US20040081653A1 - Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer - Google Patents

Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer Download PDF

Info

Publication number
US20040081653A1
US20040081653A1 US10/418,972 US41897203A US2004081653A1 US 20040081653 A1 US20040081653 A1 US 20040081653A1 US 41897203 A US41897203 A US 41897203A US 2004081653 A1 US2004081653 A1 US 2004081653A1
Authority
US
United States
Prior art keywords
protein
cancer
cell
peptide
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/418,972
Other languages
English (en)
Inventor
Arthur Raitano
Pia Challita-Eid
Aya Jakobovits
Mary Faris
Wangmao Ge
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agensys Inc
Original Assignee
Agensys Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agensys Inc filed Critical Agensys Inc
Priority to US10/418,972 priority Critical patent/US20040081653A1/en
Publication of US20040081653A1 publication Critical patent/US20040081653A1/en
Assigned to AGENSYS, INC. reassignment AGENSYS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: JAKOBOVITS, AYA, CHALLITA-EID, PIA M., FARIS, MARY, GE, WANGMAO, RAITANO, ARTHUR B.
Priority to US11/549,900 priority patent/US7696336B2/en
Priority to US12/651,336 priority patent/US8604169B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0693—Tumour cells; Cancer cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention described herein relates to genes and their encoded proteins, termed 251P5G2, expressed in certain cancers, and to diagnostic and therapeutic methods and compositions useful in the management of cancers that express 251P5G2.
  • Cancer is the second leading cause of human death next to coronary disease. Worldwide, millions of people die from cancer every year. In the United States alone, as reported by the American Cancer Society, cancer causes the death of well over a half-million people annually, with over 1.2 million new cases diagnosed per year. While deaths from heart disease have been declining significantly, those resulting from cancer generally are on the rise. In the early part of the next century, cancer is predicted to become the leading cause of death.
  • carcinomas of the lung, prostate, breast, colon, pancreas, and ovary represent the primary causes of cancer death. These and virtually all other carcinomas share a common lethal feature. With very few exceptions, metastatic disease from a carcinoma is fatal. Moreover, even for those cancer patients who initially survive their primary cancers, common experience has shown that their lives are dramatically altered. Many cancer patients experience strong anxieties driven by the awareness of the potential for recurrence or treatment failure. Many cancer patients experience physical debilitations following treatment. Furthermore, many cancer patients experience a recurrence.
  • prostate cancer is the fourth most prevalent cancer in men. In North America and Northern Europe, it is by far the most common cancer in males and is the second leading cause of cancer death in men. In the United States alone, well over 30,000 men die annually of this disease—second only to lung cancer. Despite the magnitude of these figures, there is still no effective treatment for metastatic prostate cancer. Surgical prostatectomy, radiation therapy, hormone ablation therapy, surgical castration and chemotherapy continue to be the main treatment modalities. Unfortunately, these treatments are ineffective for many and are often associated with undesirable consequences.
  • PSA serum prostate specific antigen
  • the LAPC Los Angeles Prostate Cancer
  • SCID severe combined immune deficient mice
  • More recently identified prostate cancer markers include PCTA-1 (Su et al., 1996, Proc. Natl. Acad. Sci. USA 93: 7252), prostate-specific membrane (PSM) antigen (Pinto et al., Clin Cancer Res Sep.
  • Renal cell carcinoma accounts for approximately 3 percent of adult malignancies. Once adenomas reach a diameter of 2 to 3 cm, malignant potential exists. In the adult, the two principal malignant renal tumors are renal cell adenocarcinoma and transitional cell carcinoma of the renal pelvis or ureter. The incidence of renal cell adenocarcinoma is estimated at more than 29,000 cases in the United States, and more than 11,600 patients died of this disease in 1998. Transitional cell carcinoma is less frequent, with an incidence of approximately 500 cases per year in the United States.
  • bladder cancer represents approximately 5 percent in men (fifth most common neoplasm) and 3 percent in women (eighth most common neoplasm). The incidence is increasing slowly, concurrent with an increasing older population. In 1998, there was an estimated 54,500 cases, including 39,500 in men and 15,000 in women. The age-adjusted incidence in the United States is 32 per 100,000 for men and eight per 100,000 in women. The historic male/female ratio of 3:1 may be decreasing related to smoking patterns in women. There were an estimated 11,000 deaths from bladder cancer in 1998 (7,800 in men and 3,900 in women). Bladder cancer incidence and mortality strongly increase with age and will be an increasing problem as the population becomes more elderly.
  • bladder cancers recur in the bladder.
  • Bladder cancer is managed with a combination of transurethral resection of the bladder (TUR) and intravesical chemotherapy or immunotherapy.
  • TUR transurethral resection of the bladder
  • the multifocal and recurrent nature of bladder cancer points out the limitations of TUR.
  • Most muscle-invasive cancers are not cured by TUR alone. Radical cystectomy and urinary diversion is the most effective means to eliminate the cancer but carry an undeniable impact on urinary and sexual function. There continues to be a significant need for treatment modalities that are beneficial for bladder cancer patients.
  • Treatment options for lung and bronchial cancer are determined by the type and stage of the cancer and include surgery, radiation therapy, and chemotherapy. For many localized cancers, surgery is usually the treatment of choice. Because the disease has usually spread by the time it is discovered, radiation therapy and chemotherapy are often needed in combination with surgery. Chemotherapy alone or combined with radiation is the treatment of choice for small cell lung cancer; on this regimen, a large percentage of patients experience remission, which in some cases is long lasting. There is however, an ongoing need for effective treatment and diagnostic approaches for lung and bronchial cancers.
  • treatment of breast cancer may involve lumpectomy (local removal of the tumor) and removal of the lymph nodes under the arm; mastectomy (surgical removal of the breast) and removal of the lymph nodes under the arm; radiation therapy; chemotherapy; or hormone therapy.
  • lumpectomy local removal of the tumor
  • mastectomy surgical removal of the breast
  • radiation therapy chemotherapy
  • hormone therapy chemotherapy
  • two or more methods are used in combination.
  • Numerous studies have shown that, for early stage disease, long-term survival rates after lumpectomy plus radiotherapy are similar to survival rates after modified radical mastectomy.
  • Significant advances in reconstruction techniques provide several options for breast reconstruction after mastectomy. Recently, such reconstruction has been done at the same time as the mastectomy.
  • DCIS ductal carcinoma in situ
  • Surgery, radiation therapy, and chemotherapy are treatment options for ovarian cancer.
  • Surgery usually includes the removal of one or both ovaries, the fallopian tubes (salpingo-oophorectomy), and the uterus (hysterectomy).
  • the fallopian tubes salivary-oophorectomy
  • the uterus hematoma-oophorectomy
  • pancreatic cancer There were an estimated 28,300 new cases of pancreatic cancer in the United States in 2000. Over the past 20 years, rates of pancreatic cancer have declined in men. Rates among women have remained approximately constant but may be beginning to decline. Pancreatic cancer caused an estimated 28,200 deaths in 2000 in the United States. Over the past 20 years, there has been a slight but significant decrease in mortality rates among men (about ⁇ 0.9% per year) while rates have increased slightly among women.
  • the present invention relates to a gene, designated 251P5G2, that has now been found to be over-expressed in the cancer(s) listed in Table I.
  • Northern blot expression analysis of 251P5G2 gene expression in normal tissues shows a restricted expression pattern in adult tissues.
  • the nucleotide (FIG. 2) and amino acid (FIG. 2, and FIG. 3) sequences of 251P5G2 are provided.
  • the invention provides polynucleotides corresponding or complementary to all or part of the 251P5G2 genes, mRNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding 251P5G2-related proteins and fragments of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 contiguous amino acids; at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or more than 100 contiguous amino acids of a 251P5G2-related protein, as well as the peptides/proteins themselves; DNA, RNA, DNA/RNA hybrids, and related molecules, polynucleotides or oligonucleotides complementary or having at least a 90% homology to the 251P5G2 genes or mRNA sequences or parts thereof, and polynucleotides or oligonucleotides that hybridize to the 251P5G
  • the invention further provides antibodies that bind to 251P5G2 proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and antibodies labeled with a detectable marker or therapeutic agent.
  • the entire nucleic acid sequence of FIG. 2 is encoded and/or the entire amino acid sequence of FIG. 2 is prepared, either of which are in respective human unit dose forms.
  • the invention further provides methods for detecting the presence and status of 251P5G2 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express 251P5G2.
  • a typical embodiment of this invention provides methods for monitoring 251P5G2 gene products in a tissue or hematology sample having or suspected of having some form of growth dysregulabon such as cancer.
  • the invention further provides various immunogenic or therapeutic compositions and strategies for treating cancers that express 251P5G2 such as cancers of tissues listed in Table I, including. therapies aimed at inhibiting the transcription, translation, processing or function of 251P5G2 as well as cancer vaccines.
  • the invention provides compositions, and methods comprising them, for treating a cancer that expresses 251P5G2 in a human subject wherein the composition comprises a carrier suitable for human use and a human unit dose of one or more than one agent that inhibits the production or function of 251P5G2.
  • the carrier is a uniquely human carrier.
  • the agent is a moiety that is immunoroactive with 251P5G2 protein.
  • Non-limiting examples of such moieties include, but are not limited to, antibodies (such as single chain, monoclonal, polyclonal, humanized, chimeric, or human antibodies), functional equivalents thereof (whether naturally occurring or synthetic), and combinations thereof.
  • the antibodies can be conjugated to a diagnostic or therapeutic moiety.
  • the agent is a small molecule as defined herein.
  • the agent comprises one or more than one peptide which comprises a cytotoxic T lymphocyte (CTL) epitope that binds an HLA class I molecule in a human to elicit a CTL response to 251P5G2 and/or one or more than one peptide which comprises a helper T lymphocyte (HTL) epitope which binds an HLA class II molecule in a human to elicit an HTL response.
  • CTL cytotoxic T lymphocyte
  • HTL helper T lymphocyte
  • the peptides of the invention may be on the same or on one or more separate polypeptide molecules.
  • the agent comprises one or more than one nucleic acid molecule that expresses one or more than one of the CTL or HTL response stimulating peptides as described above.
  • the one or more than one nucleic acid molecule may express a moiety that is immunologically reactive with 251P5G2 as described above.
  • the one or more than one nucleic acid molecule may also be, or encodes, a molecule that inhibits production of 251P5G2.
  • Non-limiting examples of such molecules include, but are not limited to, those complementary to a nucleotide sequence essential for production of 251P5G2 (e.g. antisense sequences or molecules that form a triple helix with a nucleotide double helix essential for 251P5G2 production) or a ribozyme effective to lyse 251P5G2 mRNA.
  • HLA Peptide Tables respective to its parental protein, e.g., variant 1, variant 2, etc.
  • HLA Peptide Tables respective to its parental protein, e.g., variant 1, variant 2, etc.
  • search Peptides in Table VII Generally, a unique Search Peptide is used to obtain HLA peptides of a particular for a particular variant. The position of each Search Peptide relative to its respective parent molecule is listed in Table VII.
  • a Search Peptide begins at position “X”, one must add the value “X ⁇ 1” to each position in Tables VIII-XXI and XXII to XLIX to obtain the actual position of the HLA peptides in their parental molecule. For example, if a particular Search Peptide begins at position 150 of its parental molecule, one must add 150 ⁇ 1, i.e., 149 to each HLA peptide amino acid position to calculate the position of that amino acid in the parent molecule.
  • One embodiment of the invention comprises an HLA peptide, that occurs at least twice in Tables VIII-XXI and XXII to XLIX collectively, or an oligonucleotide that encodes the HLA peptide.
  • Another embodiment of the invention comprises an HLA peptide that occurs at least once in Tables VIII-XXI and at least once in tables XXI! to XLIX, or an oligonucleotide that encodes the HLA peptide.
  • antibody epitopes which comprise a peptide regions, or an oligonucleotide encoding the peptide region, that has one two, three, four, or five of the following characteristics:
  • FIG. 1 The 251P5G2 SSH sequence of 162 nucleotides.
  • FIG. 2A The cDNA and amino acid sequence of 251P5G2 variant 1 (also called “251P5G2v.1” or “251P5G2 variant 1”) is shown in FIG. 2A.
  • the start methionine is underlined.
  • the open reading frame extends from nucleic acid 722-1489 including the stop codon.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 722-1489 including the stop codon.
  • 251P5G2 variant 7 (also called “251P5G2 v.7”) is shown in FIG. 2G.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 722-1489 including the stop codon.
  • 251P5G2 variant 9 (also called “251P5G2 v.9”) is shown in FIG. 2I.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 722-1489 including the stop codon.
  • a reference to 251P5G2 includes all variants thereof, including those shown in FIGS. 2, 3, 10 , and 11 , unless the context clearly indicates otherwise.
  • FIG. 4A Alignment of 251P5G2 v.1 with the mouse vomeronasal 1 receptor C3.
  • FIG. 4B Amino acid alignment of 251P5G2 v.12 with the protein XM — 063686 predicted from GenomeScan.
  • FIG. 5 Hydrophilicity amino acid profile of 251P5G2 v.1 and v.12 determined by computer algorithm sequence analysis using the method of Hopp and Woods (Hopp T. P., Woods K. R., 1981. Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828) accessed on the Protscale website located on the World Wide Web at (expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • FIG. 6 Hydropathicity amino acid profile of 251P5G2 v.1 and v.12 determined by computer algorithm sequence analysis using the method of Kyte and Doolittle (Kyte J., Dooliltle R. F., 1982. J. Mol. Biol. 157:105-132) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • FIG. 7 Percentaccessible residues amino acid profile of 251P5G2 v.1 and v.12 determined by computer algorithm sequence analysis using the method of Janin (Janin J., 1979 Nature 277:491-492) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • FIG. 8 Average flexibility amino acid profile of 251P5G2 v.1 and v.12 determined by computer algorithm sequence analysis using the method of Bhaskaran and Ponnuswamy (Bhaskaran R., and Ponnuswamy P. K., 1988. Int. J. Pept. Protein Res. 32:242-255) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • FIG. 9 Beta-turn amino acid profile of 251P5G2 v.1 and v.12 determined by computer algorithm sequence analysis using the method of Deleage and Roux (Deleage, G., Roux B. 1987 Protein Engineering 1:289-294) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • FIG. 10 Schematic alignment of SNP variants of 251P5G2.
  • Variants 251P5G2 v.2 through v.11 are variants with single nucleotide differences. Though these SNP variants are shown separately, they could also occur in any combinations and in any transcript variants that contains the base pairs. Numbers correspond to those of 251P5G2 v.1. Black box shows the same sequence as 251P5G2 v.1. SNPs are indicated above the box.
  • FIG. 11 Schematic alignment of protein variants of 251P5G2. Protein variants correspond to nucleotide variants. Nucleotide variants 251P5G2 v.5 through v.11 in FIG. 10 code for the same protein as 251P5G2 v.1. Nucleotide variants 251P5G2 v.12 and v.13 as shown in FIG. 12 code the same protein. Single amino acid differences were indicated above the boxes. Black boxes represent the same sequence as 251P5G2 v.1. Numbers underneath the box correspond to 251P5G2 v.1.
  • FIG. 12 Exon compositions of transcript variants of 251P5G2.
  • Variant 251P5G2 v.12 and v.13 are transcript variants each with 19 exons.
  • the first two exons of variants 251P5G2 v.12 and v.13 matches part of variant 251P5G2 v.1.
  • 251P5G2 v.13 has a shorter first exon (starting at base 722) but the other 18 exons are the same.
  • Numbers in “( )” underneath the boxes correspond to those of 251P5G2 v.1. Lengths of introns and exons are not proportional.
  • FIGS. 13 (A) (SEQ ID NO: 82) and 13 (B) (SEQ ID NO: 83) Secondary structure and transmembrane domains prediction for 251P5G2 protein variants.
  • FIGS. 13 (C) and 13 (E) Schematic representations of the probability of existence of transmembrane regions and orientation of 251P5G2 variants 1 and 12, respectively, based on the TMpred algorithm of Hofmann and Stoffel which utilizes TMBASE (K. Hofmann, W. Stoffel. TMBASE—A database of membrane spanning protein segments Biol. Chem. Hoppe-Seyler 374:166, 1993).
  • FIGS. 13 (C) and 13 (E) Schematic representations of the probability of existence of transmembrane regions and orientation of 251P5G2 variants 1 and 12, respectively, based on the TMpred algorithm of Hofmann and Stoffel which utilizes TMBASE (K. Hofmann, W. Stoffel. TMBASE—A database of membrane spanning protein segments Biol. Chem. Hoppe-Seyler 374:166, 1993).
  • FIG. 14 Expression of 251P5G2 by RT-PCR.
  • First strand cDNA was prepared from vital pool 1 (liver, lung and kidney), vital pool 2 (pancreas, colon and stomach), prostate cancer metastasis to lymph node, prostate cancer pool, bladder cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification. Results show strong expression of 251P5G2 in prostate cancer metastasis, prostate cancer pool, and cancer metastasis pool. Expression of 251P5G2 was also detected in bladder cancer pool, but not in vital pool 1 and vital pool 2.
  • FIG. 15 Expression of 251P5G2 in normal tissues. Two multiple tissue northern blots (Clontech) both with 2 ug of mRNA/lane were probed with the 251P5G2 sequence. Size standards in kilobases (kb) are indicated on the side. Results show weak expression of 251P5G2 in prostate and testis, but not in any other normal tissue tested.
  • FIG. 16 Expression of 251P5G2 in Patient Cancer Specimens and Normal Tissues.
  • RNA was extracted from two prostate cancer metastasis to lymph node isolated from two different patients (Met1 and Met2), as well as from normal bladder (NB), normal kidney (NK), normal lung (NL) and normal breast (NBr), normal ovary (NO), and normal pancreas (NPa).
  • Northern blot with 10 Gig of total RNA/lane was probed with 251P5G2 SSH sequence. Size standards in kilobases (kb) are indicated on the side.
  • the 251P5G2 transcript was detected in the prostate cancer metastasis specimens, but not in the normal tissues tested.
  • FIG. 17 Expression of 251P5G2 in Prostate Cancer Patient Specimens.
  • RNA was extracted from prostate cancer xenografts (LAPCAAD, LAPC4AI, LAPC-9AD, LAPC-9AI), prostate cancer cell lines (LNCaP and PC3), normal prostate (N), and prostate cancer patient tumors (T).
  • Northern blots with 10 ug of total RNA were probed with the 251P5G2 SSH fragment. Size standards in kilobases are on the side.
  • Results show expression of 251P5G2 in the LAPC-9AD xenograft and in prostate tumor tissues. Lower level expression was detected in the other xenograft tissues and LNCaP cell line but not in PC3. The lower panel represents ethidium-bromide staining of the gel confirming the quality of the RNA.
  • FIG. 18 Expression of 251P5G2 in Human Normal and Cancer Tissues.
  • First strand cDNA was prepared from a panel of 13 normal tissues, prostate cancer pool, bladder cancer pool, kidney cancer pool, colon cancer pool, lung cancer pool, ovary cancer pool, breast cancer pool, pancreas cancer pool, 2 different prostate cancer metastasis specimens to lymph node, and a pool of prostate cancer LAPC xenografts (LAPC4AD, LAPC-4AI, LAPC-9AD, and LAPC-9AI). Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification.
  • a standard curve was generated using plasmid DNA containing 251P5G2 of known copy number. The experiment was performed in duplicate. Results show strong expression of 251P5G2 in prostate cancer metastasis, prostate cancer pool, and cancer metastasis pool. Expression of 251P5G2 was also detected in bladder cancer pool. Amongst normal tissues, very weak expression was detected in hear, prostate, skeletal muscle and testis but not in any other normal tissue tested.
  • FIG. 19 Expression of 251P5G2 in Prostate Cancer Patient Specimens.
  • First strand cDNA was prepared from normal prostate, prostate cancer cell lines (PC3, DU145, LNCaP, 293T), and a panel of prostate cancer patient specimens. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification. Results show expression of 251P5G2 in 10 out of 19 patient specimens. Very strong expression was detected in 5 out of the 10 expressing tumors. Expression was also detected in LNCaP but not in the other cell lines tested nor in normal prostate.
  • FIG. 20 Expression of 251P5G2 in Bladder Cancer Patient Specimens.
  • First strand cDNA was prepared from normal bladder, bladder cancer cell lines (UM-UC-3, TCCSUP, J82), and a panel of bladder cancer patient specimens. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification. Results show expression of 251P5G2 in 5 out of 9 patient specimens, but not in the cell lines tested nor in normal bladder.
  • Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL Peptides
  • prostate cancer locally advanced prostate cancer
  • advanced disease and “locally advanced disease” mean prostate cancers that have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AUA) system, stage C1-C2 disease under the Whitmore-Jewett system, and stage T3-T4 and N+ disease under the TNM (tumor, node, metastasis) system.
  • AUA American Urological Association
  • stage C1-C2 disease under the Whitmore-Jewett system
  • TNM tumor, node, metastasis
  • surgery is not recommended for patients with locally advanced disease, and these patients have substantially less favorable outcomes compared to patients having clinically localized (organ-confined) prostate cancer.
  • Locally advanced disease is clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base.
  • Locally advanced prostate cancer is presently diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends into the surgical margin, or invades the seminal vesicles.
  • “Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence 251P5G2 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence 251P5G2.
  • the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
  • analog refers to a molecule which is structurally similar or shares similar or corresponding attributes with another molecule (e.g. a 251P5G2-related protein).
  • a 251P5G2 protein can be specifically bound by an antibody or T cell that specifically binds to 251P5G2.
  • antibody is used in the broadest sense. Therefore, an “antibody” can be naturally occurring or man-made such as monoclonal antibodies produced by conventional hybridoma technology.
  • Anti-251P5G2 antibodies comprise monoclonal and polyclonal antibodies as well as fragments containing the antigen-binding domain and/or one or more complementarity determining regions of these antibodies.
  • An antibody fragment is defined as at least a portion of the variable region of the immunoglobulin molecule that binds to its target, i.e., the antigen-binding region. In one embodiment it specifically covers single anti-251P5G2 antibodies and clones thereof (including agonist, antagonist and neutralizing antibodies) and anti-251P5G2 antibody compositions with polyepitopic specificity.
  • codon optimized sequences refers to nucleotide sequences that have been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20%. Nucleotide sequences that have been optimized for expression in a given host species by elimination of spurious polyadenylation sequences, elimination of exon/intron splicing signals, elimination of transposon-like repeats and/or optimization of GC content in addition to codon optimization are referred to herein as an “expression enhanced sequences.”
  • a “combinatorial library” is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical “building blocks” such as reagents.
  • a linear combinatorial chemical library such as a polypeptide (e.g., mutein) library, is formed by combining a set of chemical building blocks called amino acids in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound).
  • Numerous chemical compounds are synthesized through such combinatorial mixing of chemical building blocks (Gallop et al., J. Med. Chem. 37(9): 1233-1251 (1994)).
  • combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010,175, Furka, Pept. Prot. Res. 37:487-493 (1991), Houghton et al., Nature, 354:84-88 (1991)), peptoids (PCT Publication No WO 91/19735), encoded peptides (PCT Publication WO 93/20242), random bio-oligomers (PCT Publication WO 92/00091), benzodiazepines (U.S. Pat. No.
  • cytotoxic agent refers to a substance that inhibits or prevents the expression activity of cells, function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes chemotherapeutic agents, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and/or variants thereof.
  • cytotoxic agents include, but are not limited to auristatins, auromycins, maytansinoids, yttrium, bismuth, ricin, ricin A-chain, combrestatin, duocarmycins, dolostatins, doxorubicin, daunorubicin, taxol, cisplatin, ccl065, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxy anthracin dione, actinomycin, diphtheria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain, modeccin A chain, alpha-sarcin, gelonin, mitogellin, retstrictocin, phenomycin, enomycin, curicin, crotin, calicheamicin, Sapaonaria officinalis
  • the “gene product” is sometimes referred to herein as a protein or mRNA.
  • a “gene product of the invention” is sometimes referred to herein as a “cancer amino acid sequence”, “cancer protein”, “protein of a cancer listed in Table I”, a “cancer mRNA”, “mRNA of a cancer listed in Table I”, etc.
  • the cancer protein is encoded by a nucleic acid of FIG. 2.
  • the cancer protein can be a fragment, or alternatively, be the full-length protein to the fragment encoded by the nucleic acids of FIG. 2.
  • a cancer amino acid sequence is used to determine sequence identity or similarity.
  • the sequences are naturally occurring allelic variants of a protein encoded by a nucleic acid of FIG. 2.
  • the sequences are sequence variants as further described herein.
  • “High throughput screening” assays for the presence, absence, quantification, or other properties of particular nucleic acids or protein products are well known to those of skill in the art.
  • binding assays and reporter gene assays are similarly well known.
  • U.S. Pat. No. 5,559,410 discloses high throughput screening methods for proteins
  • U.S. Pat. No. 5,585,639 discloses high throughput screening methods for nucleic acid binding (i.e., in arrays)
  • U.S. Pat. Nos. 5,576,220 and 5,541,061 disclose high throughput methods of screening for ligand/antibody binding.
  • high throughput screening systems are commercially available (see, e.g., Amersham Biosdences, Piscataway, N.J.; Zymark Corp., Hopkinton, Mass.; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, Calif.; Precision Systems, Inc., Natick, Mass.; etc.). These systems typically automate entire procedures, including all sample and reagent pipetling, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for various high throughput systems. Thus, e.g., Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.
  • homolog refers to a molecule which exhibits homology to another molecule, by for example, having sequences of chemical residues that are the same or similar at corresponding positions.
  • HLA Human Leukocyte Antigen
  • MHC Major Histocompatibility Complex
  • hybridize used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6 ⁇ SSC/0.1% SDS/100 ⁇ g/ml ssDNA, in which temperatures for hybridization are above 37 degrees C. and temperatures for washing in 0.1 ⁇ SSC/0.1% SDS are above 55 degrees C.
  • isolated or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state.
  • isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment.
  • a polynucleotide is said to be “isolated” when it is substantially separated from contaminant polynucleotides that correspond or are complementary to genes other than the 251P5G2 genes or that encode polypeptides other than 251P5G2 gene product or fragments thereof.
  • a skilled artisan can readily employ nucleic acid isolation procedures to obtain an isolated 251P5G2 polynucleotide.
  • a protein is said to be “isolated,” for example, when physical, mechanical or chemical methods are employed to remove the 251P5G2 proteins from cellular constituents that are normally associated with the protein.
  • a skilled artisan can readily employ standard purification methods to obtain an isolated 251P5G2 protein.
  • an isolated protein can be prepared by chemical means.
  • mammal refers to any organism classified as a mammal, including mice, rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the invention, the mammal is a mouse. In another embodiment of the invention, the mammal is a human.
  • metastatic prostate cancer and “metastatic disease” mean prostate cancers that have spread to regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage T ⁇ N ⁇ M+ under the TNM system.
  • surgery is generally not indicated for patients with metastatic disease, and hormonal (androgen ablation) therapy is a preferred treatment modality.
  • Patients with metastatic prostate cancer eventually develop an androgen-refractory state within 12 to 18 months of treatment initiation. Approximately half of these androgen-refractory patients die within 6 months after developing that status. The most common site for prostate cancer metastasis is bone.
  • Prostate cancer bone metastases are often osteoblastic rather than osteolytic (i.e., resulting in net bone formation). Bone metastases are found most frequently in the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiography, and/or bone lesion biopsy.
  • modulator or “test compound” or “drug candidate” or grammatical equivalents as used herein describe any molecule, e.g., protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide, etc., to be tested for the capacity to directly or indirectly alter the cancer phenotype or the expression of a cancer sequence, e.g., a nucleic acid or protein sequences, or effects of cancer sequences (e.g., signaling, gene expression, protein interaction, etc.)
  • a modulator will neutralize the effect of a cancer protein of the invention.
  • a modulator will neutralize the effect of a gene, and its corresponding protein, of the invention by normalizing levels of said protein.
  • modulators alter expression profiles, or expression profile nucleic acids or proteins provided herein, or downstream effector pathways.
  • the modulator suppresses a cancer phenotype, e.g. to a normal tissue fingerprint.
  • a modulator induced a cancer phenotype.
  • a plurality of assay mixtures is run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
  • Modulators, drug candidates or test compounds encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 Daltons. Preferred small molecules are less than 2000, or less than 1500 or less than 1000 or less than 500 D.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Modulators also comprise biomolecules such as peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Particularly preferred are peptides.
  • One class of modulators are peptides, for example of from about five to about 35 amino acids, with from about five to about 20 amino acids being preferred, and from about 7 to about 15 being particularly preferred.
  • the cancer modulatory protein is soluble, includes a non-transmembrane region, and/or, has an N-terminal Cys to aid in solubility.
  • the C-terminus of the fragment is kept as a free acid and the N-terminus is a free amine to aid in coupling, i.e., to cysteine.
  • a cancer protein of the invention is conjugated to an immunogenic agent as discussed herein.
  • the cancer protein is conjugated to BSA.
  • the peptides of the invention e.g., of preferred lengths, can be linked to each other or to other amino acids to create a longer peptide/protein.
  • the modulatory peptides can be digests of naturally occurring proteins as is outlined above, random peptides, or “biased” random peptides.
  • peptide/protein-based modulators are antibodies, and fragments thereof, as defined herein.
  • Modulators of cancer can also be nucleic acids.
  • Nucleic acid modulating agents can be naturally occurring nucleic acids, random nucleic acids, or “biased” random nucleic acids. For example, digests of prokaryotic or eukaryotic genomes can be used in an approach analogous to that outlined above for proteins.
  • the term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the antibodies comprising the population are identical except for possible naturally occurring mutations that are present in minor amounts.
  • a “motif”, as in biological motif of a 251P5G2-related protein, refers to any pattern of amino acids forming part of the primary sequence of a protein, that is associated with a particular function (e.g. protein-protein interaction, protein-DNA interaction, etc) or modification (e.g. that is phosphorylated, glycosylated or amidated), or localization (e.g. secretory sequence, nuclear localization sequence, etc.) or a sequence that is correlated with being immunogenic, either humorally or cellularly.
  • a motif can be either contiguous or capable of being aligned to certain positions that are generally correlated with a certain function or property.
  • motif refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule.
  • Peptide motifs for HLA binding are typically different for each protein encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues.
  • a “pharmaceutical excipient” comprises a material such as an adjuvant, a carrier, pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservative, and the like.
  • “Pharmaceutically acceptable” refers to a non-toxic, inert, and/or composition that is physiologically compatible with humans or other mammals.
  • polynucleotide means a polymeric form of nucleotides of at least 10 bases or base pairs in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA and/or RNA. In the art, this term if often used interchangeably with “oligonuleotide”.
  • a polynucleotide can comprise a nucleotide sequence disclosed herein wherein thymidine (T), as shown for example in FIG. 2, can also be uracil (U); this definition pertains to the differences between the chemical structures of DNA and RNA, in particular the observation that one of the four major bases in RNA is uracil (U) instead of thymidine (T).
  • polypeptide means a polymer of at least about 4, 5, 6, 7, or 8 amino acids. Throughout the specification, standard three letter or single letter designations for amino acids are used. In the art, this term is often used interchangeably with “peptide” or “protein”.
  • An HLA “primary anchor residue” is an amino acid at a specific position along a peptide sequence which is understood to provide a contact point between the immunogenic peptide and the HLA molecule.
  • One to three, usually two, primary anchor residues within a peptide of defined length generally defines a “motif” for an immunogenic peptide. These residues are understood to fit in close contact with peptide binding groove of an HLA molecule, with their side chains buried in specific pockets of the binding groove.
  • the primary anchor residues for an HLA class I molecule are located at position 2 (from the amino terminal position) and at the carboxyl terminal position of a 8, 9, 10, 11, or 12 residue peptide epitope in accordance with the invention.
  • the primary anchor residues of a peptide binds an HLA class II molecule are spaced relative to each other, rather than to the termini of a peptide, where the peptide is generally of at least 9 amino acids in length.
  • the primary anchor positions for each motif and supermotif are set forth in Table IV.
  • analog peptides can be created by altering the presence or absence of particular residues in the primary and/or secondary anchor positions shown in Table IV. Such analogs are used to modulate the binding affinity and/or population coverage of a peptide comprising a particular HLA motif or supermotif.
  • Radioisotopes include, but are not limited to the following (non-limiting exemplary uses are also set forth):
  • Tc-99 m is the most widely used radioisotope used for diagnostic imaging of various cancers and diseases involving the brain, heart, liver, lungs; also used in detection of deep vein thrombosis of the legs Osmium-194 Cancer radioimmunotherapy (Os-194) Palladium-103 Prostate cancer treatment (Pd-103) Platinum-195 m
  • a chemotherapeutic drug Phosphorus-32 Polycythemia rubra vera (blood cell disease) and leukemia treatment, bone cancer (P-32) diagnosis/treatment; colon, pancreatic, and liver cancer treatment
  • radiolabeling nucleic acids for in vitro research, diagnosis of superficial tumors, treatment of blocked arteries (i.e., arteriosclerosis and restenosis), and intracavity therapy
  • Phosphorus-33 Leukemia treatment, bone disease diagnosis/treatment, radiolabeling, and treatment of (P-33) blocked arteries i.
  • each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively. These random peptides (or nucleic acids, discussed herein) can incorporate any nucleotide or amino acid at any position.
  • the synthetic process can be designed to generate randomized proteins or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence, thus forming a library of randomized candidate bioactive proteinaceous agents.
  • a library is “fully randomized,” with no sequence preferences or constants at any position.
  • the library is a “biased random” library. That is, some positions within the sequence either are held constant, or are selected from a limited number of possibilities.
  • the nucleotides or amino acid residues are randomized within a defined class, e.g., of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or large) residues, towards the creation of nucleic acid binding domains, the creation of cysteines, for cross-linking, prolines for SH-3 domains, serines, threonines, tyrosines or histidines for phosphorylation sites, etc., or to purines, etc.
  • a defined class e.g., of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or large) residues, towards the creation of nucleic acid binding domains, the creation of cysteines, for cross-linking, prolines for SH-3 domains, serines, threonines, tyrosines or histidines for phosphorylation sites, etc., or to purines, etc.
  • a “recombinant” DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro.
  • Non-limiting examples of small molecules include compounds that bind or interact with 251P5G2, ligands including hormones, neuropeptides, chemokines, odorants, phospholipids, and functional equivalents thereof that bind and preferably inhibit 251P5G2 protein function.
  • Such non-limiting small molecules preferably have a molecular weight of less than about 10 kDa, more preferably below about 9, about 8, about 7, about 6, about 5 or about 4 kDa.
  • small molecules physically associate with, or bind, 251P5G2 protein; are not found in naturally occurring metabolic pathways; and/or are more soluble in aqueous than non-aqueous solutions
  • “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured nucleic acid sequences to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley lnterscience Publishers, (1995).
  • “Stringent conditions” or “high stringency conditions”, as defined herein, are identified by, but not limited to, those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50° C.; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42° C.; or (3) employ 50% formamide, 5 ⁇ SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 ⁇ Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% S
  • Modely stringent conditions are described by, but not limited to, those in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above.
  • washing solution and hybridization conditions e.g., temperature, ionic strength and %SDS
  • An example of moderately stringent conditions is overnight incubation at 37° C.
  • HLA “supermotif” is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles. Overall phenotypic frequencies of HLA-supertypes in different ethnic populations are set forth in Table IV (F). The non-limiting constituents of various supetypes are as follows:
  • A2 A*0201, A*0202, A*0203, A*0204, A*0205, A*0206, A*6802, A*6901, A*0207
  • A3 A3, A11, A31, A*3301, A*6801, A*0301, A*1101, A*3101
  • B7 B7, B*3501-03, B*51, B*5301, B*5401, B*5501, B*5502, B*5601, B*6701, B*7801, B*0702, B*5101, B*5602
  • B44 B*3701, B*4402, B*4403, B*60 (B*4001), B61 (B*4006)
  • A1 A*0102, A*2604, A*3601, A*4301, A*8001
  • A24 A*24, A*30, A*2403, A*2404, A*3002, A*3003
  • B27 B*1401-02, B*1503, B*1509, B*1510, B*1518, B*3801-02, B*3901, B*3902, B*3903-04, B*4801-02, B*7301, B*2701-08
  • B58 B*1516, B*1517, B*5701, B*5702, B58
  • B62 B*4601, B52, B*1501 (B62), B*1502 (B75), B*1513 (B77)
  • to treat or “therapeutic” and grammatically related terms, refer to any improvement of any consequence of disease, such as prolonged survival, less morbidity, and/or a lessening of side effects which are the byproducts of an alternative therapeutic modality; full eradication of disease is not required.
  • a “transgenic animal” e.g., a mouse or rat
  • a “transgenic animal” is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage.
  • a “transgene” is a DNA that is integrated into the genome of a cell from which a transgenic animal develops.
  • an HLA or cellular immune response “vaccine” is a composition that contains or encodes one or more peptides of the invention.
  • vaccines such as a cocktail of one or more individual peptides; one or more peptides of the invention comprised by a polyepitopic peptide; or nucleic acids that encode such individual peptides or polypeptides, e.g., a minigene that encodes a polyepitopic peptide.
  • the “one or more peptides” can include anywhole unitintegerfrom 1-150 ormore, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 or more peptides of the invention.
  • the peptides or polypeptides can optionally be modified, such as by lipidation, addition of targeting or other sequences.
  • HLA class I peptides of the invention can be admixed with, or linked to, HLA class II peptides, to facilitate activation of both cytotoxic T lymphocytes and helper T lymphocytes.
  • HLA vaccines can also comprise peptide-pulsed antigen presenting cells, e.g., dendritic cells.
  • variant refers to a molecule that exhibits a variation from a described type or norm, such as a protein that has one or more different amino acid residues in the corresponding position(s) of a specifically described protein (e.g. the 251P5G2 protein shown in FIG. 2 or FIG. 3.
  • An analog is an example of a variant protein.
  • Splice isoforms and single nucleotides polymorphisms (SNPs) are further examples of variants.
  • the “251P5G2-related proteins” of the invention include those specifically identified herein, as well as allelic variants, conservative substitution variants, analogs and homologs that can be isolated/generated and characterized without undue experimentation following the methods outlined herein or readily available in the art Fusion proteins that combine parts of different 251P5G2 proteins or fragments thereof, as well as fusion proteins of a 251P5G2 protein and a heterologous polypeptide are also included. Such 251P5G2 proteins are collectively referred to as the 251P5G2-related proteins, the proteins of the invention, or 251P5G2.
  • 251P5G2-related protein refers to a polypeptide fragment or a 251P5G2 protein sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 amino acids; or, at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, or 576 or more amino acids.
  • One aspect of the invention provides polynucleotides corresponding or complementary to all or part of a 251P5G2 gene, mRNA, and/or coding sequence, preferably in isolated form, including polynucleotides encoding a 251P5G2-related protein and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to a 251P5G2 gene or mRNA sequence or a part thereof, and polynucleotides or oligonucleotides that hybridize to a 251P5G2 gene, mRNA, or to a 251P5G2 encoding polynucleotide (collectively, “251P5G2 polynucleotides”).
  • T can also be U in FIG. 2.
  • Embodiments of a 251P5G2 polynucleotide include: a 251P5G2 polynucleotide having the sequence shown in FIG. 2, the nucleotide sequence of 251P5G2 as shown in FIG. 2 wherein T is U; at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in FIG. 2; or, at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in FIG. 2 where T is U.
  • embodiments of 251P5G2 nucleotides comprise, without limitation:
  • (II) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2A, from nucleotide residue number 722 through nucleotide residue number 1489, including the stop codon, wherein T can also be U;
  • (IV) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2C, from nucleotide residue number 722 through nucleotide residue number 1489, including the a stop codon, wherein T can also be U;
  • V a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2D, from nucleotide residue number 722 through nucleotide residue number 1489, including the stop codon, wherein T can also be U;
  • (VI) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2E, from nucleotide residue number 722 through nucleotide residue number 1489, including the stop codon, wherein T can also be U;
  • VII a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2F, from nucleotide residue number 722 through nucleotide residue number 1489, including the stop codon, wherein T can also be U;
  • (VIII) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2G, from nucleotide residue number 722 through nucleotide residue number 1489, including the stop codon, wherein T can also be U;
  • (IX) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2H, from nucleotide residue number 722 through nucleotide residue number 1489, including the stop codon, wherein T can also be U;
  • (XII) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2K, from nucleotide residue number 722 through nucleotide residue number 1489, including the stop codon, wherein T can also be U;
  • (XIV) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in FIG. 2M, from nucleotide residue number 1 through nucleotide residue number 3801, including the stop codon, wherein T can also be U;
  • (XV) a polynucleotide that encodes a 251P5G2-related protein that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% homologous to an entire amino acid sequence shown in FIGS. 2 A-M;
  • (XVI) a polynucleotide that encodes a 251P5G2-related protein that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to an entire amino acid sequence shown in FIGS. 2 A-M;
  • (XVII) a polynucleotide that encodes at least one peptide set forth in Tables VIII-XXI and XXII-XLIX;
  • (XVIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3A-D in any whole number increment up to 255 that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of FIG. 5;
  • (XIX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3A-D in any whole number increment up to 255 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of FIG. 6;
  • (XX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3A-D in any whole number increment up to 255 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of FIG. 7;
  • (XXI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3A-D in any whole number increment up to 255 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of FIG. 8;
  • (XXII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIGS. 3 A-D in any whole number increment up to 255 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta-turn profile of FIG. 9;
  • (XXIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3E in any whole number increment up to 1266 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of FIG. 5;
  • (XXIV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3E in any whole number increment up to 1266 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of FIG. 6;
  • (XXV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3E in any whole number increment up to 1266 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of FIG. 7;
  • (XXVI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3E in any whole number increment up to 1266 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of FIG. 8;
  • (XXVII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of FIG. 3E in any whole number increment up to 1266 that indudes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta-turn profile of FIG. 9
  • (XXVIII) a polynucleotide that is fully complementary to a polynucleotide of any one of (I)-(XXVII).
  • (XXX) a composition comprising a polynucleotide of any of (I)-(XXVIII) or peptide of (XXIX) together with a pharmaceutical excipient and/or in a human unit dose form.
  • (XXXI) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of (XXIX) or a composition of (XXX) in a method to modulate a cell expressing 251P5G2,
  • (XXXII) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of (XXIX) or a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 251P5G2
  • (XXXIII) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of (XXIX) or a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 251P5G2, said cell from a cancer of a tissue listed in Table I;
  • (XXIV) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of (XXIX) or a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat a a cancer;
  • (XXXV) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of (XXIX) or a composition of (XXX) in a method to diagnose, prophylax, prognose, or treat a a cancer of a tissue listed in Table I; and,
  • (XXXVI) a method of using a polynucleotide of any (I)-(XXVIII) or peptide of (XXIX) or a composiion of (XXX) in a method to identify or characterize a modulator of a cell expressing 251P5G2.
  • Typical embodiments of the invention disclosed herein include 251P5G2 polynucleotides that encode specific portions of 251P5G2 mRNA sequences (and those which are complementary to such sequences) such as those that encode the proteins and/or fragments thereof, for example:
  • representative embodiments of the invention disclosed herein include: polynucleotides and their encoded peptides themselves encoding about amino acid 1 to about amino acid 10 of the 251P5G2 protein shown in FIG. 2 or FIG. 3, polynucleotides encoding about amino acid 10 to about amino acid 20 of the 251P5G2 protein shown in FIG. 2 or FIG. 3, polynucleotides encoding about amino acid 20 to about amino acid 30 of the 251P5G2 protein shown in FIG. 2 or FIG. 3, polynucleotides encoding about amino acid 30 to about amino acid 40 of the 251P5G2 protein shown in FIG. 2 or FIG.
  • polynucleotides encoding about amino acid 40 to about amino acid 50 of the 251P5G2 protein shown in FIG. 2 or FIG. 3 polynucleotides encoding about amino acid 50 to about amino acid 60 of the 251P5G2 protein shown in FIG. 2 or FIG. 3
  • polynucleotides encoding about amino acid 70 to about amino acid 80 of the 251P5G2 protein shown in FIG. 2 or FIG. 3 polynucleotides encoding about amino acid 80 to about amino acid 90 of the 251P5G2 protein shown in FIG. 2 or FIG.
  • Polynucleotides encoding relatively long portions of a 251P5G2 protein are also within the scope of the invention.
  • polynucleotides encoding from about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of the 251P5G2 protein “or variant” shown in FIG. 2 or FIG. 3 can be generated by a variety of techniques well known in the art.
  • These polynucleotide fragments can include any portion of the 251P5G2 sequence as shown in FIG. 2.
  • Additional illustrative embodiments of the invention disclosed herein include 251P5G2 polynucleotide fragments encoding one or more of the biological motifs contained within a “251P5G2 protein” or variant sequence, including one or more of the motif-bearing subsequences of a 251P5G2 protein or varianr set forth in Tables VIII-XXI and XXII-XLIX.
  • typical polynucleotide fragments of the invention encode one or more of the regions of 251P5G2 protein or variant that exhibit homology to a known molecule.
  • typical polynucleotide fragments can encode one or more of the 251P5G2 protein or variant N-glycosylation sites, cAMP and cGMP-dependent protein kinase phosphorylation sites, casein kinase II phosphorylation sites or N-myristoylation site and amidation sites.
  • a Search Peptide begins at position “X”, one must add the value “X minus 1” to each position in Tables VIII-XXI and Tables XXII-IL to obtain the actual position of the HLA peptides in their parental molecule. For example if a particular Search Peptide begins at position 150 of its parental molecule, one must add 150 ⁇ 1, i.e., 149 to each HLA peptide amino acid position to calculate the position of that amino acid in the parent molecule.
  • the polynucleotides of the preceding paragraphs have a number of different specific uses.
  • the human 251P5G2 gene maps to the chromosomal location set forth in the Example entitled “Chromosomal Mapping of 251P5G2.”
  • polynucleotides that encode different regions of the 251P5G2 proteins are used to characterize cytogenefic abnormalities of this chromosomal locale, such as abnormalities that are identified as being associated with various cancers.
  • cytogenefic abnormalities of this chromosomal locale such as abnormalities that are identified as being associated with various cancers.
  • a variety of chromosomal abnormalities including rearrangements have been identified as frequent cytogenetic abnormalities in a number of different cancers (see e.g.
  • polynucleotides encoding specific regions of the 251P5G2 proteins provide new tools that can be used to delineate, with greater precision than previously possible, cytogenetic abnormalities in the chromosomal region that encodes 251P5G2 that may contribute to the malignant phenotype.
  • these polynucleotides satisfy a need in the art for expanding the sensitivity of chromosomal screening in order to identify more subtle and less common chromosomal abnormalities (see e.g. Evans et al., Am. J. Obstet. Gynecol 171(4): 1055-1057 (1994)).
  • 251P5G2 was shown to be highly expressed in prostate and other cancers
  • 251P5G2 polynucleotides are used in methods assessing the status of 251P5G2 gene products in normal versus cancerous tissues.
  • polynucleotides that encode specific regions of the 251P5G2 proteins are used to assess the presence of perturbations (such as deletions, insertions, point mutations, or alterations resulting in a loss of an antigen etc.) in specific regions of the 251P5G2 gene, such as regions containing one or more motifs.
  • Exemplary assays include both RT-PCR assays as well as single-strand conformation polymorphism (SSCP) analysis (see, e.g., Marrogi et al., J. Cutan. Pathol. 26(8): 369-378 (1999), both of which utilize polynucleotides encoding specific regions of a protein to examine these regions within the protein.
  • SSCP single-strand conformation polymorphism
  • nucleic acid related embodiments of the invention disclosed herein are genomic DNA, cDNAs, dibozymes, and antisense molecules, as well as nucleic acid molecules based on an alternative backbone, or including alternative bases, whether derived from natural sources or synthesized, and indude molecules capable of inhibiting the RNA or protein expression of 251P5G2.
  • antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives that specifically bind DNA or RNA in a base pair-dependent manner.
  • PNAs peptide nucleic acids
  • non-nucleic acid molecules such as phosphorothioate derivatives that specifically bind DNA or RNA in a base pair-dependent manner.
  • a skilled artisan can readily obtain these classes of nucleic acid molecules using the 251P5G2 polynucleotides and polynucleotide sequences disclosed herein.
  • Antisense technology entails the administration of exogenous oligonucleotides that bind to a target polynucleotide located within the cells.
  • the term “antisense” refers to the fact that such oligonucleotides are complementary to their intracellular targets, e.g., 251P5G2. See for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press, 1989; and Synthesis 1:1-5 (1988).
  • the 251P5G2 antisense oligonucleotides of the present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra), which exhibit enhanced cancer cell growth inhibitory action.
  • S-oligos are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom.
  • the S-oligos of the present invention can be prepared by treatment of the corresponding O-oligos with 3H-1,2-benzodithiol-3-one-1,1-dioxide, which is a sulfur transfer reagent. See, e.g., Iyer, R. P. et al., J. Org. Chem. 55:4693-4698 (1990); and Iyer, R. P. et a., J. Am. Chem. Soc. 112:1253-1254 (1990).
  • Additional 251P5G2 antisense oligonucleotides of the present invention include morpholino antisense oligonucleotides known in the art (see, e.g., Partridge et al., 1996, Antisense & Nucleic Acid Drug Development 6: 169-175).
  • the 251P5G2 antisense oligonucleotides of the present invention typically can be RNA or DNA that is complementary to and stably hybridizes with the first 100 5′ codons or last 100 3′ codons of a 251P5G2 genomic sequence or the corresponding mRNA. Absolute complementarity is not required, although high degrees of complementarity are preferred. Use of an oligonucleotide complementary to this region allows for the selective hybridization to 251P5G2 mRNA and not to mRNA specifying other regulatory subunits of protein kinase.
  • 251P5G2 antisense oligonucleotides of the present invention are 15 to 30-mer fragments of the antisense DNA molecule that have a sequence that hybridizes to 251P5G2 mRNA.
  • 251P5G2 antisense oligonucleotide is a 30-mer oligonucleotide that is complementary to a region in the first 10 5′ codons or last 10 3′ codons of 251P5G2.
  • the antisense molecules are modified to employ ribozymes in the inhibition of 251P5G2 expression, see, e.g., L. A. Couture & D. T. Stinchcomb; Trends Genet 12: 510-515 (1996).
  • nucleotides of the invention include primers and primer pairs, which allow the specific amplification of polynucleotides of the invention or of any specific parts thereof, and probes that selectively or specifically hybridize to nucleic acid molecules of the invention or to any part thereof.
  • Probes can be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • Such probes and primers are used to detect the presence of a 251P5G2 polynucleotide in a sample and as a means for detecting a cell expressing a 251P5G2 protein.
  • Examples of such probes indude polypeptides comprising all or part of the human 251P5G2 cDNA sequence shown in FIG. 2.
  • Examples of primer pairs capable of specifically amplifying 251P5G2 mRNAs are also described in the Examples. As will be understood by the skilled artisan, a great many different primers and probes can be prepared based on the sequences provided herein and used effectively to amplify and/or detect a 251P5G2 mRNA.
  • the 251P5G2 polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and primers for the amplification and/or detection of the 251P5G2 gene(s), mRNA(s), or fragments thereof; as reagents for the diagnosis and/or prognosis of prostate cancer and other cancers; as coding sequences capable of directing the expression of 251P5G2 polypeptides; as tools for modulating or inhibiting the expression of the 251P5G2 gene(s) and/or translation of the 251P5G2 transcript(s); and as therapeutic agents.
  • the present invention includes the use of any probe as described herein to identify and isolate a 251P5G2 or 251P5G2 related nucleic acid sequence from a naturally occurring source, such as humans or other mammals, as well as the isolated nucleic acid sequence per se, which would comprise all or most of the sequences found in the probe used.
  • the 251P5G2 cDNA sequences described herein enable the isolation of other polynucleotides encoding 251P5G2 gene product(s), as well as the isolation of polynucleotides encoding 251P5G2 gene product homologs, alternatively spliced isoforms, allelic variants, and mutant forms of a 251P5G2 gene product as well as polynucleotides that encode analogs of 251P5G2-related proteins.
  • Various molecular cloning methods that can be employed to isolate full length cDNAs encoding a 251P5G2 gene are well known (see, for example, Sambrook, J.
  • a 251P5G2 gene cDNA can be identified by probing with a labeled 251P5G2 cDNA or a fragment thereof.
  • a 251P5G2 cDNA e.g., FIG.
  • a 251P5G2 gene itself can be isolated by screening genomic DNA libraries, bacterial artificial chromosome libraries (BACs), yeast artificial chromosome libraries (YACs), and the like, with 251P5G2 DNA probes or primers.
  • BACs bacterial artificial chromosome libraries
  • YACs yeast artificial chromosome libraries
  • the invention also provides recombinant DNA or RNA molecules containing a 251P5G2 polynucleotide, a fragment, analog or homologue thereof, including but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as well as various viral and non-viral vectors well known in the art, and cells transformed or transfected with such recombinant DNA or RNA molecules. Methods for generating such molecules are well known (see, for example, Sambrook et al., 1989, supra).
  • the invention further provides a host-vector system comprising a recombinant DNA molecule containing a 251P5G2 polynucleotide, fragment, analog or homologue thereof within a suitable prokaryotic or eukaryotic host cell.
  • suitable eukaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9 or HighFive cell).
  • suitable mammalian cells include various prostate cancer cell lines such as DU145 and TsuPr1, other transfectable or transducible prostate cancer cell lines, primary cells (PrEC), as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g., COS, CHO, 293, 293T cells). More particularly, a polynucleotide comprising the coding sequence of 251P5G2 or a fragment, analog or homolog thereof can be used to generate 251P5G2 proteins or fragments thereof using any number of host-vector systems routinely used and widely known in the art.
  • a wide range of host-vector systems suitable for the expression of 251P5G2 proteins or fragments thereof are available, see for example, Sambrook et al., 1989, supra; Current Protocols in Molecular Biology, 1995, supra).
  • Preferred vectors for mammalian expression include but are not limited to pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSRatkneo (Muller et al., 1991, MCB 11:1785).
  • 251P5G2 can be expressed in several prostate cancer and non-prostate cell lines, including for example 293, 293T, rat-1, NIH 3T3 and TsuPr1.
  • the host-vector systems of the invention are useful for the production of a 251P5G2 protein or fragment thereof. Such host-vector systems can be employed to study the functional properties of 251P5G2 and 251P5G2 mutations or analogs.
  • Recombinant human 251P5G2 protein or an analog or homolog or fragment thereof can be produced by mammalian cells transfected with a construct encoding a 251P5G2-related nucleotide.
  • 293T cells can be transfected with an expression plasmid encoding 251P5G2 or fragment, analog or homolog thereof, a 251P5G2-related protein is expressed in the 293T cells, and the recombinant 251P5G2 protein is isolated using standard purification methods (e.g., affinity purification using anti-251P5G2 antibodies).
  • a 251P5G2 coding sequence is subcloned into the retroviral vector pSR ⁇ MSVtkneo and used to infect various mammalian cell lines, such as NIH 3T3, TsuPrl, 293 and rat-1 in order to establish 251P5G2 expressing cell lines.
  • various mammalian cell lines such as NIH 3T3, TsuPrl, 293 and rat-1
  • Various other expression systems well known in the art can also be employed.
  • Expression constructs encoding a leader peptide joined in frame to a 251P5G2 coding sequence can be used for the generation of a secreted form of recombinant 251P5G2 protein.
  • Additional sequence modifications are known to enhance protein expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exonlintron splice site signals, transposon-like repeats, and/or other such well-haracterized sequences that are deleterious to gene expression.
  • the GC content of the sequence is adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Where possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
  • Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described in Kozak, Mol. Cell Biol., 9:5073-5080 (1989).
  • 251P5G2-related proteins Another aspect of the present invention provides 251P5G2-related proteins.
  • Specific embodiments of 251P5G2 proteins comprise a polypeptide having all or part of the amino acid sequence of human 251P5G2 as shown in FIG. 2 or FIG. 3.
  • embodiments of 251P5G2 proteins comprise variant, homolog or analog polypeptides that have alterations in the amino acid sequence of 251P5G2 shown in FIG. 2 or FIG. 3.
  • Embodiments of a 251P5G2 polypeptide include: a 251P5G2 polypeptide having a sequence shown in FIG. 2, a peptide sequence of a 251P5G2 as shown in FIG. 2 wherein T is U; at least 10 contiguous nucleotides of a polypeptide having the sequence as shown in FIG. 2; or, at least 10 contiguous peptides of a polypeptide having the sequence as shown in FIG. 2 where T is U.
  • embodiments of 251P5G2 peptides comprise, without limitation:
  • (I) a protein comprising, consisting essentially of, or consisting of an amino acid sequence as shown in FIGS. 2 A-M or FIGS. 3 A-E;
  • (VII) a protein that comprises at least two peptides selected from the peptides set forth in Tables VII to XLIX collectively, with a proviso that the protein is not a contiguous sequence from an amino acid sequence of FIG. 2;
  • (IX) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a protein of FIGS. 3 A-D or 3 E, in any whole number increment up to 255 or 1266 respectively that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of FIG. 5;
  • (XII) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a protein of FIGS. 3 A-D or 3 E, in any whole number increment up to 255 or 1266 respectively that includes at least at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of FIG. 8;
  • (XIX) a peptide that occurs at least once in Tables VIII-XXI, and at least twice in tables XXII to XLIX;
  • (XX) a peptide that occurs at least twice in Tables VIII-XXI, and at least once in tables XXII to XLIX;
  • (XXI) a peptide that occurs at least twice in Tables VIII-XXI, and at least twice in tables XXII to XLIX;
  • (XXII) a peptide which comprises one two, three, four, or five of the following characteristics, or an oligonucleotide encoding such peptide:
  • (XXIII) a composition comprising a peptide of (I)-(XXII) or an antibody or binding region thereof together with a pharmaceutical excipient and/or in a human unit dose form.
  • (XXIV) a method of using a peptide of (I)-(XXII), or an antibody or binding region thereof or a composition of (XXIII) in a method to modulate a cell expressing 251P5G2,
  • (XXV) a method of using a peptide of (I)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 251P5G2
  • (XXVI) a method of using a peptide of (I)-(XXII) or an antibody or binding region thereof or a composition (XXIII) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 251P5G2, said cell from a cancer of a tissue listed in Table I;
  • (XXVII) a method of using a peptide of (I)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat a a cancer;
  • (XXVIII) a method of using a peptide of (I)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat a a cancer of a tissue listed in Table I; and,
  • (XXIX) a method of using a a peptide of (I)-(XXII) or an antibody or binding region thereof or a composition (XXIII) in a method to identify or characterize a modulator of a cell expressing 251P5G2.
  • Typical embodiments of the invention disclosed herein include 251P5G2 polynucleotides that encode specific portions of 251P5G2 mRNA sequences (and those which are complementary to such sequences) such as those that encode the proteins and/or fragments thereof, for example:
  • allelic variants of human 251P5G2 share a high degree of structural identity and homology (e.g., 90% or more homology).
  • allelic variants of a 251P5G2 protein contain conservative amino acid substitutions within the 251P5G2 sequences described herein or contain a substitution of an amino acid from a corresponding position in a homologue of 251P5G2.
  • One rouge of 251P5G2 allelic variants are proteins that share a high degreeof homology with at least a small region of a particular 251P5G2 amino acid sequence, but further contain a radical departure from the sequence, such as a non-conservative substitution, truncation, insertion or frame shift.
  • Proteins of the invention can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 conservative substitutions. Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa.
  • isoleucine I
  • V valine
  • L leucine
  • Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa.
  • substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein.
  • G glycine
  • A alanine
  • V valine
  • M Methionine
  • L Lysine
  • K arginine
  • R arginine
  • Embodiments of the invention disclosed herein include a wide variety of art-accepted variants or analogs of 251P5G2 proteins such as polypeptides having amino acid insertions, deletions and substitutions.
  • 251P5G2 variants can be made using methods known in the art such as site-directed mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl. Acids Res., 13:4331(1986); Zoller et al., Nucl.
  • Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence that is involved in a specific biological activity such as a protein-protein interaction.
  • preferred scanning amino acids are relatively small, neutral amino acids.
  • amino acids include alanine, glycine, serine, and cysteine.
  • Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine substitution does not yield adequate amounts of variant, an isosteric amino acid can be used.
  • 251P5G2 variants, analogs or homologs have the distinguishing attribute of having at least one epitope that is “cross reactive” with a 251P5G2 protein having an amino acid sequence of FIG. 3.
  • cross reactive means that an antibody or T cell that specifically binds to a 251P5G2 variant also specifically binds to a 251P5G2 protein having an amino acid sequence set forth in FIG. 3.
  • a polypeptide ceases to be a variant of a protein shown in FIG. 3, when it no longer contains any epitope capable of being recognized by an antibody or T cell that specifically binds to the starting 251P5G2 protein.
  • 251P5G2-related protein variants share 70%, 75%, 80%, 85% or 90% or more similarity with an amino acid sequence of FIG. 3, or a fragment thereof.
  • Another specific class of 251P5G2 protein variants or analogs comprises one or more of the 251P5G2 biological motifs described herein or presently known in the art.
  • analogs of 251P5G2 fragments that have altered functional (e.g. immunogenic) properties relative to the starting fragment. It is to be appreciated that motifs now or which become part of the art are to be applied to the nucleic or amino acid sequences of FIG. 2 or FIG. 3.
  • embodiments of the claimed invention include polypeptides containing less than the full amino acid sequence of a 251P5G2 protein shown in FIG. 2 or FIG. 3.
  • representative embodiments of the invention comprise peptides/proteins having any 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous amino acids of a 251P5G2 protein shown in FIG. 2 or FIG. 3.
  • representative embodiments of the invention disclosed herein include polypeptides consisting of about amino acid 1 to about amino acid 10 of a 251P5G2 protein shown in FIG. 2 or FIG. 3, polypeptides consisting of about amino acid 10 to about amino acid 20 of a 251P5G2 protein shown in FIG. 2 or FIG. 3, polypeptides consisting of about amino acid 20 to about amino acid 30 of a 251P5G2 protein shown in FIG. 2 or FIG. 3, polypepbdes consisting of about amino acid 30 to about amino acid 40 of a 251P5G2 protein shown in FIG. 2 or FIG. 3, polypepbdes consisting of about amino acid 40 to about amino acid 50 of a 251P5G2 protein shown in FIG.
  • polypeptides consisting of about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 130, or 140 or 150 etc.) of a 251P5G2 protein shown in FIG. 2 or FIG. 3 are embodiments of the invention. It is to be appreciated that the starting and stopping positions in this paragraph refer to the specified position as well as that position plus or minus 5 residues.
  • 251P5G2-related proteins are generated using standard peptide synthesis technology or using chemical cleavage methods well known in the art. Alternatively, recombinant methods can be used to generate nucleic acid molecules that encode a 251P5G2-related protein. In one embodiment, nucleic acid molecules provide a means to generate defined fragments of a 251P5G2 protein (or variants, homologs or analogs thereof).
  • Additional illustrative embodiments of the invention disclosed herein include 251P5G2 polypeptides comprising the amino acid residues of one or more of the biological motifs contained within a 251P5G2 polypeptide sequence set forth in FIG. 2 or FIG. 3.
  • motifs are known in the art, and a protein can be evaluated for the presence of such motifs by a number of publicly available Internet sites (see, e.g., URL addresses: pfam.wustl.edu/; searchlauncher.bcm.tmc.edu/seq-search/struc-predict.html; psort.ims.u-tokyo.ac.jp/; cbs.dtu.dk/; ebi.ac.uk/interpro/scan.html; expasy.ch/tools/scnpsit1.html; EpimatrixTM and EpimerTM, Brown University, brown.edu/ResearchrTB-HIV_Lab/epimatrix/epimatrix.html; and BIMAS, bimas.dcrt.nih.gov/.).
  • Table V sets forth several frequently occurring motifs based on pfam searches (see URL address pfam.wustl.edu/). The columns of Table V list (1) motif name abbreviation, (2) percent identity found amongst the different member of the motif family, (3) motif name or description and (4) most common function; location information is included if the motif is relevant for location.
  • Polypeptides comprising one or more of the 251P5G2 motifs discussed above are useful in elucidating the specific characteristics of a malignant phenotype in view of the observation that the 251P5G2 motifs discussed above are associated with growth dysregulation and because 251P5G2 is overexpressed in certain cancers (See, e.g., Table I).
  • Casein kinase II, cAMP and camp-dependent protein kinase, and Protein Kinase C are enzymes known to be associated with the development of the malignant phenotype (see e.g.
  • proteins of the invention comprise one or more of the immunoreactive epitopes identified in accordance with art-accepted methods, such as the peptides set forth in Tables VIII-XXI and XXII-XLIX.
  • CTL epitopes can be determined using specific algorithms to identify peptdes within a 251P5G2 protein that are capable of optimally binding to specified HLA alleles (e.g., Table IV; EpimatrixTM and EpimerTM, Brown University, URL brown.edu/Research/TB-HIV_Lab/epimatrix/epimatrix.html; and BIMAS, URL bimas.dcrt.nih.gov/.)
  • processes for identifying peptides that have sufficient binding affinity for HLA molecules and which are correlated with being immunogenic epitopes are well known in the art, and are carried out without undue experimentation.
  • processes for identifying peptides that are immunogenic epitopes are well known in the art, and are carried out without undue experimentation either in vitro or in vivo.
  • epitopes are also known in the art.
  • one begins with an epitope that bears a CTL or HTL motif (see, e.g., the HLA Class I and HLA Class II motifs/supermotifs of Table IV).
  • the epitope is analoged by substituting out an amino acid at one of the specified positions, and replacing it with another amino acid specified for that position.
  • residues defined in Table IV one can substitute out a deleterious residue in favor of any other residue, such as a preferred residue; substitute a less-preferred residue with a preferred residue; or substitute an originally-occurring preferred residue with another preferred residue.
  • Substitutions can occur at primary anchor positions or at other positions in a peptide; see, e.g., Table IV.
  • Related embodiments of the invention include polypeptdes comprising combinations of the different motifs set forth in Table VI, and/or, one or more of the predicted CTL epitopes of Tables VIII-XXI and XXII-XLIX, and/or, one or more of the predicted HTL epitopes of Tables XLVI-XLIX, and/or, one or more of the T cell binding motifs known in the art.
  • Preferred embodiments contain no insertions, deletions or substitutions either within the motifs or within the intervening sequences of the polypeptides.
  • embodiments which include a number of either N-terminal and/or C-terminal amino acid residues on either side of these motifs may be desirable (to, for example, include a greater portion of the polypeptide architecture in which the motif is located).
  • the number of N-terminal and/or C-terminal amino acid residues on either side of a motif is between about 1 to about 100 amino acid residues, preferably 5 to about 50 amino acid residues.
  • 251P5G2-related proteins are embodied in many forms, preferably in isolated form.
  • a purified 251P5G2 protein molecule will be substantially free of other proteins or molecules that impair the binding of 251P5G2 to antibody, T cell or other ligand.
  • the nature and degree of isolation and purification will depend on the intended use.
  • Embodiments of a 251P5G2-related proteins include purified 251P5G2-related proteins and functional, soluble 251P5G2-related proteins.
  • a functional, soluble 251P5G2 protein or fragment thereof retains the ability to be bound by antibody, T cell or other ligand.
  • the invention also provides 251P5G2 proteins comprising biologically active fragments of a 251P5G2 amino acid sequence shown in FIG. 2 or FIG. 3. Such proteins exhibit properties of the starting 251P5G2 protein, such as the ability to elicit the generation of antibodies that specifically bind an epitope associated with the starting 251P5G2 protein; to be bound by such antibodies; to elicit the activation of HTL or CTL; and/or, to be recognized by HTL or CTL that also specifically bind to the starting protein.
  • 251P5G2-related polypeptides that contain particularly interesting structures can be predicted and/or identified using various analytical techniques well known in the art, including, for example, the methods of Chou-Fasman, Gamier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis, or based on immunogenicity. Fragments that contain such structures are particularly useful in generating subunit-specific anti-251P5G2 antibodies or T cells or in identifying cellular factors that bind to 251P5G2. For example, hydrophilicity profiles can be generated, and immunogenic peptide fragments identified, using the method of Hopp, T. P. and Woods, K. R., 1981, Proc. Natl.
  • Hydropathicity profiles can be generated, and immunogenic peptide fragments idenfified, using the method of Kyte, J. and Doolittle, R. F., 1982, J. Mol. Biol. 157:105-132. Percent (%) Accessible Residues profiles can be generated, and immunogenic peptide fragments identified, using the method of Janin J., 1979, Nature 277:491-492. Average Flexibility profiles can be generated, and immunogenic peptide fragments identified, using the method of Bhaskaran R., Ponnuswamy P. K., 1988, Int. J. Pept. Protein Res. 32:242-255. Beta-turn profiles can be generated, and immunogenic peptide fragments identified, using the method of Deleage, G., Roux B., 1987, Protein Engineering 1:289-294.
  • CTL epitopes can be determined using specific algorithms to identify peptides within a 251P5G2 protein that are capable of optimally binding to specified HLA alleles (e.g., by using the SYFPEITHI site at World Wide Web URL syfpeithi.bmi-heidelberg.com/; the listings in Table IV(A)-(E); EpimatrixTM and EpimerTM, Brown University, URL (brown.edu/Research/TB-HIV_Lab/epimatrix/epimatrix.html); and BIMAS, URL bimas.dcrt.nih.gov/).
  • peptide epitopes from 251P5G2 that are presented in the context of human MHC Class I molecules, e.g., HLA-A1, A2, A3, A11, A24, B7 and B35 were predicted (see, e.g., Tables VIII-XXI, XXII-XLIX).
  • the complete amino acid sequence of the 251P5G2 protein and relevant portions of other variants i.e., for HLA Class I predictions 9 flanking residues on either side of a point mutation or exon juction, and for HLA Class II predictions 14 flanking residues on either side of a point mutation or exon junction corresponding to that variant, were entered into the HLA Peptide Motif Search algorithm found in the Bioinformatics and Molecular Analysis Section (BIMAS) web site listed above; in addition to the site SYFPEITHI, at URL syfpeithi.bmi-heidelberg.com/.
  • BIMAS Bioinformatics and Molecular Analysis Section
  • HLA peptide motif search algorithm was developed by Dr. Ken Parker based on binding of specific peptide sequences in the groove of HLA Class I molecules, in particular HLA-A2 (see, e.g., Falk et al., Nature 351: 290-6 (1991); Hunt et al., Science 255:1261-3 (1992); Parker et al., J. Immunol. 149:3580-7 (1992); Parker et al., J. Immunol. 152:163-75 (1994)).
  • This algorithm allows location and ranking of 8-mer, 9-mer, and 10-mer peptides from a complete protein sequence for predicted binding to HLA-A2 as well as numerous other HLA Class I molecules.
  • HLA class I binding peptides are 8-9-, 10 or 11-mers.
  • the epitopes preferably contain a leucine (L) or methionine (M) at position 2 and a valine (V) or leucine (L) at the C-terminus (see, e.g., Parker et al., J. Immunol. 149:3580-7 (1992)).
  • Selected results of 251P5G2 predicted binding peptides are shown in Tables VIII-XXI and XXII-XLIX herein.
  • Tables VIII-XXI and XXII-XLVII selected candidates, 9-mers and 10-mers, for each family member are shown along with their location, the amino acid sequence of each specific peptide, and an estimated binding score.
  • Tables XLVI-XLIX selected candidates, 15-mers, for each family member are shown along with their location, the amino acid sequence of each specific peptide, and an estimated binding score.
  • the binding score corresponds to the estimated half time of dissociation of complexes containing the peptide at 37° C. at pH 6.5. Peptides with the highest binding score are predicted to be the most tightly bound to HLA Class I on the cell surface for the greatest period of time and thus represent the best immunogenic targets for T-cell recognition.
  • every epitope predicted by the BIMAS site, EpimerTM and EpimatdxTM sites, or specified by the HLA class I or class II motifs available in the art or which become part of the art such as set forth in Table IV (or determined using World Wide Web site URL syfpeithi.bmi-heidelberg.com/, or BIMAS, bimas.dcrtnih.gov/) are to be “applied” to a 251P5G2 protein in accordance with the invention.
  • “applied” means that a 251P5G2 protein is evaluated, e.g., visually or by computer-based patterns finding methods, as appreciated by those of skill in the relevant art.
  • Every subsequence of a 251P5G2 protein of 8, 9, 10, or 11 amino acid residues that bears an HLA Class I motif, or a subsequence of 9 or more amino acid residues that bear an HLA Class II motif are within the scope of the invention.
  • 251P5G2 can be conveniently expressed in cells (such as 293T cells) transfected with a commercially available expression vector such as a CMV-driven expression vector encoding 251P5G2 with a C-terminal 6XHis and MYC tag (pcDNA3.1/mycHIS, Invitrogen or Tag5, GenHunter Corporation, Nashville Tenn.).
  • the Tag5 vector provides an IgGK secretion signal that can be used to facilitate the production of a secreted 251P5G2 protein in transfected cells.
  • the secreted HIS-tagged 251P5G2 in the culture media can be purified, e.g., using a nickel column using standard techniques.
  • Modifications of 251P5G2-related proteins such as covalent modifications are included within the scope of this invention.
  • One type of covalent modification indudes reacting targeted amino acid residues of a 251P5G2 polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of a 251P5G2 protein.
  • Another type of covalent modification of a 251P5G2 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of a protein of the invention.
  • Another type of covalent modification of 251P5G2 comprises linking a 251P5G2 polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
  • PEG polyethylene glycol
  • polypropylene glycol polypropylene glycol
  • polyoxyalkylenes polyoxyalkylenes
  • the 251P5G2-related proteins of the present invention can also be modified to form a chimeric molecule comprising 251P5G2 fused to another, heterologous polypeptide or amino acid sequence.
  • a chimeric molecule can be synthesized chemically or recombinantly.
  • a chimeric molecule can have a protein of the invention fused to another tumor-associated antigen or fragment thereof.
  • a protein in accordance with the invention can comprise a fusion of fragments of a 251P5G2 sequence (amino or nucleic acid) such that a molecule is created that is not, through its length, directly homologous to the amino or nucleic acid sequences shown in FIG. 2 or FIG. 3.
  • Such a chimeric molecule can comprise multiples of the same subsequence of 251P5G2.
  • a chimeric molecule can comprise a fusion of a 251P5G2-related protein with a polyhistidine epitope tag, which provides an epitope to which immobilized nickel can selectively bind, with cytokines or with growth factors.
  • the epitope tag is generally placed at the amino- or carboxyl- terminus of a 251P5G2 protein.
  • the chimeric molecule can comprise a fusion of a 251P5G2-related protein with an immunoglobulin or a particular region of an immunoglobulin.
  • the chimeric molecule also referred to as an “immunoadhesin”
  • a fusion could be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a 251P5G2 polypeptide in place of at least one variable region within an Ig molecule.
  • the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGI molecule.
  • the proteins of the invention have a number of different specific uses. As 251P5G2 is highly expressed in prostate and other cancers, 251P5G2-related proteins are used in methods that assess the status of 251P5G2 gene products in normal versus cancerous tissues, thereby elucidating the malignant phenotype. Typically, polypeptides from specific regions of a 251P5G2 protein are used to assess the presence of perturbations (such as deletions, insertions, point mutations etc.) in those regions (such as regions containing one or more motifs).
  • perturbations such as deletions, insertions, point mutations etc.
  • Exemplary assays utilize antibodies or T cells targeting 251P5G2-related proteins comprising the amino acid residues of one or more of the biological motifs contained within a 251P5G2 polypeptide sequence in order to evaluate the characteristics of this region in normal versus cancerous tissues or to elicit an immune response to the epitope.
  • 251P5G2-related proteins that contain the amino acid residues of one or more of the biological motifs in a 251P5G2 protein are used to screen for factors that interact with that region of 251P5G2.
  • 251P5G2 protein fragments/subsequences are particularly useful in generating and characterizing domain-specific antibodies (e.g., antibodies recognizing an extracellular or intracellular epitope of a 251P5G2 protein), for identifying agents or cellular factors that bind to 251P5G2 or a particular structural domain thereof, and in various therapeutic and diagnostic contexts, induding but not limited to diagnostic assays, cancer vaccines and methods of preparing such vaccines.
  • domain-specific antibodies e.g., antibodies recognizing an extracellular or intracellular epitope of a 251P5G2 protein
  • Proteins encoded by the 251P5G2 genes, or by analogs, homologs or fragments thereof, have a variety of uses, including but not limited to generating antibodies and in methods for identifying ligands and other agents and cellular constituents that bind to a 251P5G2 gene product
  • Antibodies raised against a 251P5G2 protein or fragment thereof are useful in diagnostic and prognostic assays, and imaging methodologies in the management of human cancers characterized by expression of 251P5G2 protein, such as those listed in Table I.
  • Such antibodies can be expressed intracellularly and used in methods of treating patients with such cancers.
  • 251P5G2-related nucleic acids or proteins are also used in generating HTL or CTL responses.
  • Various immunological assays useful for the detection of 251P5G2 proteins are used, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunocytochemical methods, and the like.
  • Antbodies can be labeled and used as immunological imaging reagents capable of detecting 251P5G2-expressing cells (e.g., in radioscintigraphic imaging methods).
  • 251P5G2 proteins are also paricularly useful in generating cancer vaccines, as further described herein.
  • Another aspect of the invention provides antibodies that bind to 251P5G2-related proteins.
  • Preferred antibodies specifically bind to a 251P5G2-related protein and do not bind (or bind weakly) to peptdes or proteins that are not 251P5G2-related proteins under physiological conditions.
  • physiological conditions include: 1) phosphate buffered saline; 2) Tris-buffered saline containing 25 mM Tris and 150 mM NaCl; or normal saline (0.9% NaCl); 4) animal serum such as human serum; or, 5) a combination of any of 1) through 4); these reactions preferably taking place at pH 7.5, alternatively in a range of pH 7.0 to 8.0, or alternatively in a range of pH 6.5 to 8.5; also, these reactions taking place at a temperature between 4° C. to 37° C.
  • antibodies that bind 251P5G2 can bind 251P5G2-related proteins such as the homologs or analogs thereof.
  • 251P5G2 antibodies of the invention are particularly useful in cancer (see, e.g., Table I) diagnostic and prognostic assays, and imaging methodologies. Similarly, such antibodies are useful in the treatment, diagnosis, and/or prognosis of other cancers, to the extent 251P5G2 is also expressed or overexpressed in these other cancers. Moreover, intracellularly expressed antibodies (e.g., single chain antibodies) are therapeutically useful in treating cancers in which the expression of 251P5G2 is involved, such as advanced or metastatic prostate cancers.
  • the invention also provides various immunological assays useful for the detection and quantification of 251P5G2 and mutant 251P5G2-related proteins.
  • Such assays can comprise one or more 251P5G2 antibodies capable of recognizing and binding a 251P5G2-related protein, as appropriate.
  • These assays are performed within various immunological assay formats well known in the art, including but not limited to various types of radioimmunoassays, enzymelinked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), and the like.
  • Immunological non-antibody assays of the invention also comprise T cell immunogenicity assays (inhibitory or stimulatory) as well as major histocompatbility complex (MHC) binding assays.
  • T cell immunogenicity assays inhibitory or stimulatory
  • MHC major histocompatbility complex
  • immunological imaging methods capable of detecting prostate cancer and other cancers expressing 251P5G2 are also provided by the invention, including but not limited to radioscinigraphic imaging methods using labeled 251P5G2 antibodies.
  • Such assays are clinically useful in the detection, monitoring, and prognosis of 251P5G2 expressing cancers such as prostate cancer.
  • 251P5G2 antibodies are also used in methods for purifying a 251P5G2-related protein and for isolating 251P5G2 homologues and related molecules.
  • a method of purifying a 251P5G2-related protein comprises incubating a 251P5G2 antibody, which has been coupled to a solid matrix, with a lysate or other solution containing a 251P5G2-related protein under conditions that permit the 251P5G2 antibody to bind to the 251P5G2-related protein; washing the solid matrix to eliminate impurities; and eluting the 251P5G2-related protein from the coupled antibody.
  • Other uses of 251P5G2 antibodies in accordance with the invention include generating anti-idiotypic antibodies that mimic a 251P5G2 protein.
  • antibodies can be prepared by immunizing a suitable mammalian host using a 251P5G2-related protein, peptide, or fragment, in isolated or immunoconjugated form (Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane (1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)).
  • fusion proteins of 251P5G2 can also be used, such as a 251P5G2 GST-fusion protein.
  • a GST fusion protein comprising all or most of the amino acid sequence of FIG. 2 or FIG. 3 is produced, then used as an immunogen to generate appropriate antibodies.
  • a 251P5G2-related protein is synthesized and used as an immunogen.
  • naked DNA immunization techniques known in the art are used (with or without purified 251P5G2-related protein or 251P5G2 expressing cells) to generate an immune response to the encoded immunogen (for review, see Donnelly et al., 1997, Ann. Rev. Immunol. 15: 617-648).
  • the amino acid sequence of a 251P5G2 protein as shown in FIG. 2 or FIG. 3 can be analyzed to select specific regions of the 251P5G2 protein for generating antibodies.
  • hydrophobicity and hydrophilicity analyses of a 251P5G2 amino acid sequence are used to identify hydrophilic regions in the 251P5G2 structure.
  • Regions of a 251P5G2 protein that show immunogenic structure, as well as other regions and domains can readily be identified using various other methods known in the art, such as Chou-Fasman, Gamier-Robson, Kyte-Doolittie, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis.
  • Hydrophilicity profiles can be generated using the method of Hopp, T. P. and Woods, K. R., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828. Hydropathicity profiles can be generated using the method of Kyte, J. and Doolittle, R. F., 1982, J. Mol. Biol. 157:105-132. Percent (%) Accessible Residues profiles can be generated using the method of Janin J., 1979, Nature 277:491-492. Average Flexibility profiles can be generated using the method of Bhaskaran R., Ponnuswamy P. K., 1988, Int. J. Pept. Protein Res. 32:242-255.
  • Beta-turn profiles can be generated using the method of Deleage, G., Roux B., 1987, Protein Engineering 1:289-294. Thus, each region identified by any of these programs or methods is within the scope of the present invention. Methods for the generation of 251P5G2 antibodies are further illustrated by way of the examples provided herein. Methods for preparing a protein or polypeptide for use as an immunogen are well known in the art. Also well known in the art are methods for preparing immunogenic conjugates of a protein with a carrier, such as BSA, KLH or other carrier protein. In some circumstances, direct conjugation using, for example, carbodiimide reagents are used; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, Ill., are effective.
  • a 251P5G2 immunogen is often conducted by injection over a suitable time period and with use of a suitable adjuvant, as is understood in the art During the immunization schedule, titers of antibodies can be taken to determine adequacy of antibody formation.
  • 251P5G2 monoclonal antibodies can be produced by various means well known in the art.
  • immortalized cell lines that secrete a desired monoclonal antibody are prepared using the standard hybridoma technology of Kohler and Milstein or modifications that immortalize antibody-producing B cells, as is generally known.
  • Immortalized cell lines that secrete the desired antibodies are screened by immunoassay in which the antigen is a 251P5G2-related protein.
  • the appropriate immortalized cell culture is identified, the cells can be expanded and antibodies produced either from in vitro cultures or from ascites fluid.
  • the antibodies or fragments of the invention can also be produced, by recombinant means. Regions that bind specifically to the desired regions of a 251P5G2 protein can also be produced in the context of chimeric or complementarity-determining region (CDR) grafted antibodies of multiple species origin. Humanized or human 251P5G2 antibodies can also be produced, and are preferred for use in therapeutic contexts. Methods for humanizing murine and other non-human antibodies, by substituting one or more of the non-human antibody CDRs for corresponding human antibody.
  • CDR complementarity-determining region
  • Fully human 251P5G2 monoclonal antibodies can be generated using doning technologies employing large human Ig gene combinatorial libraries (i.e., phage display) (Griffiths and Hoogenboom, Building an in vitro immune system: human antibodies from phage display libraries. In: Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic Applicatons in Man, Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from combinatorial libraries. Id., pp 65-82).
  • Fully human 251P5G2 monodonal antibodies can also be produced using transgenic mice engineered to contain human immunoglobulin gene loci as described in PCT Patent Application WO98/24893, Kucherlapat and Jakobovits et al., published Dec. 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4): 607414; U.S. Pat. Nos. 6,162,963 issued Dec. 19, 2000; 6,150,584 issued Nov. 12, 2000; and, 6,114598 issued Sep. 5, 2000). This method avoids the in vitro manipulation required with phage display technology and efficienty produces high affinity authentic human antibodies.
  • Reactivity of 251P5G2 antibodies with a 251P5G2-related protein can be established by a number of well known means, including Western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, 251P5G2-related proteins, 251P5G2-expressing cells or extracts thereof.
  • a 251P5G2 antibody or fragment thereof can be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator or an enzyme.
  • bi-specific antibodies specific for two or more 251P5G2 epitopes are generated using methods generally known in the art.
  • Homodimeric antibodies can also be generated by cross-linking techniques known in the art (e.g., Wolff et al., Cancer Res. 53: 2560-2565).
  • compositions of the invention induce a therapeutic or prophylactic immune responses in very broad segments of the world-wide population.
  • immunology-related technology For an understanding of the value and efficacy of compositions of the invention that induce cellular immune responses, a brief review of immunology-related technology is provided.
  • a complex of an HLA molecule and a peptidic antigen acts as the ligand recognized by HLA-restricted T cells (Buus, S. et al., Cell 47:1071, 1986; Babbitt, B. P. et al., Nature 317:359, 1985; Townsend, A. and Bodmer, H., Annu. Rev. Immunol. 7:601, 1989; Germain, R. N., Annu. Rev. Immunol. 11:403, 1993).
  • class I and class II allele-specific HLA binding motifs allows identification of regions within a protein that are correlated with binding to particular HLA antigen(s).
  • candidates for epitope-based vaccines have been identified; such candidates can be further evaluated by HLA-peptide binding assays to determine binding affinity and/or the time period of association of the epitope and its corresponding HLA molecule. Additional confirmatory work can be performed to select, amongst these vaccine candidates, epitopes with preferred characteristics in terms of population coverage, and/or immunogenicity.
  • recall responses are detected by culturing PBL from subjects that have been exposed to the antigen due to disease and thus have generated an immune response “naturally”, or from patients who were vaccinated against the antigen.
  • PBL from subjects are cultured in vitro for 1-2 weeks in the presence of test peptide plus antigen presenting cells (APC) to allow activation of “memory” T cells, as compared to “naive” T cells.
  • APC antigen presenting cells
  • T cell activity is detected using assays including 51 Cr release involving peptide-sensitized targets, T cell proliferation, or lymphokine release.
  • Nucleic acids that encode a 251P5G2-related protein can also be used to generate either transgenic animals or “knock out” animals that, in tum, are useful in the development and screening of therapeutically useful reagents.
  • cDNA encoding 251P5G2 can be used to clone genomic DNA that encodes 251P5G2.
  • the cloned genomic sequences can then be used to generate transgenic animals containing cells that express DNA that encode 251P5G2.
  • Methods for generating transgenic animals, particularly animals such as mice or rats have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 issued Apr. 12, 1988, and 4,870,009 issued Sep. 26, 1989.
  • particular cells would be targeted for 251P5G2 transgene incorporation with tissue-specific enhancers.
  • Transgenic animals that include a copy of a transgene encoding 251P5G2 can be used to examine the effect of increased expression of DNA that encodes 251P5G2. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
  • an animal is treated with a reagent and a reduced incidence of a pathological condition, compared to untreated animals that bear the transgene, would indicate a potential therapeutic intervention for the pathological condition.
  • non-human homologues of 251P5G2 can be used to construct a “251P5G2 ” knock outs animal that has a defective or altered gene encoding 251P5G2 as a result of homologous recombination between the endogenous gene encoding 251P5G2 and altered genomic DNA encoding 251P5G2 introduced into an embryonic cell of the animal.
  • cDNA that encodes 251P5G2 can be used to clone genomic DNA encoding 251P5G2 in accordance with established techniques.
  • a portion of the genomic DNA encoding 251P5G2 can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to monitor integration.
  • another gene such as a gene encoding a selectable marker that can be used to monitor integration.
  • several kilobases of unaltered flanking DNA are included in the vector (see, e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a description of homologous recombination vectors).
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected (see, e.g., Li et al., Cell, 69:915(1992)).
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras (see, e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152).
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal, and the embryo brought to term to create a “knock out” animal.
  • Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA.
  • Knock out animals can be characterized, for example, for their ability to defend against certain pathological conditions or for their development of pathological conditions due to absence of a 251P5G2 polypeptide.
  • Another aspect of the present invention relates to methods for detecting 251P5G2 polynucleotides and 251P5G2-related proteins, as well as methods for identfying a cell that expresses 251P5G2.
  • the expression profile of 251P5G2 makes it a diagnostic marker for metastasized disease. Accordingly, the status of 251P5G2 gene products provides information useful for predicting a variety of factors including suscepubility to advanced stage disease, rate of progression, and/or tumor aggressiveness.
  • the status of 251P5G2 gene products in patient samples can be analyzed by a variety protocols that are well known in the art induding immunohistochemical analysis, the variety of Northern blotting techniques including in situ hybridizabon, RT-PCR analysis (for example on laser capture micro-dissected samples), Western blot analysis and tissue array analysis.
  • the invention provides assays for the detection of 251P5G2 polynucleotides in a biological sample, such as serum, bone, prostate, and other tissues, urine, semen, cell preparations, and the like.
  • Detectable 251P5G2 polynucleotides include, for example, a 251P5G2 gene or fragment thereof, 251P5G2 mRNA, alternative splice variant 251P5G2 mRNAs, and recombinant DNA or RNA molecules that contain a 251P5G2 polynucleotide.
  • a number of methods for amplifying and/or detecting the presence of 251P5G2 polynucleotides are well known in the art and can be employed in the practice of this aspect of the invention.
  • a method for detecting a 251P5G2 mRNA in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA so produced using a 251P5G2 polynucleotides as sense and antisense primers to amplify 251P5G2 cDNAs therein; and detecting the presence of the amplified 251P5G2 cDNA.
  • the sequence of the amplified 251P5G2 cDNA can be determined.
  • a method of detecting a 251P5G2 gene in a biological sample comprises first isolating genomic DNA from the sample; amplifying the isolated genomic DNA using 251P5G2 polynucleotides as sense and antisense primers; and detecting the presence of the amplified 251P5G2 gene.
  • Any number of appropriate sense and antisense probe combinations can be designed from a 251P5G2 nucleotide sequence (see, e.g., FIG. 2) and used for this purpose.
  • the invention also provides assays for detecting the presence of a 251P5G2 protein in a tissue or other biological sample such as serum, semen, bone, prostate, urine, cell preparations, and the like.
  • Methods for detecting a 251P5G2-related protein are also well known and indude, for example, immunoprecipitaton, immunohistochemical analysis, Western blot analysis, molecular binding assays, ELISA, ELIFA and the like.
  • a method of detecting the presence of a 251P5G2-related protein in a biological sample comprises first contacting the sample with a 251P5G2 antibody, a 251P5G2-reactive fragment thereof, or a recombinant protein containing an antigen-binding region of a 251P5G2 antibody; and then detecting the binding of 251P5G2-related protein in the sample.
  • an assay for identifying a cell that expresses a 251P5G2 gene comprises detecting the presence of 251P5G2 mRNA in the cell.
  • Methods for the detection of particular mRNAs in cells include, for example, hybridization assays using complementary DNA probes (such as in sdu hybridization using labeled 251P5G2 riboprobes, Northern blot and related techniques) and various nucleic acid amplification assays (such as RT-PCR using complementary primers specific for 251P5G2, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like).
  • an assay for identifying a cell that expresses a 251P5G2 gene comprises detecting the presence of 251P5G2-related protein in the cell or secreted by the cell.
  • Various methods for the detection of proteins are well known in the art and are employed for the detection of 251P5G2-related proteins and cells that express 251P5G2-related proteins.
  • 251P5G2 expression analysis is also useful as a tool for identifying and evaluating agents that modulate 251P5G2 gene expression.
  • 251P5G2 expression is significantly upregulated in prostate cancer, and is expressed in cancers of the tissues listed in Table I.
  • Identification of a molecule or biological agent that inhibits 251P5G2 expression or over-expression in cancer cells is of therapeutic value.
  • such an agent can be identified by using a screen that quantifies 251P5G2 expression by RT-PCR, nucleic acid hybridization or antibody binding.
  • Oncogenesis is known to be a multistep process where cellular growth becomes progressively dysregulated and cells progress from a normal physiological state to precancerous and then cancerous states (see, e.g., Alers et al., Lab Invest. 77(5): 437-438 (1997) and Isaacs et al., Cancer Surv. 23: 19-32 (1995)).
  • examining a biological sample for evidence of dysregulated cell growth allows for early detection of such aberrant physiology, before a pathologic state such as cancer has progressed to a stage that therapeutic options are more limited and or the prognosis is worse.
  • the status of 251P5G2 in a biological sample of interest can be compared, for example, to the status of 251P5G2 in a corresponding normal sample (e.g. a sample from that individual or alternatively another individual that is not affected by a pathology).
  • a corresponding normal sample e.g. a sample from that individual or alternatively another individual that is not affected by a pathology.
  • An alteration in the status of 251P5G2 in the biological sample provides evidence of dysregulated cellular growth.
  • a predetermined normative value such as a predetermined normal level of mRNA expression (see, e.g., Grever et al., J. Comp. Neurol. Dec. 9, 1996; 376(2): 306-14 and U.S. Pat. No. 5,837,501) to compare 251P5G2 status in a sample.
  • the term “status” in this context is used according to its art accepted meaning and refers to the condition or state of a gene and its products.
  • skilled artisans use a number of parameters to evaluate the condition or state of a gene and its products. These include, but are not limited to the location of expressed gene products (including the location of 251P5G2 expressing cells) as well as the level, and biological activity of expressed gene products (such as 251P5G2 mRNA, polynucleotides and polypeptides).
  • an alteration in the status of 251P5G2 comprises a change in the location of 251P5G2 and/or 251P5G2 expressing cells and/or an increase in 251P5G2 mRNA and/or protein expression.
  • 251P5G2 status in a sample can be analyzed by a number of means well known in the art, including without limitation, immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser capture micro-dissected samples, Western blot analysis, and tissue array analysis.
  • Typical protocols for evaluating the status of a 251P5G2 gene and gene products are found, for example in Ausubel et al. eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis).
  • the status of 251P5G2 in a biological sample is evaluated by various methods utilized by skilled artisans including, but not limited to genomic Southern analysis (to examine, for example perturbations in a 251P5G2 gene), Northern analysis and/or PCR analysis of 251P5G2 mRNA (to examine, for example alterations in the polynucleotide sequences or expression levels of 251P5G2 mRNAs), and, Western and/or immunohistochemical analysis (to examine, for example alterations in polypeptide sequences, alterations in polypeptide localization within a sample, alterations in expression levels of 251P5G2 proteins and/or associations of 251P5G2 proteins with polypeptide binding partners).
  • genomic Southern analysis to examine, for example perturbations in a 251P5G2 gene
  • Northern analysis and/or PCR analysis of 251P5G2 mRNA to examine, for example alterations in the polynucleotide sequences or expression levels of 251P5G2 mRNAs
  • Detectable 251P5G2 polynucleotides include, for example, a 251P5G2 gene or fragment thereof, 251P5G2 mRNA, alternative splice variants, 251P5G2 mRNAs, and recombinant DNA or RNA molecules containing a 251P5G2 polynucleotide.
  • the expression profile of 251P5G2 makes it a diagnostic marker for local and/or metastasized disease, and provides information on the growth or oncogenic potential of a biological sample.
  • the status of 251P5G2 provides information useful for predicting susceptibility to particular disease stages, progression, and/or tumor aggressiveness.
  • the invention provides methods and assays for determining 251P5G2 status and diagnosing cancers that express 251P5G2, such as cancers of the tissues listed in Table I.
  • assays that evaluate the levels of 251P5G2 mRNA transcripts or proteins in a biological sample can be used to diagnose a disease associated with 251P5G2 dysregulaton, and can provide prognostic information useful in defining appropriate therapeutic options.
  • the expression status of 251P5G2 provides information including the presence, stage and location of dysplastic, precancerous and cancerous cells, predicting susceptibility to various stages of disease, and/or for gauging tumor aggressiveness. Moreover, the expression profile makes it useful as an imaging reagent for metastasized disease. Consequently, an aspect of the invention is directed to the various molecular prognostic and diagnostic methods for examining the status of 251P5G2 in biological samples such as those from individuals suffering from, or suspected of suffering from a pathology characterized by dysregulated cellular growth, such as cancer.
  • the status of 251P5G2 in a biological sample can be examined by a number of well-known procedures in the art.
  • the status of 251P5G2 in a biological sample taken from a specific location in the body can be examined by evaluating the sample for the presence or absence of 251P5G2 expressing cells (e.g. those that express 251P5G2 mRNAs or proteins).
  • This examination can provide evidence of dysregulated cellular growth, for example, when 251P5G2-expressing cells arefound in a biological sample that does not normally contain such cells (such as a lymph node), because such alterations in the status of 251P5G2 in a biological sample are often associated with dysregulated cellular growth.
  • one indicator of dysregulated cellular growth is the metastases of cancer cells from an organ of origin (such as the prostate) to a different area of the body (such as a lymph node).
  • evidence of dysregulated cellular growth is important for example because occult lymph node metastases can be detected in a substantial proportion of patients with prostate cancer, and such metastases are associated with known predictors of disease progression (see, e.g., Murphy et al., Prostate 42(4): 315-317 (2000); Su et al., Semin. Surg. Oncol. 18(1): 17-28 (2000) and Freeman et al., J Urol 1995 August 154(2 Pt 1):474-8).
  • the invention provides methods for monitoring 251P5G2 gene products by determining the status of 251P5G2 gene products expressed by cells from an individual suspected of having a disease associated with dysregulated cell growth (such as hyperplasia or cancer) and then comparing the status so determined to the status of 251P5G2 gene products in a corresponding normal sample.
  • the presence of aberrant 251P5G2 gene products in the test sample relative to the normal sample provides an indication of the presence of dysregulated cell growth within the cells of the individual.
  • the invention provides assays useful in determining the presence of cancer in an individual, comprising detecting a significant increase in 251P5G2 mRNA or protein expression in a test cell or tissue sample relative to expression levels in the corresponding normal cell or tissue.
  • the presence of 251P5G2 mRNA can, for example, be evaluated in tissues including but not limited to those listed in Table I.
  • the presence of significant 251P5G2 expression in !any of these tissues is useful to indicate the emergence, presence and/or severity of a cancer, since the corresponding normal tissues do not express 251P5G2 mRNA or express it at lower levels.
  • 251P5G2 status is determined at the protein level rather than at the nucleic acid level.
  • a method comprises determining the level of 251P5G2 protein expressed by cells in a test tissue sample and comparing the level so determined to the level of 251P5G2 expressed in a corresponding normal sample.
  • the presence of 251P5G2 protein is evaluated, for example, using immunohistochemical methods.
  • 251P5G2 antibodies or binding partners capable of detecting 251P5G2 protein expression are used in a variety of assay formats well known in the art for this purpose.
  • a wide variety of assays for observing perturbations in nucleotide and amino acid sequences are well known in the art
  • the size and structure of nucleic acid or amino acid sequences of 251P5G2 gene products are observed by the Northern, Southern, Western, PCR and DNA sequencing protocols discussed herein.
  • other methods for observing perturbations in nucleotide and amino acid sequences such as single strand conformation polymorphism analysis are well known in the art (see, e.g., U.S. Pat. Nos. 5,382,510 issued Sep. 7, 1999, and 5,952,170 issued Jan. 17, 1995).
  • methylaton status of a 251P5G2 gene in a biological sample. Aberrant demethylation and/or hypermethylation of CpG islands in gene 5′ regulatory regions frequently occurs in immortalized and transformed cells, and can result in altered expression of various genes. For example, promoter hypermethylaton of the pi-class glutathione S-transferase (a protein expressed in normal prostate but not expressed in >90% of prostate carcinomas) appears to permanently silence transcription of this gene and is the most frequently detected genomic alteration in prostate carcinomas (De Marzo et al., Am. J. Pathol. 155(6): 1985-1992 (1999)).
  • MSP methylation specific PCR
  • MSP methylation specific PCR
  • This procedure involves initial modification of DNA by sodium bisulfite (which will convert all unmethylated cytosines to uracil) followed by amplification using primers specific for methylated versus unmethylated DNA. Protocols involving methylation interference can also be found for example in Current Protocols In Molecular Biology, Unit 12, Frederick M. Ausubel et al eds., 1995.
  • Gene amplification is an additional method for assessing the status of 251P5G2.
  • Gene amplification is measured in a sample directly, for example, by conventional Southern blotting or Northern blotting to quantitate the transcription of mRNA (Thomas, 1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies are employed that recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn are labeled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Biopsied tissue or peripheral blood can be conveniently assayed for the presence of cancer cells using for example, Northern, dot blot or RT-PCR analysis to detect 251P5G2 expression.
  • the presence of RT-PCR amplifiable 251P5G2 mRNA provides an indication of the presence of cancer.
  • RT-PCR assays are well known in the art. RT-PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of a number of human solid tumors. In the prostate cancer field, these indude RT-PCR assays for the detection of cells expressing PSA and PSM (Verkaik et al., 1997, Urol. Res. 25:373-384; Ghossein et al., 1995, J. Clin. Oncol. 13:1195-2000; Heston et al., 1995, Clin. Chem. 41:1687-1688).
  • a further aspect of the invention is an assessment of the susceptibility that an individual has for developing cancer.
  • a method for predicting susceptibility to cancer comprises detecting 251P5G2 mRNA or 251P5G2 protein in a tissue sample, its presence indicating susceptibility to cancer, wherein the degree of 251P5G2 mRNA expression correlates to the degree of susceptibility.
  • the presence of 251P5G2 in prostate or other tissue is examined, with the presence of 251P5G2 in the sample providing an indication of prostate cancer susceptibility (or the emergence or existence of a prostate tumor).
  • the presence of one or more perturbations in 251P5G2 gene products in the sample is an indication of cancer susceptibility (or the emergence or existence of a tumor).
  • the invention also comprises methods for gauging tumor aggressiveness.
  • a method for gauging aggressiveness of a tumor comprises determining the level of 251P5G2 mRNA or 251P5G2 protein expressed by tumor cells, comparing the level so determined to the level of 251P5G2 mRNA or 251P5G2 protein expressed in a corresponding normal tissue taken from the same individual or a normal tissue reference sample, wherein the degree of 251P5G2 mRNA or 251P5G2 protein expression in the tumor sample relative to the normal sample indicates the degree of aggressiveness.
  • aggressiveness of a tumor is evaluated by determining the extent to which 251P5G2 is expressed in the tumor cells, with higher expression levels indicating more aggressive tumors.
  • Another embodiment is the evaluation of the integrity of 251P5G2 nucleotde and amino acid sequences in a biological sample, in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like. The presence of one or more perturbations indicates more aggressive tumors.
  • Another embodiment of the invention is directed to methods for observing the progression of a malignancy in an individual over time.
  • methods for observing the progression of a malignancy in an individual over time comprise determining the level of 251P5G2 mRNA or 251P5G2 protein expressed by cells in a sample of the tumor, comparing the level so determined to the level of 251P5G2 mRNA or 251P5G2 protein expressed in an equivalent tissue sample taken from the same individual at a different time, wherein the degree of 251P5G2 mRNA or 251P5G2 protein expression in the tumor sample over time provides information on the progression of the cancer.
  • the progression of a cancer is evaluated by determining 251P5G2 expression in the tumor cells over time, where increased expression over time indicates a progression of the cancer. Also, one can evaluate the integrity 251P5G2 nucleotide and amino acid sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like, where the presence of one or more perturbations indicates a progression of the cancer.
  • Another embodiment of the invention is directed to methods for observing a coincidence between the expression of 251P5G2 gene and 251P5G2 gene products (or perturbations in 251P5G2 gene and 251P5G2 gene products) and a factor that is assodated with malignancy, as a means for diagnosing and prognosticating the status of a tissue sample.
  • factors associated with malignancy can be utilized, such as the expression of genes associated with malignancy (e.g.
  • Methods for observing a coincidence between the expression of 251P5G2 gene and 251P5G2 gene products (or perturbations in 251P5G2 gene and 251P5G2 gene products) and another factor that is associated with malignancy are useful, for example, because the presence of a set of specic factors that coincide with disease provides information crucial for diagnosing and prognosticating the status of a tissue sample.
  • methods for observing a coincidence between the expression of 251P5G2 gene and 251P5G2 gene products (or perturbations in 251P5G2 gene and 251P5G2 gene products) and another factor associated with malignancy entails detecting the overexpression of 251P5G2 mRNA or protein in a tissue sample, detecting the overexpression of PSA mRNA or protein in a tissue sample (or PSCA or PSM expression), and observing a coincidence of 251P5G2 mRNA or protein and PSA mRNA or protein overexpression (or PSCA or PSM expression).
  • the expression of 251P5G2 and PSA mRNA in prostate issue is examined, where the coincidence of 251P5G2 and PSA mRNA overexpression in the sample indicates the existence of prostate cancer, prostate cancer susceptibility or the emergence or status of a prostate tumor.
  • Standard methods for the detection and quantificaton of 251P5G2 mRNA include in situ hybridization using labeled 251P5G2 riboprobes, Northern blot and related techniques using 251P5G2 polynucdeotde probes, RT-PCR analysis using primers specific for 251P5G2, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like.
  • semi-quantitative RT-PCR is used to detect and quantify 251P5G2 mRNA expression.
  • Any number of primers capable of amplifying 251P5G2 can be used for this purpose, including but not limited to the various primer sets specifically described herein.
  • polyclonal or monoclonal antibodies specifically reactive with the wild-type 251P5G2 protein can be used in an immunohistochemical assay of biopsied tissue.
  • the 251P5G2 protein and nucleic add sequences disclosed herein allow a skilled artisan to identify proteins, small molecules and other agents that interact with 251P5G2, as well as pathways activated by 251P5G2 via any one of a variety of art accepted protocols.
  • one can utilize one of the so-called interaction trap systems also referred to as the “two-hybrid assay”.
  • molecules interact and reconstitute a transcription factor which directs expression of a reporter gene, whereupon the expression of the reporter gene is assayed.
  • Other systems identify protein-protein interactions in vivo through reconstitution of a eukaryotic transcriptional activator, see, e.g., U.S. Pat. Nos.
  • peptide libraries can be screen peptide libraries to identify molecules that interact with 251P5G2 protein sequences.
  • peptides that bind to 251P5G2 are identified by screening libraries that encode a random or controlled collection of amino acids.
  • Peptides encoded by the libraries are expressed as fusion proteins of bacteriophage coat proteins, the bacteriophage particles are then screened against the 251P5G2 protein(s).
  • peptides having a wide variety of uses are thus identified without any prior information on the structure of the expected ligand or receptor molecule.
  • Typical peptide libraries and screening methods that can be used to identify molecules that interact with 251P5G2 protein sequences are disclosed for example in U.S. Pat. Nos. 5,723,286 issued Mar. 3, 1998 and 5,733,731 issued Mar. 31, 1998.
  • 251P5G2 cell lines that express 251P5G2 are used to identify protein-protein interactions mediated by 251P5G2. Such interactions can be examined using immunopredipitation techniques (see, e.g., Hamilton B. J., et al. Biochem. Biophys. Res. Commun. 1999, 261:646-51).
  • 251P5G2 protein can be immunoprecipitated from 251P5G2-expressing cell lines using anti-251P5G2 antibodies.
  • antibodies against His-tag can be used in a cell line engineered to express fusions of 251P5G2 and a His-tag (vectors mentioned above).
  • the immunoprecipitated complex can be examined for protein association by procedures such as Western blotting, 35 S-methionine labeling of proteins, protein microsequencing, silver staining and two-dimensional gel electrophoresis.
  • Small molecules and ligands that interact with 251P5G2 can be identified through related embodiments of such screening assays. For example, small molecules can be identified that interfere with protein function, including molecules that interfere with 251P5G2's ability to mediate phosphorylation and de-phosphorylation, interaction with DNA or RNA molecules as an indication of regulation of cell cycles, second messenger signaling or tumorigenesis.
  • small molecules that modulate 251P5G2-related ion channel, protein pump, or cell communication functions are identified and used to treat patients that have a cancer that expresses 251P5G2 (see, e.g., Hille, B., Ionic Channels of Excitable Membranes 2 nd Ed., Sinauer Assoc., Sunderland, Mass., 1992).
  • ligands that regulate 251P5G2 function can be identified based on their ability to bind 251P5G2 and activate a reporter construct. Typical methods are discussed for example in U.S. Pat. No. 5,928,868 issued Jul. 27, 1999, and include methods for forming hybrid ligands in which at least one ligand is a small molecule.
  • cells engineered to express a fusion protein of 251P5G2 and a DNA-binding protein are used to co-express a fusion protein of a hybrid ligand/small molecule and a cDNA library transcriptional activator protein.
  • the cells further contain a reporter gene, the expression of which is conditioned on the proximity of the first and second fusion proteins to each other, an event that occurs only if the hybrid ligand binds to target sites on both hybrid proteins.
  • Those cells that express the reporter gene are selected and the unknown small molecule or the unknown ligand is identified. This method provides a means of identifying modulators, which activate or inhibit 251P5G2.
  • An embodiment of this invention comprises a method of screening for a molecule that interacts with a 251P5G2 amino acid sequence shown in FIG. 2 or FIG. 3, comprising the steps of contacting a population of molecules with a 251P5G2 amino acid sequence, allowing the population of molecules and the 251P5G2 amino acid sequence to interact under conditions that facilitate an interaction, determining the presence of a molecule that interacts with the 251P5G2 amino acid sequence, and then separating molecules that do not interact with the 251P5G2 amino acid sequence from molecules that do.
  • the method further comprises purifying, characterizing and identifying a molecule that interacts with the 251P5G2 amino acid sequence. The identified molecule can be used to modulate a function performed by 251P5G2.
  • the 251P5G2 amino acid sequence is contacted with a library of peptides.
  • 251P5G2 as a protein that is normally expressed in a restricted set of tissues, but which is also expressed in cancers such as those listed in Table I, opens a number of therapeutic approaches to the treatment of such cancers.
  • targeted antitumor therapies have been useful even when the targeted protein is expressed on normal tissues, even vital normal organ tissues.
  • a vital organ is one that is necessary to sustain life, such as the heart or colon.
  • a non-vital organ is one that can be removed whereupon the individual is still able to survive. Examples of non-vital organs are ovary, breast, and prostate.
  • Herceptin® is an FDA approved pharmaceutical that has as its active ingredient an antibody which is immunoreactive with the protein variously known as HER2, HER2/neu, and erb-b-2. It is marketed by Genentech and has been a commercially successful antitumor agent. Herceptin sales reached almost $400 million in 2002. Herceptin is a treatment for HER2 positive metastatic breast cancer. However, the expression of HER2 is not limited to such tumors. The same protein is expressed in a number of normal tissues. In particular, it is known that HER2/neu is present in normal kidney and heart, thus these tissues are present in all human recipients of Herceptin.
  • HER2/neu in normal kidney is also confirmed by Latif, Z., et al., B.J.U. International (2002) 89:5-9.
  • this artide which evaluated whether renal cell carcinoma should be a preferred indication for anti-HER2 antibodies such as Herceptin
  • both protein and mRNA are produced in benign renal tissues.
  • HER2/neu protein was strongly overexpressed in benign renal tissue.
  • Herceptin is a very useful, FDA approved, and commercially successful drug.
  • the effect of Herceptin on cardiac tissue, i.e., “cardiotoxicity,” has merely been a side effect to treatment. When patients were treated with Herceptin alone, significant cardiotoxicity occurred in a very low percentage of patients.
  • kidney tissue is indicated to exhibit normal expression, possibly even higher expression than cardiac tissue, kidney has no appreciable Herceptin side effect whatsoever.
  • kidney has no appreciable Herceptin side effect whatsoever.
  • cardiac tissue has manifested any appreciable side effect at all.
  • EGFR epidermal growth factor receptor
  • therapeutic approaches that inhibit the activity of a 251P5G2 protein are useful for patients suffering from a cancer that expresses 251P5G2.
  • These therapeutic approaches generally fall into two classes.
  • One class comprises various methods for inhibiting the binding or association of a 251P5G2 protein with its binding partner or with other proteins.
  • Another class comprises a variety of methods for inhibiting the transcription of a 251P5G2 gene or translation of 251P5G2 mRNA.
  • the invention provides cancer vaccines comprising a 251P5G2-related protein or 251P5G2-related nucleic acid.
  • cancer vaccines prevent and/or treat 251P5G2-expressing cancers with minimal or no effects on non-target tissues.
  • the use of a tumor antigen in a vaccine that generates humoral and/or cellrnediated immune responses as anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al., 1995, Int. J. Cancer 63:231-237; Fong et al., 1997, J. Immunol. 159:3113-3117).
  • Such methods can be readily practiced by employing a 251P5G2-related protein, or a 251P5G2-encoding nucleic acid molecule and recombinant vectors capable of expressing and presenting the 251P5G2 immunogen (which typically comprises a number of antibody or T cell epitopes).
  • a 251P5G2-related protein or a 251P5G2-encoding nucleic acid molecule and recombinant vectors capable of expressing and presenting the 251P5G2 immunogen (which typically comprises a number of antibody or T cell epitopes).
  • Skilled artisans understand that a wide variety of vaccine systems for delivery of immunoreactive epitopes are known in the art (see, e.g., Heryln et al., Ann Med 1999 February 31(1):66-78; Maruyama et a., Cancer Immunol Immunother 2000 Jun 49(3):123-32) Briefly, such methods of generating an immune response (e.g.
  • a mammal's immune system comprises the steps of: exposing the mammal's immune system to an immunoreactive epitope (e.g. an epitope present in a 251P5G2 protein shown in FIG. 3 or analog or homolog thereof) so that the mammal generates an immune response that is specific for that epitope (e.g. generates antibodies that specifically recognize that epitope).
  • an immunoreactive epitope e.g. an epitope present in a 251P5G2 protein shown in FIG. 3 or analog or homolog thereof
  • an immunoreactive epitope e.g. an epitope present in a 251P5G2 protein shown in FIG. 3 or analog or homolog thereof
  • an immunoreactive epitope e.g. an epitope present in a 251P5G2 protein shown in FIG. 3 or analog or homolog thereof
  • an immune response e.g. generates antibodies that specifically recognize that epitope.
  • a 251P5G2 immunogen contains
  • the entire 251P5G2 protein, immunogenic regions or epitopes thereof can be combined and delivered by various means.
  • vaccine compositions can indude, for example, lipopeptides (e.g., Vitiello, A. et al., J. Clin. Invest. 95:341, 1995), peptide compositions encapsulated in poly(DL-lactide-co-glycolide) (“PLG”) microspheres (see, e.g., Eldridge, et al., Molec. Immunol.
  • Toxin-targeted delivery technologies also known as receptor mediated targeting, such as those of Avant Immunotherapeutics, Inc. (Needham, Mass.) may also be used.
  • the vaccine compositions of the invention can also be used in conjunction with other treatments used for cancer, e.g., surgery, chemotherapy, drug therapies, radiation therapies, etc. including use in combination with immune adjuvants such as IL-2, IL-12, GM-CSF, and the like.
  • CTL epitopes can be determined using specific algorithms to identify peptides within 251P5G2 protein that bind corresponding HLA alleles (see e.g., Table IV; EpimerTM and EpimatrixTM, Brown University (URL brown.edulResearch/TB-HIV_Lab/epimatrix/epimatrix.html); and, BIMAS, (URL bimas.dcrtnih.gov/; SYFPEITHI at URL syfpeithi.bmi-heidelberg.com/).
  • a 251P5G2 immunogen contains one or more amino adid sequences identified using techniques well known in the art, such as the sequences shown in Tables VIII-XXI and XXII-XLIX or a peptide of 8, 9, 10 or 11 amino acids specified by an HLA Class I motif/supermotif (e.g., Table IV (A), Table IV (D), or Table IV (E)) and/or a peptide of at least 9 amino acids that comprises an HLA Class II motif/supermotif (e.g., Table IV (B) or Table IV (C)).
  • HLA Class I motif/supermotif e.g., Table IV (A), Table IV (D), or Table IV (E)
  • HLA Class II motif/supermotif e.g., Table IV (B) or Table IV (C)
  • the HLA Class I binding groove is essentially closed ended so that peptides of only a particular size range can fit into the groove and be bound, generally HLA Class I epitopes are 8, 9, 10, or 11 amino acids long.
  • the HLA Class II binding groove is essentially open ended; therefore a peptide of about 9 or more amino acids can be bound by an HLA Class II molecule. Due to the binding groove differences between HLA Class I and II, HLA Class I motifs are length specific, i.e., position two of a Class I motif is the second amino acid in an amino to carboxyl direction of the peptide.
  • HLA Class II epitopes are often 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids long, or longer than 25 amino acids.
  • Methods of generating an immune response in a mammal comprise exposing the mammal's immune system to an immunogenic epitope on a protein (e.g. a 251P5G2 protein) so that an immune response is generated.
  • a protein e.g. a 251P5G2 protein
  • a typical embodiment consists of a method for generating an immune response to 251P5G2 in a host, by contacting the host with a sufficient amount of at least one 251P5G2 B cell or cytotoxic T-cell epitope or analog thereof; and at least one periodic interval thereafter re-contacting the host with the 251P5G2 B cell or cytotoxic T-cell epitope or analog thereof.
  • a specific embodiment consists of a method of generating an immune response against a 251P5G2-related protein or a man-made multiepitopic peptide comprising: administering 251P5G2 immunogen (e.g.
  • a 251P5G2 protein or a peptide fragment thereof, a 251P5G2 fusion protein or analog etc. in a vaccine preparation to a human or another mammal.
  • vaccine preparations further contain a suitable adjuvant (see, e.g., U.S. Pat. No. 6,146,635) or a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San Diego, Calif.; see, e.g., Alexander et al., J. Immunol. 2000 164(3); 164(3): 1625-1633; Alexander et al., Immunity 1994 1(9): 751-761 and Alexander et al., Immunol. Res.
  • An alternative method comprises generating an immune response in an individual against a 251P5G2 immunogen by: administering in vivo to muscle or skin of the individual's body a DNA molecule that comprises a DNA sequence that encodes a 251P5G2 immunogen, the DNA sequence operatively linked to regulatory sequences which control the expression of the DNA sequence; wherein the DNA molecule is taken up by cells, the DNA sequence is expressed in the cells and an immune response is generated against the immunogen (see, e.g., U.S. Pat. No. 5,962,428).
  • a genetic vaccine facilitator such as anionic lipids; saponins; lectins; estrogenic compounds; hydroxylated lower alkyls; dimethyl sulfoxide; and urea is also administered.
  • an antiidiotypic antibody can be administered that mimics 251P5G2, in order to generate a response to the target antigen.
  • Vaccine compositions of the invention include nucleic acid-mediated modalities.
  • DNA or RNA that encode protein(s) of the invention can be administered to a patient.
  • Genetic immunization methods can be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing 251P5G2.
  • Constructs comprising DNA encoding a 251P5G2-related protein/immunogen and appropriate regulatory sequences can be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take-up the construct and express the encoded 251P5G2 proteinlimmunogen.
  • a vaccine comprises a 251P5G2-related protein.
  • 251P5G2-related protein immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against cells that bear a 251P5G2 protein.
  • Various prophylactic and therapeutic genetic immunization techniques known in the art can be used (for review, see information and references published at Internet address genweb.com). Nucleic acid-based delivery is described, for instance, in Wolff et al., Science 247:1465 (1990) as well as U.S. Pat. Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; WO 98/04720.
  • DNA-based delivery technologies include “naked DNA”, facilitated (bupivicaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particlemediated (“gene gun”) or pressure-mediated delivery (see, e.g., U.S. Pat. No. 5,922,687).
  • proteins of the invention can be expressed via viral or bacterial vectors.
  • viral gene delivery systems that can be used in the practice of the invention indude, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus, adeno-associated virus, lenfivirus, and Sindbis virus (see, e.g., Restifo, 1996, Curr. Opin. Immunol. 8:658-663; Tsang et al. J. Natl. Cancer Inst. 87:982-990 (1995)).
  • Non-viral delivery systems can also be employed by introducing naked DNA encoding a 251P5G2-related protein into the patient (e.g., intramuscularly or intradenmally) to induce an anfi-tumor response.
  • Vaccinia virus is used, for example, as a vector to express nucleotide sequences that encode the peptides of the invention. Upon introduction into a host, the recombinant vaccinia virus expresses the protein immunogenic peptide, and thereby elicits a host immune response.
  • Vaccinia vectors and methods useful in immunization protocols are described in, e.g., U.S. Pat. No. 4,722,848.
  • Another vector is BCG (Bacille Calmelle Guerin). BCG vectors are described in Stover et al., Nature 351:456-460 (1991).
  • vectors useful for therapeutic administration or immunization of the peptides of the invention e.g. adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, and the like, will be apparent to those skilled in the art from the description herein.
  • gene delivery systems are used to deliver a 251P5G2-related nucleic acid molecule.
  • the full-length human 251P5G2 cDNA is employed.
  • 251P5G2 nucleic acid molecules encoding specific cytotoxic T lymphocyte (CTL) and/or antibody epitopes are employed.
  • APCs antigen presenting cells
  • DC dendritc cells
  • DRCs antigen presenting cells
  • DRCs dendritc cells
  • MHC class I and II molecules MHC class I and II molecules
  • B7 co-stimulator B7 co-stimulator
  • IL-12 IL-12
  • PSMA prostate-specific membrane antigen
  • dendritic cells can be used to present 251P5G2 peptides to T cells in the context of MHC class I or II molecules.
  • autologous dendritic cells are pulsed with 251P5G2 peptides capable of binding to MHC class I and/or class II molecules.
  • dendritic cells are pulsed with the complete 251P5G2 protein.
  • Yet another embodiment involves engineering the overexpression of a 251P5G2 gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur et al, 1997, Cancer Gene Ther. 4:17-25), retrovirus (Henderson et al., 1996, Cancer Res.
  • Cells that express 251P5G2 can also be engineered to express immune modulators, such as GM-CSF, and used as immunizing agents.
  • 251P5G2 is an allractive target for antibody-based therapeutic strategies.
  • a number of antibody strategies are known in the art for targeting both extracellular and intracellular molecules (see, e.g., complement and ADCC mediated killing as well as the use of intrabodies).
  • 251P5G2 is expressed by cancer cells of various lineages relative to corresponding normal cells, systemic administration of 251P5G2-immunoreactive compositions are prepared that exhibit excellent sensitivity without toxic, non-specific and/or non-target effects caused by binding of the immunoreactive composition to non-target organs and tissues.
  • Antibodies specifically reactive with domains of 251P5G2 are useful to treat 251P5G2-expressing cancers systemically, either as conjugates with a toxin or therapeutic agent, or as naked antibodies capable of inhibiting cell proliferation or function.
  • 251P5G2 antibodies can be introduced into a patient such that the antibody binds to 251P5G2 and modulates a function, such as an interaction with a binding partner, and consequently mediates destruction of the tumor cells and/or inhibits the growth of the tumor cells.
  • Mechanisms by which such antibodies exert a therapeutic effect can include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, modulation of the physiological function of 251P5G2, inhibition of ligand binding or signal transduction pathways, modulation of tumor cell differentiation, alteration of tumor angiogenesis factor profiles, and/or apoptosis.
  • antibodies can be used to specifically target and bind immunogenic molecules such as an immunogenic region of a 251P5G2 sequence shown in FIG. 2 or FIG. 3.
  • cytotoxic agents see, e.g., Slevers et al. Blood 93:11 3678-3684 (Jun. 1, 1999)).
  • cytotoxic and/or therapeutic agents When cytotoxic and/or therapeutic agents are delivered directly to cells, such as by conjugating them to antibodies specific for a molecule expressed by that cell (e.g. 251P5G2), the cytotoxic agent will exert its known biological effect (i.e. cytotoxicity) on those cells.
  • compositions and methods for using antibody-cytotoxic agent conjugates to kill cells are known in the art.
  • typical methods entail administering to an animal having a tumor a biologically effective amount of a conjugate comprising a selected cytotoxic and/or therapeutic agent linked to a targeting agent (e.g. an anti-251P5G2 antibody) that binds to a marker (e.g. 251P5G2) expressed, accessible to binding or localized on the cell surfaces.
  • a targeting agent e.g. an anti-251P5G2 antibody
  • a marker e.g. 251P5G2 expressed, accessible to binding or localized on the cell surfaces.
  • a typical embodiment is a method of delivering a cytotoxic and/or therapeutic agent to a cell expressing 251P5G2, comprising conjugating the cytotoxic agent to an antibody that immunospecifically binds to a 251P5G2 epitope, and, exposing the cell to the antibody-agent conjugate.
  • Another illustrative embodiment is a method of treating an individual suspected of suffering from metastasized cancer, comprising a step of administering parenterally to said individual a pharmaceutical composition comprising a therapeutically effective amount of an antibody conjugated to a cytotoxic and/or therapeutic agent.
  • Cancer immunotherapy using anti-251P5G2 antibodies can be done in accordance with various approaches that have been successfully employed in the treatment of other types of cancer, including but not limited to colon cancer (Arlen et al., 1998, Crit. Rev. Immunol. 18:133-138), multiple myeloma (Ozaki et al., 1997, Blood 90:3179-3186, Tsunenari et al., 1997, Blood 90:2437-2444), gastric cancer (Kasprzyk et al., 1992, Cancer Res. 52:2771-2776), B-cell lymphoma (Funakoshi et al., 1996, J. Immunother. Emphasis Tumor Immunol.
  • leukemia Zhong et al., 1996, Leuk. Res. 20:581-589
  • colorectal cancer Moun et al., 1994, Cancer Res. 54:6160-6166; Velders et al., 1995, Cancer Res. 55:4398-4403)
  • breast cancer Shepard et al., 1991, J. Clin. Immunol. 11:117-127.
  • Some therapeutic approaches involve conjugation of naked antibody to a toxin or radioisotope, such as the conjugation of Y 91 or I 131 to anti-CD20 antibodies (e.g., ZevalinTM, IDEC Pharmaceuticals Corp.
  • antibodies and other therapeutic agents such as HerceptinTM (trastuzumab) with paclitaxel (Genentech, Inc.).
  • the antibodies can be conjugated to a therapeutic agent.
  • 251P5G2 antibodies can be administered in conjunction with radiation, chemotherapy or hormone ablation.
  • antibodies can be conjugated to a toxin such as calicheamicin (e.g., Mylotarglm, Wyeth-Ayerst, Madison, N.J., a recombinant humanized IgG4 kappa antibody conjugated to antitumor antibiotic calicheamicin) or a maytansinoid (e.g., taxane-based Tumor-Activated Prodrug, TAP, platform, ImmunoGen, Cambridge, Mass., also see e.g., U.S. Pat. No. 5,416,064).
  • a toxin such as calicheamicin (e.g., Mylotarglm, Wyeth-Ayerst, Madison, N.J., a recombinant humanized IgG4 kappa antibody conjugated to antitumor antibiotic calicheamicin) or a maytansinoid (e.g., taxane-based Tumor-Activated Prodrug, TAP, platform, ImmunoGen
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention is indicated for patients who have received one or more rounds of chemotherapy. Alternatively, antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment. Additionally, antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very well. Fan et al. (Cancer Res. 53:4637-4642, 1993), Prewett et al. (International J. of Onco. 9:217-224, 1996), and Hancock et al. (Cancer Res. 51:4575-4580, 1991) describe the use of various antibodies together with chemotherapeutic agents.
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention is indicated for patients who have received one or more rounds of chemotherapy. Alternatively, antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment. Additionally, antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very well.
  • Cancer patients can be evaluated for the presence and level of 251P5G2 expression, preferably using immunohistochemical assessments of tumor tissue, quantitative 251P5G2 imaging, or other techniques that reliably indicate the presence and degree of 251P5G2 expression. Immunohistochemical analysis of tumor biopsies or surgical specimens is preferred for this purpose. Methods for immunohistochemical analysis of tumor tissues are well known in the art.
  • Anti-251P5G2 monoclonal antibodies that treat prostate and other cancers include those that initiate a potent immune response against the tumor or those that are directly cytotoxic.
  • anti-251P5G2 monoclonal antibodies mAbs
  • ADCC antibody-dependent cell cytotoxicity
  • anti-251P5G2 mAbs that exert a direct biological effect on tumor growth are useful to treat cancers that express 251P5G2.
  • Mechanisms by which directly cytotoxic mAbs act include: inhibition of cell growth, modulation of cellular differentiation, modulation of tumor angiogenesis factor profiles, and the-induction of apoptosis.
  • the mechanism(s) by which a particular anti-251P5G2 mAb exerts an anti-tumor effect is evaluated using any number of in vitro assays that evaluate cell death such as ADCC, ADMMC, complement-mediated cell lysis, and so forth, as is generally known in the art.
  • preferred monoclonal antibodies used in the therapeutic methods of the invention are those that are either fully human or humanized and that bind specifically to the target 251P5G2 antigen with high affinity but exhibit low or no antigenicity in the patient.
  • Therapeutic methods of the invention contemplate the administration of single anti-251P5G2 mAbs as well as combinations, or cocktails, of different mAbs.
  • Such mAb cocktails can have certain advantages inasmuch as they contain mAbs that target different epitopes, exploit different effector mechanisms or combine directly cytotoxic mAbs with mAbs that rely on immune effector functionality. Such mAbs in combination can exhibit synergistic therapeutic effects.
  • anti-251P5G2 mAbs can be administered concomitantly with other therapeutic modalities, including but not limited to various chemotherapeutic agents, androgen-blockers, immune modulators (e.g., IL-2, GM-CSF), surgery or radiation.
  • the anti-251P5G2 mAbs are administered in their “naked” or unconjugated form, or can have a therapeutic agent(s) conjugated to them.
  • Anti-251P5G2 antibody formulations are administered via any route capable of delivering the antibodies to a tumor cell.
  • Routes of administration include, but are not limited to, intravenous, intraperitoneal, intramuscular, intratumor, intradermal, and the like.
  • Treatment generally involves repeated administration of the anti-251P5G2 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-1000 mg mAb per week are effective and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti-251P5G2 mAb preparation represents an acceptable dosing regimen.
  • the initial loading dose is administered as a 90-minute or longer infusion.
  • the periodic maintenance dose is administered as a 30 minute or longer infusion, provided the initial dose was well tolerated.
  • various factors can influence the ideal dose regimen in a particular case.
  • Such factors include, for example, the binding affinity and half life of the Ab or mAbs used, the degree of 251P5G2 expression in the patient, the extent of circulating shed 251P5G2 antigen, the desired steady-state antibody concentration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in combination with the treatment method of the invention, as well as the health status of a particular patient.
  • patients should be evaluated for the levels of 251P5G2 in a given sample (e.g. the levels of circulating 251P5G2 antigen and/or 251P5G2 expressing cells) in order to assist in the determination of the most effective dosing regimen, etc.
  • levels of 251P5G2 in a given sample e.g. the levels of circulating 251P5G2 antigen and/or 251P5G2 expressing cells
  • Such evaluations are also used for monitoring purposes throughout therapy, and are useful to gauge therapeutic success in combination with the evaluation of other parameters (for example, urine cytology andlor ImmunoCyt levels in bladder cancer therapy, or by analogy, serum PSA levels in prostate cancer therapy).
  • Anti-idiotypic anti-251P5G2 antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a 251P5G2-related protein.
  • the generation of anti-idiotypic antibodies is well known in the art; this methodology can readily be adapted to generate anti-idiotypic anti-251P5G2 antibodies that mimic an epitope on a 251P5G2-related protein (see, for example, Wagner et al., 1997, Hybridoma 16: 3340; Foon et al., 1995, J. Clin. Invest. 96:334-342; Herlyn et al., 1996, Cancer Immunol. Immunother. 43:65-76).
  • Such an anti-idiotypic antibody can be used in cancer vaccine strategies.
  • Vaccines and methods of preparing vaccines that contain an immunogenically effective amount of one or more HLA-binding peptides as described herein are further embodiments of the invention.
  • vaccines in accordance with the invention encompass compositions of one or more of the claimed peptides.
  • a peptide can be present in a vaccine individually.
  • the peptide can exist as a homopolymer comprising multiple copies of the same peptide, or as a heteropolymer of various peptides.
  • Polymers have the advantage of increased immunological reaction and, where different peptide epitopes are used to make up the polymer, the additional ability to induce antibodies and/or CTLs that react with different antigenic determinants of the pathogenic organism or tumor-related peptide targeted for an immune response.
  • the composition can be a naturally occurring region of an antigen or can be prepared, e.g., recombinanuy or by chemical synthesis.
  • Carriers that can be used with vaccines of the invention are well known in the art, and include, e.g., thyroglobulin, albumins such as human serum albumin, tetanus toxoid, polyamino acids such as poly L-lysine, poly L-glutamic acid, influenza, hepatitis B virus core protein, and the like.
  • the vaccines can contain a physiologically tolerable (i.e., acceptable) diluent such as water, or saline, preferably phosphate buffered saline.
  • the vaccines also typically include an adjuvant.
  • Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are examples of materials well known in the art. Additionally, as disclosed herein, CTL responses can be primed by conjugating peptides of the invention to lipids, such as tripalmitoyl-S-glycerylcysteinlyseryl-serine (P 3 CSS). Moreover, an adjuvant such as a synthetic cytosine-phosphorothiolated-guanine-containing (CpG) oligonucleotides has been found to increase CTL responses 10- to 100-fold. (see, e.g. Davila and Celis, J. Immunol. 165:539-547 (2000))
  • the immune system of the host Upon immunization with a peptide composition in accordance with the invention, via injection, aerosol, oral, transdermal, transmucosal, intrapleural, intrathecal, or other suitable routes, the immune system of the host responds to the vaccine by producing large amounts of CTLs and/or HTLs specific for the desired antigen. Consequently, the host becomes at least partially immune to later development of cells that express or overexpress 251P5G2 antigen, or derives at least some therapeutic benefit when the antigen was tumor-associated.
  • class I peptide components may be desirable to combine with components that induce or facilitate neutralizing antibody and or helper T cell responses directed to the target antigen.
  • a preferred embodiment of such a composition comprises class I and class II epitopes in accordance with the invention.
  • An alternative embodiment of such a composition comprises a class I and/or class II epitope in accordance with the invention, along with a cross reactive HTL epitope such as PADRETM (Epimmune, San Diego, Calif.) molecule (described e.g., in U.S. Pat. No. 5,736,142).
  • a vaccine of the invention can also include antigen-presenting cells (APC), such as dendritic cells (DC), as a vehicle to present peptides of the invention.
  • APC antigen-presenting cells
  • DC dendritic cells
  • Vaccine compositions can be created in vitro, following dendritic cell mobilization and harvesting, whereby loading of dendritic cells occurs in vitro.
  • dendritic cells are transfected, e.g., with a minigene in accordance with the invention, or are pulsed with peptides.
  • the dendritic cell can then be administered to a patient to elicit immune responses in vivo.
  • Vaccine compositions either DNA- or peptide-based, can also be administered in vivo in combination with dendritic cell mobilization whereby loading of dendritic cells occurs in vivo.
  • the following principles are utilized when selecting an array of epitopes for inclusion in a polyepitopic composition for use in a vaccine, or for selecting discrete epitopes to be included in a vaccine and/or to be encoded by nucleic acids such as a minigene. It is preferred that each of the following principles be balanced in order to make the selection.
  • the multiple epitopes to be incorporated in a given vaccine composition may be, but need not be, contiguous in sequence in the native antigen from which the epitopes are derived.
  • Epitopes are selected which, upon administration, mimic immune responses that have been observed to be correlated with tumor clearance.
  • this includes 3-4 epitopes that come from at least one tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • HLA Class II a similar rationale is employed; again 3-4 epitopes are selected from at least one TAA (see, e.g., Rosenberg et al., Science 278:1447-1450).
  • Epitopes from one TAA may be used in combination with epitopes from one or more additional TAAs to produce a vaccine that targets tumors with varying expression patterns of frequenuy-expressed TAAs.
  • Epitopes are selected that have the requisite binding affinity established to be correlated with immunogenidity: for HLA Class I an IC 50 of 500 nM or less, often 200 nM or less; and for Class II an IC 50 of 1000 nM or less.
  • Sufficient supermotif bearing-peptides, or a sufficient array of allele-specific motif-bearing peptides, are selected to give broad population coverage. For example, it is preferable to have at least 80% population coverage.
  • a Monte Carlo analysis a statistical evaluation known in the art, can be employed to assess the breadth, or redundancy of, population coverage.
  • nested epitopes are epitopes referred to as “nested epitopes.” Nested epitopes occur where at least two epitopes overlap in a given peptide sequence.
  • a nested peptide sequence can, comprise B cell, HLA class I and/or HLA class II epitopes.
  • a general objective is to provide the greatest number of epitopes per sequence.
  • an aspect is to avoid providing a peptide that is any longer than the amino terminus of the amino terminal epitope and the carboxyl terminus of the carboxyl terminal epitope in the peptide.
  • a multi-epitopic sequence such as a sequence comprising nested epitopes, it is generally important to screen the sequence in order to insure that it does not have pathological or other deleterious biological properties.
  • Spacer amino acid residues can, for example, be introduced to avoid junctional epitopes (an epitope recognized by the immune system, not present in the target antigen, and only created by the man-made juxtaposition of epitopes), or to facilitate cleavage between epitopes and thereby enhance epitope presentation.
  • Junctional epitopes are generally to be avoided because the recipient may generate an immune response to that non-native epitope. Of particular concern is a junctional epitope that is a “dominant epitope.” A dominant epitope may lead to such a zealous response that immune responses to other epitopes are diminished or suppressed.
  • potential peptide epitopes can also be selected on the basis of their conservancy.
  • a criterion for conservancy may define that the entire sequence of an HLA class I binding peptide or the entire 9-mer core of a class II binding peptide be conserved in a designated percentage of the sequences evaluated for a specific protein antigen.
  • Nucleic acids encoding the peptides of the invention are a particularly useful embodiment of the invention. Epitopes for inclusion in a minigene are preferably selected according to the guidelines set forth in the previous section. A preferred means of administering nucleic acids encoding the peptides of the invention uses minigene constructs encoding a peptide comprising one or multiple epitopes of the invention.
  • a multi-epitope DNA plasmid encoding supermotif- and/or motif-bearing epitopes derived 251P5G2, the PADRE® universal helper T cell epitope or multiple HTL epitopes from 251P5G2 (see e.g., Tables VIII-XXI and XXII to XLIX), and an endoplasmic reticulum-translocating signal sequence can be engineered.
  • a vaccine may also comprise epitopes that are derived from other TAAs.
  • the immunogenicity of a multi-epitopic minigene can be confirmed in transgenic mice to evaluate the magnitude of CTL induction responses against the epitopes tested. Further, the immunogenicity of DNA-encoded epitopes in vivo can be correlated with the in vitro responses of specific CTL lines against target cells transfected with the DNA plasmid. Thus, these experiments can show that the minigene serves to both: 1.) generate a CTL response and 2.) that the induced CTLs recognized cells expressing the encoded epitopes.
  • the amino acid sequences of the epitopes may be reverse translated.
  • a human codon usage table can be used to guide the codon choice for each amino acid.
  • HLA presentation of CTL and HTL epitopes may be improved by including synthetic (e.g. poly-alanine) or naturally-occurring flanking sequences adjacent to the CTL or HTL epitopes; these larger peptides comprising the epitope(s) are within the scope of the invention.
  • the minigene sequence may be converted to DNA by assembling oligonucleotides that encode the plus and minus strands of the minigene. Overlapping oligonucleotides (30-100 bases long) may be synthesized, phosphorylated, purified and annealed under appropriate conditions using well known techniques. The ends of the oligonucleotides can be joined, for example, using T4 DNA ligase. This synthetic minigene, encoding the epitope polypeptide, can then be cloned into a desired expression vector.
  • Standard regulatory sequences well known to those of skill in the art are preferably included in the vector to ensure expression in the target cells.
  • Several vector elements are desirable: a promoter with a down-stream cloning site for minigene insertion; a polyadenylation signal for efficient transcription termination; an E. coli origin of replication; and an E. coli selectable marker (e.g. ampicillin or kanamycin resistance).
  • Numerous promoters can be used for this purpose, e.g., the human cytomegalovirus (hCMV) promoter. See, e.g., U.S. Pat. Nos. 5,580,859 and 5,589,466 for other suitable promoter sequences.
  • introns are required for efficient gene expression, and one or more synthetic or naturally-occurring introns could be incorporated into the transcribed region of the minigene.
  • mRNA stabilization sequences and sequences for replication in mammalian cells may also be considered for increasing minigene expression.
  • the minigene is cloned into the polylinker region downstream of the promoter.
  • This plasmid is transformed into an appropriate E. coli strain, and DNA is prepared using standard techniques. The orientation and DNA sequence of the minigene, as well as all other elements included in the vector, are confirmed using restriction mapping and DNA sequence analysis. Bacterial cells harboring the correct plasmid can be stored as a master cell bank and a working cell bank.
  • immunostimulatory sequences appear to play a role in the immunogenicity of DNA vaccines. These sequences may be included in the vector, outside the minigene coding sequence, if desired to enhance immunogenicity.
  • a bi-cistronic expression vector which allows production of both the minigene-encoded epitopes and a second protein (included to enhance or decrease immunogenicity) can be used.
  • proteins or polypeptides that could beneficially enhance the immune response if co-expressed include cytokines (e.g., IL-2, IL-12, GM-CSF), cytokine-inducing molecules (e.g., LeIF), costimulatory molecules, or for HTL responses, pan-DR binding proteins (PADRETM, Epimmune, San Diego, Calif.).
  • Helper (HTL) epitopes can be joined to intracellular targeting signals and expressed separately from expressed CTL epitopes; this allows direction of the HTL epitopes to a cell compartment different than that of the CTL epitopes. If required, this could facilitate more efficient entry of HTL epitopes into the HLA class II pathway, thereby improving HTL induction.
  • immunosuppressive molecules e.g. TGF- ⁇
  • TGF- ⁇ immunosuppressive molecules
  • Therapeutic quantities of plasmid DNA can be produced for example, by fermentation in E. coli, followed by purification. Aliquots from the working cell bank are used to inoculate growth medium, and grown to saturation in shaker flasks or a bioreactor according to well-known techniques. Plasmid DNA can be purified using standard bioseparation technologies such as solid phase anion-exchange resins supplied by QIAGEN, Inc. (Valencia, Calif.). If required, supercoiled DNA can be isolated from the open circular and linear forms using gel electrophoresis or other methods.
  • Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is reconstitution of lyophilized DNA in sterile phosphate-buffer saline (PBS) This approach, known as “naked DNA,” is currently being used for intramuscular (IM) administration in clinical trials. To maximize the immunotherapeutic effects of minigene DNA vaccines, an alternative method for formulating purified plasmid DNA may be desirable. A variety of methods have been described, and new techniques may become available.
  • Cationic lipids, glycolipids, and fusogenic liposomes can also be used in the formulation (see, e.g., as described by WO 93/24640; Mannino & Gould-Fogerite, BioTechniques 6(7): 682 (1988); U.S. Pat No. 5,279,833; WO 91/06309; and Feigner, et al., Proc. Nat'l Acad. Sci. USA 84:7413 (1987).
  • peptides and compounds referred to collectively as protective, interactive, non-condensing compounds could also be complexed to purified plasmid DNA to influence variables such as stability, intramuscular dispersion, or trafficking to specific organs or cell types.
  • Target cell sensitization can be used as a functional assay for expression and HLA class I presentation of minigene-encoded CTL epitopes.
  • the plasmid DNA is introduced into a mammalian cell line that is suitable as a target for standard CTL chromium release assays.
  • the transfection method used will be dependent on the final formulation. Electroporation can be used for “naked” DNA, whereas cationic lipids allow direct in vitro transfection.
  • a plasmid expressing green fluorescent protein (GFP) can be co-transfected to allow enrichment of transfected cells using fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • HTL epitopes may be evaluated in an analogous manner using assays to assess HTL activity.
  • In vivo immunogenicity is a second approach for functional testing of minigene DNA formulations.
  • Transgenic mice expressing appropriate human HLA proteins are immunized with the DNA product.
  • the dose and route of administration are formulation dependent (e.g., IM for DNA in PBS, intraperitoneal (i.p.) for lipid-complexed DNA).
  • Twenty-one days after immunization splenocytes are harvested and restimulated for one week in the presence of peptides encoding each epitope being tested. Thereafter, for CTL effector cells, assays are conducted for cytolysis of peptide-loaded, 51 Cr-labeled target cells using standard techniques.
  • Lysis of target cells that were sensitized by HLA loaded with peptide epitopes, corresponding to minigene-encoded epitopes, demonstrates DNA vaccine function for in vivo induction of CTLs. Immunogenicity of HTL epitopes is confirmed in transgenic mice in an analogous manner.
  • the nucleic acids can be administered using ballistic delivery as described, for instance, in U.S. Pat. No. 5,204,253. Using this technique, particles comprised solely of DNA are administered. In a further alternative embodiment, DNA can be adhered to particles, such as gold particles.
  • Minigenes can also be delivered using other bacterial or viral delivery systems well known in the art, e.g., an expression construct encoding epitopes of the invention can be incorporated into a viral vector such as vaccinia.
  • Vaccine compositions comprising CTL peptides of the invention can be modified, e.g., analoged, to provide desired attributes, such as improved serum half life, broadened population coverage or enhanced immunogenicity.
  • the ability of a peptide to induce CTL activity can be enhanced by linking the peptide to a sequence which contains at least one epitope that is capable of inducing a T helper cell response.
  • a CTL peptide can be directly linked to a T helper peptide, often CTL epitope/HTL epitope conjugates are linked by a spacer molecule.
  • the spacer is typically comprised of relatively small, neutral molecules, such as amino acids or amino acid mimetics, which are substantially uncharged under physiological conditions.
  • the spacers are typically selected from, e.g., Ala, Gly, or other neutral spacers of nonpolar amino acids or neutral polar amino acids.
  • the optionally present spacer need not be comprised of the same residues and thus may be a hetero- or homo-oligomer. When present, the spacer will usually be at least one or two residues, more usually three to six residues and sometimes 10 or more residues.
  • the CTL peptide epitope can be linked to the T helper peptde epitope either directly or via a spacer either at the amino or carboxy terminus of the CTL peptide.
  • the amino terminus of either the immunogenic peptide or the T helper peptide may be acylated.
  • the T helper peptide is one that is recognized by T helper cells present in a majority of a genetically diverse population. This can be accomplished by selecting peptides that bind to many, most, or all of the HLA class II molecules.
  • HLA Class II molecules examples include sequences from antigens such as tetanus toxoid at positions 830-843 (QYIKANSKFIGITE; SEQ ID NO: 37), Plasmodium falciparum circumsporozoite (CS) protein at positions 378-398 (DIEKKIAKMEKASSVFNVVNS; SEQ ID NO: 38), and Streptococcus 18kD protein at positions 116-131 (GAVDSILGGVATYGM; SEQ ID NO: 39).
  • Other examples include peptides bearing a DR 1-4-7 supermotif, or either of the DR3 motifs.
  • An alternative of a pan-DR binding epitope comprises all “L” natural amino acids and can be provided in the form of nucleic acids that encode the epitope.
  • HTL peptide epitopes can also be modified to alter their biological properties. For example, they can be modified to include D-amino acids to increase their resistance to proteases and thus extend their serum half life, or they can be conjugated to other molecules such as lipids, proteins, carbohydrates, and the like to increase their biological activity.
  • a T helper peptide can be conjugated to one or more palmitic acid chains at either the amino or carboxyl termini.
  • compositions of the invention at least one component which primes B lymphocytes or T lymphocytes.
  • Lipids have been identified as agents capable of priming CTL in vivo.
  • palmitic acid residues can be attached to the ⁇ - and ⁇ -amino groups of a lysine residue and then linked, e.g., via one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser, or the like, to an immunogenic peptide.
  • lipidated peptide can then be administered either directly in a micelle or particle, incorporated into a liposome, or emulsified in an adjuvant, e.g., incomplete Freund's adjuvant.
  • a particularly effective immunogenic composition comprises palmitic acid allached to ⁇ - and ⁇ -amino groups of Lys, which is attached via linkage, e.g., Ser-Ser, to the amino terminus of the immunogenic peptide.
  • E. coli lipoproteins such as tripalmitoyl-S-glycerylcysteinlyseryl-serine (P 3 CSS) can be used to prime virus specific CTL when covalently attached to an appropriate peptide (see, e.g., Deres, et al., Nature 342:561, 1989).
  • Peptides of the invention can be coupled to P3CSS, for example, and the lipopeptide administered to an individual to prime specifically an immune response to the target antigen.
  • P 3CSS tripalmitoyl-S-glycerylcysteinlyseryl-serine
  • two such compositions can be combined to more effectively elicit both humoral and cell-mediated responses.
  • Vaccine Compositions Comprising DC Pulsed with CTL andlor HTL Peptides
  • An embodiment of a vaccine composition in accordance with the invention comprises ex vivo administration of a cocktail of epitope-bearing peptides to PBMC, or isolated DC therefrom, from the patient's blood.
  • a pharmaceutical to facilitate harvesting of DC can be used, such as ProgenipoietinTM (Pharmacia-Monsanto, St. Louis, Mo.) or GM-CSF/IL-4. After pulsing the DC with peptides and prior to reinfusion into patients, the DC are washed to remove unbound peptides.
  • a vaccine comprises peptide-pulsed DCs which present the pulsed peptide epitopes complexed with HLA molecules on their surfaces.
  • the DC can be pulsed ex vivo with a cocktail of peptides, some of which stimulate CTL responses to 251P5G2.
  • a helper T cell (HTL) peptide such as a natural or artificial loosely restricted HLA Class II peptide, can be included to facilitate the CTL response.
  • HTL helper T cell
  • a vaccine in accordance with the invention is used to treat a cancer which expresses or overexpresses 251P5G2.
  • Antigenic 251P5G2-related peptides are used to elicit a CTL and/or HTL response ex vivo, as well.
  • the resulting CTL or HTL cells can be used to treat tumors in patients that do not respond to other conventional forms of therapy, or will not respond to a therapeutic vaccine peptide or nucleic acid in accordance with the invention.
  • Ex vivo CTL or HTL responses to a particular antigen are induced by incubating in tissue culture the patients, or genetically compatible, CTL or HTL precursor cells together with a source of antigen-presenting cells (APC), such as dendritic cells, and the appropriate immunogenic peptide.
  • APC antigen-presenting cells
  • the cells After an appropriate incubation time (typically about 7-28 days), in which the precursor cells are activated and expanded into effector cells, the cells are infused back into the patient, where they will destroy (CTL) or facilitate destruction (HTL) of their specific target cell (e.g., a tumor cell).
  • CTL destroy
  • HTL facilitate destruction
  • Transfected dendritic cells may also be used as antigen presenting cells.
  • compositions of the invention are typically used to treat and/or prevent a cancer that expresses or overexpresses 251P5G2.
  • peptide and/or nucleic acid compositions are administered to a patient in an amount sufficient to elicit an effective B cell, CTL and/or HTL response to the antigen and to cure or at least partially arrest or slow symptoms and/or complications.
  • An amount adequate to accomplish this is defined as “therapeutically effective dose.” Amounts effective for this use will depend on, e.g., the particular composition administered, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of the patient, and the judgment of the prescribing physician.
  • the immunogenic peptides of the invention are generally administered to an individual already bearing a tumor that expresses 251P5G2.
  • the peptides or DNA encoding them can be administered individually or as fusions of one or more peptide sequences.
  • Patients can be treated with the immunogenic peptides separately or in conjunction with other treatments, such as surgery, as appropriate.
  • administration should generally begin at the first diagnosis of 251P5G2-associated cancer. This is followed by boosting doses until at least symptoms are substantially abated and for a period thereafter.
  • the embodiment of the vaccine composition i.e., including, but not limited to embodiments such as peptide cocktails, polyepitopic polypeptides, minigenes, or TAA-specific CTLs or pulsed dendritic cells
  • delivered to the patient may vary according to the stage of the disease or the patient's health status. For example, in a patient with a tumor that expresses 251P5G2, a vaccine comprising 251P5G2-specific CTL may be more efficacious in killing tumor cells in patient with advanced disease than alternative embodiments.
  • compositions which stimulate helper T cell responses can also be given in accordance with this embodiment of the invention.
  • the dosage for an initial therapeutic immunization generally occurs in a unit dosage range where the lower value is about 1, 5, 50, 500, or 1,000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient.
  • Boosting dosages of between about 1.0 ⁇ g to about 50,000 ⁇ g of peptide pursuant to a boosting regimen over weeks to months may be administered depending upon the patient's response and condition as determined by measuring the specific activity of CTL and HTL obtained from the patient's blood. Administration should continue until at least clinical symptoms or laboratory tests indicate that the neoplasia, has been eliminated or reduced and for a period thereafter.
  • the dosages, routes of administration, and dose schedules are adjusted in accordance with methodologies known in the art.
  • the peptides and compositions of the present invention are employed in serious disease states, that is, life-threatening or potentially life threatening situations.
  • life-threatening or potentially life threatening situations in certain embodiments, it is possible and may be felt desirable by the treating physician to administer substantial excesses of these peptide compositions relative to these stated dosage amounts.
  • the vaccine compositions of the invention can also be used purely as prophylactic agents.
  • the dosage for an initial prophylactic immunization generally occurs in a unit dosage range where the lower value is about 1, 5, 50, 500, or 1000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient. This is followed by boosting dosages of between about 1.0 ⁇ g to about 50,000 ⁇ g of peptide administered at defined intervals from about four weeks to six months after the initial administration of vaccine.
  • the immunogenicity of the vaccine can be assessed by measuring the specific activity of CTL and HTL obtained from a sample of the patient's blood.
  • compositions for therapeutic treatment are intended for parenteral, topical, oral, nasal, intrathecal, or local (e.g. as a cream or topical ointment) administration.
  • the pharmaceutical compositions are administered parentally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly.
  • compositions for parenteral administration which comprise a solution of the immunogenic peptides dissolved or suspended in an acceptable carrier, preferably an aqueous carrier.
  • aqueous carriers may be used, e.g., water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid and the like. These compositions may be sterilized by conventional, well-known sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration.
  • compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH-adjusting and buffering agents, tonicity adjusting agents, welting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • auxiliary substances such as pH-adjusting and buffering agents, tonicity adjusting agents, welting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • concentration of peptides of the invention in the pharmaceutical formulations can vary widely, i.e., from less than about 0.1%, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.
  • a human unit dose form of a composition is typically included in a pharmaceutical composition that comprises a human unit dose of an acceptable carrier, in one embodiment an aqueous carrier, and is administered in a volume/quantity that is known by those of skill in the art to be used for administration of such compositions to humans (see, e.g., Remington's Pharmaceutical Sciences, 17 th Edition, A. Gennaro, Editor, Mack Publishing Co., Easton, Pa., 1985).
  • a peptide dose for initial immunization can be from about 1 to about 50,000 ⁇ g, generally 100-5,000 ⁇ g, for a 70 kg patient.
  • an initial immunization may be performed using an expression vector in the form of naked nucleic acid administered IM (or SC or ID) in the amounts of 0.5-5 mg at multiple sites.
  • the nucleic add (0.1 to 1000 ⁇ g) can also be administered using a gene gun.
  • a booster dose is then administered.
  • the booster can be recombinant fowlpox virus administered at a dose of 5-10 7 to 5 ⁇ 10 9 pfu.
  • a treatment generally involves repeated administration of the anti-251P5G2 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1 to about 10 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-500 mg mAb per week are effective and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti-251P5G2 mAb preparation represents an acceptable dosing regimen.
  • various factors can influence the ideal dose in a particular case.
  • Such factors include, for example, half life of a composition, the binding affinity of an Ab, the immunogenicity of a substance, the degree of 251P5G2 expression in the patient, the extent of circulating shed 251P5G2 antigen, the desired steady-state concentration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in combination with the treatment method of the invention, as well as the health status of a particular patient.
  • Non-limiting preferred human unit doses are, for example, 500 ⁇ g-1 mg, 1 mg-50 mg, 50 mg-100 mg, 100 mg-200 mg, 200 mg-300 mg, 400 mg-500 mg, 500 mg-600 mg, 600 mg-700 mg, 700 mg-800 mg, 800 mg-900 mg, 900 mg-1 g, or 1 mg-700 mg.
  • the dose is in a range of 2-5 mg/kg body weight, e.g., with follow on weekly doses of 1-3 mg/kg; 0.5mg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 mg/kg body weight followed, e.g., in two, three or four weeks by weekly doses; 0.5-10 mg/kg body weight, e.g., followed in two, three or four weeks by weekly doses; 225, 250, 275, 300, 325, 350, 375, 400 mg m 2 of body area weekly; 1-600 mg m 2 of body area weekly; 225-400 mg m 2 of body area weekly; these does can be followed by weekly doses for 2, 3, 4, 5, 6, 7, 8, 9, 19, 11, 12 or more weeks.
  • human unit dose forms of polynucleotides comprise a suitable dosage range or effective amount that provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors, including the sequence of the polynucleotide, molecular weight of the polynucleotide and route of administration. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dosage range may be selected from, for example, an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to an independently selected upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to an independently selected upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • a dose may be about any of the following: 0.1 to 100 mg/kg, 0.1 to 50 mg/kg, 0.1 to 25 mg/kg, 0.1 to 10 mg/kg, 1 to 500 mg/kg, 100 to 400 mg/kg, 200 to 300 mg/kg, 1 to 100 mg/kg, 100 to 200 mg/kg, 300 to 400 mg/kg, 400 to 500 mg/kg, 500 to 1000 mg/kg, 500 to 5000 mg/kg, or 500 to 10,000 mg/kg.
  • parenteral routes of administration may require higher doses of polynucleotide compared to more direct application to the nucleotide to diseased tissue, as do polynucleotides of increasing length.
  • human unit dose forms of T-cells comprise a suitable dosage range or effective amount that provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dose may be about 10 4 cells to about 10 6 cells, about 10 6 cells to about 10 8 cells, about 10 8 to about 10 11 cells, or about 10 8 to about 5 ⁇ 10 10 cells.
  • a dose may also about 10 6 cells/m 2 to about 10 10 cells/M 2 , or about 10 6 cells/m 2 to about 10 8 cells/m 2 .
  • Proteins(s) of the invention, and/or nucleic acids encoding the protein(s), can also be administered via liposomes, which may also serve to: 1) target the proteins(s) to a particular tissue, such as lymphoid tissue; 2) to target selectively to diseases cells; or, 3) to increase the half-life of the peptide composition.
  • liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like.
  • the peptide to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule which binds to a receptor prevalent among lymphoid cells, such as monoclonal antibodies which bind to the CD45 antigen, or with other therapeutic or immunogenic compositions.
  • liposomes either filled or decorated with a desired peptide of the invention can be directed to the site of lymphoid cells, where the liposomes then deliver the peptide compositions.
  • Liposomes for use in accordance with the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol.
  • lipids are generally guided by consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream.
  • a variety of methods are available for preparing liposomes, as described in, e.g., Szoka, et al., Ann. Rev. Biophys. Bioeng. 9:467 (1980), and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369.
  • a ligand to be incorporated into the liposome can include, e.g., antibodies or fragments thereof specific for cell surface determinants of the desired immune system cells.
  • a liposome suspension containing a peptide may be administered intravenously, locally, topically, etc. in a dose which varies according to, inter alia, the manner of administration, the peptide being delivered, and the stage of the disease being treated.
  • nontoxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10-95% of active ingredient, that is, one or more peptides of the invention, and more preferably at a concentration of 25%-75%.
  • immunogenic peptides are preferably supplied in finely divided form along with a surfactant and propellant. Typical percentages of peptides are about 0.01%-20% by weight, preferably about 1%-10%.
  • the surfactant must, of course, be nontoxic, and preferably soluble in the propellant.
  • Representative of such agents are the esters or partial esters of fatty acids containing from about 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride.
  • the surfactant may constitute about 0.1%-20% by weight of the composition, preferably about 0.25-5%.
  • the balance of the composition is ordinarily propellant.
  • a carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery.
  • 251P5G2 polynucleotides, polypeptides, reactive cytotoxic T cells (CTL), reactive helper T cells (HTL) and anti-polypeptide antibodies are used in well known diagnostic, prognostic and therapeutic assays that examine conditions associated with dysregulated cell growth such as cancer, in particular the cancers listed in Table I (see, e.g., both its specific pattern of tissue expression as well as its overexpression in certain cancers as described for example in the Example entitled “Expression analysis of 251P5G2 in normal tissues, and patient specimens”).
  • 251P5G2 can be analogized to a prostate associated antigen PSA, the archetypal marker that has been used by medical practitioners for years to identify and monitor the presence of prostate cancer (see, e.g., Merrill et al., J. Urol. 163(2): 503-5120 (2000); Polascik et al., J. Urol. Aug; 162(2):293-306 (1999) and Fortier et al., J. Nat. Cancer Inst. 91(19): 1635-1640(1999)).
  • PSA prostate associated antigen PSA
  • Typical embodiments of diagnostic methods which utilize the 251P5G2 polynucleotides, polypeptides, reactive T cells and antibodies are analogous to those methods from well-established diagnostic assays, which employ, e.g., PSA polynucleotides, polypeptides, reactive T cells and antibodies.
  • PSA polynucleotides are used as probes (for example in Northern analysis, see, e.g., Sharief et al., Biochem. Mol. Biol. Int. 33(3):567-74(1994)) and primers (for example in PCR analysis, see, e.g., Okegawa et al., J. Urol.
  • the 251P5G2 polynucleotides described herein can be utilized in the same way to detect 251P5G2 overexpression or the metastasis of prostate and other cancers expressing this gene.
  • PSA polypeptides are used to generate antibodies specific for PSA which can then be used to observe the presence and/or the level of PSA proteins in methods to monitor PSA protein overexpression (see, e.g., Stephan et al., Urology 55(4):560-3 (2000)) or the metastasis of prostate cells (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3):233-7 (1996)), the 251P5G2 polypeptides described herein can be utilized to generate antibodies for use in detecting 251P5G2 overexpression or the metastasis of prostate cells and cells of other cancers expressing this gene.
  • metastases involves the movement of cancer cells from an organ of origin (such as the lung or prostate gland etc.) to a different area of the body (such as a lymph node)
  • assays which examine a biological sample for the presence of cells expressing 251P5G2 polynucleotides and/or polypeptides can be used to provide evidence of metastasis.
  • tissue that does not normally contain 251P5G2-expressing cells lymph node
  • lymph node xenografts isolated from lymph node and bone metastasis, respectively, this finding is indicative of metastasis.
  • 251P5G2 polynucleotides and/or polypeptides can be used to provide evidence of cancer, for example, when cells in a biological sample that do not normally express 251P5G2 or express 251P5G2 at a different level are found to express 251P5G2 or have an increased expression of 251P5G2 (see, e.g., the 251P5G2 expression in the cancers listed in Table I and in patient samples etc. shown in the accompanying Figures).
  • artisans may further wish to generate supplementary evidence of metastasis by testing the biological sample for the presence of a second tissue restricted marker (in addition to 251P5G2) such as PSA, PSCA etc. (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)).
  • PSA polynucleotide fragments and polynucleotide variants are employed by skilled artisans for use in methods of monitoring PSA
  • 251P5G2 polynucleotide fragments and polynucleotide variants are used in an analogous manner.
  • typical PSA polynucleotides used in methods of monitoring PSA are probes or primers which consist of fragments of the PSA cDNA sequence.
  • primers used to PCR amplify a PSA polynucleotide must include less than the whole PSA sequence to function in the polymerase chain reaction.
  • PCR reactions In the context of such PCR reactions, skilled artisans generally create a variety of different polynucleotide fragments that can be used as primers in order to amplify different portions of a polynucleotide of interest or to optimize amplification reactions (see, e.g., Caetano-Anolles, G. Biotechniques 25(3): 472-476, 478-480 (1998); Robertson et al., Methods Mol. Biol. 98:121-154 (1998)).
  • variant polynucleotide sequences are typically used as primers and probes for the corresponding mRNAs in PCR and Northern analyses (see, e.g., Sawai et al, Fetal Diagn. Ther. 1996 November-December 11(6):407-13 and Current Protocols In Molecular Biology, Volume 2, Unit 2, Frederick M. Ausubel et al eds., 1995)).
  • Polynucleotide fragments and variants are useful in this context where they are capable of binding to a target polynucleotide sequence (e.g., a 251P5G2 polynucleotide shown in FIG. 2 or variant thereof) under conditions of high stringency.
  • a target polynucleotide sequence e.g., a 251P5G2 polynucleotide shown in FIG. 2 or variant thereof
  • PSA polypeptides which contain an epitope that can be recognized by an antibody or T cell that specifically binds to that epitope are used in methods of monitoring PSA.
  • 251P5G2 polypeptide fragments and polypeptide analogs or variants can also be used in an analogous manner.
  • This practice of using polypeptide fragments or polypeptde variants to generate antibodies is typical in the art with a wide variety of systems such as fusion proteins being used by practitioners (see, e.g., Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubel et al. eds., 1995).
  • each epitope(s) functions to provide the architecture with which an antibody or T cell is reactive.
  • skilled artisans create a variety of different polypeptide fragments that can be used in order to generate immune responses specific for different portions of a polypeptide of interest (see, e.g., U.S. Pat. No. 5,840,501 and U.S. Pat. No. 5,939,533).
  • a polypeptide comprising one of the 251P5G2 biological motifs discussed herein or a motif-bearing subsequence which is readily identified by one of skill in the art based on motifs available in the art.
  • Polypeptide fragments, variants or analogs are typically useful in this context as long as they comprise an epitope capable of generating an antibody or T cell specific for a target polypeptide sequence (e.g. a 251P5G2 polypeptide shown in FIG. 3).
  • a target polypeptide sequence e.g. a 251P5G2 polypeptide shown in FIG. 3.
  • the 251P5G2 polynucleotides and polypeptides exhibit specific properties that make them useful in diagnosing cancers such as those listed in Table I.
  • Diagnostic assays that measure the presence of 251P5G2 gene products, in order to evaluate the presence or onset of a disease condition described herein, such as prostate cancer, are used to identify patients for preventive measures or further monitoring, as has been done so successfully with PSA.
  • these materials satisfy a need in the art for molecules having similar or complementary characteristics to PSA in situations where, for example, a definite diagnosis of metastasis of prostatc origin cannot be made on the basis of a test for PSA alone (see, e.g., Alanen et al., Pathol. Res. Pract. 192(3): 233-237 (1996)), and consequently, materials such as 251P5G2 polynucleotides and polypeptides (as well as the 251P5G2 polynucleotide probes and anti-251P5G2 antibodies used to identify the presence of these molecules) need to be employed to confirm a metastases of prostatic origin.
  • the 251P5G2 polynucleotides disclosed herein have a number of other utilities such as their use in the identification of oncogenetic associated chromosomal abnormalities in the chromosomal region to which the 251P5G2 gene maps (see the Example entitled “Chromosomal Mapping of 251P5G2” below).
  • the 251P5G2-related proteins and polynucleotides disclosed herein have other utilities such as their use in the forensic analysis of tissues of unknown origin (see, e.g., Takahama K Forensic Sci Int Jun. 28, 1996; 80(1-2): 63-9).
  • 251P5G2-related proteins or polynucleotides of the invention can be used to treat a pathologic condition characterized by the over-expression of 251P5G2.
  • the amino acid or nucleic acid sequence of FIG. 2 or FIG. 3, or fragments of either can be used to generate an immune response to a 251P5G2 antigen.
  • Antibodies or other molecules that react with 251P5G2 can be used to modulate the function of this molecule, and thereby provide a therapeutic benefit.
  • the invention includes various methods and compositions for inhibiting the binding of 251P5G2 to its binding partner or its association with other protein(s) as well as methods for inhibiting 251P5G2 function.
  • a recombinant vector that encodes single chain antibodies that specifically bind to 251P5G2 are introduced into 251P5G2 expressing cells via gene transfer technologies. Accordingly, the encoded single chain anti-251P5G2 antibody is expressed intracellularly, binds to 251P5G2 protein, and thereby inhibits its function.
  • Methods for engineering such intracellular single chain antibodies are well known.
  • intracellular antibodies also known as “intrabodies”, are specifically targeted to a particular compartment within the cell, providing control over where the inhibitory activity of the treatment is focused. This technology has been successfully applied in the art (for review, see Richardson and Marasco, 1995, TIBTECH vol. 13).
  • Intrabodies have been shown to virtually eliminate the expression of otherwise abundant cell surface receptors (see, e.g., Richardson etaaL, 1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141; Beedi et al., 1994, J. Biol. Chem. 289: 23931-23936; Deshane et al., 1994, Gene Ther. 1: 332-337).
  • Single chain antibodies comprise the variable domains of the heavy and light chain joined by a flexible linker polypeptide, and are expressed as a single polypeptide.
  • single chain antibodies are expressed as a single chain variable region fragment joined to the light chain constant region.
  • Well-known intracellular trafficking signals are engineered into recombinant polynucleotide vectors encoding such single chain antibodies in order to target precisely the intrabody to the desired intracellular compartment.
  • intrabodies targeted to the endoplasmic reticulum (ER) are engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal, such as the KDEL amino acid motif.
  • Intrabodies intended to exert activity in the nucleus are engineered to include a nuclear localization signal. Lipid moieties are joined to intrabodies in order to tether the intrabody to the cytosolic side of the plasma membrane. Intrabodies can also be targeted to exert function in the cytosol. For example, cytosolic intrabodies are used to sequester factors within the cytosol, thereby preventing them from being transported to their natural cellular destination.
  • intrabodies are used to capture 251P5G2 in the nucleus, thereby preventing its activity within the nucleus.
  • Nuclear targeting signals are engineered into such 251P5G2 intrabodies in order to achieve the desired targeting.
  • Such 251P5G2 intrabodies are designed to bind specifically to a particular 251P5G2 domain.
  • cytosolic intrabodies that specifically bind to a 251P5G2 protein are used to prevent 251P5G2 from gaining access to the nucleus, thereby preventing it from exerting any biological activity within the nucleus (e.g., preventing 251P5G2 from forming transcription complexes with other factors).
  • the transcription of the intrabody is placed under the regulatory control of an appropriate tumor-specific promoter and/or enhancer.
  • an appropriate tumor-specific promoter and/or enhancer In order to target intrabody expression specifically to prostate, for example, the PSA promoter and/or promoterlenhancer can be utilized (See, for example, U.S. Pat. No. 5,919,652 issued Jul. 6, 1999).
  • recombinant molecules bind to 251P5G2 and thereby inhibit 251P5G2 function.
  • these recombinant molecules prevent or inhibit 251P5G2 from accessing/binding to its binding partner(s) or associating with other protein(s).
  • Such recombinant molecules can, for example, contain the reactive part(s) of a 251P5G2 specific antibody molecule.
  • the 251P5G2 binding domain of a 251P5G2 binding partner is engineered into a dimeric fusion protein, whereby the fusion protein comprises two 251P5G2 ligand binding domains linked to the Fc portion of a human IgG, such as human IgG1.
  • Such IgG portion can contain, for example, the C H 2 and C H 3 domains and the hinge region, but not the C H 1 domain.
  • Such dimeric fusion proteins are administered in soluble form to patients suffering from a cancer assodated with the expression of 251P5G2, whereby the dimeric fusion protein specifically binds to 251P5G2 and blocks 251P5G2 interaction with a binding partner.
  • Such dimeric fusion proteins are further combined into multimeric proteins using known antibody linking technologies.
  • the present invention also comprises various methods and compositions for inhibiting the transcription of the 251P5G2 gene. Similarly, the invention also provides methods and compositions for inhibiting the translation of 251P5G2 mRNA into protein.
  • a method of inhibiting the transcription of the 251P5G2 gene comprises contacting the 251P5G2 gene with a 251P5G2 antisense polynucleotide.
  • a method of inhibiting 251P5G2 mRNA translation comprises contacting a 251P5G2 mRNA with an antisense polynucleotide.
  • a 251P5G2 specific ribozyme is used to cleave a 251P5G2 message, thereby inhibiting translation.
  • Such antisense and ribozyme based methods can also be directed to the regulatory regions of the 251P5G2 gene, such as 251P5G2 promoter and/or enhancer elements.
  • proteins capable of inhibiting a 251P5G2 gene transcription factor are used to inhibit 251P5G2 mRNA transcription.
  • the various polynucleotides and compositions useful in the aforementioned methods have been described above.
  • the use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.
  • Gene transfer and gene therapy technologies can be used to deliver therapeutic polynucleotide molecules to tumor cells synthesizing 251P5G2 (i.e., antisense, ribozyme, polynucleotides encoding intrabodies and other 251P5G2 inhibitory molecules).
  • 251P5G2 i.e., antisense, ribozyme, polynucleotides encoding intrabodies and other 251P5G2 inhibitory molecules.
  • a number of gene therapy approaches are known in the art.
  • Recombinant vectors encoding 251P5G2 antisense polynucleotides, fibozymes, factors capable of interfering with 251P5G2 transcription, and so forth, can be delivered to target tumor cells using such gene therapy approaches.
  • the above therapeutic approaches can be combined with any one of a wide variety of surgical, chemotherapy or radiation therapy regimens.
  • the therapeutic approaches of the invention can enable the use of reduced dosages of chemotherapy (or other therapies) and/or less frequent administration, an advantage for all patients and particularly for those that do not tolerate the toxicity of the chemotherapeutic agent well.
  • the anti-tumor activity of a particular composition can be evaluated using various in vitro and in vivo assay systems.
  • In vitro assays that evaluate therapeutic activity include cell growth assays, soft agar assays and other assays indicative of tumor promoting activity, binding assays capable of determining the extent to which a therapeutic composition will inhibit the binding of 251P5G2 to a binding partner, etc.
  • a 251P5G2 therapeutic composition can be evaluated in a suitable animal model.
  • xenogenic prostate cancer models can be used, wherein human prostate cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice (Klein et al., 1997, Nature Medicine 3: 402-408).
  • PCT Patent Application WO98/16628 and U.S. Pat. No. 6,107,540 describe various xenograft models of human prostate cancer capable of recapitulating the development of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of late stage disease. Efficacy can be predicted using assays that measure inhibition of tumor formation, tumor regression or metastasis, and the like.
  • xenografts from tumor bearing mice treated with the therapeutic composition can be examined for the presence of apoptotic foci and compared to untreated control xenograft-bearing mice. The extent to which apoptotic foci are found in the tumors of the treated mice provides an indication of the therapeutic efficacy of the composition.
  • compositions used in the practice of the foregoing methods can be formulated into pharmaceutical compositions comprising a carrier suitable for the desired delivery method.
  • Suitable carriers include any material that when combined with the therapeutic composition retains the antitumor function of the therapeutic composition and is generally non-reactive with the patient's immune system. Examples include, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the like (see, generally, Remington's Pharmaceutical Sciences 16 th Edition, A. Osal., Ed., 1980).
  • Therapeutic formulations can be solubilized and administered via any route capable of delivering the therapeutic composition to the tumor site.
  • Potentially effective routes of administration include, but are not limited to, intravenous, parenteral, intraperitoneal, intramuscular, intratumor, intradermal, intraorgan, orthotopic, and the like.
  • a preferred formulation for intravenous injection comprises the therapeutic composition in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or diluted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP.
  • Therapeutic protein preparations can be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water (containing for example, benzyl alcohol preservative) or in sterile water prior to injection.
  • screening is performed to identify modulators that induce or suppress a particular expression profile, suppress or induce specific pathways, preferably generating the associated phenotype thereby.
  • having identified differentially expressed genes important in a particular state screens are performed to identify modulators that alter expression of individual genes, either increase or decrease.
  • screening is performed to identify modulators that alter a biological function of the expression product of a differentially expressed gene. Again, having identified the importance of a gene in a particular state, screens are performed to identify agents that bind and/or modulate the biological activity of the gene product.
  • screens are done for genes that are induced in response to a candidate agent. After identifying a modulator (one that suppresses a cancer expression pattern leading to a normal expression pattern, or a modulator of a cancer gene that leads to expression of the gene as in normal tissue) a screen is performed to identify genes that are specifically modulated in response to the agent. Comparing expression profiles between normal tissue and agent-treated cancer tissue reveals genes that are not expressed in normal tissue or cancer tissue, but are expressed in agent treated tissue, and vice versa.
  • agent-specific sequences are identified and used by methods described herein for cancer genes or proteins. In particular these sequences and the proteins they encode are used in marking or identifying agent-treated cells.
  • antibodies are raised against the agent-induced proteins and used to target novel therapeutics to the treated cancer tissue sample.
  • Proteins, nucleic acids, and antibodies of the invention are used in screening assays.
  • the cancer-associated proteins, antibodies, nucleic acids, modified proteins and cells containing these sequences are used in screening assays, such as evaluating the effect of drug candidates on a “gene expression profile,” expression profile of polypeptides or alteration of biological function.
  • the expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring for expression profile genes after treatment with a candidate agent (e.g., Davis, G F, et al, J Biol Screen 7:69 (2002); Zlokarnik, et al., Science 279:84-8 (1998); Heid, Genome Res 6:986-94, 1996).
  • the cancer proteins, antibodies, nucleic acids, modified proteins and cells containing the native or modified cancer proteins or genes are used in screening assays. That is, the present invention comprises methods for screening for compositions which modulate the cancer phenotype or a physiological function of a cancer protein of the invention. This is done on a gene itself or by evaluating the effect of drug candidates on a “gene expression profile” or biological function. In one embodiment, expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring after treatment with a candidate agent, see Zlokamik, supra.
  • a variety of assays are executed directed to the genes and proteins of the invention. Assays are run on an individual nucleic acid or protein level. That is, having identified a particular gene as up regulated in cancer, test compounds are screened for the ability to modulate gene expression or for binding to the cancer protein of the invention. “Modulation” in this context includes an increase or a decrease in gene expression. The preferred amount of modulation will depend on the original change of the gene expression in normal versus tissue undergoing cancer, with changes of at least 10%, preferably 50%, more preferably 100-300%, and in some embodiments 300-1000% or greater.
  • a gene exhibits a 4-fold increase in cancer tissue compared to normal tissue, a decrease of about four-fold is often desired; similarly, a 10-fold decrease in cancer tissue compared to normal tissue a target value of a 10-fold increase in expression by the test compound is often desired.
  • Modulators that exacerbate the type of gene expression seen in cancer are also useful, e.g., as an upregulated target in further analyses.
  • the amount of gene expression is monitored using nucleic acid probes and the quantification of gene expression levels, or, alternatively, a gene product itself is monitored, e.g., through the use of antibodies to the cancer protein and standard immunoassays. Proteomics and separation techniques also allow for quantification of expression.
  • gene expression monitoring i.e., an expression profile
  • Such profiles will typically involve one or more of the genes of FIG. 2.
  • cancer nucleic acid probes are attached to biochips to detect and quantify cancer sequences in a particular cell.
  • PCR can be used.
  • a series e.g., wells of a microtiter plate, can be used with dispensed primers in desired wells. A PCR reaction can then be performed and analyzed for each well.
  • Expression monitoring is performed to identify compounds that modify the expression of one or more cancer-associated sequences, e.g., a polynucleotide sequence set out in FIG. 2.
  • a test modulator is added to the cells prior to analysis.
  • screens are also provided to identify agents that modulate cancer, modulate cancer proteins of the invention, bind to a cancer protein of the invention, or interfere with the binding of a cancer protein of the invention and an antibody or other binding partner.
  • high throughput screening methods involve providing a library containing a large number of potential therapeutic compounds (candidate compounds). Such “combinatorial chemical libraries” are then screened in one or more assays to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional “lead compounds,” as compounds for screening, or as therapeutics.
  • combinatorial libraries of potential modulators are screened for an abilityito bind to a cancer polypeptide or to modulate activity.
  • new chemical entities with useful properties are generated by identifying a chemical compound (called a “lead compound”) with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds.
  • HTS high throughput screening
  • gene expression monitoring is conveniently used to test candidate modulators (e.g., protein, nucleic acid or small molecule).
  • candidate modulators e.g., protein, nucleic acid or small molecule.
  • the target sequence is prepared using known techniques. For example, a sample is treated to lyse the cells, using known lysis buffers, electroporation, etc., with purification and/or amplification such as PCR performed as appropriate. For example, an in vitro transcription with labels covalently attached to the nucleotides is performed. Generally, the nucleic acids are labeled with biotin-FITC or PE, or with cy3 or cy5.
  • the target sequence can be labeled with, e.g., a fluorescent, a chemiluminescent, a chemical, or a radioactive signal, to provide a means of detecting the target sequence's specific binding to a probe.
  • the label also can be an enzyme, such as alkaline phosphatase or horseradish peroxidase, which when provided with an appropriate substrate produces a product that is detected.
  • the label is a labeled compound or small molecule, such as an enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme.
  • the label also can be a moiety or compound, such as, an epitope tag or biotin which specifically binds to streptavidin.
  • the streptavidin is labeled as described above, thereby, providing a detectable signal for the bound target sequence. Unbound labeled streptavidin is typically removed prior to analysis.
  • these assays can be direct hybridization assays or can comprise “sandwich assays”, which include the use of multiple probes, as is generally outlined in U.S. Pat. Nos. 5,681,702; 5,597,909; 5,545,730; 5,594,117; 5,591,584; 5,571,670; 5,580,731; 5,571,670; 5,591,584; 5,624,802; 5,635,352; 5,594,118; 5,359,100; 5,124,246; and 5,681,697.
  • the target nucleic acid is prepared as outlined above, and then added to the biochip comprising a plurality of nucleic acid probes, under conditions that allow the formation of a hybridization complex.
  • hybridization conditions are used in the present invention, including high, moderate and low stringency conditions as outlined above.
  • the assays are generally run under stringency conditions which allow formation of the label probe hybridization complex only in the presence of target.
  • Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc. These parameters may also be used to control non-specific binding, as is generally outlined in U.S. Pat. No. 5,681,697. Thus, it can be desirable to perform certain steps at higher stringency conditions to reduce non-specific binding.
  • the reactions outlined herein can be accomplished in a variety of ways. Components of the reaction can be added simultaneously, or sequentially, in different orders, with preferred embodiments outlined below.
  • the reaction may include a variety of other reagents. These include salts, buffers, neutral proteins, e.g. albumin, detergents, etc. which can be used to facilitate optimal hybridization and detection, and/or reduce nonspecific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may also be used as appropriate, depending on the sample preparation methods and purity of the target.
  • the assay data are analyzed to determine the expression levels of individual genes, and changes in expression levels as between states, forming a gene expression profile.
  • the invention provides methods identify or screen for a compound that modulates the activity of a cancer-related gene or protein of the invention.
  • the methods comprise adding a test compound, as defined above, to a cell comprising a cancer protein of the invention.
  • the cells contain a recombinant nucleic acid that encodes a cancer protein of the invention.
  • a library of candidate agents is tested on a plurality of cells.
  • the assays are evaluated in the presence or absence or previous or subsequent exposure of physiological signals, e.g. hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (i.e., cell-cell contacts).
  • physiological signals e.g. hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (i.e., cell-cell contacts).
  • the determinations are made at different stages of the cell cycle process. In this way, compounds that modulate genes or proteins of the invention are identified. Compounds with pharmacological activity are able to enhance or interfere with the activity of the cancer protein of the invention. Once identified, similar structures are evaluated to identify critical structural features of the compound.
  • a method of modulating (e.g., inhibiting) cancer cell division comprises administration of a cancer modulator.
  • a method of modulating (e.g., inhibiting) cancer is provided; the method comprises administration of a cancer modulator.
  • methods of treating cells or individuals with cancer are provided; the method comprises administration of a cancer modulator.
  • a method for modulating the status of a cell that expresses a gene of the invention comprises such art-accepted parameters such as growth, proliferation, survival, function, apoptosis, senescence, location, enzymatic activity, signal transduction, etc. of a cell.
  • a cancer inhibitor is an antibody as discussed above.
  • the cancer inhibitor is an antisense molecule.
  • a variety of cell growth, proliferation, and metastasis assays are known to those of skill in the art, as described herein.
  • the assays to identify suitable modulators are amenable to high throughput screening. Preferred assays thus detect enhancement or inhibition of cancer gene transcription, inhibition or enhancement of polypeptide expression, and inhibition or enhancement of polypeptide activity.
  • modulators evaluated in high throughput screening methods are proteins, often naturally occurring proteins or fragments of naturally occurring proteins.
  • proteins e.g., cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts, are used.
  • libraries of proteins are made for screening in the methods of the invention.
  • Particularly preferred in this embodiment are libraries of bacterial, fungal, viral, and mammalian proteins, with the latter being preferred, and human proteins being especially preferred.
  • Particularly useful test compound will be directed to the class of proteins to which the target belongs, e.g., substrates for enzymes, or ligands and receptors.
  • Normal cells require a solid substrate to attach and grow. When cells are transformed, they lose this phenotype and grow detached from the substrate. For example, transformed cells can grow in stirred suspension culture or suspended in semi-solid media, such as semi-solid or soft agar. The transformed cells, when transfected with tumor suppressor genes, can regenerate normal phenotype and once again require a solid substrate to attach to and grow. Soft agar growth or colony formation in assays are used to identify modulators of cancer sequences, which when expressed in host cells, inhibit abnormal cellular proliferation and transformation. A modulator reduces or eliminates the host cells' ability to grow suspended in solid or semisolid media, such as agar.
  • Normal cells typically grow in a flat and organized pattern in cell culture until they touch other cells. When the cells touch one another, they are contact inhibited and stop growing. Transformed cells, however, are not contact inhibited and continue to grow to high densities in disorganized foci. Thus, transformed cells grow to a higher saturation density than corresponding normal cells. This is detected morphologically by the formation of a disoriented monolayer of cells or cells in foci. Alternatively, labeling index with ( 3 H)-thymidine at saturation density is used to measure density limitation of growth, similarly an MTT or Alamar blue assay will reveal proliferation capacity of cells and the the ability of modulators to affect same. See Freshney (1994), supra. Transformed cells, when transfected with tumor suppressor genes, can regenerate a normal phenotype and become contact inhibited and would grow to a lower density.
  • labeling index with 3 H)-thymidine at saturation density is a preferred method of measuring density limitation of growth.
  • Transformed host cells are transfected with a cancer-associated sequence and are grown for 24 hours at saturation density in non-limiting medium conditions.
  • the percentage of cells labeling with ( 3 H)-thymidine is determined by incorporated cpm.
  • Transformed cells have lower serum dependence than their normal counterparts (see, e.g., Temin, J. Natl. Cancer Inst. 37:167-175 (1966); Eagle et al., J. Exp. Med 131:836-879 (1970)); Freshney, supra. This is in part due to release of various growth factors by the transformed cells.
  • the degree of growth factor or serum dependence of transformed host cells can be compared with that of control. For example, growth factor or serum dependence of a cell is monitored in methods to identify and characterize compounds that modulate cancer-associated sequences of the invention.
  • Tumor cells release an increased amount of certain factors (hereinafter “tumor specific markers”) than their normal counterparts.
  • plasminogen activator PA
  • PA plasminogen activator
  • Tumor Angiogenesis Factor TAF
  • TAF Tumor Angiogenesis Factor
  • the degree of invasiveness into Matrigel or an extracellular matrix constituent can be used as an assay to identify and characterize compounds that modulate cancer associated sequences.
  • Tumor cells exhibit a positive correlation between malignancy and invasiveness of cells into Matrigel or some other extracellular matrix constituent.
  • tumorigenic cells are typically used as host cells. Expression of a tumor suppressor gene in these host cells would decrease invasiveness of the host cells. Techniques described in Cancer Res. 1999; 59:6010; Freshney (1994), supra, can be used. Briefly, the level of invasion of host cells is measured by using filters coated with Matrigel or some other extracellular matrix constituent.
  • Penetration into the gel, or through to the distal side of the filter, is rated as invasiveness, and rated histologically by number of cells and distance moved, or by prelabeling the cells with 125 1 and counting the radioactivity on the distal side of the filter or bottom of the dish. See, e.g., Freshney (1984), supra.
  • Transgenic organisms are prepared in a variety of art-accepted ways. For example, knock-out transgenic organisms, e.g., mammals such as mice, are made, in which a cancer gene is disrupted or in which a cancer gene is inserted. Knock-out transgenic mice are made by insertion of a marker gene or other heterologous gene into the endogenous cancer gene site in the mouse genome via homologous recombination. Such mice can also be made by substituting the endogenous cancer gene with a mutated version of the cancer gene, or by mutating the endogenous cancer gene, e.g., by exposure to carcinogens.
  • knock-out transgenic organisms e.g., mammals such as mice
  • Knock-out transgenic mice are made by insertion of a marker gene or other heterologous gene into the endogenous cancer gene site in the mouse genome via homologous recombination.
  • Such mice can also be made by substituting the endogenous cancer gene with a mutated version of the
  • transgenic chimeric animals e.g., mice
  • a DNA construct is introduced into the nuclei of embryonic stem cells.
  • Cells containing the newly engineered genetic lesion are injected into a host mouse embryo, which is re-implanted into a recipient female. Some of these embryos develop into chimeric mice that possess germ cells some of which are derived from the mutant cell line. Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice containing the introduced genetic lesion (see, e.g., Capecchi et al., Science 244:1288 (1989)).
  • Chimeric mice can be derived according to U.S. Pat. No. 6,365,797, issued Apr. 2, 2002; U.S. Pat. No.
  • various immune-suppressed or immune-deficient host animals can be used.
  • a genetically athymic “nude” mouse see, e.g., Giovanella et al., J. Natl. Cancer Inst. 52:921 (1974)
  • SCID mouse see, e.g., Giovanella et al., J. Natl. Cancer Inst. 52:921 (1974)
  • SCID mouse see, e.g., a thymectornized mouse, or an irradiated mouse
  • irradiated mouse see, e.g., Bradley et al., Br. J. Cancer 38:263 (1978); Selby et al., Br. J. Cancer 41:52 (1980)
  • Transplantable tumor cells typically about 106 cells injected into isogenic hosts produce invasive tumors in a high proportion of cases, while normal cells of similar origin will not.
  • cells expressing cancer-associated sequences are injected subcutaneously or orthotopically. Mice are then separated into groups, including control groups and treated experimental groups) e.g. treated with a modulator). After a suitable length of time, preferably 4-8 weeks, tumor growth is measured (e.g., by volume or by its two largest dimensions, or weight) and compared to the control. Tumors that have statistically significant reduction (using, e.g., Student's T test) are said to have inhibited growth.
  • Assays to identify compounds with modulating activity can be performed in vitro.
  • a cancer polypeptide is first contacted with a potential modulator and incubated for a suitable amount of time, e.g., from 0.5 to 48 hours.
  • the cancer polypeptide levels are determined in vitro by measuring the level of protein or mRNA.
  • the level of protein is measured using immunoassays such as Western blotting, ELISA and the like with an antibody that selectively binds to the cancer polypeptide or a fragment thereof.
  • amplification e.g., using PCR, LCR, or hybridization assays, e.
  • RNAse protection e.g., Northern hybridization, RNAse protection, dot blotting, are preferred.
  • the level of protein or mRNA is detected using directly or indirectly labeled detection agents, e.g., fluorescently or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.
  • a reporter gene system can be devised using a cancer protein promoter operably linked to a reporter gene such as luciferase, green fluorescent protein, CAT, or P-gal.
  • the reporter construct is typically transfected into a cell. After treatment with a potential modulator, the amount of reporter gene transcription, translation, or activity is measured according to standard techniques known to those of skill in the art (Davis GF, supra; Gonzalez, J. & Negulescu, P. Curr. Opin. Biotechnol. 1998: 9:624).
  • in vitro screens are done on individual genes and gene products. That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of the expression of the gene or the gene product itself is performed.
  • screening for modulators of expression of specific gene(s) is performed. Typically, the expression of only one or a few genes is evaluated. In another embodiment, screens are designed to first find compounds that bind to differentially expressed proteins. These compounds are then evaluated for the ability to modulate differentially expressed activity. Moreover, once initial candidate compounds are identified, variants can be further screened to better evaluate structure activity relationships.
  • a purified or isolated gene product of the invention is generally used.
  • antibodies are generated to a protein of the invention, and immunoassays are run to determine the amount and/or location of protein.
  • cells comprising the cancer proteins are used in the assays.
  • the methods comprise combining a cancer protein of the invention and a candidate compound such as a ligand, and determining the binding of the compound to the cancer protein of the invention.
  • a cancer protein of the invention utilizes the human cancer protein; animal models of human disease of can also be developed and used.
  • other analogous mammalian proteins also can be used as appreciated by those of skill in the art.
  • variant or derivative cancer proteins are used.
  • the cancer protein of the invention, or the ligand is non-diffusibly bound to an insoluble support.
  • the support can, e.g., be one having isolated sample receiving areas (a microtiter plate, an array, etc.).
  • the insoluble supports can be made of any composition to which the compositions can be bound, is readily separated from soluble material, and is otherwise compatible with the overall method of screening.
  • the surface of such supports can be solid or porous and of any convenient shape.
  • suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically made of glass, plastic (e.g., polystyrene), polysaccharide, nylon, nitrocellulose, or TeflonTM, etc. Microtiter plates and arrays are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples. The particular manner of binding of the composition to the support is not crucial so long as it is compatible with the reagents and overall methods of the invention, maintains the activity of the composition and is nondiffusable.
  • Preferred methods of binding include the use of antibodies which do not sterically block either the ligand binding site or activation sequence when attaching the protein to the support, direct binding to “sticky” or ionic supports, chemical crosslinking, the synthesis of the protein or agent on the surface, etc. Following binding of the protein or ligand/binding agent to the support, excess unbound material is removed by washing. The sample receiving areas may then be blocked through incubation with bovine serum albumin (BSA), casein or other innocuous protein or other moiety.
  • BSA bovine serum albumin
  • Binding agents include specific antibodies, non-natural binding agents identified in screens of chemical libraries, peptide analogs, etc.
  • assays to identify agents that have a low toxicity for human cells.
  • a wide variety of assays can be used for this purpose, including proliferation assays, cAMP assays, labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, functional assays (phosphorylation assays, etc.) and the like.
  • a determination of binding of the test compound (ligand, binding agent, modulator, etc.) to a cancer protein of the invention can be done in a number of ways.
  • the test compound can be labeled, and binding determined directly; e.g., by attaching all or a portion of the cancer protein of the invention to a solid support, adding a labeled candidate compound (e.g., a fluorescent label), washing off excess reagent, and determining whether the label is present on the solid support.
  • a labeled candidate compound e.g., a fluorescent label
  • only one of the components is labeled, e.g., a protein of the invention or ligands labeled.
  • more than one component is labeled with different labels, e.g., I 125 , for the proteins and a fluorophor for the compound.
  • Proximity reagents e.g., quenching or energy transfer reagents are also useful.
  • the binding of the “test compound” is determined by competitive binding assay with a “competitor.”
  • the competitor is a binding moiety that binds to the target molecule (e.g., a cancer protein of the invention). Competitors include compounds such as antibodies, peptides, binding partners, ligands, etc. Under certain circumstances, the competitive binding between the test compound and the competitor displaces the test compound.
  • the test compound is labeled. Either the test compound, the competitor, or both, is added to the protein for a time sufficient to allow binding. Incubations are performed at a temperature that facilitates optimal activity, typically between four and 40° C.
  • Incubation periods are typically optimized, e.g., to facilitate rapid high throughput screening; typically between zero and one hour will be sufficient. Excess reagent is generally removed or washed away. The second component is then added, and the presence or absence of the labeled component is followed, to indicate binding.
  • the competitor is added first, followed by the test compound.
  • Displacement of the competitor is an indication that the test compound is binding to the cancer protein and thus is capable of binding to, and potentially modulating, the activity of the cancer protein.
  • either component can be labeled.
  • the presence of label in the post-test compound wash solution indicates displacement by the test compound.
  • the presence of the label on the support indicates displacement.
  • test compound is added first, with incubation and washing, followed by the competitor.
  • the absence of binding by the competitor indicates that the test compound binds to the cancer protein with higher affinity than the competitor.
  • the presence of the label on the support, coupled with a lack of competitor binding indicates that the test compound binds to and thus potentially modulates the cancer protein of the invention.
  • the competitive binding methods comprise differential screening to identity agents that are capable of modulating the activity of the cancer proteins of the invention.
  • the methods comprise combining a cancer protein and a competitor in a first sample.
  • a second sample comprises a test compound, the cancer protein, and a competitor.
  • the binding of the competitor is determined for both samples, and a change, or difference in binding between the two samples indicates the presence of an agent capable of binding to the cancer protein and potentially modulating its activity. That is, if the binding of the competitor is different in the second sample relative to the first sample, the agent is capable of binding to the cancer protein.
  • differential screening is used to identify drug candidates that bind to the native cancer protein, but cannot bind to modified cancer proteins.
  • the structure of the cancer protein is modeled and used in rational drug design to synthesize agents that interact with that site, agents which generally do not bind to site-modified proteins.
  • drug candidates that affect the activity of a native cancer protein are also identified by screening drugs for the ability to either enhance or reduce the activity of such proteins.
  • Positive controls and negative controls can be used in the assays.
  • control and test samples are performed in at least triplicate to obtain statistically significant results. Incubation of all samples occurs for a time sufficient to allow for the binding of the agent to the protein. Following incubation, samples are washed free of non-specifically bound material and the amount of bound, generally labeled agent determined. For example, where a radiolabel is employed, the samples can be counted in a scintillation counter to determine the amount of bound compound.
  • a variety of other reagents can be included in the screening assays. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc. which are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., can be used. The mixture of components is added in an order that provides for the requisite binding.
  • Polynucleotide modulators of cancer can be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand-binding molecule, as described in WO 91/04753.
  • Suitable ligand-binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors.
  • conjugation of the ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the cell.
  • a polynucleotide modulator of cancer can be introduced into a cell containing the target nucleic acid sequence, e.g., by formation of a polynucleotide-lipid complex, as described in WO 90/10448. It is understood that the use of antisense molecules or knock out and knock in models may also be used in screening assays as discussed above, in addition to methods of treatment.
  • the activity of a cancer-associated protein is down-regulated, or entirely inhibited, by the use of antisense polynucleotide or inhibitory small nuclear RNA (snRNA), i.e., a nucleic acid complementary to, and which can preferably hybridize specifically to, a coding mRNA nucleic acid sequence, e.g., a cancer protein of the invention, mRNA, or a subsequence thereof. Binding of the antisense polynucleotide to the mRNA reduces the translation and/or stability of the mRNA.
  • snRNA inhibitory small nuclear RNA
  • antisense polynucleotides can comprise naturally occurring nucleotides, or synthetic species formed from naturally occurring subunits or their close homologs. Antisense polynucleotides may also have altered sugar moieties or inter-sugar linkages. Exemplary among these are the phosphorothioate and other sulfur containing species which are known for use in the art. Analogs are comprised by this invention so long as they function effectively to hybridize with nucleotides of the invention. See, e.g., Isis Pharmaceuticals, Carlsbad, Calif.; Sequitor, Inc., Natick, Mass.
  • antisense polynucleotides can readily be synthesized using recombinant means, or can be synthesized in vitro. Equipment for such synthesis is sold by several vendors, including Applied Biosystems. The preparation of other oligonucleotides such as phosphorothioates and alkylated derivatives is also well known to those of skill in the art.
  • Antisense molecules as used herein include antiserse or sense oligonucleotides.
  • Sense oligonucleotides can, e.g., be employed to block transcription by binding to the anti-sense strand.
  • the antisense and sense oligonucleotide comprise a single stranded nucleic acid sequence (either RNA or DNA) capable of binding to target mRNA (sense) or DNA (antisense) sequences for cancer molecules.
  • Antisense or sense oligonucleotides, according to the present invention comprise a fragment generally at least about 12 nucleotides, preferably from about 12 to 30 nucleotides.
  • ribozymes can be used to target and inhibit transcription of cancer-associated nucleotide sequences.
  • a ribozyme is an RNA molecule that catalytically cleaves other RNA molecules.
  • Different kinds of ribozymes have been described, including group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P, and axhead ribozymes (see, e.g., Castanollo et al., Adv. in Pharmacology 25: 289-317 (1994) for a general review of the properties of different ribozymes).
  • hairpin ribozymes are described, e.g., in Hampel et al., Nucl. Acids Res. 18:299-304 (1990); European Patent Publication No. 0360257; U.S. Pat. No. 5,254,678.
  • Methods of preparing are well known to those of skill in the art (see, e.g., WO 94/26877; Ojwang et al., Proc. Natl. Acad. Sci. USA 90:6340-6344 (1993); Yamada et al., Human Gene Therapy 1:3945 (1994); Leavitt et al., Proc. Natl. Acad Sci. USA 92:699-703 (1995); Leavitt et al., Human Gene Therapy 5: 1151-120 (1994), and Yamada et al., Virology 205:121-126 (1994)).
  • a test compound is administered to a population of cancer cells, which have an associated cancer expression profile.
  • administration or “contacting” herein is meant that the modulator is added to the cells in such a manner as to allow the modulator to act upon the cell, whether by uptake and intracellular action, or by action at the cell surface.
  • a nucleic acid encoding a proteinaceous agent i.e., a peptide
  • a viral construct such as an adenoviral or retroviral construct
  • expression of the peptide agent is accomplished, e.g., PCT US97/01019.
  • Regulatable gene therapy systems can also be used.
  • the cells are washed if desired and are allowed to incubate under preferably physiological conditions for some period.
  • the cells are then harvested and a new gene expression profile is generated.
  • cancer tissue is screened for agents that modulate, e.g., induce or suppress, the cancer phenotype.
  • a change in at least one gene, preferably many, of the expression profile indicates that the agent has an effect on cancer activity.
  • altering a biological function or a signaling pathway is indicative of modulator activity.
  • screens are done to assess genes or gene products. That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of either the expression of the gene or the gene product itself is performed.
  • Measurements of cancer polypeptide activity, or of the cancer phenotype are performed using a variety of assays. For example, the effects of modulators upon the function of a cancer polypeptide(s) are measured by examining parameters described above. A physiological change that affects activity is used to assess the influence of a test compound on the polypeptides of this invention.
  • a variety of effects can be assesses such as, in the case of a cancer associated with solid tumors, tumor growth, tumor metastasis, neovascularization, hormone release, transcriptional changes to both known and uncharacterized genetic markers (e.g., by Northern blots), changes in cell metabolism such as cell growth or pH changes, and changes in intracellular second messengers such as cGNIP.
  • the invention provides methods for identifying cells containing variant cancer genes, e.g., determining the presence of, all or part, the sequence of at least one endogenous cancer gene in a cell. This is accomplished using any number of sequencing techniques.
  • the invention comprises methods of identifying the cancer genotype of an individual, e.g., determining all or part of the sequence of at least one gene of the invention in the individual. This is generally done in at least one tissue of the individual, e.g., a tissue set forth in Table I, and may include the evaluation of a number of tissues or different samples of the same tissue.
  • the method may include comparing the sequence of the sequenced gene to a known cancer gene, i.e., a wild-type gene to determine the presence of family members, homologies, mutations or variants.
  • the sequence of all or part of the gene can then be compared to the sequence of a known cancer gene to determine if any differences exist. This is done using any number of known homology programs, such as BLAST, Bestfit, etc.
  • the presence of a difference in the sequence between the cancer gene of the patient and the known cancer gene correlates with a disease state or a propensity for a disease state, as outlined herein.
  • the cancer genes are used as probes to determine the number of copies of the cancer gene in the genome.
  • the cancer genes are used as probes to determine the chromosomal localization of the cancer genes.
  • Information such as chromosomal localization finds use in providing a diagnosis or prognosis in particular when chromosomal abnormalities such as translocations, and the like are identified in the cancer gene locus.
  • kits are also within the scope of the invention.
  • Such kits can comprise a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in the method.
  • the container(s) can comprise a probe that is or can be detectably labeled.
  • probe can be an antibody or polynucleotide specific for a FIG. 2-related protein or a FIG. 2 gene or message, respectively.
  • the kit can also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and/or a container comprising a reporter-means such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
  • a reporter-means such as a biotin-binding protein, such as avidin or streptavidin
  • the kit can include all or part of the amino acid sequences in FIG. 2 or FIG. 3 or analogs thereof, or a nucleic acid molecules that encodes such amino acid sequences.
  • the kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes; carrier, package, container, vial and/or tube labels listing contents and/or instructions for use, and package inserts with instructions for use.
  • a label can be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, such as a diagnostic or laboratory application, and can also indicate directions for either in vivo or in vitro use, such as those described herein. Directions and or other information can also be included on an insert(s) or label(s) which is included with or on the kit.
  • an article(s) of manufacture containing compositions such as amino acid sequence(s), small molecule(s), nucleic acid sequence(s), and/or antibody(s), e.g., materials useful for the diagnosis, prognosis, prophylaxis and/or treatment of neoplasias of tissues such as those set forth in Table I is provided.
  • the article of manufacture typically comprises at least one container and at least one label. Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers can be formed from a variety of materials such as glass or plastic.
  • the container can hold amino acid sequence(s), small molecule(s), nucleic acid sequence(s), and/or antibody(s), in one embodiment the container holds a polynucleotide for use in examining the mRNA expression profile of a cell, together with reagents used for this purpose.
  • the container can alternatively hold a composition which is effective for treating, diagnosis, prognosing or prophylaxing a condition and can have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • the active agents in the composition can be an antibody capable of specifically binding 251P5G2 and modulating the function of 251P5G2.
  • the label can be on or associated with the container.
  • a label a can be on a container when letters, numbers or other characters forming the label are molded or etched into the container itself; a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
  • the label can indicate that the composition is used for diagnosing, treating, prophylaxing or prognosing a condition, such as a neoplasia of a tissue set forth in Table I.
  • the article of manufacture can further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and/ordextrose solution. It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, stirrers, needles, syringes, and/or package inserts with indications and/or instructions for use.
  • SSH Suppression Subtractive Hybridization
  • NDRI Philadelphia, Pa.
  • mRNA for some normal tissues were purchased from Clontech, Palo Alto, Calif.
  • Tissues were homogenized in Trizol reagent (Life Technologies, Gibco BRL) using 10 ml/g tissue isolate total RNA. Poly A RNA was purified from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total and mRNA were quantified by spectrophotometric analysis (O.D. 260/280 nm) and analyzed by gel electrophoresis.
  • DPNCDN cDNA synthesis primer
  • Adaptor 1 5′CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAG3′ (SEQ ID NO: 42) 3′GGCCCGTCCTAG5′ (SEQ ID NO: 43)
  • Adaptor 2 5′GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAG3′ (SEQ ID NO: 44) 3′CGGCTC CTAG 5′ (SEQ ID NO: 45)
  • PCR primer 1 5′CTAATACGACTCACTATAGGGC3′ (SEQ ID NO: 46)
  • Nested primer (NP)1 5′TCGAGCGGCCGCCCGGGCAG GA 3′ (SEQ ID NO: 47)
  • Nested primer (NP)2 5′AGCGTGGTCGCGCGCGCGAG GA 3′ (SEQ ID NO: 48)
  • SSH Suppression Subtractive Hybridization
  • the gene 251P5G2 sequence was derived from a prostate cancer metastasis minus normal tissue cDNA subtraction.
  • the SSH DNA sequence (FIG. 1) was identified.
  • the cDNA derived from of pool of normal tissues was used as the source of the “driver” cDNA, while the cDNA from prostate cancer metastasis was used as the source of the “tester” cDNA.
  • Double stranded cDNAs corresponding to tester and driver cDNAs were synthesized from 2 ⁇ g of poly(A) + RNA isolated from the relevant xenograft tissue, as described above, using CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of oligonucleotide DPNCDN as primer. First- and second-strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1, Catalog No. K1804-1). The resulting cDNA was digested with Dpn II for 3 hrs at37° C. Digested cDNA was extracted with phenol/chloroform (1:1) and ethanol precipitated.
  • Driver cDNA was generated by combining in a 1:1 ratio Dpn II digested cDNA from the relevant tissue source (see above) with a mix of digested cDNAs derived from the nine normal tissues: stomach, skeletal muscle, lung, brain, liver, kidney, pancreas, small intestine, and heart.
  • Tester cDNA was generated by diluting 1 ⁇ l of Dpn II digested cDNA from the relevant tissue source (see above) (400 ng) in 5 ⁇ l of water. The diluted cDNA (2 ⁇ l, 160 ng) was then ligated to 2 ⁇ l of Adaptor 1 and Adaptor 2 (10 ⁇ M), in separate ligation reactions, in a total volume of 10 ⁇ l at 160° C. overnight, using 400 u of T4 DNA ligase (CLONTECH). Ligation was terminated with 1 ⁇ l of 0.2 M EDTA and heating at 72° C. for 5 min.
  • the first hybridization was performed by adding 1.5 ⁇ l (600 ng) of driver cDNA to each of two tubes containing 1.5 ⁇ l (20 ng) Adaptor 1- and Adaptor 2-ligated tester cDNA. In a final volume of 4 ⁇ l, the samples were overlaid with mineral oil, denatured in an MJ Research thermal cycler at 98° C. for 1.5 minutes, and then were allowed to hybridize for 8 hrs at 68° C. The two hybridizations were then mixed together with an additional 1 ⁇ l of fresh denatured driver cDNA and were allowed to hybridize overnight at 68° C. The second hybridization was then diluted in 200 ⁇ l of 20 mM Hepes, pH 8.3, 50 mM NaCl, 0.2 mM EDTA, heated at 70° C. for 7 min. and stored at ⁇ 20° C.
  • PCR 1 was conducted using the following conditions: 75° C. for 5 min., 94° C. for 25 sec., then 27 cycles of 94° C. for 10 sec, 66° C. for 30 sec, 72° C. for 1.5 min.
  • PCR 2 was performed using 10-12 cycles of 94° C. for 10 sec, 68° C. for 30 sec, and 72° C. for 1.5 minutes. The PCR products were analyzed using 2% agarose gel electrophoresis.
  • PCR products were inserted into pCR2.1 using the T/A vector cloning kit (Invitrogen). Transformed E. coli were subjected to blue/white and ampicillin selection. White colonies were picked and arrayed into 96 well plates and were grown in liquid culture overnight. To identify inserts, PCR amplification was performed on 1 ul of bacterial culture using the conditions of PCR1 and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis.
  • Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid DNA was prepared, sequenced, and subjected to nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP databases.
  • First strand cDNAs can be generated from 1 ⁇ g of mRNA with oligo (dT)12-18 priming using the Gibco-BRL Superscript Preamplification system. The manufacturer's protocol was used which included an incubation for 50 min at 42° C. with reverse transcriptase followed by RNAse H treatment at 37° C. for 20 min. After completing the reaction, the volume can be increased to 200 ⁇ l with water prior to normalization. First strand cDNAs from 16 different normal human tissues can be obtained from Clontech.
  • First strand cDNA (5 ⁇ l) were amplified in a total volume of 50 ⁇ l containing 0.4 ⁇ M primers, 0.2 ⁇ M each dNTPs, 1XPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgCl 2 , 50 mM KCl, pH8.3) and 1X Klentaq DNA polymerase (Clontech).
  • Five ⁇ l of the PCR reaction can be removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis.
  • PCR was performed using an MJ Research thermal cycler under the following conditions: Initial denaturation can be at 94° C. for 15 sec, followed by a 18, 20, and 22 cycles of 94° C. for 15, 65° C.
  • FIG. 14 A typical RT-PCR expression analysis is shown in FIG. 14.
  • First strand cDNA was prepared from vital pool 1 (liver, lung and kidney), vital pool 2 (pancreas, colon and stomach), prostate cancer metastasis to lymph node, prostate cancer pool, bladder cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin and GAPDH. Semiquantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification. Results show strong expression of 251P5G2 in prostate cancer metastasis, prostate cancer pool, and cancer metastasis pool. Expression of 251P5G2 was also detected in bladder cancer pool, but not in vital pool 1 and vital pool 2.
  • the 251P5G2 SSH cDNA sequence was derived from a substraction consisting of prostate cancer metastasis to lymph node minus a mixture of 9 normal tissues: stomach, skeletal muscle, lung, brain, liver, kidney, pancreas, small intestine and heart.
  • the SSH cDNA sequence (FIG. 1) was designated 251P5G2.
  • the 251P5G2 SSH DNA sequence of 162 bp (FIG. 1) was novel and did not show homology to any known gene.
  • 251P5G2 v.1 (clone 4.7) of 2157 bp was cloned from prostate cancer cDNA library, revealing an ORF of 255 amino acids (FIG. 2 and FIG. 3).
  • Other variants of 251P5G2 were also identified and these are listed in FIGS. 2 and 3.
  • 251P5G2 v.1, v.2, v.3, and v.4 proteins are 255 amino acids in length and differ from each other by one amino acid as shown in FIG. 11.
  • 251P5G2 v.5, v.6, v.7, v.8, v.9, and v.10 code for the same protein as 251P5G2 v.1.
  • 251P5G2 v.12 codes for a protein of 1266 amino acids in length.
  • 251P5G2 v.13 codes for the same protein as 251P5G2 v.12.
  • 251P5G2 v.1 and variants v.2 through v.11 are novel, and did not show significant homology to known human genes.
  • the 251P5G2 v.1 protein showed homology to the mouse vomeronasal 1 receptor C3, 44% identity and 60% homology over 234 amino acids (FIG. 4A).
  • 251P5G2 v.12 protein aligns with the protein XM — 063686 at 100% identity over 1213 amino acids, ranging from position 54 to 1266 of 251P5G2 v.12 protein (FIG. 4B).
  • XM — 063686 protein is a hypothetical protein predicted by automated computational analysis using GenomeScan.
  • Chromosomal localization can implicate genes in disease pathogenesis.
  • chromosome mapping approaches include fluorescent in situ hybridization (FISH), human/hamster radiation hybrid (RH) panels (Walter et al., 1994; Nature Genetics 7:22; Research Genetics, Huntsville Ala.), human-rodent somatic cell hybrid panels such as is available from the Cornell Institute (Camden, N.J.), and genomic viewers utilizing BLAST homologies to sequenced and mapped genomic clones (NCBI, Bethesda, Md.).
  • Expression analysis by RT-PCR demonstrated that 251P5G2 is strongly expressed in prostate cancer patient specimens (FIG. 14).
  • First strand cDNA was prepared from vital pool 1 (liver, lung and kidney), vital pool 2 (pancreas, colon and stomach), prostate cancer metastasis to lymph node, prostate cancer pool, bladder cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification. Results show strong expression of 251P5G2 in prostate cancer metastasis, prostate cancer pool, and cancer metastasis pool. Expression of 251P5G2 was also detected in bladder cancer pool, but not in vital pool 1 and vital pool 2.
  • Northern blot analysis of 251P5G2 is a technique known to those skilled in the art to detect 251P5G2 protein production.
  • Northern blotting detects relative levels of mRNA expressed from a 251P5G2 gene. Specific mRNA is measured using a nucleic acid hybridization technique and the signal is detected on an autoradiogram. The stronger the signal, the more abundant is the mRNA.
  • 251P5G2 genes that produce mRNA that contains an open reading frame flanked by a good Kozak translation initiation site and a stop codon in the vast majority of cases the synthesized mRNA is expressed as a protein.
  • the level of expression of the 251P5G2 gene is determined in various normal tissues and in various tumor tissues and tumor cell lines using the technique of Northern blotting, which detects production of messenger RNA. It is well known in the art that the production of messenger RNA, that encodes the protein, is a necessary step in the production of the protein itself. Thus, detection of high levels of messenger RNA by, for example, Northern blot, is a way of determining that the protein itself is produced.
  • the Northern blot technique is used as a routine procedure because it does not require the time delays (as compared to Western blotting, immunoblotting or immunohistochemistry) involved in isolating or synthesizing the protein, preparing an immunological composition of the protein, eliciting a humoral immune response, harvesting the antibodies, and verifying the specificity thereof.
  • NB normal bladder
  • NK normal kidney
  • NL normal lung
  • NBr normal breast
  • NO normal pancreas
  • NPa normal pancreas
  • FIG. 18 shows expression of 251 p5g2 in human normal and cancer tissues.
  • First strand cDNA was prepared from a panel of 13 normal tissues, prostate cancer pool, bladder cancer pool, kidney cancer pool, colon cancer pool, lung cancer pool, ovary cancer pool, breast cancer pool, pancreas cancer pool, 2 different prostate cancer metastasis specimens to lymph node, and a pool of prostate cancer LAPC xenografts (LAPC-4AD, LAPC-4AI, LAPC-9AD, and LAPC-9AI). Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification.
  • a standard curve was generated using plasmid DNA containing 251P5G2 of known copy number. The experiment was performed in duplicate. Results show strong expression of 251P5G2 in prostate cancer metastasis, prostate cancer pool, and cancer metastasis pool. Expression of 251P5G2 was also detected in bladder cancer pool. Amongst normal tissues, very weak expression was detected in hear, prostate, skeletal muscle and testis but not in any other normal tissue tested.
  • FIG. 19 shows expression of 251P5G2 in prostate cancer patient specimens.
  • First strand cDNA was prepared from normal prostate, prostate cancer cell lines (PC3, DU145, LNCaP, 293T), and a panel of prostate cancer patient specimens. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification. Results show expression of 251P5G2 in 10 out of 19 patient specimens. Very strong expression was detected in 5 out of the 10 expressing tumors. Expression was also detected in LNCaP but not in the other cell lines tested nor in normal prostate.
  • FIG. 20 Expression of 251P5G2 in bladdercancer patient specimens is shown in FIG. 20.
  • First strand cDNA was prepared from normal bladder, bladder cancer cell lines (UM-UC-3, TCCSUP, J82), and a panel of bladder cancer patient specimens. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 251P5G2, was performed at 26 and 30 cycles of amplification. Results show expression of 251P5G2 in 5 out of 9 patient specimens, but not in the cell lines tested nor in normal bladder.
  • 251P5G2 is a potential therapeutic target and a diagnostic marker for human cancers.
  • Transcript variants are variants of mature mRNA from the same gene which arise by alternative transcription or alternative splicing.
  • Alternative transcripts are transcripts from the same gene but start transcription at different points.
  • Splice variants are mRNA variants spliced differently from the same transcript.
  • a given gene can have zero to many alternative transcripts and each transcript can have zero to many splice variants.
  • Each transcript variant has a unique exon makeup, and can have different coding and/or non-coding (5′ or 3′ end) portions, from the original transcript.
  • Transcript variants can code for similar or different proteins with the same or a similar function or can encode proteins with different functions, and can be expressed in the same tissue at the same time, or in different tissues at the same time, or in the same tissue at different times, or in different tissues at different times. Proteins encoded by transcript variants can have similar or different cellular or extracellular localizations, e.g., secreted versus intracellular.
  • Transcript variants are identified by a variety of art-accepted methods. For example, alternative transcripts and splice variants are identified by full-length cloning experiment, or by use of full-length transcript and EST sequences. First, all human ESTs were grouped into clusters which show direct or indirect identity with each other. Second, ESTs in the same cluster were further grouped into sub-clusters and assembled into a consensus sequence. The original gene sequence is compared to the consensus sequence(s) or other full-length sequences. Each consensus sequence is a potential splice variant for that gene. Even when a variant is identified that is not a full-length clone, that portion of the variant is very useful for antigen generation and for further cloning of the full-length splice variant, using techniques known in the art.
  • Genomic-based transcript variant identification programs include FgenesH (A. Salamov and V. Solovyev, “Ab initio gene finding in Drosophila genomic DNA,” Genome Research. 2000 April; 10(4):516-22); Grail (URL compbio.ornl.gov/Grail-bin/EmptyGrailForm) and Gen Scan (URL genes.mit.edu/GENSCAN.html).
  • FgenesH A. Salamov and V. Solovyev, “Ab initio gene finding in Drosophila genomic DNA,” Genome Research. 2000 April; 10(4):516-22
  • Grail URL compbio.ornl.gov/Grail-bin/EmptyGrailForm
  • Gen Scan URL genes.mit.edu/GENSCAN.html.
  • splice variant identification protocols see., e.g., Southan, C., A genomic perspective on human proteases, FEBS Lett. Jun. 8, 2001; 498(2-3):214-8; de Souza, S.
  • PCR-based Validation Wellmann S, et al., Specific reverse transcription-PCR quantification of vascular endothelial growth factor (VEGF) splice variants by LightCycler technology, Clin Chem. 2001 April; 47(4):654-60; Jia, H. P., et al., Discovery of new human beta-defensins using a genomics-based approach, Gene. Jan. 24, 2001; 263(1-2):211-8.
  • PCR-based and 5′ RACE Validation Brigle, K. E., et al., Organization of the murine reduced folate carrier gene and identification of variant splice forms, Biochem Biophys Acta. Aug. 7, 1997; 1353(2): 191-8).
  • genomic regions are modulated in cancers.
  • the alternative transcripts or splice variants of the gene are modulated as well.
  • 251P5G2 has a particular expression profile related to cancer.
  • Alternative transcripts and splice variants of 251P5G2 may also be involved in cancers in the same or different tissues, thus serving as tumor-associated markers/antigens.
  • the exon composition of the original transcript designated as 251P5G2 v.1, is shown in Table LI.
  • two transcript variants were identified, designated as 251P5G2 v.12 and v.13.
  • transcript variant 251P5G2 v.12 has spliced out two fragments from variant 251P5G2 v.1, as shown in FIG. 12.
  • each different combination of exons in spatial order e.g. exons 2 and 3
  • FIG. 12 shows the schematic alignment of exons of the two transcript variants.
  • Tables LII (a) and (b) through LV (a) and (b) are set forth on a variant by variant basis.
  • LII (a) and (b) shows nucleotide sequence of the transcript variant.
  • Table LIII (a) and (b) shows the alignment of the transcript variant with nucleic acid sequence of 251P5G2 v.1.
  • Table LIV (a) and (b) lays out amino acid translation of the transcript variant for the identified reading frame orientation.
  • Table LV (a) and (b) displays alignments of the amino acid sequence encoded by the splice variant with that of 251P5G2 v.1.
  • a Single Nucleotide Polymorphism is a single base pair variation in a nucleotide sequence at a specific location.
  • SNP Single Nucleotide Polymorphism
  • A/T the specific base pair sequence of one or more locations in the genome of an individual.
  • Haplotype refers to the base pair sequence of more than one location on the same DNA molecule (or the same chromosome in higher organisms), often in the context of one gene or in the context of several tightly linked genes.
  • SNPs that occur on a cDNA are called cSNPs.
  • cSNPs may change amino acids of the protein encoded by the gene and thus change the functions of the protein.
  • Some SNPs cause inherited diseases; others contribute to quantitative variations in phenotype and reactions to environmental factors including diet and drugs among individuals. Therefore, SNPs and/or combinations of alleles (called haplotypes) have many applications, including diagnosis of inherited diseases, determination of drug reactions and dosage, identification of genes responsible for diseases, and analysis of the genetic relationship between individuals (P. Nowotny, J. M. Kwon and A. M. Goate, “SNP analysis to dissect human traits,” Curr. Opin. Neurobiol. 2001 October; 11(5):637-641; M. Pirmohamed and B. K.
  • SNPs are identified by a variety of art-accepted methods (P. Bean, “The promising voyage of SNP target discovery,” Am. Clin. Lab. 2001 October-November; 20(9):18-20; K. M. Weiss, “In search of human variation,” Genome Res. 1998 July; 8(7):691-697; M. M. She, “Enabling large-scale pharmacogenetic studies by high-throughput mutation detection and genotyping technologies,” Clin. Chem. 2001 February; 47(2):164-172).
  • SNPs are identified by sequencing DNA fragments that show polymorphism by gel-based methods such as restriction fragment length polymorphism (RFLP) and denaturing gradient gel electrophoresis (DGGE).
  • RFLP restriction fragment length polymorphism
  • DGGE denaturing gradient gel electrophoresis
  • SNPs can also be discovered by direct sequencing of DNA samples pooled from different individuals or by comparing sequences from different DNA samples. With the rapid accumulation of sequence data in public and private databases, one can discover SNPs by comparing sequences using computer programs (Z. Gu, L. Hillier and P. Y. Kwok, “Single nucleotide polymorphism hunting in cyberspace,” Hum. Mutat. 1998; 12(4):221-225). SNPs can be verified and genotype or haplotype of an individual can be determined by a variety of methods including direct sequencing and high throughput microarrays (P. Y. Kwok, “Methods for genotyping single nucleotide polymorphisms,” Annu. Rev. Genomics Hum. Genet.
  • FIG. 10 shows the schematic alignment of the SNP variants.
  • FIG. 11 shows the schematic alignment of protein variants, corresponding to nucleotide variants. Nucleotide variants that code for the same amino acid sequence as variant 1 are not shown in FIG. 11. These alleles of the SNPS, though shown separately here, can occur in different combinations (haplotypes) and in any one of the transcript variants (such as 251P5G2 v.12) that contains the sequence context of the SNPs.
  • 251P5G2 and 251P5G2 variants are cloned into any one of a variety of expression vectors known in the art.
  • One or more of the following regions of 251P5G2 variants are expressed: the full length sequence presented in FIGS. 2 and 3, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 251P5G2, variants, or analogs thereof.
  • pCRII To generate 251P5G2 sense and anti-sense RNA probes for RNA in situ investigations, pCRII constructs (Invitrogen, Carlsbad Calif.) are generated encoding either all or fragments of the 251P5G2 cDNA.
  • the PCRII vector has Sp6 and T7 promoters flanking the insert to drive the transcription of 251P5G2 RNA for use as probes in RNA in situ hybridization experiments. These probes are used to analyze the cell and tissue expression of 251P5G2 at the RNA level.
  • Transcribed 251P5G2 RNA representing the cDNA amino acid coding region of the 251P5G2 gene is used in in vitro translation systems such as the TnTTM Coupled Reticulolysate System (Promega, Corp., Madison, Wis.) to synthesize 251P5G2 protein.
  • TnTTM Coupled Reticulolysate System Promega, Corp., Madison, Wis.
  • pGEX Constructs To generate recombinant 251P5G2 proteins in bacteria that are fused to the Glutathione S-transferase (GST) protein, all or parts of the 251P5G2 cDNA protein coding sequence are cloned into the pGEX family of GST-fusion vectors (Amersham Pharmacia Biotech, Piscataway, N.J.). These constructs allow controlled expression of recombinant 251P5G2 protein sequences with GST fused at the amino-terminus and a six histidine epitope (6X His) at the carboxyl-terminus.
  • GST Glutathione S-transferase
  • the GST and 6X His tags permit purification of the recombinant fusion protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-GST and anti-His antibodies.
  • the 6X His tag is generated by adding 6 histidine codons to the cloning primer at the 3′ end, e.g., of the open reading frame (ORF).
  • a proteolytic cleavage site such as the PreScissionTM recognition site in pGEX-6P-1, may be employed such that it permits cleavage of the GST tag from 251P5G2-related protein.
  • the ampicillin resistance gene and pBR322 origin permits selection and maintenance of the pGEX plasmids in E. coli.
  • pMAL Constructs To generate, in bacteria, recombinant 251P5G2 proteins that are fused to maltose-binding protein (MBP), all or parts of the 251P5G2 cDNA protein coding sequence are fused to the MBP gene by cloning into the, pMAL-c2X and pMAL-p2X vectors (New England Biolabs, Beverly, Mass.). These constructs allow controlled expression of recombinant 251P5G2 protein sequences with MBP fused at the amino-terminus and a 6X His epitope tag at the carboxyl-terminus.
  • MBP maltose-binding protein
  • the MBP and 6X His tags permit purification of the recombinant protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-MBP and anti-His antibodies.
  • the 6X His epitope tag is generated by adding 6 histidine codons to the 3′ cloning primer.
  • a Factor Xa recognition site permits cleavage of the pMAL tag from 251P5G2.
  • the pMAL-c2X and pMAL-p2X vectors are optimized to express the recombinant protein in the cytoplasm or periplasm respectively. Periplasm expression enhances folding of proteins with disulfide bonds.
  • pET Constructs To express 251P5G2 in bacterial cells, all or parts of the 251P5G2 cDNA protein coding sequence are cloned into the pET family of vectors (Novagen, Madison, Wis.). These vectors allow tightly controlled expression of recombinant 251P5G2 protein in bacteria with and without fusion to proteins that enhance solubility, such as NusA and thioredoxin (Trx), and epitope tags, such as 6X His and S-TagTM that aid purification and detection of the recombinant protein. For example, constructs are made utilizing pET NusA fusion system 43.1 such that regions of the 251P5G2 protein are expressed as amino-terminal fusions to NusA.
  • pESC Constructs To express 251P5G2 in the yeast species Saccharomyces cerevisiae for generation of recombinant protein and functional studies, all or parts of the 251P5G2 cDNA protein coding sequence are cloned into the pESC family of vectors each of which contain 1 of 4 selectable markers, HIS3, TRP1, LEU2, and URA3 (Stratagene, La Jolla, Calif.). These vectors allow controlled expression from the same plasmid of up to 2 different genes or cloned sequences containing either FlagTM or Myc epitope tags in the same yeast cell. This system is useful to confirm protein-protein interactions of 251P5G2. In addition, expression in yeast yields similar post-translational modifications, such as glycosylations and phosphorylations that are found when expressed in eukaryotic cells.
  • PESP Constructs To express 251P5G2 in the yeast species Saccharomyces pombe, all or parts of the 251P5G2 cDNA protein coding sequence are cloned into the pESP family of vectors. These vectors allow controlled high level of expression of a 251P5G2 protein sequence that is fused at either the amino terminus or at the carboxyl terminus to GST which aids purification of the recombinant protein. A FlagTM epitope tag allows detection of the recombinant protein with anti-FlagTM antibody.
  • the full or partial length 251P5G2 cDNA sequences can be cloned into any one of a variety of expression vectors known in the art.
  • one or more of the following regions of 251P5G2 are expressed in these constructs, amino acids 1 to 255, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 251P5G2 v.1 through v.11; amino acids 1 to 1266, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 251P5G2 v.12 and v.13, variants, or analogs thereof.
  • constructs can be transfected into any one of a wide variety of mammalian cells such as 293T cells.
  • Transfected 293T cell lysates can be probed with the anti-251P5G2 polyclonal serum, described herein.
  • pcDNA4/HisMax Constructs To express 251P5G2 in mammalian cells, a 251P5G2 ORF, or portions thereof, of 251P5G2 are cloned into pcDNA41HisMax Version A (Invitrogen, Carlsbad, Calif.). Protein expression is driven from the cytomegalovirus (CMV) promoter and the SP16 translational enhancer. The recombinant protein has XpressTM and six histidine (6X His) epitopes fused to the amino-terminus.
  • CMV cytomegalovirus
  • 6X His six histidine
  • the pcDNA4/HisMax vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Zeocin resistance gene allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in E. coli.
  • pcDNA3.1/MycHis Constructs To express 251P5G2 in mammalian cells, a 251P5G2 ORF, or portions thereof, of 251P5G2 with a consensus Kozak translation initiation site was cloned into pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad, Calif.). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the myc epitope and 6X His epitope fused to the carboxyl-terminus.
  • CMV cytomegalovirus
  • the pcDNA3.1/MycHis vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability, along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomycin resistance gene can be used, as it allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in E. coli.
  • pcDNA3.1/CT-GFP-TOPO Construct To express 251P5G2 in mammalian cells and to allow detection of the recombinant proteins using fluorescence, a 251P5G2 ORF, or portions thereof, with a consensus Kozak translation initiation site are cloned into pcDNA3.1/CT-GFP-TOPO (Invitrogen, Calif.). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the Green Fluorescent Protein (GFP) fused to the carboxyl-terminus facilitating non-invasive, in vivo detection and cell biology studies.
  • CMV cytomegalovirus
  • the pcDNA3.1CT-GFP-TOPO vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomycin resistance gene allows for selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in E. coli. Additional constructs with an amino-terminal GFP fusion are made in pcDNA3.1/NT-GFP-TOPO spanning the entire length of a 251P5G2 protein.
  • PAPtag A 251P5G2 ORF, or portions thereof, is cloned into pAPtag-5 (GenHunter Corp. Nashville, Tenn.). This construct generates an alkaline phosphatase fusion at the carboxyl-terminus of a 251P5G2 protein while fusing the IgG ⁇ signal sequence to the amino-terminus. Constructs are also generated in which alkaline phosphatase with an amino-terminal IgG ⁇ signal sequence is fused to the amino-terminus of a 251P5G2 protein.
  • the resulting recombinant 251P5G2 proteins are optimized for secretion into the media of transfected mammalian cells and can be used to identify proteins such as ligands or receptors that interact with 251P5G2 proteins.
  • Protein expression is driven from the CMV promoter and the recombinant proteins also contain myc and 6X His epitopes fused at the carboxyl-terminus that facilitates detection and purification.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the recombinant protein and the ampicillin resistance gene permits selection of the plasmid in E. coli.
  • pTag5 A 251P5G2 ORF, or portions thereof, is cloned into pTag-5.
  • This vector is similar to pAPtag but without the alkaline phosphatase fusion.
  • This construct generates 251P5G2 protein with an amino-terminal IgGK signal sequence and myc and 6X His epitope tags at the carboxyl-terminus that facilitate detection and affinity purification.
  • the resulting recombinant 251P5G2 protein is optimized for secretion into the media of transfected mammalian cells, and is used as immunogen or ligand to identify proteins such as ligands or receptors that interact with the 251P5G2 proteins. Protein expression is driven from the CMV promoter.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the protein, and the ampicillin resistance gene permits selection of the plasmid in E. coli.
  • PsecFc A 251P5G2 ORF, or portions thereof, is also cloned into psecFc.
  • the psecFc vector was assembled by cloning the human immunoglobulin G1 (IgG) Fc (hinge, CH2, CH3 regions) into pSecTag2 (Invitrogen, California). This construct generates an IgG1 Fc fusion at the carboxyl-terminus of the 251P5G2 proteins, while fusing the IgGk signal sequence to N-terminus. 251P5G2 fusions utilizing the murine IgG1 Fc region are also used.
  • IgG human immunoglobulin G1
  • the resulting recombinant 251P5G2 proteins are optimized for secretion into the media of transfected mammalian cells, and can be used as immunogens or to identify proteins such as ligands or receptors that interact with 251P5G2 protein. Protein expression is driven from the CMV promoter.
  • the hygromycin resistance gene present in the vector allows for selection of mammalian cells that express the recombinant protein, and the ampicillin resistance gene permits selection of the plasmid in E. coli.
  • pSR ⁇ Constructs To generate mammalian cell lines that express 251P5G2 constitutively, 251P5G2 ORF, or portions thereof, of 251P5G2 were cloned into pSR ⁇ constructs. Amphotropic and ecotropic retroviruses were generated by transfection of pSR ⁇ constructs into the 293T-10A1 packaging line or co-transfection of pSR ⁇ and a helper plasmid (containing deleted packaging sequences) into the 293 cells, respectively. The retrovirus is used to infect a variety of mammalian cell lines, resulting in the integration of the cloned gene, 251P5G2, into the host cell-lines. Protein expression is driven from a long terminal repeat (LTR).
  • LTR long terminal repeat
  • Neomycin resistance gene present in the vector allows for selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColE1 origin permit selection and maintenance of the plasmid in E coli.
  • the retroviral vectors can thereafter be used for infection and generation of various cell lines using, for example, PC3, NIH 3T3, TsuPr1, 293 or rat-1 cells.
  • Additional pSR ⁇ constructs are made that fuse an epitope tag such as the FLAGTM tag to the carboxyl-terminus of 251P5G2 sequences to allow detection using anti-Flag antibodies.
  • the FLAGTM sequence 5′ gat tac aag gat gac gac gat aag 3′ (SEQ ID NO: 53) is added to cloning primer at the 3′ end of the ORF.
  • Additional pSR ⁇ constructs are made to produce both amino-terminal and carboxyl-terminal GFP and myc/6X His fusion proteins of the full-length 251P5G2 proteins.
  • Additional Viral Vectors Additional constructs are made for viral-mediated delivery and expression of 251P5G2. High virus fiter leading to high level expression of 251P5G2 is achieved in viral delivery systems such as adenoviral vectors and herpes amplicon vectors.
  • a 251P5G2 coding sequences or fragments thereof are amplified by PCR and subcloned into the AdEasy shuttle vector (Stratagene). Recombination and virus packaging are performed according to the manufacturer's instructions to generate adenoviral vectors.
  • 251P5G2 coding sequences or fragments thereof are cloned into the HSV-1 vector (Imgenex) to generate herpes viral vectors.
  • the viral vectors are thereafter used for infection of various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • Regulated Expression Systems To control expression of 251P5G2 in mammalian cells, coding sequences of 251P5G2, or portions thereof, are cloned into regulated mammalian expression systems such as the T-Rex System (Invitrogen), the GeneSwitch System (Invitrogen) and the tightiy-regulated Ecdysone System (Sratagene). These systems allow the study of the temporal and concentration dependent effects of recombinant 251P5G2. These vectors are thereafter used to control expression of 251P5G2 in various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • T-Rex System Invitrogen
  • GeneSwitch System Invitrogen
  • Sratagene the tightiy-regulated Ecdysone System
  • 251P5G2 ORF To generate recombinant 251P5G2 proteins in a baculovirus expression system, 251P5G2 ORF, or portions thereof, are cloned into the baculovirus transfer vector pBlueBac 4.5 (Invitrogen), which provides a His-tag at the N-terminus.
  • pBlueBac-251P5G2 is co-transfected with helper plasmid pBac-N-Blue (Invitrogen) into SF9 ( Spodoptera frugiperda ) insect cells to generate recombinant baculovirus (see Invitrogen instruction manual for details). Baculovirus is then collected from cell supernatant and purified by plaque assay.
  • Recombinant 251P5G2 protein is then generated by infection of HighFive insect cells (Invitrogen) with purified baculovirus.
  • Recombinant 251P5G2 protein can be detected using anti-251P5G2 or anti-His-tag antibody.
  • 251P5G2 protein can be purified and used in various cell-based assays or as immunogen to generate polyclonal and monoclonal antibodies specific for 251P5G2.
  • FIGS. 5 (A & B), FIGS. 6 (A & B), FIGS. 7 (A & B), FIGS. 8 (A & B), and FIGS. 9 (A & B) depict graphically five amino acid profiles of 251P5G2 variants 1 and 12, each assessment available by accessing the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) on the ExPasy molecular biology server.
  • FIG. 5 Hydrophilicity, (Hopp T. P., Woods K. R., 1981. Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828); FIG. 6, Hydropathicity, (Kyte J., Doolittle R. F., 1982. J. Mol. Biol. 157:105-132); FIG. 7, Percentage Accessible Residues (Janin J., 1979 Nature 277:491-492); FIG. 8, Average Flexibility, (Bhaskaran R., and Ponnuswamy P. K., 1988. Int. J. Pept. Protein Res. 32:242-255); FIG. 9, Beta-turn (Deleage, G., Roux B.
  • Hydrophilicity (FIG. 5), Hydropathicity (FIG. 6) and Percentage Accessible Residues (FIG. 7) profiles were used to determine stretches of hydrophilic amino acids (i.e., values greater than 0.5 on the Hydrophilicity and Percentage Accessible Residues profile, and values less than 0.5 on the Hydropathicity profile). Such regions are likely to be exposed to the aqueous environment, be present on the surface of the protein, and thus available for immune recognition, such as by antibodies.
  • Average Flexibility (FIG. 8) and Beta-turn (FIG. 9) profiles determine stretches of amino acids (i.e., values greater than 0.5 on the Beta-turn profile and the Average Flexibility profile) that are not constrained in secondary structures such as beta sheets and alpha helices. Such regions are also more likely to be exposed on the protein and thus accessible to immune recognition, such as by antibodies.
  • Antigenic sequences of the 251P5G2 variant proteins indicated, e.g., by the profiles set forth in FIGS. 5 (A & B), FIGS. 6 (A & B), FIGS. 7 (A & B), FIGS. 8 (A & B), and/or FIGS. 9 (A & B) are used to prepare immunogens, either peptides or nucleic acids that encode them, to generate therapeutic and diagnostic anti-251P5G2 antibodies.
  • the immunogen can be any 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more than 50 contiguous amino acids, or the corresponding nucleic acids that encode them, from the 251P5G2 protein variants 1 and 12 listed in FIGS. 2 and 3.
  • peptide immunogens of the invention can comprise, a peptide region of at least 5 amino acids of FIGS. 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in the Hydrophilicity profiles of FIG. 5; a peptide region of at least 5 amino acids of FIGS. 2 and 3 in any whole number increment that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of FIG.
  • Peptide immunogens of the invention can also comprise nucleic acids that encode any of the forgoing.
  • All immunogens of the invention, peptide or nucleic acid can be embodied in human unit dose form, or comprised by a composition that includes a pharmaceutical excipient compatible with human physiology.
  • the analysis indicates that 251P5G2 variant 1 is composed of 40.39% alpha helix, 18.82% extended strand, and 40.78% random coil (FIG. 13A).
  • Variant 12 is composed of 42.28% alpha helix, 8.33% extended strand, and 49.39% random coil (FIG. 13B).
  • Analysis for the potential presence of transmembrane domains in the 251P5G2 variant proteins was carried out using a variety of transmembrane prediction algorithms accessed from the ExPasy molecular biology server located on the World Wide Web at (.expasy.ch/tools/).
  • FIGS. 13C and 13D are the results of analysis of variant 1 depicting the presence and location of 6 transmembrane domains using the TMpred program (FIG. 13C) and 5 transmembrane domains using the TMHMM program (FIG. 13D). Shown graphically in FIGS.
  • 13E and 13F are the results of analysis of variant 12 depicting the presence and location of 6 transmembrane domains using the TMpred program (FIG. 13E) and 3 transmembrane domains using the TMHMM program (FIG. 13F).
  • the results of each program, namely the amino acids encoding the transmembrane domains are summarized in Table VI.
  • Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant.
  • the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • computer algorithms are employed in design of immunogens that, based on amino acid sequence analysis contain characteristics of being antigenic and available for recognition by the immune system of the immunized host (see the Example entitled “Antigenicity Profiles and Secondary Structure”).
  • Such regions would be predicted to be hydrophilic, flexible, in beta-turn conformations, and be exposed on the surface of the protein (see, e.g., FIGS. 5 (A & B), FIGS. 6 (A & B), FIGS. 7 (A & B), FIGS. 8 (A & B), or FIGS. 9 (A & B) for amino acid profiles that indicate such regions of 251P5G2 protein variants).
  • recombinant bacterial fusion proteins or peptdes containing hydrophilic, flexible, beta-turn regions of 251P5G2 protein variants are used as antigens to generate polyconal antibodies in New Zealand White rabbits.
  • such regions include, but are not limited to, amino acids 28-40, amino acids 65-85, and amino acids 200-222.
  • sequence specific for variant 12 such regions include, but are not limited to, amino acids 236-251, amino acids 540-598, amino acids 832-978, and amino acids 1151-1242 It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
  • immunogenic proteins examples include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • KLH keyhole limpet hemocyanin
  • serum albumin serum albumin
  • bovine thyroglobulin bovine thyroglobulin
  • soybean trypsin inhibitor soybean trypsin inhibitor.
  • a peptide encoding amino acids 65-85 of 251P5G2 variant 1 is conjugated to KLH and used to immunize the rabbit.
  • the immunizing agent may include all or portions of the 251P5G2 variant proteins, analogs or fusion proteins thereof.
  • the 251P5G2 variant 1 amino acid sequence can be fused using recombinant DNA techniques to any one of a variety of fusion protein partners that are well known in the art, such as glutathione-S-transferase (GST) and HIS tagged fusion proteins.
  • GST glutathione-S-transferase
  • HIS HIS tagged fusion proteins
  • a GST-fusion protein encoding the whole cDNA of 251P5G2 variant 1, amino acids 1-255 fused to GST is produced and purified and used as immunogen.
  • Other recombinant bacterial fusion proteins that may be employed include maltose binding protein, LacZ, thioredoxin, NusA, or an immunoglobulin constant region (see the section entitled “Production of Recombinant 251P5G2 in Prokaryotic Systems” and Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubul et al. eds., 1995; Linsley, P. S., Brady, W., Umes, M., Grosmaire, L., Damle, N., and Ledbetter, L. (1991) J. Exp. Med. 174, 561-566).
  • mammalian expressed protein antigens are also used. These antigens are expressed from mammalian expression vectors such as the Tag5 and Fc-fusion vectors (see the section entitled “Production of Recombinant 251P5G2 in Eukaryotic Systems”), and retain post-translational modifications such as glycosylations found in native protein.
  • amino acids 60-85 of variant 1, encoding a loop between transmembrane domains is cloned into the TagS mammalian secretion vector.
  • the recombinant protein is purified by metal chelate chromatography from tissue culture supernatants of 293T cells stably expressing the recombinant vector.
  • the purified Tag5 251P5G2 protein is then used as immunogen.
  • adjuvants include, but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
  • CFA complete Freund's adjuvant
  • MPL-TDM adjuvant monophosphoryl Lipid A, synthetic trehalose dicorynomycolate
  • rabbits are initially immunized subcutaneously with up to 200 ⁇ g, typically 100-200 ⁇ g, of fusion protein or peptide conjugated to KLH mixed in complete Freund's adjuvant (CFA). Rabbits are then injected subcutaneously every two weeks with up to 200 ⁇ g, typically 100-200 ⁇ g, of the immunogen in incomplete Freund's adjuvant (IFA). Test bleeds are taken approximately 7-10 days following each immunization and used to monitor the titer of the antiserum by ELISA.
  • CFA complete Freund's adjuvant
  • the full-length 251P5G2 variant 1 cDNA is cloned into pCDNA 3.1 myc-his expression vector (Invitrogen, see the Example entitled “Production of Recombinant 251P5G2 in Eukaryotic Systems”). After transfection of the constructs into 293T cells, cell lysates are probed with the anti-251P5G2 serum and with anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz, Calif.) to determine specific reactivity to denatured 251P5G2 protein using the Western blot technique.
  • the immune serum is tested by fluorescence microscopy, flow cytometry and immunoprecipitation against 293T and other recombinant 251P5G2-expressing cells to determine specific recognition of native protein.
  • Western blot, immunoprecipitation, fluorescent microscopy, and flow cytometric techniques using cells that endogenously express 251P5G2 are also carried out to test reactivity and specificity.
  • Anti-serum from rabbits immunized with 251P5G2 variant fusion proteins are purified by depletion of antibodies reactive to the fusion partner sequence by passage over an affinity column containing the fusion partner either alone or in the context of an irrelevant fusion protein.
  • 251P5G2 variant fusion proteins such as GST and MBP fusion proteins
  • antiserum derived from a GST-251P5G2 variant 1 fusion protein is first purified by passage over a column of GST protein covalenily coupled to AffiGel matrix (BioRad, Hercules, Calif.). The antiserum is then affinity purified by passage over a column composed of a MBP-251P5G2 fusion protein covalenfy coupled to Affigel matrix.
  • the serum is then further purified by protein G affinity chromatography to isolate the IgG fraction.
  • Sera from other His-tagged antigens and peptide immunized rabbits as well as fusion partner depleted sera are affinity purified by passage over a column matrix composed of the original protein immunogen or free peptide.
  • therapeutic mAbs to 251P5G2 variants comprise those that react with epitopes specific for each variant protein or specific to sequences in common between the variants that would disrupt or modulate the biological function of the 251P5G2 variants, for example those that would disrupt the interaction with ligands and binding partners.
  • Immunogens for generation of such mAbs include those designed to encode or contain the entire 251P5G2 protein variant sequence, regions of the 251P5G2 protein variants predicted to be antigenic from computer analysis of the amino acid sequence (see, e.g., FIGS. 5 (A & B), FIGS. 6 (A & B), FIGS. 7 (A & B), FIGS. 8 (A & B), or FIGS.
  • Immunogens include peptides, recombinant bacterial proteins, and mammalian expressed Tag 5 proteins and human and murine IgG FC fusion proteins.
  • cells engineered to express high levels of a respective 251P5G2 variant such as 293T-251P5G2 variant 1 or 300.19-251P5G2 variant 1murine Pre-B cells, are used to immunize mice.
  • mice are first immunized intraperitoneally (IP) with, typically, 10-50 ⁇ g of protein immunogen or 10 7 251P5G2-expressing cells mixed in complete Freund's adjuvant. Mice are then subsequently immunized IP every 2-4 weeks with, typically, 10-50 ⁇ g of protein immunogen or 10 7 cells mixed in incomplete Freund's adjuvant. Alternatively, MPL-TDM adjuvant is used in immunizations.
  • a DNA-based immunization protocol in which a mammalian expression vector encoding a 251P5G2 variant sequence is used to immunize mice by direct injection of the plasmid DNA.
  • amino acids 60-85 is cloned into the Tag5 mammalian secretion vector and the recombinant vector is used as immunogen.
  • the same amino acids are cloned into an Fc-fusion secretion vector in which the 251P5G2 variant 1 sequence is fused at the amino-terminus to an IgK leader sequence and at the carboxyl-terminus to the coding sequence of the human or murine IgG Fc region.
  • This recombinant vector is then used as immunogen.
  • the plasmid immunization protocols are used in combination with purified proteins expressed from the same vector and with cells expressing the respective 251P5G2 variant.
  • test bleeds are taken 7-10 days following an injection to monitor titer and specificity of the immune response. Once appropriate reactivity and specificity is obtained as determined by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy, and flow cytometric analyses, fusion and hybridoma generation is then carried out with established procedures well known in the art (see, e.g., Harlow and Lane, 1988).
  • a Tag5-251P5G2 variant 1 antigen encoding amino acids 60-85 is expressed and purified from stably transfected 293T cells.
  • Balb C mice are initially immunized intraperitoneally with 25 ⁇ g of the Tag5-251P5G2 variant 1 protein mixed in complete Freund's adjuvant. Mice are subsequently immunized every two weeks with 25 ⁇ g of the antigen mixed in incomplete Freund's adjuvant for a total of three immunizations.
  • ELISA using the Tag5 antigen determines the titer of serum from immunized mice.
  • Reactivity and specificity of serum to full length 251P5G2 variant 1 protein is monitored by Western blotting, immunoprecipitation and flow cytometry using 293T cells transfected with an expression vector encoding the 251P5G2 variant 1 cDNA (see e.g., the Example entitled “Production of Recombinant 251P5G2 in Eukaryotic Systems” and FIG. 20.
  • Other recombinant 251P5G2 variant 1-expressing cells or cells endogenously expressing 251P5G2 variant 1 are also used Mice showing the strongest reactivity are rested and given a final injection of Tag5 antigen in PBS and then sacrificed four days later.
  • mice The spleens of the sacrificed mice are harvested and fused to SPO/2 myeloma cells using standard procedures (Harlow and Lane, 1988). Supernatants from HAT selected growth wells are screened by ELISA, Western blot, immunoprecipitation, fluorescent microscopy, and flow cytometry to identify 251P5G2 specific antibody-producing clones.
  • a Tag5 antigen encoding amino acids 800-1266 of variant 12 is produced, purified and used as immunogen to derive monoclonal antibodies specific to 251P5G2 variant 12. Hybridoma supernatants are then screened on both 251P5G2 variant 1- and 251P5G2 variant 12-expressing cells to identify specific anti-251P5G2 variant 12 monoclonal antibodies.
  • the binding affinity of a 251P5G2 monoclonal antibody is determined using standard technologies. Affinity measurements quantify the strength of antibody to epitope binding and are used to help define which 251P5G2 monoclonal antibodies preferred for diagnostic or therapeutic use, as appreciated by one of skill in the art.
  • the BIAcore system (Uppsala, Sweden) is a preferred method for determining binding affinity.
  • the BIAcore system uses surface plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23:1; Morton and Myszka, 1998, Methods in Enzymology 295: 268) to monitor biomolecular interactions in real time. BIAcore analysis conveniently generates association rate constants, dissociation rate constants, equilibrium dissociation constants, and affinity constants.
  • HLA class I and class II binding assays using purified HLA molecules are performed in accordance with disclosed protocols (e.g., PCT publications WO 94/20127 and WO 94/03205; Sidney et al., Current Protocols in Immunology 18.3.1 (1998); Sidney, et al., J. Immunol. 154:247 (1995); Sette, et al., Mol. Immunol. 31:813 (1994)). Briefly, purified MHC molecules (5 to 500 nM) are incubated with various unlabeled peptide inhibitors and 1-10 nM 125 1-radiolabeled probe peptides as described.
  • MHG-peptide complexes are separated from free peptide by gel filtration and the fraction of peptide bound is determined.
  • each MHC preparation is titered in the presence of fixed amounts of radiolabefed peptdes to determine the concentration of HLA molecules necessary to bind 10-20% of the total radioactivity. All subsequent inhibition and direct binding assays are performed using these HLA concentrations.
  • Binding assays as outined above may be used to analyze HLA supenmotif and/or HLA motif-bearing peptides (see Table IV).
  • HLA vaccine compositions of the invention can include multiple epitopes.
  • the multiple epitopes can comprise multiple HLA supermotifs or motifs to achieve broad population coverage. This example illustrates the identification and confirmation of supernotif- and motif-bearing epitopes for the inclusion in such a vaccine composition. Calculation of population coverage is performed using the strategy described below.
  • Identified A2-, A3-, and DR-supermotif sequences are scored using polynomial algorithms to predict their capacity to bind to specific HLA-Class I or Class II molecules. These polynomial algorithms account for the impact of different amino acids at different positions, and are essentially based on the premise that the overall affinity (or ⁇ G) of peptide-HLA molecule interactions can be approximated as a linear polynomial function of the type:
  • a ji is a coefficient which represents the effect of the presence of a given amino acid (j) at a given position (i) along the sequence of a peptide of n amino acids.
  • the crucial assumption of this method is that the effects at each position are essentially independent of each other (i.e., independent binding of individual side-chains).
  • residue j occurs at position i in the peptide, it is assumed to contribute a constant amount j i to the free energy of binding of the peptide irrespective of the sequence of the rest of the peptide.
  • the ARB values corresponding to the sequence of the peptide are multiplied. If this product exceeds a chosen threshold, the peptide is predicted to bind. Appropriate thresholds are chosen as a function of the degree of stringency of prediction desired.
  • Protein sequences from 251P5G2 are scanned utilizing motif identification software, to identify 8-, 9- 10- and 11-mer sequences containing the HLA-A2-supermotif main anchor specificity. Typically, these sequences are then scored using the protocol described above and the peptides corresponding to the positive-scoring sequences are synthesized and tested for their capacity to bind purified HLA-A*0201 molecules in vitro (HLA-A*0201 is considered a prototype A2 supertype molecule).
  • A2-supertype molecules A*0202, A*0203, A*0206, and A*6802.
  • Peptides that bind to at least three of the five A2-supertype alleles tested are typically deemed A2-supertype cross-reactive binders.
  • Preferred peptides bind at an affinity equal to or less than 500 nM to three or more HLA-A2 supertype molecules.
  • the peptides that bind at least one of the two alleles with binding affinities of ⁇ 500 nM, often ⁇ 200 nM, are then tested for binding cross-reactvity to the other common A3-supertype alleles (e.g., A*3101, A*3301, and A*6801) to identify those that can bind at least three of the five HLA-A3-supertype molecules tested.
  • A3-supertype alleles e.g., A*3101, A*3301, and A*6801
  • the 251P5G2 protein(s) scanned above is also analyzed for the presence of 8-, 9- 10-, or 11-mer peptides with the HLA-B7-supermotif.
  • Corresponding peptides are synthesized and tested for binding to HLA-B*0702, the molecule encoded by the most common B7-supertype allele (i.e., the prototype B7 supertype allele).
  • Peptides binding B*0702 with IC 50 of ⁇ 500 nM are identified using standard methods. These peptides are then tested for binding to other common B7-supertype molecules (e.g., B*3501, B*5101, B*5301, and B*5401). Peptides capable of binding to three or more of the five B7-supertype alleles tested are thereby identified.
  • HLA-A1 and -A24 epitopes can also be incorporated into vaccine compositions.
  • An analysis of the 251P5G2 protein can also be performed to identify HLA-A1- and A24-motif-containing sequences.
  • Cross-reactive candidate CTL A2-supermotif-bearing peptides that are identified as described herein are selected to confirm in vitro immunogenicity. Confirmation is performed using the following methodology:
  • the .221A2.1 cell line produced by transferring the HLA-A2.1 gene into the HLA-A, -B, -C null mutant human B-lymphoblastoid cell line 721.221, is used as the pepide-loaded target to measure activity of HLA-A2.1 -restricted CTL.
  • This cell line is grown in RPMI-1640 medium supplemented with antibiotics, sodium pyruvate, nonessential amino acids and 10% (v/v) heat inactivated FCS.
  • Cells that express an antigen of interest, or transfectants comprising the gene encoding the antigen of interest can be used as target cells to confirm the ability of pepfide-specific CTLs to recognize endogenous antigen.
  • DC Dendritic Cells
  • the wells are washed a total of three times with 3 ml RPMI to remove most of the non-adherent and loosely adherent cells.
  • Three ml of complete medium containing 50 ng/ml of GM-CSF and 1,000 U/ml of IL4 are then added to each well.
  • TNF ⁇ is added to the DCs on day 6 at 75 ng/ml and the cells are used for CTL induction cultures on day 7.
  • CD8+ T-cells are isolated by positive selection with Dynal immunomagnetic beads (Dynabeads® M450) and the detacha-bead® reagent. Typically about 200-250 ⁇ 10 6 PBMC are processed to obtain 24 ⁇ 10 6 CD8+ T-cells (enough fora 48-well plate culture). Briefly, the PBMCs are thawed in RPMI with 30 ⁇ g/ml DNAse, washed once with PBS containing 1% human AB serum and resuspended in PBS/1% AB serum at a concentration of 20 ⁇ 10 6 cells/ml.
  • the magnetic beads are washed 3 times with PBS/AB serum, added to the cells (140 ⁇ l beads/20 ⁇ 10 6 cells) and incubated for 1 hour at 4° C. with continuous mixing.
  • the beads and cells are washed 4 ⁇ with PBS/AB serum to remove the nonadherent cells and resuspended at 100 ⁇ 10 6 cells/ml (based on the original cell number) in PBS/AB serum containing 100 ⁇ l/ml detacha-bead® reagent and 30 ⁇ g/ml DNAse.
  • the mixture is incubated for 1 hour at room temperature with continuous mixing.
  • the beads are washed again with PBS/AB/DNAse to collect the CD8+ T-cells.
  • the DC are collected and centrifuged at 1300 rpm for 5-7 minutes, washed once with PBS with 1% BSA, counted and pulsed with 40 ⁇ g/ml of peptide at a cell concentration of 1-2 ⁇ 10 6 /ml in the presence of 3 ⁇ g/ml ⁇ 2 -microglobulin for 4 hours at 20° C.
  • the DC are then irradiated (4,200 rads), washed 1 time with medium and counted again.
  • the plates are washed twice with RPMI by tapping the plate gently to remove the nonadherent cells and the adherent cells pulsed with 10 ⁇ g/ml of peptide in the presence of 3 ⁇ g/ml ⁇ 2 microglobulin in 0.25 ml RPMI/5%AB per well for 2 hours at 37° C.
  • Peptide solution from each well is aspirated and the wells are washed once with RPMI. Most of the media is aspirated from the induction cultures (CD8+ cells) and brought to 0.5 ml with fresh media.
  • the cells are then transferred to the wells containing the peptide-pulsed adherent cells.
  • recombinant human IL-10 is added at a final concentration of 10 ng/ml and recombinant human IL2 is added the next day and again 2-3 days later at 50 IU/ml (Tsai et al., Critical Reviews in Immunology 18(1-2):65-75, 1998). Seven days later, the cultures are assayed for CTL activity in a 51 Cr release assay. In some experiments the cultures are assayed for peptide-specific recognition in the in situ IFN Y ELISA at the time of the second restimulation followed by assay of endogenous recognition 7 days later. After expansion, activity is measured in both assays for a side-by-side comparison.
  • cytotoxicity is determined in a standard (5 hr) 51 Cr release assay by assaying individual wells at a single E:T.
  • Peptde-pulsed targets are prepared by incubating the cells with 10 ⁇ g/ml peptide overnight at 37° C.
  • Adherent target cells are removed from culture flasks with trypsin-EDTA.
  • Target cells are labeled with 200 ⁇ Ci of 51 Cr sodium chromate (Dupont, Wilmington, Del.) for 1 hour at 37° C.
  • Labeled target cells are resuspended at 10 6 per ml and diluted 1:10 with K562 cells at a concentration of 3.3 ⁇ 10 6 /ml (an NK-sensitive erythroblastoma cell line used to reduce non-specific lysis).
  • Target cells (100 ⁇ l) and effectors (100 ⁇ l) are plated in 96 well round-bottom plates and incubated for 5 hours at 37° C. At that time, 100 ⁇ l of supernatant are collected from each well and percent lysis is determined according to the formula:
  • Immulon 2 plates are coated with mouse anti-human IFN ⁇ monoclonal antibody (4 ⁇ g/ml 0.1M NaHCO 3 , pH8.2) overnight at 4° C.
  • the plates are washed with Ca 2+ , Mg 2+ free PBS/0.05% Tween 20 and blocked with PBS/10% FCS for two hours, after which the CTLs (100 ⁇ l/well) and targets (100 ⁇ l/well) are added to each well, leaving empty wells for the standards and blanks (which received media only).
  • the target cells either peptide-pulsed or endogenous targets, are used at a concentration of 1 ⁇ 10 6 cells/ml.
  • the plates are incubated for 48 hours at 37° C. with 5% CO 2 .
  • Recombinant human IFN-gamma is added to the standard wells starting at 400 pg or 1200 pg/100 microliter/well and the plate incubated for two hours at 37° C. The plates are washed and 100 ⁇ l of biotinylated mouse anti-human IFN-gamma monoclonal antibody (2 microgram/ml in PBS/3%FCS/0.05% Tween 20) are added and incubated for 2 hours at room temperature. After washing again, 100 microliter HRP-streptavidin (1:4000) are added and the plates incubated for one hour at room temperature.
  • TMB 1:1 100 microliter/well developing solution
  • the reaction is stopped with 50 microliter/well 1M H 3 PO 4 and read at OD450.
  • a culture is considered positive if it measured at least 50 pg of IFN-gamma/well above background and is twice the background level of expression.
  • Those cultures that demonstrate specific lytic activity against peptide-pulsed targets and/or tumor targets are expanded over a two week period with anti-CD3. Briefly, 5 ⁇ 10 4 CD8+ cells are added to a T25 flask containing the following: 1 ⁇ 10 6 irradiated (4,200 rad) PBMC (autologous or allogeneic) per ml, 2 ⁇ 10 5 irradiated (8,000 rad) EBV-transformed cells per ml, and OKT3 (anti-CD3) at 30 ng per ml in RPMI-1640 containing 10% (v/v) human AB serum, non-essential amino acids, sodium pyruvate, 25 ⁇ M 2-mercaptoethanol, L-glutamine and penicillin/streptomycin.
  • PBMC autologous or allogeneic
  • OKT3 anti-CD3
  • Recombinant human IL2 is added 24 hours later at a final concentration of 200 IU/ml and every three days thereafter with fresh media at 50 IU/ml.
  • the cells are split if the cell concentration exceeds 1 ⁇ 10 6 /ml and the cultures are assayed between days 13 and 15 at E:T ratios of 30, 10, 3 and 1:1 in the 51 Cr release assay or at 1 ⁇ 10 6 /ml in the in sftu IFN ⁇ assay using the same targets as before the expansion.
  • A2-supermotif cross-reactive binding peptides are tested in the cellular assay for the ability to induce peptide-specific CTL in normal individuals.
  • a peptide is typically considered to be an epitope if it induces peptide-specific CTLs in at least individuals, and preferably, also recognizes the endogenously expressed peptide.
  • PBMCs isolated from patients bearing a tumor that expresses 251P5G2. Briefly, PBMCs are isolated from patients, re-stimulated with peptide-pulsed monocytes and assayed for the ability to recognize peptide-pulsed target cells as well as transfected cells endogenously expressing the antigen.
  • HLA-A3 supermotif-bearing cross-reactive binding peptides are also evaluated for immunogenicity using methodology analogous for that used to evaluate the immunogenicity of the HLA-A2 supermotif peptides.
  • HLA motifs and supermotifs are useful in the identification and preparation of highly cross-reactive native peptides, as demonstrated herein. Moreover, the definition of HLA motifs and supermotifs also allows one to engineer highly cross-reactive epitopes by identifying residues within a native peptide sequence which can be analoged to confer upon the peptide certain characteristics, e.g. greater cross-reactivity within the group of HLA molecules that comprise a supertype, and/or greater binding affinity for some or all of those HLA molecules. Examples of analoging peptides to exhibit modulated binding affinity are set forth in this example.
  • Peptide engineering strategies are implemented to further increase the cross-reactivity of the epitopes.
  • the main anchors of A2-supermotif-bearing peptides are altered, for example, to introduce a preferred L, I, V, or M at position 2, and I or V at the C-terminus.
  • each engineered analog is initially tested for binding to the prototype A2 supertype allele A*0201, then, if A*0201 binding capacity is maintained, for A2-supertype cross-reactivity.
  • a peptide is confirmed as binding one or all supertype members and then analoged to modulate binding affinity to any one (or more) of the supertype members to add population coverage.
  • the selection of analogs for immunogenicity in a cellular screening analysis is typically further restricted by the capacity of the parent wild type (WT) peptide to bind at least weakly, i.e., bind at an IC 50 of 5000 nM or less, to three of more A2 supertype alleles.
  • WT wild type
  • the rationale for this requirement is that the WT peptides must be present endogenously in sufficient quantity to be biologically relevant.
  • Analoged peptides have been shown to have increased immunogenicity and cross-reactivity by T cells specific for the parent epitope (see, e.g., Parkhurst et al., J. Immunol 157:2539, 1996; and Pogue et al., Proc. Natl. Acad. Sci. USA 92:8166, 1995).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
US10/418,972 2002-08-16 2003-04-17 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer Abandoned US20040081653A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US10/418,972 US20040081653A1 (en) 2002-08-16 2003-04-17 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US11/549,900 US7696336B2 (en) 2002-08-16 2006-10-16 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US12/651,336 US8604169B2 (en) 2002-08-16 2009-12-31 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US40430602P 2002-08-16 2002-08-16
US42329002P 2002-11-01 2002-11-01
US10/418,972 US20040081653A1 (en) 2002-08-16 2003-04-17 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/549,900 Continuation US7696336B2 (en) 2002-08-16 2006-10-16 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer

Publications (1)

Publication Number Publication Date
US20040081653A1 true US20040081653A1 (en) 2004-04-29

Family

ID=31891426

Family Applications (16)

Application Number Title Priority Date Filing Date
US10/418,972 Abandoned US20040081653A1 (en) 2002-08-16 2003-04-17 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US10/422,571 Abandoned US20040083497A1 (en) 2002-08-16 2003-04-23 Nucleic acids and corresponding proteins entitled 191P4D12(b) useful in treatment and detection of cancer
US10/435,751 Active 2024-07-24 US7115727B2 (en) 2002-08-16 2003-05-09 Nucleic acids and corresponding proteins entitled 282P1G3 useful in treatment and detection of cancer
US10/463,782 Abandoned US20040192597A1 (en) 2002-08-16 2003-06-16 Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US10/641,633 Expired - Fee Related US7250498B2 (en) 2002-08-16 2003-08-15 Nucleic acids and corresponding proteins entitled 273P4B7 useful in treatment and detection of cancer
US11/438,944 Expired - Lifetime US7612172B2 (en) 2002-08-16 2006-05-23 Nucleic acids and corresponding proteins entitled 282P1G3 useful in treatment and detection of cancer
US11/548,626 Expired - Fee Related US8057996B2 (en) 2002-08-16 2006-10-11 Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US11/549,900 Expired - Lifetime US7696336B2 (en) 2002-08-16 2006-10-16 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US11/708,975 Abandoned US20070298424A1 (en) 2002-08-16 2007-02-20 Nucleic acids and corresponding proteins entitled 273P4B7 useful in treatment and detection of cancer
US12/400,679 Abandoned US20090252747A1 (en) 2002-08-16 2009-03-09 Nucleic acids and corresponding proteins entitled 282p1g3 useful in treatment and detection of cancer
US12/651,336 Expired - Lifetime US8604169B2 (en) 2002-08-16 2009-12-31 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US12/821,045 Abandoned US20100297669A1 (en) 2002-08-16 2010-06-22 NUCLEIC ACIDS AND CORRESPONDING PROTEINS ENTITLED 191P4D12(b) USEFUL IN TREATMENT AND DETECTION OF CANCER
US12/821,016 Abandoned US20100297006A1 (en) 2002-08-16 2010-06-22 NUCLEIC ACIDS AND CORRESPONDING PROTEINS ENTITLED 191P4D12(b) USEFUL IN TREATMENT AND DETECTION OF CANCER
US13/021,202 Expired - Fee Related US8426571B2 (en) 2002-08-16 2011-02-04 Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US13/749,461 Abandoned US20130177569A1 (en) 2002-08-16 2013-01-24 Nucleic acids and corresponding proteins entitled 202p5a5 useful in treatment and detection of cancer
US13/913,360 Abandoned US20130267024A1 (en) 2002-08-16 2013-06-07 Nucleic acids and corresponding proteins entitled 282p1g3 useful in treatment and detection of cancer

Family Applications After (15)

Application Number Title Priority Date Filing Date
US10/422,571 Abandoned US20040083497A1 (en) 2002-08-16 2003-04-23 Nucleic acids and corresponding proteins entitled 191P4D12(b) useful in treatment and detection of cancer
US10/435,751 Active 2024-07-24 US7115727B2 (en) 2002-08-16 2003-05-09 Nucleic acids and corresponding proteins entitled 282P1G3 useful in treatment and detection of cancer
US10/463,782 Abandoned US20040192597A1 (en) 2002-08-16 2003-06-16 Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US10/641,633 Expired - Fee Related US7250498B2 (en) 2002-08-16 2003-08-15 Nucleic acids and corresponding proteins entitled 273P4B7 useful in treatment and detection of cancer
US11/438,944 Expired - Lifetime US7612172B2 (en) 2002-08-16 2006-05-23 Nucleic acids and corresponding proteins entitled 282P1G3 useful in treatment and detection of cancer
US11/548,626 Expired - Fee Related US8057996B2 (en) 2002-08-16 2006-10-11 Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US11/549,900 Expired - Lifetime US7696336B2 (en) 2002-08-16 2006-10-16 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US11/708,975 Abandoned US20070298424A1 (en) 2002-08-16 2007-02-20 Nucleic acids and corresponding proteins entitled 273P4B7 useful in treatment and detection of cancer
US12/400,679 Abandoned US20090252747A1 (en) 2002-08-16 2009-03-09 Nucleic acids and corresponding proteins entitled 282p1g3 useful in treatment and detection of cancer
US12/651,336 Expired - Lifetime US8604169B2 (en) 2002-08-16 2009-12-31 Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US12/821,045 Abandoned US20100297669A1 (en) 2002-08-16 2010-06-22 NUCLEIC ACIDS AND CORRESPONDING PROTEINS ENTITLED 191P4D12(b) USEFUL IN TREATMENT AND DETECTION OF CANCER
US12/821,016 Abandoned US20100297006A1 (en) 2002-08-16 2010-06-22 NUCLEIC ACIDS AND CORRESPONDING PROTEINS ENTITLED 191P4D12(b) USEFUL IN TREATMENT AND DETECTION OF CANCER
US13/021,202 Expired - Fee Related US8426571B2 (en) 2002-08-16 2011-02-04 Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US13/749,461 Abandoned US20130177569A1 (en) 2002-08-16 2013-01-24 Nucleic acids and corresponding proteins entitled 202p5a5 useful in treatment and detection of cancer
US13/913,360 Abandoned US20130267024A1 (en) 2002-08-16 2013-06-07 Nucleic acids and corresponding proteins entitled 282p1g3 useful in treatment and detection of cancer

Country Status (12)

Country Link
US (16) US20040081653A1 (fr)
EP (6) EP1576170B1 (fr)
JP (6) JP2006513724A (fr)
AU (6) AU2003243151A1 (fr)
CA (5) CA3066279A1 (fr)
CY (1) CY1113247T1 (fr)
DK (2) DK1576170T3 (fr)
ES (2) ES2392341T3 (fr)
IL (6) IL166532A (fr)
PT (2) PT1576170E (fr)
SI (2) SI1576170T1 (fr)
WO (5) WO2004016733A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070231261A1 (en) * 2002-08-16 2007-10-04 Agensys, Inc. Nucleic acids and corresponding proteins entitled 251p5g2 useful in treatment and detection of cancer
US20130039936A1 (en) * 2010-03-12 2013-02-14 The United States Of America, As Represented By The Secretary, Dept. Of Health & Human Services Immunogenic pote peptides and methods of use
CN108875628A (zh) * 2018-06-14 2018-11-23 攀枝花学院 行人检测方法
WO2023019236A1 (fr) * 2021-08-13 2023-02-16 Agensys, Inc. Méthodes de traitement du cancer de la vessie invasif non musculaire avec des conjugués anticorps-médicament (adc) qui se lient à des protéines 191p4d12

Families Citing this family (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7271240B2 (en) 2001-03-14 2007-09-18 Agensys, Inc. 125P5C8: a tissue specific protein highly expressed in various cancers
US7678889B2 (en) * 2002-08-06 2010-03-16 Diadexus, Inc. Compositions and methods relating to ovarian specific genes and proteins
EP1697750B1 (fr) * 2003-12-01 2013-03-20 Dako Denmark A/S Methodes et compositions de detection immunohistochimique
US20060019396A1 (en) * 2004-06-07 2006-01-26 Tissuegene, Inc. Retroviral vectors with enhanced efficiency of transgene expression and safety
EA016186B1 (ru) * 2005-09-26 2012-03-30 Медарекс, Инк. Человеческие моноклональные антитела к cd70 и их применение
TW200745163A (en) 2006-02-17 2007-12-16 Syntonix Pharmaceuticals Inc Peptides that block the binding of IgG to FcRn
AU2007333098A1 (en) * 2006-12-14 2008-06-19 Medarex, Inc. Human antibodies that bind CD70 and uses thereof
CN104189885A (zh) * 2007-02-23 2014-12-10 纽约哥伦比亚大学理事会 通过激活或阻断HLA-E/Qa-1限制性CD8+T细胞调控途径治疗免疫疾病的方法
TW200911289A (en) 2007-08-09 2009-03-16 Syntonix Pharmaceuticals Inc Immunomodulatory peptides
CA2758964A1 (fr) * 2009-04-16 2010-10-21 Abbott Biotherapeutics Corp. Anticorps anti-tnf-.alpha. et leurs utilisations
US20120183518A1 (en) * 2009-08-24 2012-07-19 Hong Jiang Assay for determining health of cd8+ t cells
US8449512B2 (en) 2010-04-09 2013-05-28 Davinci Biomedical Research Products Inc. Stoma stabilitating device and method
TW202344270A (zh) 2010-09-29 2023-11-16 美商艾澤西公司 與191p4d12蛋白結合之抗體藥物共軛物(adc)
CA2864868A1 (fr) 2011-02-25 2012-11-15 Wellstat Diagnostics, Llc Analyses permettant de detecter une activite enzymatique
WO2012164004A1 (fr) 2011-06-01 2012-12-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Nouveau peptide antigénique et ses utilisations
WO2013055929A1 (fr) 2011-10-12 2013-04-18 The General Hospital Corporation Annexine a2 humaine recombinante non-n-glycosylée
AU2013364043B2 (en) 2012-12-21 2018-01-04 Seagen Inc. Anti-NTB-A antibodies and related compositions and methods
US9944689B2 (en) 2013-03-07 2018-04-17 The General Hospital Corporation Human CTLA4 mutants and use thereof
WO2015114633A1 (fr) * 2014-01-30 2015-08-06 Yissum Research And Development Company Of The Hebrew University Of Jerusalem Ltd. Peptides se liant à l'actine et compositions les contenant pour inhiber l'angiogenèse et traiter des affections médicales associées à celle-ci
KR101503341B1 (ko) * 2014-03-12 2015-03-18 국립암센터 자가암항원 특이적 cd8+ t 세포의 분리 및 증식방법
US9616114B1 (en) 2014-09-18 2017-04-11 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US11512289B2 (en) 2015-02-18 2022-11-29 Enlivex Therapeutics Rdo Ltd Combination immune therapy and cytokine control therapy for cancer treatment
US11497767B2 (en) 2015-02-18 2022-11-15 Enlivex Therapeutics R&D Ltd Combination immune therapy and cytokine control therapy for cancer treatment
US11318163B2 (en) 2015-02-18 2022-05-03 Enlivex Therapeutics Ltd Combination immune therapy and cytokine control therapy for cancer treatment
US11000548B2 (en) 2015-02-18 2021-05-11 Enlivex Therapeutics Ltd Combination immune therapy and cytokine control therapy for cancer treatment
US11304976B2 (en) 2015-02-18 2022-04-19 Enlivex Therapeutics Ltd Combination immune therapy and cytokine control therapy for cancer treatment
US11596652B2 (en) 2015-02-18 2023-03-07 Enlivex Therapeutics R&D Ltd Early apoptotic cells for use in treating sepsis
JP6803339B2 (ja) 2015-04-21 2020-12-23 エンリヴェックス セラピューティクス リミテッド 治療用のプールされた血液アポトーシス細胞調製物及びそれらの使用
CN109069539A (zh) 2016-02-18 2018-12-21 恩立夫克治疗有限责任公司 用于癌症治疗的联合免疫疗法和细胞因子控制疗法
WO2018035046A1 (fr) 2016-08-15 2018-02-22 President And Fellows Of Harvard College Traitement d'infections.utilisant l'idsd pour l'élimination de proteus mirabilis
US10350280B2 (en) * 2016-08-31 2019-07-16 Medgenome Inc. Methods to analyze genetic alterations in cancer to identify therapeutic peptide vaccines and kits therefore
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
MX2019004692A (es) 2017-01-06 2019-11-08 Eutilex Co Ltd Anticuerpos 4-1bb anti-humano y usos de los mismos.
JP7106810B2 (ja) * 2018-04-19 2022-07-27 学校法人 埼玉医科大学 新規肺がんマーカー
CR20210444A (es) 2019-02-25 2021-11-02 Novartis Ag Composiciones y métodos para tratar distrofia cristalina de bietti
WO2020174369A2 (fr) 2019-02-25 2020-09-03 Novartis Ag Compositions et procédés pour traiter une dystrophie cristalline de bietti
CN110147939B (zh) * 2019-04-24 2022-04-08 中国食品药品检定研究院 一种仿制药品的工艺评价方法和系统
JP2023540526A (ja) 2020-09-04 2023-09-25 ノヴァロック バイオセラピューティクス， リミテッド ネクチン－４抗体およびそれの使用

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5539084A (en) * 1989-02-17 1996-07-23 Coselco Mimotopes Pty. Ltd. Method for the use and synthesis of peptides
US5614372A (en) * 1995-02-24 1997-03-25 Lilja; Hans Early detection of prostate cancer (CAP) by employing prostate specific antigen (PSA) and human glandular kallikrein (hGK-1)
US5785973A (en) * 1988-02-01 1998-07-28 Praxis Biologics, Inc. Synthetic peptides representing a T-cell epitope as a carrier molecule for conjugate vaccines
US5840839A (en) * 1996-02-09 1998-11-24 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Alternative open reading frame DNA of a normal gene and a novel human cancer antigen encoded therein
US6344550B1 (en) * 1996-01-11 2002-02-05 Corixa Corporation Compositions and methods for the treatment and diagnosis of breast cancer
US20020022248A1 (en) * 1997-02-25 2002-02-21 Jiangchun Xu Compositions and methods for the therapy and diagnosis of prostate cancer
US20020082206A1 (en) * 2000-05-30 2002-06-27 Leach Martin D. Novel polynucleotides from atherogenic cells and polypeptides encoded thereby
US20020132753A1 (en) * 2000-01-31 2002-09-19 Rosen Craig A. Nucleic acids, proteins, and antibodies
US20020165371A1 (en) * 1996-01-11 2002-11-07 Frudakis Tony N. Compositions and methods for the therapy and diagnosis of breast cancer
US20020192763A1 (en) * 2000-04-17 2002-12-19 Jiangchun Xu Compositions and methods for the therapy and diagnosis of prostate cancer
US20030134283A1 (en) * 2000-10-03 2003-07-17 Peterson David P. Genes regulated in dendritic cell differentiation
US20030157089A1 (en) * 1997-02-25 2003-08-21 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US20030185830A1 (en) * 1997-02-25 2003-10-02 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US20040115629A1 (en) * 2002-01-09 2004-06-17 Panzer Scott R Molecules for diagnostics and therapeutics

Family Cites Families (238)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL6903384A (fr) 1969-03-05 1970-09-08
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
JPS6023084B2 (ja) 1979-07-11 1985-06-05 味の素株式会社 代用血液
US4640835A (en) 1981-10-30 1987-02-03 Nippon Chemiphar Company, Ltd. Plasminogen activator derivatives
US4722848A (en) 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
US4870009A (en) 1982-11-22 1989-09-26 The Salk Institute For Biological Studies Method of obtaining gene product through the generation of transgenic animals
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4496689A (en) 1983-12-27 1985-01-29 Miles Laboratories, Inc. Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer
US4736866A (en) 1984-06-22 1988-04-12 President And Fellows Of Harvard College Transgenic non-human mammals
US5430136A (en) 1984-10-16 1995-07-04 Chiron Corporation Oligonucleotides having selectably cleavable and/or abasic sites
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
DE3675588D1 (de) 1985-06-19 1990-12-20 Ajinomoto Kk Haemoglobin, das an ein poly(alkenylenoxid) gebunden ist.
US4791192A (en) 1986-06-26 1988-12-13 Takeda Chemical Industries, Ltd. Chemically modified protein with polyethyleneglycol
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5124246A (en) 1987-10-15 1992-06-23 Chiron Corporation Nucleic acid multimers and amplified nucleic acid hybridization assays using same
US5359100A (en) 1987-10-15 1994-10-25 Chiron Corporation Bifunctional blocked phosphoramidites useful in making nucleic acid mutimers
GB8724885D0 (en) 1987-10-23 1987-11-25 Binns M M Fowlpox virus promotors
US5254678A (en) 1987-12-15 1993-10-19 Gene Shears Pty. Limited Ribozymes
WO1989006692A1 (fr) * 1988-01-12 1989-07-27 Genentech, Inc. Procede de traitement de cellules tumorales par inhibition de la fonction receptrice du facteur de croissance
US5010175A (en) 1988-05-02 1991-04-23 The Regents Of The University Of California General method for producing and selecting peptides with specific properties
CA1340323C (fr) 1988-09-20 1999-01-19 Arnold E. Hampel Catalyseur d'arn pour le clivage de sequences specifiques d'arn
US5225538A (en) 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
WO1990010448A2 (fr) 1989-03-07 1990-09-20 Genentech, Inc. Conjugue covalent de lipides et d'oligonucleotides
US5703055A (en) 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
WO1991004753A1 (fr) 1989-10-02 1991-04-18 Cetus Corporation Conjugues d'oligonucleotides non codants et leurs emplois therapeutiques
US5208020A (en) 1989-10-25 1993-05-04 Immunogen Inc. Cytotoxic agents comprising maytansinoids and their therapeutic use
DK0452457T3 (da) 1989-11-03 1998-03-02 Univ Vanderbilt Fremgangsmåde til in vivo fjernelse af funktionelle fremmede gener
US6673986B1 (en) 1990-01-12 2004-01-06 Abgenix, Inc. Generation of xenogeneic antibodies
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
AU633698B2 (en) 1990-01-12 1993-02-04 Amgen Fremont Inc. Generation of xenogeneic antibodies
US5279833A (en) 1990-04-04 1994-01-18 Yale University Liposomal transfection of nucleic acids into animal cells
US5204253A (en) 1990-05-29 1993-04-20 E. I. Du Pont De Nemours And Company Method and apparatus for introducing biological substances into living cells
IE66205B1 (en) 1990-06-14 1995-12-13 Paul A Bartlett Polypeptide analogs
US5723286A (en) 1990-06-20 1998-03-03 Affymax Technologies N.V. Peptide library and screening systems
ES2264239T3 (es) 1990-06-27 2006-12-16 Princeton University Complejo de proteinas p53/p90'.
US5650489A (en) 1990-07-02 1997-07-22 The Arizona Board Of Regents Random bio-oligomer library, a method of synthesis thereof, and a method of use thereof
SE9002480D0 (sv) 1990-07-23 1990-07-23 Hans Lilja Assay of free and complexed prostate-specific antigen
US5733731A (en) 1991-10-16 1998-03-31 Affymax Technologies N.V. Peptide library and screening method
AU3665893A (en) 1992-02-12 1993-09-03 United States Of America, As Represented By The Secretary, Department Of Health And Human Services, The Sequences characteristic of human gene transcription product
US5573905A (en) 1992-03-30 1996-11-12 The Scripps Research Institute Encoded combinatorial chemical libraries
US5541061A (en) 1992-04-29 1996-07-30 Affymax Technologies N.V. Methods for screening factorial chemical libraries
CA2134773A1 (fr) 1992-06-04 1993-12-09 Robert J. Debs Methodes et compositions pour genotherapie in vivo
IL106610A0 (en) 1992-08-07 1993-12-08 Cytel Corp Hla binding peptides and their uses
JP3472587B2 (ja) * 1992-08-28 2003-12-02 アベンティス ファーマ株式会社 骨関連カルボキシペプチダーゼ様タンパク質およびその製造法
US5288514A (en) 1992-09-14 1994-02-22 The Regents Of The University Of California Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support
US5652138A (en) * 1992-09-30 1997-07-29 The Scripps Research Institute Human neutralizing monoclonal antibodies to human immunodeficiency virus
DE69314148T2 (de) 1992-12-17 1998-01-15 Valeo Systemes Dessuyage Stromversorgungsverfahren und -vorrichtung für einen elektrischen Motor zum Antrieb eines Scheibenwischers eines Kraftfahrzeugs
US5576220A (en) 1993-02-19 1996-11-19 Arris Pharmaceutical Corporation Thin film HPMP matrix systems and methods for constructing and displaying ligands
ATE466869T1 (de) 1993-03-05 2010-05-15 Epimmune Inc Verfahren zur herstellung von immunogenen hla- a2.1-bindenden peptiden
CA2163129A1 (fr) 1993-05-17 1994-11-24 Flossie Wong-Staal Therapie genique a l'aide de ribozyme pour infection par le vih et pour le sida
US5837501A (en) 1993-07-09 1998-11-17 Akzo Nobel N.V. Nucleic acid quantitation by co-amplification of target with multiple internal controls
US5804566A (en) 1993-08-26 1998-09-08 The Regents Of The University Of California Methods and devices for immunizing a host through administration of naked polynucleotides with encode allergenic peptides
US5679647A (en) 1993-08-26 1997-10-21 The Regents Of The University Of California Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides
ES2318848T3 (es) 1993-09-14 2009-05-01 Pharmexa Inc. Peptidos que se unen a pan dr para potenciar la respuesta inmunitaria.
US5681697A (en) 1993-12-08 1997-10-28 Chiron Corporation Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor
CH686982A5 (fr) 1993-12-16 1996-08-15 Maurice Stroun Méthode pour le diagnostic de cancers.
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5593853A (en) 1994-02-09 1997-01-14 Martek Corporation Generation and screening of synthetic drug libraries
US5539083A (en) 1994-02-23 1996-07-23 Isis Pharmaceuticals, Inc. Peptide nucleic acid combinatorial libraries and improved methods of synthesis
US5739118A (en) 1994-04-01 1998-04-14 Apollon, Inc. Compositions and methods for delivery of genetic material
US7625697B2 (en) * 1994-06-17 2009-12-01 The Board Of Trustees Of The Leland Stanford Junior University Methods for constructing subarrays and subarrays made thereby
US5525735A (en) 1994-06-22 1996-06-11 Affymax Technologies Nv Methods for synthesizing diverse collections of pyrrolidine compounds
US5549974A (en) 1994-06-23 1996-08-27 Affymax Technologies Nv Methods for the solid phase synthesis of thiazolidinones, metathiazanones, and derivatives thereof
EP1405911A1 (fr) 1994-07-20 2004-04-07 The General Hospital Corporation Systèmes de détection d'intéraction permettant de décéler des intéractions entre protéines
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5681702A (en) 1994-08-30 1997-10-28 Chiron Corporation Reduction of nonspecific hybridization by using novel base-pairing schemes
US5919652A (en) 1994-11-09 1999-07-06 The Regents Of The University Of California Nucleic acid molecules comprising the prostate specific antigen (PSA) promoter and uses thereof
US5736524A (en) 1994-11-14 1998-04-07 Merck & Co.,. Inc. Polynucleotide tuberculosis vaccine
US5962428A (en) 1995-03-30 1999-10-05 Apollon, Inc. Compositions and methods for delivery of genetic material
NZ306767A (en) 1995-04-11 2000-03-27 Univ Johns Hopkins Method of identifying molecular interactions employing counterselection and at least two hybrid molecules or two hybrid systems
ATE408015T1 (de) 1995-04-14 2008-09-15 Univ Alabama Res Found Transfer system basierend auf einem fusionsprotein und seine anwendungen.
WO1996032959A1 (fr) 1995-04-19 1996-10-24 Acorda Therapeutics Modulateurs de la croissance de l'axone et des dendrites du systeme nerveux central, compositions, cellules et procedes dans lesquels ils sont mis en ×uvre et utilises
US6576607B1 (en) * 1995-04-19 2003-06-10 Acorda Therapeutics Methods using CNS neurite outgrowth modulators
US5922687A (en) 1995-05-04 1999-07-13 Board Of Trustees Of The Leland Stanford Junior University Intracellular delivery of nucleic acids using pressure
US5759776A (en) * 1995-06-05 1998-06-02 California Pacific Medical Center Targets for breast cancer diagnosis and treatment
US5861160A (en) * 1995-06-07 1999-01-19 Ambico, Inc. Isospora suis sporozoite antigen
US5585639A (en) 1995-07-27 1996-12-17 Hewlett-Packard Company Optical scanning apparatus
US5569588A (en) 1995-08-09 1996-10-29 The Regents Of The University Of California Methods for drug screening
US6248555B1 (en) * 1995-08-31 2001-06-19 The General Hospital Corporation Genetic alterations related to familial alzheimer's disease
KR19990077146A (ko) 1996-01-11 1999-10-25 길리스 스티브 유방암의 치료 및 진단용 조성물 및 방법
US20030125536A1 (en) 1996-01-11 2003-07-03 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
US20020068285A1 (en) 1996-01-11 2002-06-06 Frudakis Tony N. Compositions and methods for the therapy and diagnosis of breast cancer
CU22559A1 (es) 1996-01-17 1999-05-03 Ct Ingenieria Genetica Biotech Sistema de expresión de antígenos heterologos en e. coli como proteínas de fusión
ES2367640T3 (es) 1996-03-11 2011-11-07 Epimmune Inc. Péptidos con afinidad de unión aumentada para al menos tres moléculas de tipo hla-a3.
EP0907750B1 (fr) 1996-04-26 2002-09-18 Massachusetts Institute Of Technology Methode de criblage a l'aide de trois hybrides
WO1998004720A1 (fr) 1996-07-26 1998-02-05 Sloan-Kettering Institute For Cancer Research Procedes et reactifs destines a l'immunisation genetique
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
WO1998014569A1 (fr) * 1996-10-02 1998-04-09 Bloch Donald B Gene et proteine specifiques aux leucocytes et leurs procedes d'utilisation
ATE371721T1 (de) 1996-10-15 2007-09-15 Univ California Tiermodelle für die menschliche prostatakrebsfortschreitung
US6365797B1 (en) 1997-10-15 2002-04-02 The Regents Of The University Of California Mice models of human prostate cancer progression
US5846722A (en) 1996-10-16 1998-12-08 Terrapin Technologies, Inc. System to detect small molecule/peptide interaction
US5840501A (en) 1996-10-25 1998-11-24 Bayer Corporation Determination of cPSA
CA2616914C (fr) 1996-12-03 2012-05-29 Abgenix, Inc. Anticorps de liaison de recepteur d'egf
US7026447B2 (en) * 1997-10-09 2006-04-11 Human Genome Sciences, Inc. 53 human secreted proteins
ZA982968B (en) 1997-04-09 1998-10-27 Corixa Corp Compositions and methods for the treatment and diagnosis of breast cancer
JP2001519666A (ja) 1997-04-10 2001-10-23 ジェネティックス・インスチチュート・インコーポレーテッド 分泌発現配列タグ（ｓＥＳＴｓ）
EP0973896A2 (fr) 1997-04-10 2000-01-26 Genetics Institute, Inc. Marqueurs secretes de sequence exprimee (sest)
AU6954398A (en) * 1997-04-11 1998-11-11 G.D. Searle & Co. Antagonistic anti-avb3 integrin antibodies
JP2001512013A (ja) 1997-08-01 2001-08-21 ジェンセット 前立腺に発現される分泌タンパク質の５’ｅｓｔ
CA2305690A1 (fr) 1997-10-09 1999-04-22 Human Genome Sciences, Inc. 53 proteines secretees humaines
ATE440951T1 (de) 1997-12-17 2009-09-15 Serono Genetics Inst Sa Verlängerte cdns, die für sekretierte proteine kodieren
WO1999038972A2 (fr) 1998-01-28 1999-08-05 Chiron Corporation Genes humains et produits ii d'expression genique
US20030215803A1 (en) 2000-12-07 2003-11-20 Garcia Pablo Dominguez Human genes and gene expression products isolated from human prostate
ID27813A (id) * 1998-01-28 2001-04-26 Corixa Corp Senyawa-senyawa untuk terapi dan diagnosa kanker paru-paru dan metoda untuk penggunaannya
US6500938B1 (en) * 1998-01-30 2002-12-31 Incyte Genomics, Inc. Composition for the detection of signaling pathway gene expression
JP4472173B2 (ja) * 1998-04-15 2010-06-02 セローノ ジェネティクス インスティテュート ソシエテ アノニム ５−リポキシゲナーゼ活性化タンパク（ｆｌａｐ）のゲノム配列、その多型マーカーおよび喘息の検出方法
US6476212B1 (en) * 1998-05-26 2002-11-05 Incyte Genomics, Inc. Polynucleotides and polypeptides derived from corn ear
US20030118599A1 (en) * 1999-04-02 2003-06-26 Corixa Corporation Compositions and methods for the therapy and diagnosis of lung cancer
EP1870466A3 (fr) 1998-07-14 2008-03-19 Corixa Corporation Compositions et procédés pour le traitement et le diagnostic du cancer de la prostate
AU6263999A (en) 1998-09-28 2000-04-17 Chiron Corporation Human genes and gene expression products
US6264949B1 (en) * 1998-09-29 2001-07-24 Mount Sinai School Of Medicine Of New York University Noninvasive agents for diagnosis and prognosis of the progression of fibrosis
WO2000021991A1 (fr) 1998-10-15 2000-04-20 Genetics Institute, Inc. ETIQUETTES DE SEQUENCES EXPRIMEES SECRETEES (sESTs)
US20020137160A1 (en) * 1998-12-17 2002-09-26 Byatt John C Nucleic acid and other molecules associated with lactation and muscle and fat deposition
CA2296792A1 (fr) 1999-02-26 2000-08-26 Genset S.A. Sequences marqueurs exprimees et proteines humaines codees
CA2368482A1 (fr) 1999-03-26 2000-10-05 Craig A. Rosen 50 proteines humaines secretees
AU3774500A (en) 1999-03-31 2000-10-16 Curagen Corporation Nucleic acids including open reading frames encoding polypeptides; "orfx"
JP2002540790A (ja) * 1999-04-02 2002-12-03 コリクサ コーポレイション 肺癌の治療および診断のための化合物ならびにその使用のための方法
EP1169444A2 (fr) 1999-04-09 2002-01-09 Corixa Corporation Compositions et methodes de depistage et de traitement du cancer du sein
WO2000073509A2 (fr) 1999-06-01 2000-12-07 Incyte Genomics, Inc. Molecules utilisees a des fins diagnostiques et therapeutiques
US6114123A (en) * 1999-06-14 2000-09-05 Incyte Pharmaceuticals, Inc. Lipocalin family protein
US7160694B2 (en) * 1999-06-14 2007-01-09 Millennium Pharmaceuticals, Inc. Nucleic acids encoding TANGO405 and functional fragments and uses thereof
EP1396543A3 (fr) 1999-07-08 2004-03-31 Research Association for Biotechnology Amorces pour la synthèse de cADN de pleine longueur et leur utilisation
EP1074617A3 (fr) * 1999-07-29 2004-04-21 Research Association for Biotechnology Amorces pour la synthèse de cADN de pleine longueur et leur utilisation
JP2002191363A (ja) * 1999-07-29 2002-07-09 Herikkusu Kenkyusho:Kk 全長ｃＤＮＡ合成用プライマー、およびその用途
CA2382161A1 (fr) * 1999-09-03 2001-03-15 Human Genome Sciences, Inc. Polynucleotides, polypeptides, et anticorps de la superfamille des immunoglobulines
EP1218392A4 (fr) * 1999-09-10 2003-04-09 Millennium Pharm Inc Nouveaux genes codant pour des proteines a usages previsionnel, diagnostique therapeutique et autres
AU7994200A (en) 1999-10-04 2001-05-10 Corixa Corporation Compositions and methods for therapy and diagnosis of prostate cancer
US6893818B1 (en) * 1999-10-28 2005-05-17 Agensys, Inc. Gene upregulated in cancers of the prostate
WO2001034802A2 (fr) 1999-11-12 2001-05-17 Corixa Corporation Compositions et methodes de traitement et de diagnostic du cancer de la prostate
EP1285088A2 (fr) 2000-01-13 2003-02-26 Genset Marqueurs bialleles derives de regions genomiques comportant des genes responsables de troubles du systeme nerveux central
BR0107643A (pt) 2000-01-14 2003-06-10 Corixa Corp Composições e processos para a terapia e diagnóstico de c ncer de próstata
WO2001051628A2 (fr) 2000-01-14 2001-07-19 Millennium Pharmaceuticals, Inc. Genes, compositions, necessaires, et procedes destines a identifier, evaluer, prevenir et soigner le cancer du sein
US20030013649A1 (en) * 2000-01-31 2003-01-16 Rosen Craig A. Nucleic acids, proteins, and antibodies
WO2001055326A2 (fr) 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Acides nucleiques, proteines et anticorps
WO2001055321A2 (fr) 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Acides nucleiques, proteines et anticorps
WO2001059063A2 (fr) 2000-01-31 2001-08-16 Human Genome Sciences, Inc. Acides nucleiques, proteines et anticorps
US20020132767A1 (en) * 2000-01-31 2002-09-19 Rosen Craig A. Nucleic acids, proteins, and antibodies
AU2001243142A1 (en) 2000-02-03 2001-08-14 Hyseq, Inc. Novel nucleic acids and polypeptides
EP1290217A2 (fr) 2000-02-04 2003-03-12 Aeomica, Inc. Procedes et appareil destines a predire, a confirmer, et a afficher des informations fonctionnelles derivees d'une sequence genomique
US20030170246A1 (en) 2000-02-11 2003-09-11 Corixa Corporation Lipophilin complexes for use in cancer diagnosis and therapy
AU2001241541A1 (en) * 2000-02-17 2001-08-27 Millennium Predictive Medicine, Inc. Novel genes, compositions, kits, and methods for identification, assessment, prevention, and therapy of human prostate cancer
AU2001241511A1 (en) 2000-02-28 2001-09-12 Hyseq, Inc. Novel nucleic acids and polypeptides
JP2001245671A (ja) 2000-03-07 2001-09-11 Chiba Prefecture ヒト神経芽細胞腫においてクローニングされた新規遺伝子及び新規遺伝子の断片
AU2001245619A1 (en) 2000-03-09 2001-09-17 Chiron Corporation Human genes and gene expression products
AU4592601A (en) * 2000-03-21 2001-10-03 Millennium Predictive Medicine Novel genes, compositions, kits, and method for identification, assessment, prevention, and therapy of ovarian cancer
AU2001249549A1 (en) 2000-03-27 2001-10-08 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
JP2004526401A (ja) 2000-03-29 2004-09-02 コリクサ コーポレイション 肺癌の治療および診断のための組成物および方法
US6436703B1 (en) * 2000-03-31 2002-08-20 Hyseq, Inc. Nucleic acids and polypeptides
ES2281416T3 (es) 2000-04-03 2007-10-01 Corixa Corporation Metodos, composiciones y sistemas para la deteccion y monitorizacion del cancer de mama.
US6682888B1 (en) * 2000-05-05 2004-01-27 Incyte Corporation Genes expressed in alzheimer's disease
WO2001085791A1 (fr) 2000-05-11 2001-11-15 Lifespan Biosciences, Inc. Sequences d'acide nucleique destinees a de nouveaux gpcrs
AU2001263006A1 (en) * 2000-05-18 2001-11-26 Hyseq, Inc. Novel nucleic acids and polypeptides
WO2001092581A2 (fr) 2000-05-26 2001-12-06 Corixa Corporation Compositions et methodes permettant le traitement et le diagnostic du cancer de l'ovaire
WO2001094629A2 (fr) 2000-06-05 2001-12-13 Avalon Pharmaceuticals Determination de gene du cancer et recherche therapeutique utilisant des ensembles de genes signature
GB0014185D0 (en) * 2000-06-09 2000-08-02 Novartis Res Found Compound and method
US6974667B2 (en) 2000-06-14 2005-12-13 Gene Logic, Inc. Gene expression profiles in liver cancer
EP1297130A2 (fr) 2000-06-16 2003-04-02 Incyte Genomics, Inc. Recepteur couple a la proteine g
US20040072996A1 (en) * 2001-06-15 2004-04-15 Lal Preeti G G-protein coupled receptors
EP1305450A2 (fr) 2000-07-28 2003-05-02 Compugen Inc. Bibliotheque d'oligonucleotides destinee a detecter des transcrits d'arn et des variantes d'epissure qui garnissent un transcriptome
KR100870486B1 (ko) 2000-09-01 2008-12-11 에피제노믹스 아게 게놈 디엔에이 시료의 서열 콘택스트 5'-씨피쥐-3'에서 특정 시토신의 메틸화 정도 측정방법
CN1345964A (zh) 2000-09-29 2002-04-24 上海博德基因开发有限公司 一种新的多肽——己糖激酶10.01和编码这种多肽的多核苷酸
WO2002029086A2 (fr) 2000-10-02 2002-04-11 Bayer Corporation Sequences d'acide nucleique differentiellement exprimees dans un tissu cancereux
AU2002213053B2 (en) * 2000-10-05 2006-12-21 Immunex Corporation Nectin polypeptides, polynucleotides, methods of making and use thereof
EP1474528A4 (fr) * 2000-10-13 2006-06-14 Protein Design Labs Inc Procedes de diagnostic du cancer de la prostate, compositions et procedes de criblage de modulateurs du cancer de la prostate
US20070014801A1 (en) * 2001-01-24 2007-01-18 Gish Kurt C Methods of diagnosis of prostate cancer, compositions and methods of screening for modulators of prostate cancer
WO2002055700A2 (fr) 2000-12-07 2002-07-18 Chiron Corp Genes humains et produits d'expression genetique isoles de la prostate humaine
EP1343813A4 (fr) 2000-12-19 2004-11-17 Smithkline Beecham Corp Nouveaux composes
US20040072264A1 (en) 2000-12-22 2004-04-15 Morris David W. Novel compositions and methods for cancer
US7820447B2 (en) 2000-12-22 2010-10-26 Sagres Discovery Inc. Compositions and methods for cancer
CN1363678A (zh) 2001-01-05 2002-08-14 上海博德基因开发有限公司 一种新的多肽——信号肽酶9.79和编码这种多肽的多核苷酸
EP1425302A2 (fr) * 2001-01-24 2004-06-09 Protein Design Labs Procedes de diagnostic du cancer du sein, compositions et procedes de criblage de modulateurs du cancer du sein
US20040029114A1 (en) * 2001-01-24 2004-02-12 Eos Technology, Inc. Methods of diagnosis of breast cancer, compositions and methods of screening for modulators of breast cancer
WO2002059271A2 (fr) 2001-01-25 2002-08-01 Gene Logic, Inc. Profils d'expression genetique dans des tissus mammaires
AU2002251841A1 (en) 2001-01-30 2002-08-12 Corixa Corporation Compositions and methods for the therapy and diagnosis of pancreatic cancer
DE20103510U1 (de) 2001-02-28 2001-06-07 Lion Bioscience Ag Genbibliothek
WO2003008583A2 (fr) 2001-03-02 2003-01-30 Sagres Discovery Nouvelles compositions et methodes relatives au cancer
US6783969B1 (en) * 2001-03-05 2004-08-31 Nuvelo, Inc. Cathepsin V-like polypeptides
US20040053250A1 (en) * 2001-03-05 2004-03-18 Tang Y. Tom Novel arginine-rich protein-like nucleic acids and polypeptides
US7271240B2 (en) * 2001-03-14 2007-09-18 Agensys, Inc. 125P5C8: a tissue specific protein highly expressed in various cancers
AU2002258518A1 (en) * 2001-03-14 2002-09-24 Millennium Pharmaceuticals, Inc. Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer
CA2442777A1 (fr) 2001-03-27 2002-10-03 Human Genome Sciences, Inc. Proteines secretees par l'etre humain
WO2002097031A2 (fr) 2001-03-28 2002-12-05 Incyte Genomics, Inc. Molecules utilisees a des fins diagnostiques et therapeutiques
AU2002311791A1 (en) 2001-03-29 2002-10-28 Incyte Genomics, Inc. Secretory molecules
WO2002078516A2 (fr) 2001-03-30 2002-10-10 Corixa Corporation Compositions et methodes de traitement et de diagnostic de cancers
US20040138416A1 (en) 2001-03-30 2004-07-15 Thornton Michael B G-protein coupled receptors
AU2002338345A1 (en) 2001-04-04 2002-10-21 Digital Gene Technologies, Inc. Genes expressed in intestinal epithelium and peyer's patch m cells
AU2002307466A1 (en) 2001-04-20 2002-11-05 Millennium Pharmaceutical, Inc. Method for detecting breast cancer cells
US20030083263A1 (en) * 2001-04-30 2003-05-01 Svetlana Doronina Pentapeptide compounds and uses related thereto
US6794501B2 (en) * 2001-05-04 2004-09-21 Ludwig Institute For Cancer Research Colon cancer antigen panel
EP1988097A1 (fr) 2001-05-09 2008-11-05 Corixa Corporation Compositions et procédés pour le traitement et le diagnostic du cancer de la prostate
WO2002092001A2 (fr) 2001-05-11 2002-11-21 Corixa Corporation Compositions et methodes de traitement et de diagnostic du cancer du poumon
US7189507B2 (en) * 2001-06-18 2007-03-13 Pdl Biopharma, Inc. Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer
US7171311B2 (en) 2001-06-18 2007-01-30 Rosetta Inpharmatics Llc Methods of assigning treatment to breast cancer patients
US20040076955A1 (en) * 2001-07-03 2004-04-22 Eos Biotechnology, Inc. Methods of diagnosis of bladder cancer, compositions and methods of screening for modulators of bladder cancer
US20040249128A1 (en) 2001-07-09 2004-12-09 Thornton Michael B Molecules for disease detection and treatment
US20050118582A1 (en) 2001-07-12 2005-06-02 Anita Swarnakar Nucleic acid-associated proteins
US20030099974A1 (en) * 2001-07-18 2003-05-29 Millennium Pharmaceuticals, Inc. Novel genes, compositions, kits and methods for identification, assessment, prevention, and therapy of breast cancer
US20030108963A1 (en) 2001-07-25 2003-06-12 Millennium Pharmaceuticals, Inc. Novel genes, compositions, kit, and methods for identification, assessment, prevention and therapy of prostate cancer
CA2456955A1 (fr) 2001-08-09 2003-10-02 Nuvelo, Inc. Nouveaux acides nucleiques et polypeptides secretes
EP1478772A2 (fr) 2001-08-14 2004-11-24 The General Hospital Corporation Sequences d'acides nucleiques et d'acides amines intervenant dans la douleur
EP1539955A4 (fr) * 2001-08-20 2006-09-27 Bristol Myers Squibb Co Polynucleotides codant pour les recepteurs couples aux proteines g et methodes d'utilisation
EP1293569A3 (fr) 2001-09-14 2004-03-31 Research Association for Biotechnology Clones d'ADNc complets
JP2003088388A (ja) * 2001-09-14 2003-03-25 Herikkusu Kenkyusho:Kk 新規な全長ｃＤＮＡ
KR101008758B1 (ko) * 2001-09-18 2011-01-14 제넨테크, 인크. 종양의 진단 및 치료를 위한 방법 및 이를 위한 조성물
CN1412309A (zh) 2001-10-08 2003-04-23 中国人民解放军军事医学科学院放射医学研究所 人支气管上皮细胞恶性转化差异表达基因的cDNA文库及与肺癌病变相关的克隆
US20040110792A1 (en) 2001-10-30 2004-06-10 Mitch Raponi Methods for assessing and treating leukemia
US20070072178A1 (en) 2001-11-05 2007-03-29 Torsten Haferlach Novel genetic markers for leukemias
CA2462653C (fr) * 2001-11-07 2016-06-07 Aya Jakobovits Acide nucleique et proteine correspondante 161p2f10b utiles dans le traitement et le depistage du cancer
US20030232350A1 (en) * 2001-11-13 2003-12-18 Eos Biotechnology, Inc. Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer
WO2003062376A2 (fr) 2002-01-16 2003-07-31 Incyte Genomics, Inc. Molécules pour le diagnostic et la thérapeutique
AU2003210266A1 (en) 2002-02-14 2003-09-04 Bioinvent International Ab Treatment, diagnosis and imaging of disease
WO2003074674A2 (fr) 2002-03-01 2003-09-12 Exelixis, Inc. Genes msra utilises en tant que modificateurs de la voie p53 et procedes d'utilisation associes
AU2003217992A1 (en) 2002-03-06 2003-09-22 Incyte Corporation Nucleic acid-associated proteins
JP2003259877A (ja) 2002-03-11 2003-09-16 Sumitomo Pharmaceut Co Ltd 肝線維症疾患マーカーおよびその利用
WO2003083074A2 (fr) 2002-03-28 2003-10-09 Idec Pharmaceuticals Corporation Nouvelles cibles geniques et ligands se liant a celles-ci pour le traitement et le diagnostic de carcinomes du colon
US20030194704A1 (en) * 2002-04-03 2003-10-16 Penn Sharron Gaynor Human genome-derived single exon nucleic acid probes useful for gene expression analysis two
US20040101874A1 (en) * 2002-04-12 2004-05-27 Mitokor Inc. Targets for therapeutic intervention identified in the mitochondrial proteome
WO2004010957A2 (fr) * 2002-07-31 2004-02-05 Seattle Genetics, Inc. Conjugues de medicaments et leur utilisation dans le traitement du cancer, d'une maladie auto-immune ou d'une maladie infectieuse
JP2004121218A (ja) 2002-08-06 2004-04-22 Jenokkusu Soyaku Kenkyusho:Kk 気管支喘息または慢性閉塞性肺疾患の検査方法
US7408048B2 (en) * 2002-08-09 2008-08-05 Melbourne Health Mammalian grainyhead transcription factors
WO2004016733A2 (fr) * 2002-08-16 2004-02-26 Agensys, Inc. Acides nucleiques et proteines correspondantes connues sous 251p5g2 que l'on utilise dans le traitement et la detection de cancers
CN1477123A (zh) 2002-08-23 2004-02-25 上海博德基因开发有限公司 一种多肽——转录因子43和编码这种多肽的多核苷酸
AU2003289716A1 (en) * 2002-09-12 2004-04-30 Incyte Corporation Molecules for diagnostics and therapeutics
EP2500438A3 (fr) 2002-09-25 2012-11-28 Genentech, Inc. Compositions et procédés nouveaux pour le traitement du psoriasis
AU2003304203A1 (en) 2002-10-29 2005-01-04 Pharmacia Corporation Differentially expressed genes involved in cancer, the polypeptides encoded thereby, and methods of using the same
AU2003297300A1 (en) 2002-11-20 2004-06-15 Biogen Idec Inc. Novel gene targets and ligands that bind thereto for treatment and diagnosis of carcinomas
AU2003294510A1 (en) 2002-11-22 2004-06-18 Incyte Corporation Transporters and ion channels
AU2003298786A1 (en) 2002-11-26 2004-06-18 Protein Design Labs, Inc. Methods of detecting soft tissue sarcoma, compositions and methods of screening for soft tissue sarcoma modulators
WO2004066948A2 (fr) 2003-01-29 2004-08-12 Exelixis Inc. Mapcax en tant que modificateurs des voies apc et axine et procedes d'utilisation associes
EP1447413A3 (fr) 2003-02-14 2006-01-04 Research Association for Biotechnology ADN complementaire humaine de pleine longueur
US20050164324A1 (en) * 2003-06-04 2005-07-28 Gygi Steven P. Systems, methods and kits for characterizing phosphoproteomes
BR122018071808B8 (pt) * 2003-11-06 2020-06-30 Seattle Genetics Inc conjugado
EP2975057A1 (fr) * 2006-07-10 2016-01-20 Fujita Health University Nouvel anticorps anti-cd73
TWI552751B (zh) 2011-06-20 2016-10-11 Ｈ 朗德貝克公司 投予４－（（１ｒ，３ｓ）－６－氯－３－苯基－二氫茚－１－基）－１，２，２－三甲基－哌及其鹽用於治療精神分裂症的方法
WO2013037693A2 (fr) 2011-09-15 2013-03-21 Convergent Information Technologies Gmbh Système et procédé de développement automatisé de programmes de robots

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5785973A (en) * 1988-02-01 1998-07-28 Praxis Biologics, Inc. Synthetic peptides representing a T-cell epitope as a carrier molecule for conjugate vaccines
US5539084A (en) * 1989-02-17 1996-07-23 Coselco Mimotopes Pty. Ltd. Method for the use and synthesis of peptides
US5614372A (en) * 1995-02-24 1997-03-25 Lilja; Hans Early detection of prostate cancer (CAP) by employing prostate specific antigen (PSA) and human glandular kallikrein (hGK-1)
US6344550B1 (en) * 1996-01-11 2002-02-05 Corixa Corporation Compositions and methods for the treatment and diagnosis of breast cancer
US20020165371A1 (en) * 1996-01-11 2002-11-07 Frudakis Tony N. Compositions and methods for the therapy and diagnosis of breast cancer
US5840839A (en) * 1996-02-09 1998-11-24 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Alternative open reading frame DNA of a normal gene and a novel human cancer antigen encoded therein
US20030157089A1 (en) * 1997-02-25 2003-08-21 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US20020022248A1 (en) * 1997-02-25 2002-02-21 Jiangchun Xu Compositions and methods for the therapy and diagnosis of prostate cancer
US6800746B2 (en) * 1997-02-25 2004-10-05 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US20030185830A1 (en) * 1997-02-25 2003-10-02 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US20020132753A1 (en) * 2000-01-31 2002-09-19 Rosen Craig A. Nucleic acids, proteins, and antibodies
US20020192763A1 (en) * 2000-04-17 2002-12-19 Jiangchun Xu Compositions and methods for the therapy and diagnosis of prostate cancer
US20020082206A1 (en) * 2000-05-30 2002-06-27 Leach Martin D. Novel polynucleotides from atherogenic cells and polypeptides encoded thereby
US20030134283A1 (en) * 2000-10-03 2003-07-17 Peterson David P. Genes regulated in dendritic cell differentiation
US20040115629A1 (en) * 2002-01-09 2004-06-17 Panzer Scott R Molecules for diagnostics and therapeutics

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070231261A1 (en) * 2002-08-16 2007-10-04 Agensys, Inc. Nucleic acids and corresponding proteins entitled 251p5g2 useful in treatment and detection of cancer
US7696336B2 (en) 2002-08-16 2010-04-13 Agensys, Inc. Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US20110195019A1 (en) * 2002-08-16 2011-08-11 Agensys, Inc. Nucleic acids and corresponding proteins entitled 251p5g2 useful in treatment and detection of cancer
US8604169B2 (en) 2002-08-16 2013-12-10 Agensys, Inc. Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US20130039936A1 (en) * 2010-03-12 2013-02-14 The United States Of America, As Represented By The Secretary, Dept. Of Health & Human Services Immunogenic pote peptides and methods of use
US8871902B2 (en) * 2010-03-12 2014-10-28 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Immunogenic POTE peptides and methods of use
US9394352B2 (en) 2010-03-12 2016-07-19 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Immunogenic POTE peptides and methods of use
CN108875628A (zh) * 2018-06-14 2018-11-23 攀枝花学院 行人检测方法
WO2023019236A1 (fr) * 2021-08-13 2023-02-16 Agensys, Inc. Méthodes de traitement du cancer de la vessie invasif non musculaire avec des conjugués anticorps-médicament (adc) qui se lient à des protéines 191p4d12

Also Published As

Publication number Publication date
CA2493923C (fr) 2020-02-18
US20090252747A1 (en) 2009-10-08
PT1576132E (pt) 2012-10-31
IL166564A0 (en) 2006-01-15
WO2004016736A2 (fr) 2004-02-26
IL166532A0 (en) 2006-01-15
AU2003236553B2 (en) 2007-09-20
WO2004016762A3 (fr) 2007-01-18
AU2003243151A1 (en) 2004-03-03
WO2004016799A2 (fr) 2004-02-26
US20070059729A1 (en) 2007-03-15
US7612172B2 (en) 2009-11-03
WO2004016733A3 (fr) 2006-03-16
WO2004016733A2 (fr) 2004-02-26
AU2003236553A1 (en) 2004-03-03
US20040083497A1 (en) 2004-04-29
IL166655A0 (en) 2006-01-15
EP1576170A2 (fr) 2005-09-21
EP1576130A4 (fr) 2007-08-08
IL200404A0 (en) 2010-04-29
US7115727B2 (en) 2006-10-03
US20110201052A1 (en) 2011-08-18
CA2493921A1 (fr) 2004-02-26
EP1576104A4 (fr) 2007-10-10
EP2301954A2 (fr) 2011-03-30
AU2003258269B2 (en) 2007-06-28
CA2493928C (fr) 2014-04-01
IL166655A (en) 2010-06-16
ES2392341T3 (es) 2012-12-07
JP2010142228A (ja) 2010-07-01
CA2493925A1 (fr) 2004-02-26
US20100297006A1 (en) 2010-11-25
AU2003232116B2 (en) 2008-05-29
US20130267024A1 (en) 2013-10-10
SI1576170T1 (sl) 2012-12-31
IL166531A (en) 2014-07-31
US8604169B2 (en) 2013-12-10
CA2493923A1 (fr) 2004-02-26
US20070298424A1 (en) 2007-12-27
IL233223A (en) 2015-03-31
US8426571B2 (en) 2013-04-23
JP2006511232A (ja) 2006-04-06
US20040192597A1 (en) 2004-09-30
SI1576132T1 (sl) 2012-12-31
AU2003228717A1 (en) 2004-03-03
WO2004016734A2 (fr) 2004-02-26
EP1576132A2 (fr) 2005-09-21
AU2003258269A1 (en) 2004-03-03
US20100297669A1 (en) 2010-11-25
CA2493921C (fr) 2015-12-08
DK1576170T3 (da) 2012-11-26
JP4490502B2 (ja) 2010-06-30
AU2003236553C1 (en) 2008-05-01
IL233223A0 (en) 2014-07-31
WO2004016799A3 (fr) 2007-04-05
AU2003258269C1 (en) 2004-03-03
US20040213778A1 (en) 2004-10-28
AU2003232116A1 (en) 2004-03-03
US7696336B2 (en) 2010-04-13
ES2391892T3 (es) 2012-11-30
EP1576104A2 (fr) 2005-09-21
US20080181885A1 (en) 2008-07-31
AU2003243151A8 (en) 2004-03-03
IL166532A (en) 2011-09-27
DK1576132T3 (da) 2012-10-01
EP2332966A1 (fr) 2011-06-15
WO2004016734A3 (fr) 2006-08-24
WO2004016762A2 (fr) 2004-02-26
CY1113247T1 (el) 2016-04-13
IL166564A (en) 2012-01-31
EP1576132B1 (fr) 2012-08-15
IL200404A (en) 2014-07-31
JP2006513724A (ja) 2006-04-27
AU2008207531A1 (en) 2008-09-18
US20040053348A1 (en) 2004-03-18
JP2009278977A (ja) 2009-12-03
EP1576170A4 (fr) 2008-07-23
PT1576170E (pt) 2012-11-05
IL166531A0 (en) 2006-01-15
CA2493928A1 (fr) 2004-02-26
US20070231261A1 (en) 2007-10-04
EP1576132A4 (fr) 2007-09-05
US7250498B2 (en) 2007-07-31
US20130177569A1 (en) 2013-07-11
EP2301954A3 (fr) 2012-05-09
JP2009278988A (ja) 2009-12-03
US8057996B2 (en) 2011-11-15
WO2004016736A3 (fr) 2006-10-05
AU2003228717B2 (en) 2008-02-21
US20110195019A1 (en) 2011-08-11
EP1576130A2 (fr) 2005-09-21
EP1576170B1 (fr) 2012-08-15
CA3066279A1 (fr) 2004-02-26
JP2009159963A (ja) 2009-07-23

Similar Documents

Publication Publication Date Title
US7696336B2 (en) Nucleic acids and corresponding proteins entitled 251P5G2 useful in treatment and detection of cancer
US8188228B2 (en) Nucleic acid and corresponding protein entitled 193P1E1B useful in treatment and detection of cancer
US20090169476A1 (en) Nucleic acid and corresponding protein entitled STEAP-1 useful in treatment and detection of cancer
US7968090B2 (en) Nucleic acids and corresponding proteins entitled 191P4D12(b) useful in treatment and detection of cancer
US8124741B2 (en) Antibodies to tumor associated proteins
CA2481503A1 (fr) Acide nucleique et proteine correspondante 98p4b6 utilises dans le traitement et la detection du cancer
US8524872B2 (en) Nucleic acids and corresponding proteins entitled 158P3D2 useful in treatment and detection of cancer
US20110008393A1 (en) Nucleic acids and corresponding proteins entitled 58p1d12 useful in treatment and detection of cancer
CA2503346C (fr) Acide nucleique 24p4c12 et proteine correspondante utilises dans le traitement et la detection du cancer
CA2496566A1 (fr) Acide nucleique et proteine correspondante denommes 98p4b6, pour traitement et detection du cancer

Legal Events

Date Code Title Description
AS Assignment

Owner name: AGENSYS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:RAITANO, ARTHUR B.;CHALLITA-EID, PIA M.;JAKOBOVITS, AYA;AND OTHERS;REEL/FRAME:014909/0034;SIGNING DATES FROM 20030414 TO 20030418

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION