 of 4N H 2 S0 4 ).
• End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of non-immune plasma with a cut-off value of 0.05.
• Anti-HBs titers were expressed as group means of individual animal values, which were themselves the average of triplicate assays.
• mice no anti-HBs antibodies were detected with HBsAg alone and low titers were obtained if either CpG ODN or alum are added.
• CpG ODN CpG ODN
• alum and CpG together gives the best result although the synergy is less evident than in the BALB/c and C57BL/6 mice (FIG. 5).
• Non-responder (C2D) mice have no detectable anti-HBs after immunization with HBsAg alone. There are low levels of IgM with addition of alum and this is increased 4-fold with further addition of CpG ODN.
• ODN induces about ten-times more IgG2a than IgGl, indicating a real shift from Th2 to Thl (FIG. 7).
• CpG ODN as adjuvant to HBV DNA vaccine
• DNA vaccines induced higher levels of anti-HBs more rapidly than did HBsAg, even when alum was included (compare FIG.s 1 and 8).
• Addition of CpG ODN to the pCMV-S DNA vaccine increased anti-HBs titers a further five-fold by 4 weeks.
• the 500 g dose was slightly better than the 100 g dose (FIG. 8).
• the DNA vaccine was also superior to the HBsAg subunit vaccine in hypo-responder mice. A single injection of DNA induced earlier appearance of anti-HBs, and these reached higher titers than with two doses of protein given at 0 and 4 weeks (FIG. 9).
• CpG ODN is as good as or superior to alum when each is used alone as adjuvant with the HBsAg subunit vaccine in mice, This indicates that CpG ODN could be used to replace alum in vaccine formulations, which could be desirable to avoid associated side-effects due to local irritation in the muscle. Furthermore, for certain live-attenuated or multivalent vaccines, it is not possible to use alum which through chemical interactions interferes with the efficacy of the vaccine. This should not occur with CpG ODN.
• alum Aluminum hydroxide
• An important disadvantage of alum is that it induces a Th2- rather than a Thl-type immune response, and this may interfere with induction of CTL. Indeed, in mice immunized with recombinant HBsAg, the addition of alum selectively blocked activation of CD8 + CTL (Schirmbeck et al, 1994). Although not essential for protective immunity against HBV, CTL may nevertheless play an important role. For example, a lack of HBV-specific CTL is thought to contribute to the chronic carrier state. In contrast, one of the primary advantages of CpG DNA over alum as an adjuvant is the Thl-bias of the responses and thus the possibility to induce CTL.
• CpG can completely counteract the Th2-bias of alum when the two adjuvants are delivered together. This could allow one to capitalize on the strong synergistic action of the two adjuvants on the humoral response while still allowing CTL.
• Th2-type diseases The use of alum has been linked to Th2-type diseases.
• the much higher prevalence of asthma (another Th2-type disease) in more highly developed countries may be linked to the high hygiene level and rapid treatment of childhood infections (Cookson and Moffatt, 1997).
• Early exposure to bacterial DNA (and immunostimulatory CpG motifs) pushes the immune system away from Th2- and towards a Thl-type response and this may account for the lower incidence of asthma in less developed countries, where there is a much higher frequency of upper respiratory infections during childhood.
• Addition of CpG ODN as adjuvant to all pediatric vaccines could re-establish a Thl -type response thereby reducing the incidence of asthma.
• the DNA vaccine provides its own adjuvant in the form of CpG DNA. Since single-stranded but not double-stranded DNA can induce immunostimulation in vitro (Krieg et al, unpublished observation), the CpG adjuvant effect of DNA vaccines in vivo is likely due to oligonucleotides resulting from plasmid degradation by nucleases. Only a small portion of the plasmid DNA injected into a muscle actually enters a myofiber and is expressed, the majority of the plasmids is degraded in the extracellular space.
• DNA vaccines would offer additional advantages such as relatively low cost and ease of manufacturing, and heat-stability which circumvents the requirement for a cold-chain.
• Subunit or DNA vaccines with CpG adjuvant should reduce this further owing to a more rapid appearance and higher titers of anti-HBs antibodies and the induction of HBV-specific CTL, which could help clear virus from the liver of babies infected in utero, and which likely account for most of the failures with neonatal vaccination.
• DNA vaccines could be particularly effective if coupled with a protein boost.
• HBsAg vaccine Between 5 and 10% of individuals are non-responders or hypo-responders to the subunit HBsAg vaccine. This may be MHC-restricted (Kruskall et al, 1992) and is thought to result from a failure to recognize T-helper epitopes. In certain immunocompromised individuals (e.g., kidney dialysis patients, alcoholics) the rate of non-response can approach 50%. In the present study, alum plus CpG ODN gave higher anti-HBs titers than alum alone in a strain of mice which has MHC-restricted hypo-responsiveness to HBsAg, thought to result in a failure to recognize T-helper epitopes.
• CpG ODN also overcame non-response in mice genetically incapable of providing T-help owing to an absence of class II MHC (Milich, 1988). These results support the in vitro finding that CpG ODN drives the T cell independent activation of B cells.
• Use of CpG DNA as an adjuvant may increase the response rate to HBsAg in humans.
• a link between MHC phenotype and non-responsiveness to HBsAg has been demonstrated in humans (Kruskall et al, 1992).
• HBV chronicity results in 10-15% of individuals infected as adolescents or adults, but 90-95% for those infected (either vertically or horizontally) as infants. HBV chronicity eventually leads to cirrhosis and increased risk of hepatocellular carcinoma and an estimated one million people die each year from HBV-related liver disease. Persistent HBV infection of the liver results when acute infection fails to launch an appropriate immune response to clear the virus. Such chronic carriers have circulating HBsAg and HBV core antigen (HBcAg/HBeAg) without specific immunity. It is thought that the absence of HBV-specific CTL may contribute to the establishment and maintenance of the chronic carrier state.
• HBV chronic infection There is currently no cure for the HBV chronic infection. Interferon is used currently but this cures only 10-20% of treated individuals (Niederau et al, 1996).
• Anti-viral drugs e.g., lamivudine
• Each of these types of treatment is also expensive and has certain undesirable side-effects.
• the possibility to induce a strong Thl-type response with CpG ODN added to a subunit vaccine may help overcome the chronic carrier state.
• pre-Sl polypeptide may prevent secretion, it might be desirable to encode a truncated version of this such as that described by Li et al. (1994) with only amino acids 21-47 which include the hepatocyte receptor-binding site and induce anti-preSl immune responses yet still maintain particle secretion.
• a subunit vaccine containing the middle HBV envelope protein preS2 + S
• preS2 + S reduced viral replication in 50% of vaccinated chronic carriers
• a DNA vaccine might also prove very effective as a therapeutic vaccine for HBV chronic carriers.
• an HBsAg-expressing DNA vaccine could break tolerance to HBsAg in transgenic mice expressing HBsAg in the liver from before birth (Mancini et al. , 1996). This response appears to be mediated by T cells via a non-lytic mechanism. Addition of CpG dinucleotide motifs that preferentially induce Thl cytokines and strong CTL responses could further improve DNA vaccines for application to HBV chronic carriers.
• ODN containing CpG dinucleotides are useful as an adjuvant to protein vaccines (whole pathogen or subunit).
• the CpG ODN could be used alone or in combination with alum. Used alone, it will allow the possibility to adjuvant vaccines that cannot be mixed with alum (e.g., live attenuated pathogens, multivalent vaccines). Used together, it will capitalize on the synergistic effect to induce very potent immune responses, yet still maintain the Thl bias of CpG DNA.
• CpG dinucleotides also act to adjuvant DNA vaccines. Additional CpG given as ODN or cloned into the plasmid vector could further augment immune responses.
• CpG ODN could be added as an adjuvant to recombinant HBsAg subunit vaccines, either alone or in combination with alum, or can be cloned into an HBsAg-expressing DNA vaccine.
• These improved vaccines can (i) induce higher titers more quickly and reduce the number of doses required to induce protective immunity from three to two, (ii) overcome hypo- or non- responsiveness to HBsAg, (iii) control the chronic carrier state through induction of CTL, and (iv) induce rapid and stronger immunity in neonates in HBV endemic areas.
• a method of inducing an immune response in a subject comprising: administering to the subject a therapeutically effective amount of nucleic acid encoding an antigenic polypeptide, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
• oligonucleotide is from 8-30 bases in length.
• nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide are administered in a vector.
• nucleic acid encoding an antigenic protein encodes a viral antigen.
• hepatitis viral antigen is a hepatitis B virus surface antigen.
• the oligonucleotide has a formula: S'N ⁇ CGX ⁇ ' (SEQ ID NO: 1 ) wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or thymidine; X 2 is cytosine or thymine, N is any nucleotide and N, + N 2 is from about 0-26 bases.
• N, and N 2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
• the oligonucleotide has a formula: 5' N,X,X 2 CGX 3 X 4 N 2 3' (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X,X 2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X 3 X 4 is selected from the group consisting ofTpT or CpT; N is any nucleotide and N, +N 2 is from about 0-26 bases.
• N, and N 2 do not contain a CCGG quadmer or more than one CCG or CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
• oligonucleotide is 5'- TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3).
• a method for treating a subj ect having or at risk of having a viral-mediated disorder comprising administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
• oligonucleotide is from 8-30 bases in length.
• nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide are administered in a vector.
• hepatitis antigen is a hepatitis B surface antigen.
• X is adenine, guanine, or
• thymidine cytosine or thymine
• N is any nucleotide and N, + N 2 is from about 0-26
• nucleic acid sequence is from about 8-30

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Veterinary Medicine (AREA)
• Chemical & Material Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Virology (AREA)
• Medicinal Chemistry (AREA)
• Public Health (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Organic Chemistry (AREA)
• Communicable Diseases (AREA)
• Oncology (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Mycology (AREA)
• Epidemiology (AREA)
• Engineering & Computer Science (AREA)
• Tropical Medicine & Parasitology (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Medicinal Preparation (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Saccharide Compounds (AREA)
• Seasonings (AREA)

Priority Applications (8)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (2)

Family

ID=21910655

Family Applications (1)

Country Status (10)

Cited By (283)

Families Citing this family (7)

Citations (5)

Family Cites Families (6)

• 1998
  • 1998-03-10 EP EP98912919A patent/EP1005368B1/en not_active Expired - Lifetime
  • 1998-03-10 AU AU67595/98A patent/AU753688B2/en not_active Ceased
  • 1998-03-10 ES ES98912919T patent/ES2333069T3/es not_active Expired - Lifetime
  • 1998-03-10 JP JP53973098A patent/JP5087758B2/ja not_active Expired - Fee Related
  • 1998-03-10 CA CA 2283557 patent/CA2283557A1/en not_active Abandoned
  • 1998-03-10 WO PCT/US1998/004703 patent/WO1998040100A1/en not_active Ceased
  • 1998-03-10 DK DK98912919T patent/DK1005368T3/da active
  • 1998-03-10 DE DE69841122T patent/DE69841122D1/de not_active Expired - Lifetime
  • 1998-03-10 PT PT98912919T patent/PT1005368E/pt unknown
  • 1998-03-10 EP EP20090166906 patent/EP2172216A3/en not_active Withdrawn
  • 1998-03-10 AT AT98912919T patent/ATE441432T1/de active
• 2009
  • 2009-08-06 JP JP2009183917A patent/JP2009280606A/ja not_active Withdrawn

Patent Citations (5)

Non-Patent Citations (5)