WO2003083074A2 - Nouvelles cibles geniques et ligands se liant a celles-ci pour le traitement et le diagnostic de carcinomes du colon - Google Patents

Nouvelles cibles geniques et ligands se liant a celles-ci pour le traitement et le diagnostic de carcinomes du colon Download PDF

Info

Publication number
WO2003083074A2
WO2003083074A2 PCT/US2003/009534 US0309534W WO03083074A2 WO 2003083074 A2 WO2003083074 A2 WO 2003083074A2 US 0309534 W US0309534 W US 0309534W WO 03083074 A2 WO03083074 A2 WO 03083074A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
gene
colon
ofthe
antigen
Prior art date
Application number
PCT/US2003/009534
Other languages
English (en)
Other versions
WO2003083074A9 (fr
Inventor
Karen Mclachlan
Dennis Gately
Original Assignee
Idec Pharmaceuticals Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Idec Pharmaceuticals Corporation filed Critical Idec Pharmaceuticals Corporation
Priority to AU2003222103A priority Critical patent/AU2003222103A1/en
Priority to US10/509,131 priority patent/US20060089493A1/en
Publication of WO2003083074A2 publication Critical patent/WO2003083074A2/fr
Publication of WO2003083074A9 publication Critical patent/WO2003083074A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates the identification of gene targets for treatment and diagnosis of neoplastic diseases, such as colon or colorectal cancer, and other cancers wherein the subject genes are upregulated and the use thereof to express the corresponding antigen, and to produce ligands that specifically bind such antigen, e.g. monoclonal antibodies and small molecules.
  • Colorectal cancers are among the most common cancers in men and women in the U.S. and are one ofthe leading causes of death. Other than surgical resection no other systemic or adjuvant therapy is available. Vogelstein and colleagues have described the sequence of genetic events that appear to be associated with the multistep process of colon cancer development in humans (Fearon and Vogelstein, 1990). An understanding ofthe molecular genetics of carcinogenesis, however, has not led to preventative or therapeutic measures. It can be expected that advances in molecular genetics will lead to better risk assessment and early diagnosis but colorectal cancers will remain a deadly disease for a majority of patients due to the lack of an adjuvant therapy.
  • Endogenous gastrins and exogenous gastrins seem to promote the growth of established colon cancers in mice (Singh, et al., 1986; Singh, et al., 1987; et al., 1984; Smith and Solomon, 1988; Singh, et al., 1990; Rehfeld and van Solinge, 1994) and promote carcinogen induced colon cancers in rats (Williamson et al., 1978; Karlin et al., 1985; Lamoste and Willems; 1988). Recent studies of Montag et al (1993) further support a possible co-carcinogenic role of gastrin in the initiation of tumors.
  • the MDR gene products actively transport the toxic substances out ofthe cell before the chemotherapeutic agents can damage the DNA machinery ofthe cell. These toxic substances harm the normal cell populations more than they harm the colon cancer cells for the above reasons.
  • growth promoting factors such as EGF, estradiol, IGF-II
  • this knowledge has not been applied and therefore the treatment outcome for colon cancers remains bleak.
  • Antisense RNA technology has been developed as an approach to inhibiting gene expression, including oncogene expression.
  • An "antisense" RNA molecule is one which contains the complement of, and can therefore hybridize with, protein-encoding RNAs ofthe cell. It is believed that the hybridization of antisense RNA to its cellular RNA complement can prevent expression ofthe cellular RNA, perhaps by limiting its franslatability.
  • a principle application of antisense RNA technology has been in connection with attempts to affect the expression of specific genes. For example, Delauney, et al. have reported the use antisense transcripts to inhibit gene expression in transgenic plants (Delauney, et al., 1988). These authors report the down-regulation of chloramphenicol acetyl transferase activity in tobacco plants transformed with CAT sequences through the application of antisense technology.
  • Antisense technology has also been applied in attempts to inhibit the expression of various oncogenes.
  • Kasid, et al., 1989 report the preparation of recombinant vector construct employing Craf-1 cDNA fragments in an antisense orientation, brought under the control of an adenoviras 2 late promoter.
  • These authors report that the introduction of this recombinant construct into a human squamous carcinoma resulted in a greatly reduced tumorigenic potential relative to cells transfected faith control sense transfectants.
  • Prochownik, et al., 1988 have reported the use of Cmiyc antisense constructs to accelerate differentiation and inhibit G.sub.l progression in Friend Murine Erythroleukemia cells.
  • Khokha, et al., 1989 discloses the use of antisense RNAs to confer oncogenicity on 3T3 cells, through the use of antisense RNA to reduce murine tissue inhibitor or metalloproteinases levels.
  • Antisense methodology takes advantage ofthe fact that nucleic acids tend to pair with "complementary" sequences.
  • complementary it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementary rales. That is, the larger purines base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.
  • Antisense polynucleotides when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA processing, transport, translation and/or stability.
  • Antisense RNA constructs, or DNA encoding such antisense RNAs can be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.
  • expression vector or construct is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all ofthe nucleic acid encoding sequence is capable of being transcribed.
  • the transcript can be translated into a protein but it need not be.
  • expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription ofthe nucleic acid encoding a gene of interest.
  • the nucleic acid encoding a gene product is under transcriptional control of a promoter.
  • a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene.
  • under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression ofthe gene.
  • promoter is used to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II.
  • Much ofthe thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 base pairs of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins. At least one module in each promoter functions to position the start site for RNA synthesis.
  • TATA box in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
  • promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 base pairs upstream ofthe start site, although a number of promoters have recently been shown to contain functional elements downstream ofthe start site as well.
  • the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 base pairs apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.
  • a promoter is selected based on its capability to direct gene expression in the targeted cell.
  • the nucleic acid coding region can be positioned adjacent to and under the control of a promoter that is capable of being expressed in a human cell.
  • a promoter might include either a human or viral promoter.
  • the human cytomegalovirus (CMV) immediate early gene promoter, the S V40 early promoter and the Rous sarcoma virus long terminal repeat can be used to obtain high-level expression ofthe gene of interest.
  • CMV cytomegalovirus
  • the use of other viral or mammalian cellular or bacterial phage promoters which are well known in the art to achieve expression of a gene of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.
  • a promoter with well-known properties, the level and pattern of expression ofthe gene product following transfection can be optimized. Further, selection of a promoter that is regulated in response to specific physiologic signals can permit inducible expression ofthe gene product.
  • Representative elements/promoters useful in accordance with the present invention include but are not limited to those listed below.
  • Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.
  • enhancers The basic distinction between enhancers and promoters is operational.
  • An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements.
  • a promoter includes one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.
  • Viral promoters cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the nucleic acid encoding a gene of interest in an expression construct.
  • enhancers include Immunoglobulin Heavy Chain; Immunoglobulin Light Chain; T-Cell Receptor; HLA DQ a and DQ b b-Interferon; Interleukin-2; Interleukin-2 Receptor: Gibbon Ape Leukemia Virus; MHC Class II 5 or HLA- DRa; b-Actin; Muscle Creatine Kinase; Prealbumin (Transthyretin); Elastase I; Metallothionein; Collagenase, Albumin Gene; ⁇ -Fetoprotein; ⁇ -Globin; ⁇ -Globin; c-fos: c- HA-ras; Insulin Neural Cell Adhesion Molecule (NCAM); al-Antitrypsin; H2B
  • Inducers such as phorbol ester (TFA) heavy metals; glucocorticoids; poly (rl)X; poly(rc); Ela; H 2 O 2 ; IL 1 ; Interferon, Newcastle Disease Vims; A23187; IL-6; Serum; SV40 Large T Antigen; FMA; thyroid Hormone; could be used. Additionally, any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression ofthe gene. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part ofthe delivery complex or as an additional genetic expression construct.
  • TFA phorbol ester
  • the expression construct can comprise a virus or engineered construct derived from a viral genome.
  • viruses to enter cells via receptor-mediated endocytosis and to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal et al., 1986: Temin, 1986).
  • the first viruses used as gene vectors were DNA viruses including the papo viruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal et al., 1986) and adenovirases (Ridgeway, 1988; Baichwal et al., 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kB of foreign genetic material but can be readily introduced in a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).
  • a polyadenylation signal is typically inserted to effect proper polyadenylation ofthe gene transcript.
  • Any suitable polyadenylation sequence can be used.
  • An expression cassette can also include a terminator sequence. These elements enhance message levels and minimize read through from the cassette into other sequences.
  • a coding sequence under the control of a promoter, or operatively linking a sequence to a promoter, one positions the 5' end ofthe transcription initiation site ofthe transcriptional reading frame ofthe protein between about land about 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter.
  • an appropriate polyadenylation site e.g., 5'- AATAAA-3' (SEQ ID NO:66)
  • the poly A addition site is placed about 30 to 2000 nucleotides "downstream" of the termination site ofthe protein at a position prior to transcription termination.
  • ligands that bind antigens expressed by certain cancers, such as colon or colorectal cancers.
  • Representative ligands include monoclonal antibodies.
  • ligands for example, monoclonal antibodies that specifically bind novel antigens that are expressed by certain cancer tissues including colon cancer
  • a ligand e.g., monoclonal antibody that specifically binds to an antigen expressed by certain colon cancers
  • a detectable label e.g., a radiolabel or fluorophore.
  • colon cancer that comprise DNA primers or probes specific for novel gene targets expressed by colon cancers, and a detectable label, e.g. radiolabel or fluorophore.
  • Figure 1 summarizes expression data for the CICO1, CICO2 and CICO3, which were identified based on overexpression in colon cancer as described in Example 1.
  • Figures 2-5 depict gene expression profiles determined using the Gene Logic datasuite as described in Example 2. The values along the y-axis represent expression intensities in Gene Logic units. Each blue circle represents an individual patient sample. The bar graph on the left ofthe figure depicts the percentage of each tissue type found to express the gene fragment.
  • colon tumor, tumor % above 50 refers to tumor samples for which at least 50% of each sample comprises malignant tissue, as determined by a pathologist. This sample set is a subset of colon tumors, which comprises all colon tumor samples contained within the Gene Logic database.
  • Figure 2 depicts the gene expression profile of Candidate 1, which was determined using the Gene Logic datasuite for GENBANK Accession No. W91975 as described in Example 2.
  • Candidate 1 is overexpressed in colon tumor tissue.
  • Figure 3 depicts the gene expression profile of Candidate 2, which was determined using the Gene Logic datasuite for GENBANK Accession No. Al 694242 as described in Example 2.
  • Candidate 2 is overexpressed in colon tumor tissue.
  • Figure 4 contains the gene expression profile of Candidate 3, which was determined using the Gene Logic datasuite for GENBANK Accession No. AI680111 as described in Example 2.
  • Candidate 3 is overexpressed in colon tumor tissue.
  • Figure 5 depicts the gene expression profile of Candidate 4, which was determined using the Gene Logic datasuite for GENBANK Accession No. AA813827 as described in Example 2.
  • Candidate 4 is overexpressed in colon tumor tissue.
  • Figures 6 A and 6B show PCR data of Candidate 3 expression (Figure 6 A) and GAPDH expression (Figure 6B) in normal human tissues.
  • Candidate 3 was screened against Human Multiple Tissue cDNA panels I & II (Clontech #K1420-1 & # K1421-1 ) according to the manufacturer's instructions. GAPDH was not tested against the prostate sample.
  • the positive confrol for Candidate 3 was IMAGE 2324560, obtained from the American Tissue Type Collection (Manassas, Virginia).
  • the cDNA samples present in each lane are as follows: lane 1, heart; lane 2, brain; lane 3, placenta; lane 4, lung; lane 5, liver; lane 6, skeletal muscle; lane 7, kidney; lane 8, pancreas; lane 9, spleen; lane 10, thymus; lane 11, prostate; lane 12, testis; lane 13, ovary; lane 14, small intestine; lane 15, colon; lane 16, peripheral blood leukocytes; lane 17, positive control; lane 18, negative control.
  • Figures 7A and 7B show PCR data of Candidate 3 expression (Figure 7A) and GAPDH expression (Figure 7B) in colon tumor samples.
  • the cDNA samples present in each lane are as follows: lane 1, grade 3 adenocarcinoma; lane 2, grade 2 adenocarcinoma; lane 3, grade 1 adenocarcinoma; lane 4, grade 2 adenocarcinoma; lane 5, colorectal cancer cell line HCT116; lane 6, positive control (IMAGE clone); lane 7, negative confrol.
  • the results shown in this figure indicate that candidate 3 is expressed in at least 3 of 4 colon tumor samples in addition to colorectal tumor cell line HCT116.
  • Figure 8 depicts E-Northern expression data for Loc 56926, which is overexpressed in colon cancer, as described in Example 4.
  • Figures 9A and 9B are PCR panels showing expression of Loc56926 (Figure 9A) and GAPDH ( Figure 9B) in malignant colon samples.
  • the cDNA samples present in each lane are as follows: lane M, marker; lane 1, no template control; lane 2 colon cancer 8T; lane 3, colon cancer DT; lane 4, colon cancer FT; lane 5, colon cancer GT; lane 6, colon cancer HT; lane 7, colon cancer IT; lane 8, colon cancer QT; lane 9, prostate cancer OT; lane 10, colon cancer RT; lane 11, colon cancer cell line HCT116; lane 12, positive control EST.
  • the results from this figure demonstrate that Loc56926 expression is present in cDNA from three of eight tested colon cancer samples.
  • Figures 10A and 10B are PCR panels showing expression of Loc56926 (Figure 10 A) and GAPDH (Figure 10B) in normal human tissues. Hybridization was performed using Human Multiple Tissue cDNA panel I (Clontech #K1420-1) according to the manufacturer's instructions.
  • the cDNA samples present in each lane are as follows: lane M, marker; lane 1, no template control; lane 2, colon tumor 8T; lane 3, colon tumor HT; lane 4, colon tumor RT; lane 5, colon cancer cell line HCT116; lane 6, normal colon; lane 7, normal brain; lane 8, normal heart; lane 9, kidney; lane 10, normal liver; lane 11, normal lung; lane 12, skeletal muscle; lane 13, normal pancreas; lane 14, normal placenta lane 15; EST control.
  • Loc56926 is present in colon tumors with light expression in the normal pancreas (note the increase in GAPDH in the pancreas lane compared to the colon tumor lanes) and not expressed at detectable levels the other tested normal human tissues.
  • Figures 11 A and 1 IB are PCR panels showing expression of Loc56926 (Figure 11 A) and GAPDH (Figure 1 IB) in human tissues. Hybridization was performed using Human Multiple Tissue cDNA panel II (Clontech # K1421-1) according to the manufacturer's instructions.
  • the cDNA samples present in each lane are as follows: lane M, marker; lane 1, no template control; lane 2, colon tumor 8T; lane 3, colon tumor HT; lane 4, colon tumor RT; lane 5, colon cancer cell line HCT116; lane 6, normal colon; lane 7, normal peripheral blood leukocytes; lane 8, small intestine; lane 9, normal ovary; lane 10, normal prostate; lane 11, normal spleen; lane 12, normal testis; lane 13, normal thymus; lane 14, EST confrol.
  • Figures 12A and 12B are PCR panels showing expression of Loc56926 (Figure 12A) and GAPDH ( Figure 12B) in normal brain tissue samples. Hybridization was performed using Normal Neural System cDNA panel (Biochain, C8234503, C8234504, C8234505).
  • the cDNA samples present in each lane are as follows: lane M, marker; lane 1, no template confrol; lane 2, cerebellum; lane 3, cerebral cortex; lane 4, medulla oblongata; lane 5, pons; lane 6, frontal lobe; lane 7, occipital lobe; lane 8, parietal lobe; lane 9, temporal lobe; lane 10, placental neural system; lane 11, EST control.
  • Figure 13 depicts E-Northern expression data for the AW779536 gene, which is overexpressed in colon cancer, as described in Example 4.
  • Figure 14 depicts E-Northern expression data for the AL531683 gene, which is overexpressed in colon cancer, as described in Example 4.
  • Figure 15 depicts E-Northern expression data for the AI202201 gene, which is overexpressed in colon cancer, as described in Example 4.
  • Figure 16 depicts E-Northern expression data for the AL389942 gene, which is overexpressed in colon cancer, as described in Example 4.
  • Figure 17 depicts E-Northern expression results for the Ly6G6Dgene, also described in Example 5.
  • Figure 18 depicts E-Northem expression results for FLJ32334, also described in Example 6.
  • the present invention relates to the identification of genes which are to be specifically expressed and upregulated in certain cancers, including colon or colorectal tumors. This was determined using the Gene Logic (Gaithersburg, Maryland) datasuite or Celera (Rockville, Maryland) database and by screening malignant colon tumor tissues as described in detail herein.
  • the present invention involves the discovery that certain genes, the nucleic acid sequences and predicted coding sequences of which are identified herein are specifically expressed in certain malignant tissues including colon or colorectal tumor tissues.
  • the disclosed therapies involve the synthesis of oligonucleotides having sequences in the antisense orientation relative to the genes identified by the present inventors which are specifically expressed by malignant tissues, including colon or colorectal tumors.
  • Suitable therapeutic antisense oligonucleotides typically vary in length from two to several hundred nucleotides in length, more typically about 50-70 nucleotides in length.
  • These antisense oligonucleotides can be administered as naked DNAs or in protected forms, e.g., encapsulated in liposomes.
  • liposomal or other protected forms may enhance in vivo stability and delivery to target sites, i.e., colon tumor cells.
  • the subject novel genes can be used to design novel ribozymes that target the cleavage ofthe corresponding mRNAs in colon and other tumor cells.
  • these ribozymes can be administered in free (naked) form or by the use of delivery systems that enhance stability and/or targeting, e.g., liposomes.
  • Ribozymal and antisense therapies used to target genes that are selectively expressed by cancer cells are well known in the art.
  • the present invention embraces the administration of use of DNAs that hybridize to the novel gene targets identified herein, attached to therapeutic effector moieties, for example radiolabels, including metallic and halogen isotopes (e.g., 90 yttrium, I31 iodine), cytotoxins, cytotoxic enzymes, in order to selectively target and kill cells that express these genes, . e. , colon tumor cells.
  • therapeutic effector moieties for example radiolabels, including metallic and halogen isotopes (e.g., 90 yttrium, I31 iodine), cytotoxins, cytotoxic enzymes, in order to selectively target and kill cells that express these genes, . e. , colon tumor cells.
  • the present invention encompasses non-nucleic acid based therapies, for example antigens encoded by the nucleic acids disclosed herein. It is anticipated that these antigens can be used as therapeutic or prophylactic anti-tumor vaccines.
  • antigens ofthe present invention can be admimstered with adjuvants that induce a cytotoxic T lymphocyte response.
  • Representative adjuvants include those disclosed in U.S. Patent Nos. 5,709,860, 5,695,770, and 5,585,103, which promote CTL responses against prostate and papillomavirus related human colon cancer. The disclosures of U.S. Patent Nos. 5,709,860, 5,695,770, and 5,585,103 are incorporated by reference in their entirety.
  • the disclosed antigens can be administered in combination with an adjuvant to elicit a humoral immune response against such antigens, thereby delaying or preventing the development of cancers (e.g., a colon cancer) associated with the overexpression ofthe antigens.
  • an adjuvant to elicit a humoral immune response against such antigens, thereby delaying or preventing the development of cancers (e.g., a colon cancer) associated with the overexpression ofthe antigens.
  • Embodiments ofthe invention comprise administration of one or more novel colon cancer antigens, for example in combination with an adjuvant.
  • a representative adjuvant is PRO VAX®, which comprises a microfluidized adjuvant containing Squalene, TWEEN® and PLURONIC®, in an amount sufficient to be therapeutically or prophylactically effective. See U.S. Patent Nos. 5,709,860, 5,695,770, and 5,585,103.
  • a typical dosage of formulated antigen ranges from about 50 to about 20,000 mg/kg body weight, or from about 100 to about 5000 mg/kg body weight.
  • the subject tumor-associated antigens can be administered with other adjuvants, e.g., ISCOM®, DETOXTM, SAF®, Freund's adjuvant, Alum, Saponin, among others.
  • the present invention provides methods for preparing monoclonal antibodies against the antigens encoded by the DNA sequences disclosed in the examples which are expressed specifically by certain malignant tissues including colon or colorectal tumor tissues.
  • Monoclonal antibodies are produced by conventional methods and include human monoclonal antibodies, humanized monoclonal antibodies, chimeric monoclonal antibodies, single chain antibodies, including scFv's and antigen-binding antibody fragments such as Fabs, 2 Fabs, and Fab' fragments.
  • monoclonal antibodies and fragments thereof for example by pepsin or papain-mediated cleavage, are well known in the art.
  • an appropriate (non-homologous) host is immunized with the subject colon cancer antigens, immune cells are isolated from the host and used to prepare hybridomas.
  • Monoclonal antibodies that specifically bind to either of such antigens are identified by routine screening techniques.
  • Useful monoclonal antibodies typically bind the target antigens with high affinity, e.g., possess a binding affinity (Kd) on the order of lO "6 to lO "10 M.
  • Monoclonal antibodies and fragments ofthe invention are useful for anti-tumor immunotherapy.
  • therapeutic effector moieties e.g., radiolabels, cytotoxins, therapeutic enzymes, agents that induce apoptosis
  • cytotoxicity i.e., killing of human colon tumor cells.
  • Antibodies and/or antibody fragments are administered to a subject in labeled or unlabeled form, alone or in combination with other therapeutics, such as chemotherapeutics such as progestin, EGFR, TAXOL®, and the like.
  • the administered composition can include a pharmaceutically acceptable carrier, and optionally adjuvants, stabilizers, etc., used in antibody compositions for therapeutic use.
  • the present invention also provides diagnostic methods for detection ofthe colon or colorectal tumor-specific genes disclosed herein. Diagnostic methods include detecting the expression of one or more of these genes at the DNA level or at the protein level. Patients who test positive for the disclosed tumor-specific genes diagnosed are identified as having or being at increased risk of developing colon cancer. Additionally, the levels of antigen expression can be useful in determining patient status, i.e., how far the disease has advanced. For example, the expression or expression level of a tumor-specific gene can indicate a particular stage of tumor progression.
  • gene expression is detected by known DNA detection methods, including but not limited to Northern blot hybridization, strand displacement amplification (SDA), catalytic hybridization amplification (CHA), PCR amplification (for example, using primers corresponding to the novel genes disclosed herein), and other known DNA detection methods.
  • SDA strand displacement amplification
  • CH catalytic hybridization amplification
  • PCR amplification for example, using primers corresponding to the novel genes disclosed herein
  • DNA detection methods for example, the presence or absence of cancer associated with the genes disclosed herein can be determined based on whether PCR products are obtained, and the level of expression. Expression levels can also be monitored to determine the prognosis of a colon cancer patient as the levels of expression ofthe PCR product likely increase as the disease progresses. Suitable controls and quantification is are performed for diagnostic methods as known in the art.
  • the status of a subject to be tested for colon cancer, or other cancer associated by overexpression of a gene disclosed herein can be evaluated by testing biological fluids, such as blood, urine, colon tissue, with an antibody or antibodies or fragment that specifically binds to the novel colon tumor antigens disclosed herein.
  • biological fluids such as blood, urine, colon tissue
  • an antibody or antibodies or fragment that specifically binds to the novel colon tumor antigens disclosed herein are well known and include ELISA, competitive binding assays, and the like.
  • Representative assays use an antibody or antibody fragment that specifically binds the target antigen directly or indirectly bound to a label that provides for detection, for example, a radiolabel, an enzyme, or a fluorophore.
  • the present invention provides novel genes and corresponding antigens that correlate to human colon cancer.
  • the present invention also embraces variants thereof.
  • variants is intended sequences that are at least 75% identical thereto, for example at least 85% identical, or at least 90% identical when these DNA sequences are aligned to the subject DNAs or a fragment thereof having a size of at least 50 nucleotides.
  • Representative variants include allelic variants.
  • the present invention also provides primers for amplification of nucleic acids encoding the subject novel genes or a portion thereof, which are present is a biological sample, for example, an mRNA library obtained from a desired cell source, including human colon cell or tissue samples.
  • primers are about 12 to 50 nucleotides in length and are constmcted such that they provide for amplification ofthe entire or most ofthe target gene.
  • the present invention further provides antigens encoded by the disclosed DNAs or fragments thereof that bind to or elicit antibodies specific to the full-length antigens. Typically, such fragments are at least 10 amino acids in length, more typically at least 25 amino acids in length.
  • the colon or colorectal tumor-specific genes ofthe invention are expressed in a majority of colon tumor samples tested. Some of these genes are also upregulated in other cancers. Thus, the present invention further contemplates identification of other cancers wherein the expression ofthe disclosed genes or variants thereof correlate to a cancer or an increased likelihood of cancer, for example breast, pancreas, lung or colon cancers. Also provided are compositions and methods to detect and treat such cancers.
  • isolated refers to any human protein that is not in its normal cellular millieu. This includes by way of example compositions comprising recombinant protein, pharmaceutical compositions comprising purified protein, diagnostic compositions comprising purified protein, and isolated protein compositions comprising protein.
  • an isolated protein comprises a substantially pure protein, in that it is substantially free of other proteins, for example, at least 90% pure, that comprises the amino acid sequence disclosed herein or natural homologues or mutants having essentially the same sequence. A naturally occurring mutant might be found, for instance, in tumor cells expressing a gene encoding a mutated protein sequence.
  • Native human protein refers to a protein that comprises the amino acid sequence of the protein expressed in its endogenous environment, i.e., a human colon or colorectal tumor tissue.
  • “Native non-human primate protein” refers to a protein that is a non-human primate homologue ofthe protein having the amino acid sequence discussed in the examples. Given the phylogenetic closeness of humans to other primates, it is anticipated that human and non- human proteins expressed by the genes disclosed in the examples have non-human primate counterparts that possess amino acid sequences that are highly similar, such as 95% sequence identity or higher.
  • isolated human or non-human primate nucleic acid molecule or sequence refers to a nucleic acid molecule that encodes human protein which is not in its normal human cellular millieu, e.g., is not comprised in the human or non-human primate chromosomal DNA.
  • a promoter or a DNA encoding a detectable marker or effector moiety Representative nucleic acid sequence encoding human proteins are disclosed herein. Also included are natural homologues or mutants having substantially the same sequence. Naturally occurring homologies that are degenerate would encode the same protein as discussed herein in the examples, but would include nucleotide differences that do not change the corresponding amino acid sequence. Naturally occurring mutants might be found in tumor cells, wherein such nucleotide differences result in a mutant protein. Naturally occurring homologues containing conservative substitutions are also encompassed.
  • Variant of human or non-human primate protein refers to a protein possessing an amino acid sequence that possess at least 90% sequence identity, such as at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, and including at least 99% sequence identity, to the corresponding native human or non-human primate protein wherein sequence identity is as defined herein.
  • a variant possesses at least one biological property in common with the human or non-human protein.
  • Variant of human or non-human primate nucleic acid molecule or sequence refers to a nucleic acid sequence that possesses at least 90% sequence identity, such as at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98% sequence identity, and including at least 99% sequence identity, to the corresponding native human or non-human primate nucleic acid sequence, wherein "sequence identity" is as defined herein.
  • “Fragment of human or non-human primate nucleic acid molecule or sequence” refers to a nucleic acid sequence corresponding to a portion ofthe native human nucleic acid sequence discussed herein in the examples or a primate native non-human homolog molecule, wherein said portion is at least about 50 nucleotides in length, or 100, for example, at least 200 or 300 nucleotides in length.
  • Antigenic fragments of colon or colorectal refer to polypeptides corresponding to a fragmentt o ⁇ f colon antigen encoded by any ofthe genes disclosed herein or a variant or homologue thereof that when used itself or attached to an immunogenic carrier that elicits antibodies that specifically bind the protein.
  • antigenic fragments are at least 20 amino acids in length.
  • Sequence identity or percent identity is intended to mean the percentage ofthe same residues shared between two sequences, referenced to the human DNA or amino acid sequences disclosed herein, when the two sequences are aligned using the Clustal method [Higgins et al, Cabios 8:189-191 (1992)] of multiple sequence alignment in the Lasergene biocomputing software (DNASTAR, INC. of Madison, Wisconsin). In this method, multiple alignments are carried out in a progressive manner, in which larger and larger alignment groups are assembled using similarity scores calculated from a series of pairwise alignments.
  • Optimal sequence alignments are obtained by finding the maximum alignment score, which is the average of all scores between the separate residues in the alignment, determined from a residue weight table representing the probability of a given amino acid change occurring in two related proteins over a given evolutionary interval. Penalties for opening and lengthening gaps in the alignment contribute to the score.
  • the residue weight table used for the alignment program is PAM25O [Dayhoffet al., in Atlas of Protein Sequence and Stracture, Dayhoff, Ed., NDRF, Washington, Vol. 5, suppl. 3, p. 345, (1978)].
  • Percent conservation is calculated from the above alignment by adding the percentage of identical residues to the percentage of positions at which the two residues represent a conservative substitution (defined as having a log odds value of greater than or equal to 0.3 in the PAM250 residue weight table).
  • Conservation is referenced to a human gene ofthe invention when determining percent conservation with a non-human gene and when determining percent conservation.
  • Conservative amino acid changes satisfying this requirement include: R-K; E-D, Y-F, L-M; V-I, Q-H.
  • polypeptide fragments ofthe disclosed proteins can comprise at least 8 amino acid residues, such as at least 25 or at least 50 amino acid residues of human or non-human primate gene according to the invention or an analogue thereof.
  • Polypeptide fragments can also comprise at least 75, 100, 125, 150, 175, 200, 225, 250, or 275 residues ofthe polypeptide encoded by gene the subject genes which are specifically expressed by certain human colon or colorectal as well as some other tumor tissues.
  • a protein fragment can also comprise a majority ofthe native protein colon or colorectal protein, i.e. at least about 100 contiguous residues ofthe native colon or colorectal protein antigen.
  • the invention also encompasses biologically active mutants of protein colon or colorectal proteins according to the invention, which comprise an amino acid sequence that is at least 80%, for example, 90% or 95-99% similar to the subject tumor-associated proteins.
  • Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, such as DNASTAR software.
  • Protein variants can include conoservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. A conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains.
  • Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.
  • mutants are a group of polypeptides in which neutral amino acids, such as serines, are substituted for cysteine residues which do not participate in disulfide bonds. These mutants may be stable over a broader temperature range than native secreted proteins. See Mark et al, U.S. Patent 4,959,314.
  • Human or non-human primate protein variants include glycosylated forms, aggregative conjugates with other molecules, and covalent conjugates with unrelated chemical moieties. Also, protein variants also include allelic variants, species variants, and muteins. Truncations or deletions of regions which do not affect the differential expression ofthe protein gene are also variants. Covalent variants can be prepared by linking functionalities to groups which are found in the amino acid chain or at the N- or C-terminal residue, as is known in the art.
  • polypeptides ofthe present invention can include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
  • the invention further includes variations ofthe protein subject colon or colorectal which show comparable expression patterns or which include antigenic regions.
  • Protein mutants include deletions, insertions, inversions, repeats, and type substitutions.
  • Guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie, J.U., et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990).
  • charged amino acids can be substituted with another charged amino acid, or with neutral or negatively charged amino acids.
  • the latter results in proteins with reduced positive charge to improve the characteristics ofthe disclosed protein.
  • the prevention of aggregation is highly desirable. Aggregation of proteins not only results in a loss of activity but can also be problematic when preparing pharmaceutical formulations, because they can be immunogenic. (Pinckard et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36:838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993)).
  • Amino acids in the polypeptides ofthe present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine- scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as binding to a natural or synthetic binding partner. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., JMol. Biol. 224:899-904 (1992) and de Vos et al. Science 255: 306-312 (1992)).
  • amino acid substitutions often do not significantly affect the folding or activity ofthe protein.
  • a skilled artisan could determine an appropriate number and nature of amino acid substitutions based on factors as described above. Generally speaking, the number of substitutions for any given polypeptide are fewer than 50, 40, 30, 25, 20, 15, 10, 5 or 3 residues.
  • Fusion proteins comprising proteins or polypeptide fragments ofthe subject colon or colorectal proteins can also be constructed. Fusion proteins are useful for generating antibodies against amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with a protein ofthe invention or which interfere with its biological function. Physical methods, such as protein affinity chromatography, or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can also be used for this purpose. The foregoing can also be adapted as a screening technique.
  • Fusion proteins comprising a signal sequence and or a transmembrane domain of a protein according to the invention or a fragment thereof can be used to target other protein domains to cellular locations in which the domains are not normally found, such as bound to a cellular membrane or secreted extracellularly.
  • a fusion protein comprises two protein segments fused together by means of a peptide bond.
  • Amino acid sequences for use in fusion proteins ofthe invention can utilize any ofthe amino acid sequences or encoded by the nucleotide sequences disclosed herein, or can be prepared from biologically active variants or fragment of said protein sequence, such as those described above.
  • the first protein segment can consist of a full-length protein or a variant or fragment thereof. These fragments can range in size from about 8 amino acids up to the full length ofthe protein.
  • the second protein segment can be a full-length protein or a polypeptide fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags can be used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
  • fusions can be made, for example, by covalently linking two protein segments or by standard procedures in the art of molecular biology.
  • Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises a coding sequence encoding an amino acid sequence according to the invention in proper reading frame with a nucleotide encoding the second protein segment and expressing the DNA construct in a host cell, as is known in the art.
  • Many kits for constructing fusion proteins are available from companies that supply research labs with tools for experiments, including, for example, Promega Corporation (Madison, Wl), Stratagene (La Jolla, CA), Clontech (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL
  • Proteins, fusion proteins, or polypeptides ofthe invention can be produced by recombinant DNA methods.
  • a sequence listing encoding one ofthe subject colon or colorectal proteins can be expressed in prokaryotic or eukaryotic host cells using expression systems known in the art. These expression systems include bacterial, yeast, insect, and mammalian cells.
  • the resulting expressed protein can then be purified from the culture medium or from extracts ofthe cultured cells using purification procedures known in the art. For example, for proteins fully secreted into the culture medium, cell-free medium can be diluted with sodium acetate and contacted with a cation exchange resin, followed by hydrophobic interaction chromatography. Using this method, the desired protein or polypeptide is typically greater than 95% pure. Further purification can be undertaken, using, for example, any ofthe techniques listed above.
  • Proteins can be further modified, for example by phosphorylation or glycosylation of the appropriate sites, in order to obtain a functional protein.
  • Covalent attachments can be made using known chemical or enzymatic methods.
  • Human or non-human primate proteins according to the invention or polypeptide of the invention can also be expressed in cultured host cells in a form that facilitates purification.
  • a protein or polypeptide can be expressed as a fusion protein comprising, for example, maltose binding protein, glutathione-S-transferase, or thioredoxin, and purified using a commercially available kit. Kits for expression and purification of such fusion proteins are available from companies such as New England BioLabs, Pharmacia, and Invifrogen. Proteins, fusion proteins, or polypeptides can also be tagged with an epitope, such as a "Flag" epitope (Kodak), and purified using an antibody which specifically binds to that epitope.
  • an epitope such as a "Flag" epitope (Kodak)
  • transgenic animals such as mice, rats, guinea pigs, cows, goats, pigs, or sheep.
  • Female transgenic animals can then produce proteins, polypeptides, or fusion proteins ofthe invention in their milk. Methods for constructing such animals are known and widely used in the art.
  • synthetic chemical methods such as solid phase peptide synthesis, can be used to synthesize a secreted protein or polypeptide.
  • General means for the production of peptides, analogs or derivatives are outlined in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins - A Survey of Recent Developments, B. Weinstein, ed. (1983).
  • Substitution of D-amino acids for the normal L-stereoisomer can be carried out to increase the half-life ofthe molecule.
  • homologous polynucleotide sequences can be confirmed by hybridization under stringent conditions, as is known in the art.
  • homologous sequences can be identified which contain at most about 25-30% base pair mismatches.
  • homologous nucleic acids can contain 15-25% base pair mismatches or fewer, for example about 5-15% base pair mismatches.
  • the invention also provides polynucleotide probes which can be used to detect complementary nucleotide sequences, for example, in hybridization protocols such as Northern or Southern blotting or in situ hybridizations.
  • Polynucleotide probes ofthe invention comprise at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, or 40 or more contiguous nucleotides ofthe gene A and gene B nucleic acid sequences provided herein.
  • Polynucleotide probes ofthe invention can comprise a detectable label, such as a radioisotopic, fluorescent, enzymatic, or chemiluminescent label.
  • Isolated genes corresponding to the cDNA sequences disclosed herein are also provided. Standard molecular biology methods can be used to isolate the corresponding genes using the cDNA sequences provided herein. These methods include preparation of probes or primers based on the disclosed sequences for use in identifying or amplifying the genes from mammalian, including human, genomic libraries or other sources of human genomic DNA.
  • Polynucleotide molecules ofthe invention can also be used as primers to obtain additional copies of the polynucleotides, using polynucleotide amplification methods.
  • Polynucleotide molecules can be propagated in vectors and cell lines using techniques well known in the art. Polynucleotide molecules can be on linear or circular molecules. They can be on autonomously replicating molecules or on molecules without replication sequences. They can be regulated by their own or by other regulatory sequences, as is known in the art.
  • Polynucleotide molecules comprising the coding sequences disclosed herein can be used in a polynucleotide construct, such as a DNA or RNA construct.
  • Polynucleotide molecules ofthe invention can be used, for example, in an expression construct to express all or a portion of a protein, variant, fusion protein, or single-chain antibody in a host cell.
  • An expression construct comprises a promoter which is functional in a chosen host cell. The skilled artisan can readily select an appropriate promoter from the large number of cell type- specific promoters known and used in the art.
  • the expression construct can also contain a transcription terminator which is functional in the host cell.
  • the expression construct comprises a polynucleotide segment which encodes all or a portion ofthe desired protein. The polynucleotide segment is located downstream from the promoter. Transcription ofthe polynucleotide segment initiates at the promoter.
  • the expression construct can be linear or circular and can contain sequences, if desired, for
  • polynucleotide molecules comprising human or non-human primate gene promoter and UTR sequences, operably linked to either protein coding sequences or other sequences encoding a detectable or selectable marker.
  • Promoter and/or UTR-based constructs are useful for studying the transcriptional and translational regulation of protein expression, and for identifying activating and/or inhibitory regulatory proteins.
  • An expression construct can be introduced into a host cell.
  • the host cell comprising the expression construct can be any suitable prokaryotic or eukaryotic cell.
  • Expression systems in bacteria include those described in Chang et al, Nature 275:615 (1978); Goeddel et al, Nature 281: 544 (1979); Goeddel et al, Nucleic Acids Res. 8:4057 (1980); EP 36,776;
  • Mammalian expression can be accomplished as described in Dijkema et al, EMBO J. 4: 761(1985); Gormanetal, Proc. Natl. Acad. Sci. USA 79: 6777 (1982b); Boshart et al, Cell 41: 521 (1985); and U.S. 4,399,216.
  • Other features of mammalian expression can be facilitated as described in Ham and Wallace, Meth Enz. 58: 44 (1979); Barnes and Sato, Anal. Biochem. 102: 255 (1980); U.S. 4,767,704; U.S. 4,657,866; U.S. 4,927,762; U.S. 4,560,655; WO 90/103430, WO 87/00195, and U.S. RE 30,985.
  • Expression constructs can be introduced into host cells using any technique known in the art. These techniques include transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and calcium phosphate-mediated transfection.
  • Expression of an endogenous gene encoding a protein ofthe invention can also be manipulated by introducing by homologous recombination a DNA construct comprising a transcription unit in frame with the endogenous gene, to form a homologously recombinant cell comprising the transcription unit.
  • the transcription unit comprises a targeting sequence, a regulatory sequence, an exon, and an unpaired splice donor site.
  • the new transcription unit can be used to turn the endogenous gene on or off as desired. This method of affecting endogenous gene expression is taught in U.S. Patent 5,641,670.
  • the targeting sequence is a segment of at least 10, 12, 15, 20, or 50 contiguous nucleotides ofthe nucleotide sequences disclosed herein.
  • the transcription unit is located upstream to a coding sequence ofthe endogenous gene.
  • the exogenous regulatory sequence directs transcription ofthe coding sequence ofthe endogenous gene.
  • Human or non-human primate protein can also include hybrid and modified forms thereof including fusion proteins, fragments and hybrid and modified forms in which certain amino acids have been deleted or replaced, modifications such as where one or more amino acids have been changed to a modified amino acid or unusual amino acid.
  • any human or non-human primate protein which shows cross-reactivity with antibodies to a gene described herein or whose encoding nucleotide sequences including genomic DNA, mRNA or cDNA are isolated through hybridization with the complementary sequence of genomic or subgenomic nucleotide sequences or cDNA of a gene disclosed herein or a fragment thereof.
  • Degenerate DNA sequences that encode human or non-human primate proteins are also included within the present invention as are allelic variants of.
  • Colon or colorectal proteins ofthe invention can be prepared using recombinant DNA techniques.
  • pure form or “purified form” or “substantially purified form” it is meant that a protein composition is substantially free of other proteins which are not protein.
  • the present invention also includes therapeutic or pharmaceutical compositions comprising human or non-human primate proteins, fragments or variants according to the invention in an effective amount for treating patients with disease, and a method comprising administering a therapeutically effective amount of a protein according to the invention.
  • These compositions and methods are useful for treating cancers associated with a protein according to the invention, e.g. colon cancer.
  • One skilled in the art can readily use a variety of assays known in the art to determine whether a protein according to the invention would be useful in promoting survival or functioning in a particular cell type.
  • anti-sense oligonucleotides can be made specific to genes disclosed herein and a method utilized for diminishing the level of expression a protein according to the invention by a cell comprising administering one or more gene anti-sense oligonucleotides.
  • gene specific anti-sense oligonucleotides reference is made to oligonucleotides that have a nucleotide sequence that interacts through base pairing with a specific complementary nucleic acid sequence involved in the expression of a gene according to the invention that the expression ofthe gene is reduced.
  • Nucleic acids involved in the expression ofthe subject gene include genomic DNA and mRNA that encode a colon or colorectal gene disclosed herein.
  • This genomic DNA molecule can comprise regulatory regions ofthe gene, or the coding sequence for mature gene encoded by the gene.
  • the term complementary to a nucleotide sequence in the context of antisense oligonucleotides and methods therefor means sufficiently complementary to such a sequence as to allow hybridization to that sequence in a cell, i.e., under physiological conditions.
  • the antisense oligonucleotides can comprise a sequence containing from about 8 to about 100 nucleotides, including antisense oligonucleotides that comprise from about 15 to about 30 nucleotides.
  • the antisense oligonucleotides can also contain a variety of modifications that confer resistance to nucleolytic degradation such as, for example, modified intemucleoside linages [Uhlmann and Peyman, Chemical Reviews 90:543-548 (1990); Schneider and Banner, Tetrahedron Lett. 31:335, (1990) which are incorporated by reference], modified nucleic acid bases as disclosed in 5,958,773 and patents disclosed therein, and/or sugars and the like.
  • modified intemucleoside linages Uhlmann and Peyman, Chemical Reviews 90:543-548 (1990); Schneider and Banner, Tetrahedron Lett. 31:335, (1990) which are incorporated by reference
  • modified nucleic acid bases as disclosed in 5,958,773 and patents disclosed therein, and/or sugars and the like.
  • the antisense compounds ofthe invention can include modified bases.
  • the antisense oligonucleotides ofthe invention can also be modified by chemically linking the oligonucleotide to one or more moieties or conjugates to enhance the activity, cellular distribution, or cellular uptake ofthe antisense oligonucleotide.
  • Representative moieties or conjugates include lipids such as cholesterol, cholic acid, thioether, aliphatic chains, phospholipids, polyamines, polyethylene glycol (PEG), palmityl moieties, and others as disclosed in, for example, U.S. Patents 5,514,758, 5,565,552, 5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,597,696 and 5,958,773.
  • Chimeric antisense oligonucleotides are also within the scope ofthe invention, and can be prepared from the present inventive oligonucleotides using the methods described in, for example, U.S. Patents 5,013,830, 5,149,797, 5,403,711, 5,491,133, 5,565,350, 5,652,355, 5,700,922 and 5,958,773.
  • Select of optimal antisense molecules for particular targets typically involves routine screening of a number of candidate molecules.
  • An antisense molecule can be targeted to an accessible, or exposed, portion ofthe target RNA molecule. Although in some cases information is available about the stracture of target mRNA molecules, the current approach to inhibition using antisense is via experimentation.
  • mRNA levels in the cell can be measured routinely in treated and control cells by reverse transcription ofthe mRNA and assaying the cDNA levels.
  • the biological effect can be determined routinely by measuring cell growth or viability as is known in the art. Measuring the specificity of antisense activity by assaying and analyzing cDNA levels is an art-recognized method of validating antisense results. It has been suggested that RNA from treated and control cells should be reverse-transcribed and the resulting cDNA populations analyzed. [Branch, A. D., T.I.B.S. 23:45-50 (1998)].
  • compositions ofthe present invention can be administered by any suitable route known in the art including for example intravenous, subcutaneous, intramuscular, transdermal, intrathecal or infracerebral. Administration can be either rapid as by injection or over a period of time as by slow infusion or administration of slow release formulation.
  • a human or non-human primate protein according to the invention can also be linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties.
  • the protein can be coupled to any substance known in the art to promote penetration or transport across the blood-brain barrier such as an antibody to the transferrin receptor, and administered by intravenous injection (see, for example, Friden et al., Science 259:373-377 (1993) which is incorporated by reference).
  • the subject protein can be stably linked to a polymer such as polyethylene glycol to obtain desirable properties of solubility, stability, half-life and other pharmaceutically advantageous properties.
  • a polymer such as polyethylene glycol
  • compositions are usually employed in the form of pharmaceutical preparations, which are made in a manner well known in the pharmaceutical art. See, e.g. Remington Pharmaceutical Science, 18th Ed., Merck Publishing Co. Eastern PA, (1990).
  • Physiological saline solutions can be used, as well as other pharmaceutically acceptable carriers such as physiological concentrations of other non-toxic salts, five percent aqueous glucose solution, sterile water and the like.
  • Compositions ofthe invention can also include a suitable buffer.
  • such solutions can be lyophilized and stored in a sterile ampoule ready for reconstitution by the addition of sterile water for ready injection.
  • the primary solvent can be aqueous or alternatively non-aqueous.
  • the subject human or primate protein, fragment or variant thereof can also be incorporated into a solid or semi-solid biologically compatible matrix which can be implanted into tissues requiring treatment.
  • the carrier can also contain other pharmaceutically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor ofthe formulation.
  • the carrier can contain still other pharmaceutically-acceptable excipients for modifying or maintaining release or absorption or penetration across the blood-brain barrier.
  • Excipients are those substances usually and customarily employed to formulate dosages for parenteral administration in either unit dosage or multi-dose form or for direct infusion into the cerebrospinal fluid by continuous or periodic infusion.
  • Dose administration can be repeated depending upon the pharmacokinetic parameters ofthe dosage formulation and the route of administration used. It is also contemplated that certain formulations containing a protein according to the invention or variant or fragment thereof are to be administered orally. Protein formulations can be encapsulated and formulated with suitable carriers in solid dosage forms.
  • suitable carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, calcium silicate, microcrystalline cellulose, polyvinylpyrrohdone, cellulose, gelatin, syrap, methyl cellulose, methyl- and propylhydroxybenzoates, talc, magnesium, stearate, water, mineral oil, and the like.
  • the formulations can additionally include lubricating agents, wetting agents, emulsifying and suspending agents, preserving agents, sweetening agents or flavoring agents.
  • compositions can be formulated so as to provide rapid, sustained, or delayed release of the active ingredients after administration to the patient by employing procedures well known in the art.
  • the formulations can also contain substances that diminish proteolytic degradation and promote absorption such as, for example, surface active agents.
  • the specific dose is calculated according to the approximate body weight or body surface area ofthe patient or the volume of body space to be occupied. The dose also depends on the particular route of admimsfration selected. Further refinement of the calculations necessary to determine the appropriate dosage for treatment is routinely made by those of ordinary skill in the art. Following a review ofthe present disclosure, an effective dosage can be determined without undue experimentation. Exact dosages are determined in conjunction with standard dose-response studies. The amount ofthe composition actually administered can be determined by a practitioner, in the light ofthe relevant circumstances including the condition or conditions to be treated, the choice of composition to be administered, the age, weight, and response ofthe individual patient, the severity ofthe patient's symptoms, and the chosen route of administration.
  • a protein ofthe present invention is therapeutically administered by implanting into patients vectors or cells capable of producing a biologically-active form of the protein or a precursor ofthe protein, i.e., a molecule that can be readily converted to a biological-active form ofthe by the body.
  • cells that secrete the protein can be encapsulated into semipermeable membranes for implantation into a patient.
  • the cells can be cells that normally express the protein or a precursor thereof or the cells can be transformed to express the protein or a precursor thereof.
  • a human protein can be used, or a non-human primate protein homolog of a human protein can be used.
  • detection as used herein in the context of detecting the presence of a cancer gene according to the invention in a patient is intended to include the determining of the amount of protein according to the invention or the ability to express an amount of this protein in a patient, the estimation of prognosis in terms of probable outcome of a disease and prospect for recovery, the monitoring of these protein levels over a period of time as a measure of status ofthe condition, and the monitoring of colon or colorectal protein according to the invention for determining an effective therapeutic regimen for the patient, e.g. one with colon cancer.
  • a sample is obtained from the patient.
  • the sample can be a tissue biopsy sample or a sample of blood, plasma, serum, CSF or the like. It has been found that the subject genes are expressed at high levels in some cancers, e.g., colon or colorectal cancers. Samples for detecting protein can be taken from these tissue. When assessing peripheral levels of protein, a sample of blood, plasma or serum can be used. When assessing the levels of protein in the central nervous system, samples can be obtained from cerebrospinal fluid or neural tissue. In some instances, it is desirable to determine whether a gene according to the invention is intact in the patient or in a tissue or cell line within the patient.
  • a method for detecting and characterizing any alterations in the gene.
  • the method comprises providing an oligonucleotide that contains the gene corresponding cDNA, genomic DNA or a fragment thereof or a derivative thereof.
  • a derivative of an oligonucleotide it is meant that the derived oligonucleotide is substantially the same as the sequence from which it is derived in that the derived sequence has sufficient sequence complementarily to the sequence from which it is derived to hybridize specifically to the gene.
  • a nucleic acid ofthe invention can be isolated, chemically synthesized, of recombinantly produced (e.g., using in vitro DNA replication, reverse transcription, or transcription).
  • patient genomic DNA is isolated from a cell sample from the patient and digested with one or more restriction endonucleases such as, for example, Taql and Alul.
  • this assay determines whether a patient or a particular tissue in a patient has an intact gene according to the invention or a gene abnormality.
  • Hybridization to a gene according to the invention would involve denaturing the chromosomal DNA to obtain a single-stranded DNA; contacting the single-stranded DNA with a gene probe associated with the gene sequence; and identifying the hybridized DNA- probe to detect chromosomal DNA containing at least a portion of a human gene according to the invention.
  • probe refers to a stracture comprised of a polynucleotide that forms a hybrid stracture with a target sequence, due to complementarity of probe sequence with a sequence in the target region.
  • Oligomers suitable for use as probes typically contain at least about 8-12 contiguous nucleotides which are complementary to the targeted sequence, for example 20 nucleotides.
  • Probes ofthe present invention can be DNA or RNA oligonucleotides and can be made by any method known in the art such as, for example, excision, transcription or chemical synthesis. Probes can be labeled with any detectable label known in the art such as, for example, radioactive or fluorescent labels or enzymatic marker.
  • Labeling ofthe probe can be accomplished by any method known in the art such as by PCR, random priming, end labeling, nick translation or the like. Methods that do not employ a labeled probe can also be used to determine the hybridization. Representative techniques include Southern blotting, fluorescence in situ hybridization, and single-strand conformation polymo ⁇ hism with PCR amplification.
  • Hybridization is typically carried out at about 25° - 45° C, or at about 32° -40° C, or at about 37° - 38° C. Hybridization can proceed for about 0.25 hour to about 96 hours, or from about 1 (one) hour to about 72 hours, or from about 4 hours to about 24 hours. Gene abnormalities can also be detected by using the PCR method and primers that flank or lie within the particular gene.
  • the PCR method is well known in the art. Briefly, this method is performed using two oligonucleotide primers which are capable of hybridizing to the nucleic acid sequences flanking a target sequence that lies within gene and amplifying the target sequence.
  • oligonucleotide primer refers to a short strand of DNA or RNA ranging in length from about 8 to about 30 bases.
  • the upstream and downstream primers are typically from about 20 to about 30 base pairs in length and hybridize to the flanking regions for replication ofthe nucleotide sequence.
  • the polymerization is catalyzed by a DNA-polymerase in the presence of deoxynucleotide triphosphates or nucleotide analogs to produce double-stranded DNA molecules.
  • the double strands are then separated by any denaturing method including physical, chemical or enzymatic.
  • a method of physical denaturation involving heating the nucleic acid, typically to temperatures from about 80°C to 105°C for times ranging from about 1 to about 10 minutes. The process is repeated for the desired number of cycles.
  • the primers are selected to be substantially complementary to the strand of DNA being amplified. Therefore, the primers need not reflect the exact sequence ofthe template, but must be sufficiently complementary to selectively hybridize with the sfrand being amplified.
  • the DNA sequence comprising a gene ofthe invention or a fragment thereof is then directly sequenced and analyzed by comparison ofthe sequence with the sequences disclosed herein to identify alterations which might change activity or expression levels or the like.
  • a method for detecting protein a colon according to the invention is provided based upon an analysis of tissue expressing the gene. Certain tissues such as breast, lung, colon and others can be analyzed. The method comprises hybridizing a polynucleotide to mRNA from a sample of tissue that normally expresses the gene. The sample is obtained from a patient suspected of having an abnormality in the gene. To detect the presence of mRNA encoding protein a colon or colorectal protein according to the invention is obtained from a patient. The sample can be from blood or from a tissue biopsy sample. The sample can be treated to extract the nucleic acids contained therein. The resulting nucleic acid from the sample is subjected to gel electrophoresis or other size separation techniques. The mRNA ofthe sample is contacted with a DNA sequence serving as a probe to form hybrid duplexes. The use of a labeled probes as discussed above allows detection ofthe resulting duplex.
  • high stringency conditions can be used in order to prevent false positives, that is the hybridization and apparent detection ofthe gene nucleotide sequences when in fact an intact and functioning gene is not present.
  • sequences derived from the gene or cDNA less stringent conditions could be used, however, are less preferred because ofthe likelihood of false positives.
  • the stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, length of time and concentration of formamide. These factors are outlined in, for example, Sambrook et al. [Sambrook et al. (1989), supra].
  • RT/PCR reverse transcription polymerization chain reaction
  • the method of RT/PCR is well known in the art, and can be performed as follows.
  • Total cellular RNA is isolated by, for example, the standard guanidium isothiocyanate method and the total RNA is reverse transcribed.
  • the reverse transcription method involves synthesis of DNA on a template of RNA using a reverse transcriptase enzyme and a 3' end primer. Typically, the primer contains an oligo(dT) sequence.
  • the cDNA thus produced is then amplified using the PCR method and specific primers.
  • the polymerase chain reaction method is performed as described above using two oligonucleotide primers that are substantially complementary to the two flanking regions of the DNA segment to be amplified. Following amplification, the PCR product is then electrophoresed and detected by ethidium bromide staining or by phosphoimaging.
  • the present invention further provides for methods to detect the presence of a colon or colorectal protein in a sample obtained from a patient.
  • any method known in the art for detecting proteins can be used. Representative methods include, but are not limited to immunodiffusion, immunoelectrophoresis, immunochemical methods, binder-ligand assays, immunohistochemical techniques, agglutination and complement assays. [Basic and Clinical Immunology, 217-262, Sites and Terr, eds., Appleton & Lange, Norwalk, CT, (1991), which is inco ⁇ orated by reference].
  • binder-ligand immunoassays can be used, which involve reacting antibodies with an epitope or epitopes of a colon protein ofthe invention and competitively displacing a labeled protein or derivative thereof.
  • a derivative of a protein according to the invention is intended to include a polypeptide in which certain amino acids have been deleted or replaced or changed to modified or unusual amino acids wherein the derivative is biologically equivalent to the gene and wherein the polypeptide derivative cross-reacts with antibodies raised against the protein.
  • cross-reaction it is meant that an antibody reacts with an antigen other than the one that induced its formation.
  • Numerous competitive and non-competitive protein-binding immunoassays are well known in the art. Antibodies employed in such assays can be unlabeled, for example as used in agglutination tests, or labeled for use in a wide variety of assay methods.
  • Labels that can be used include radionuclides, enzymes, fluorescers, chemiluminescers, enzyme substrates or co-factors, enzyme inhibitors, particles, dyes and the like for use in radioinununoassay (RIA), enzyme immunoassays, e.g., enzyme-linked immunosorbent assay (ELISA), fluorescent immunoassays and the like.
  • RIA radioinununoassay
  • ELISA enzyme-linked immunosorbent assay
  • fluorescent immunoassays and the like.
  • polyclonal or monoclonal antibodies to the subject non-human primate or human proteins or according to the invention an epitope thereof can be made for use in immunoassays by any of a number of methods known in the art.
  • epitope reference is made to an antigenic determinant of a polypeptide.
  • An epitope could comprise 3 amino acids in a spatial conformation which is unique to the epitope. Generally an epitope consists of at least 5 such amino acids. Methods of determining the spatial conformation of amino acids are known in the art, and include, for example, x-ray crystallography and 2 dimensional nuclear magnetic resonance.
  • One approach for preparing antibodies to a protein is the selection and preparation of an amino acid sequence of all or part ofthe protein, chemically synthesizing the sequence and injecting it into an appropriate animal, typically a rabbit, hamster or a mouse.
  • Oligopeptides can be selected as candidates for the production of an antibody to the subject colon or colorectal protein based upon the oligopeptides lying in hydrophilic regions, which are thus likely to be exposed in the mature protein.
  • Additional oligopeptides can be determined using, for example, the Antigenicity Index, Welling, G.W. et al., FEBSLett. 188:215-218 (1985), inco ⁇ orated herein by reference.
  • humanized monoclonal antibodies are provided, wherein the antibodies are specific for a protein according to the invention.
  • the phrase "humanized antibody” refers to an antibody derived from a non-human antibody, typically a mouse monoclonal antibody.
  • a humanized antibody can be derived from a chimeric antibody that retains or substantially retains the antigen-binding properties of the parental, non-human, antibody but which exhibits diminished immunogenicity as compared to the parental antibody when administered to humans.
  • chimeric antibody refers to an antibody containing sequence derived from two different antibodies (see, e.g., U.S. Patent No. 4,816,567) which typically originate from different species. Most typically, chimeric antibodies comprise human and murine antibody fragments generally human constant and mouse variable regions.
  • humanized antibodies are far less immunogenic in humans than the parental mouse monoclonal antibodies, they can be used for the treatment of humans with far less risk of anaphylaxis. Thus, these antibodies are useful in therapeutic applications that involve in vivo administration to a human such as, e.g., use as radiation sensitizers for the treatment of neoplastic disease or use in methods to reduce the side effects of, e.g., cancer therapy.
  • Humanized antibodies can be prepared using a variety of techniques including, for example: (1) grafting the non-human complementarity determining regions (CDRs) onto a human framework and constant region (a process referred to in the art as “humanizing”), or, alternatively, (2) transplanting the entire non-human variable domains, but “cloaking” them with a human-like surface by replacement of surface residues (a process referred to in the art as “veneering”).
  • humanized antibodies include both “humanized” and “veneered” antibodies. These methods are disclosed in, e.g., Jones et al., Nature 321:522-525 (1986); Morrison et al., Proc. Natl. Acad.
  • complementarity determining region refers to amino acid sequences which together define the binding affinity and specificity ofthe natural Fv region of a native immunoglobulin-binding site. See, e.g., Chothia et al., J. Mol. Biol 196:901-917 (1987);
  • constant region refers to the portion ofthe antibody molecule that confers effector functions.
  • mouse constant regions are substituted by human constant regions.
  • the constant regions ofthe subject-humanized antibodies are derived from human immunoglobulins.
  • the heavy chain constant region can be selected from any ofthe five isotypes: alpha, delta, epsilon, gamma or mu.
  • One method of humanizing antibodies comprises aligning the non-human heavy and light chain sequences to human heavy and light chain sequences, selecting and replacing the non-human framework with a human framework based on such alignment, molecular modeling to predict the conformation ofthe humanized sequence and comparing to the conformation ofthe parent antibody. This process is followed by repeated back mutation of residues in the CDR region which disturb the stracture ofthe CDRs until the predicted conformation ofthe humanized sequence model closely approximates the conformation of the non-human CDRs ofthe parent non-human antibody.
  • Humanized antibodies can be further derivatized to facilitate uptake and clearance, e.g, via Ashwell receptors. See, e.g.,
  • Humanized antibodies to proteins according to the invention can also be produced using transgenic animals that are engineered to contain human immunoglobulin loci.
  • transgenic animals that are engineered to contain human immunoglobulin loci.
  • WO 98/24893 discloses transgenic animals having a human Ig locus wherein the animals do not produce functional endogenous immunoglobulins due to the inactivation of endogenous heavy and light chain loci.
  • WO 91/10741 also discloses transgenic non-primate mammalian hosts capable of mounting an immune response to an immunogen, wherein the antibodies have primate constant and/or variable regions, and wherein the endogenous immunoglobulin-encoding loci are substituted or inactivated.
  • WO 96/30498 discloses the use ofthe Cre/Lox system to modify the immunoglobulin locus in a mammal, such as to replace all or a portion ofthe constant or variable region to form a modified antibody molecule.
  • WO 94/02602 discloses non-human mammalian hosts having inactivated endogenous Ig loci and functional human Ig loci.
  • U.S. Patent No. 5,939,598 discloses methods of making transgenic mice in which the mice lack endogenous heavy claims, and express an exogenous immunoglobulin locus comprising one or more xenogeneic constant regions.
  • an immune response can be produced to a selected antigenic molecule, and antibody-producing cells can be removed from the animal and used to produce hybridomas that secrete human monoclonal antibodies.
  • Immunization protocols, adjuvants, and the like are known in the art, and are used in immunization of, for example, a transgenic mouse as described in WO 96/33735.
  • This publication discloses monoclonal antibodies against a variety of antigenic molecules including IL-6, IL-8, TNF, human CD4, L-selectin, gp39, and tetanus toxin.
  • the monoclonal antibodies can be tested for the ability to inhibit or neutralize the biological activity or physiological effect ofthe corresponding protein.
  • WO 96/33735 discloses that monoclonal antibodies against IL-8, derived from immune cells of transgenic mice immunized with IL-8, blocked IL-8-induced functions of neutrophils. Human monoclonal antibodies with specificity for the antigen used to immunize transgenic animals are also disclosed in WO 96/34096.
  • proteins and variants thereof according to the invention are used to immunize a transgenic animal as described above.
  • Monoclonal antibodies are made using methods known in the art, and the specificity ofthe antibodies is tested using isolated colon or colorectal proteins according to the invention.
  • Methods for preparation ofthe human or primate protein according to the invention or an epitope thereof include, but are not limited to chemical synthesis, recombinant DNA techniques or isolation from biological samples. Chemical synthesis of a peptide can be performed, for example, by the classical Merrifeld method of solid phase peptide synthesis (Merrifeld, J. Am. Chem. Soc.
  • Polyclonal antibodies can be prepared by immunizing rabbits or other animals by injecting antigen followed by subsequent boosts at appropriate intervals. The animals are bled and sera assayed against purified protein usually by ELISA or by bioassay based upon the ability to block the action of a gene according to the invention.
  • the antibody can be isolated from the yolk ofthe egg.
  • Monoclonal antibodies can be prepared after the method of Milstein and Kohler by fusing splenocytes from immunized mice with continuously replicating tumor cells such as myeloma or lymphoma cells. [Milstein and Kohler, Nature 256:495-491 (1975); Gulfre and Milstein, Methods in Enzymology: Immunochemical Techniques 75:1-46, Langone and Banatis eds., Academic Press, (1981) which are inco ⁇ orated by reference]. The hybridoma cells so formed are then cloned by limiting dilution methods and supemates assayed for antibody production by ELISA, RIA or bioassay.
  • Another aspect of the present invention provides for a method for preventing or treating diseases involving overexpression ofthe a protein according to the invention by treatment of a patient with antibodies to specific tumor antigen according to the invention.
  • antibodies either polyclonal or monoclonal, to the protein can be produced by any suitable method known in the art as discussed above.
  • murine or human monoclonal antibodies can be produced by hybridoma technology or, alternatively, the tumor protein, or an immunologically active fragment thereof, or an anti-idiotypic antibody, or fragment thereof can be administered to an animal to elicit the production of antibodies capable of recognizing and binding to the tumor protein.
  • Antibodies can be of any class or subclass, e.g., IgG, IgA, lgM, IgD, and IgE or in the case of avian species, IgY, and subclasses thereof.
  • HTS high- throughput screening methods
  • Model systems are available that can be adapted for use in high throughput screening for compounds that inhibit the interaction of a protein with its ligand, for example by competing with the protein for ligand binding.
  • Sarabbi et al, Anal. Biochem. 237:10-15 (1996) describe cell-free, non-isotopic assays for discovering molecules that compete with natural ligands for binding to the active site of IL-1 receptor.
  • Martens, C. et al, Anal Biochem. 273:20-31 (1999) describe a generic particle-based nonradioactive method in which a labeled ligand binds to its receptor immobilized on a particle; label on the particle decreases in the presence of a molecule that competes with the labeled ligand for receptor binding.
  • the therapeutic gene polynucleotides and polypeptides ofthe present invention can be utilized in gene delivery vehicles.
  • the gene delivery vehicle can be of viral or non- viral origin (see generally, Jolly, Cancer Gene Therapy 1:51-64 (1994); Kimura, Human Gene Therapy 5:845-852 (1994); Connelly, Human Gene Therapy 1:185-193 (1995); and Kaplitt, Nature Genetics 6:148-153 (1994)).
  • Gene therapy vehicles for delivery of constructs including a coding sequence of a therapeutic according to the invention can be administered either locally or systemically. These constructs can utilize viral or non- viral vector approaches. Expression of such coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression ofthe coding sequence can be either constitutive or regulated.
  • the present invention can employ recombinant retrovirases which are constructed to carry or express a selected nucleic acid molecule of interest.
  • Retroviras vectors that can be employed include those described in EP 0415 731; WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Patent No. 5,219,740; WO 93/11230; WO 93/10218; Vile and Hart, Cancer Res. 53:3860-3864 (1993); Vile and Hart, Cancer Res. 53:962-967 (1993); Ram et al., Cancer Res. 53:83-88 (1993); Takamiya et al., J. Neurosci. Res.
  • Recombinant retrovirases useful in accordance with the present invention include those described in WO 91/02805.
  • Packaging cell lines suitable for use with the above-described retroviral vector constructs can be readily prepared (see PCT publications WO 95/3 0763 and WO 92/05266), and used to create producer cell lines (also termed vector cell lines) for the production of recombinant vector particles.
  • producer cell lines also termed vector cell lines
  • packaging cell lines can be prepared from human (such as HT1080 cells) or mink parent cell lines, thereby allowing production of recombinant retrovirases that can survive inactivation in human serum.
  • the present invention also employs alphaviras-based vectors that can function as gene delivery vehicles.
  • Vectors can be constructed from a wide variety of alphavirases, including, for example, Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532).
  • Representative examples of such vector systems include those described in U.S. Patent Nos. 5,091,309; 5,217,879; and 5,185,440; and PCT Publication Nos. WO 92/10578; WO 94/21792; WO 95/27069; WO 95/27044; and WO 95/07994.
  • Gene delivery vehicles ofthe present invention can also employ parvovirus such as adeno-associated virus (AAV) vectors.
  • AAV adeno-associated virus
  • Representative examples include the AAV vectors disclosed by Srivastava in WO 93/09239, Samulski et al., J. Vir. 63: 3822-3828 (1989); Mendelson et al., Virol 166: 154-165 (1988); and Flotte et al., P.NA.S. 90: 10613-10617 (1993).
  • adenoviral vectors include those described by Berkner, Biotechniques 6:616-621 (Biotechniques); Rosenfeld et al, Science 252:431-434 (1991); WO 93/19191; Kolls et al, P.N.A.S. 215-219 (1994); Kass-Bisleret al., P. ⁇ .A.S. 90: 11498- 11502 (1993); Guzman et al., Circulation 88: 2838-2848 (1993); Guzman et al, Cir. Res. 73: 1202-1207 (1993); Zabner et al., Cell 75: 207-216 (1993); Li et al., Hum. Gene Ther.
  • adenoviral gene therapy vectors employable in this invention also include those described in WO 94/12649, WO 93/03769; WO 93/19191 ; WO 94/28938; WO 95/11984 and WO 95/00655.
  • Administration of D ⁇ A linked to kill adenoviras as described in Curiel, Hum. Gene Ther. 3: 147-154 (1992) can be employed.
  • eukaryotic cell delivery vehicles cells for example see U.S. Serial No. 08/240,030, filed May 9, 1994, and U.S. Serial No. 08/404,796; deposition of photopolymerized hydrogel materials; hand-held gene transfer particle gun, as described in U.S. Patent No. 5,149,655; ionizing radiation as described in U.S. Patent No. 5,206,152 and in WO 92/11033; nucleic charge neutralization or fusion with cell membranes. Additional approaches are described in Philip, Mol. Cell Biol. -7 ⁇ :2411-2418 (1994), and in Woffendin, Proc. Natl Acad. Sci. 97:1581-1585 (1994).
  • Naked DNA can also be administered directly to a subject.
  • Exemplary naked DNA introduction methods are described in WO 90/11092 and U.S. Patent No. 5,580,859. Uptake efficiency may be improved using biodegradable latex beads. DNA coated latex beads are efficiently transported into cells after endocytosis initiation by the beads. The method may be improved further by treatment of the beads to increase hydrophobicity and thereby facilitate disruption ofthe endosome and release ofthe DNA into the cytoplasm.
  • Liposomes that can act as gene delivery vehicles are described in U.S. Patent No. 5,422,120, PCT Patent Publication Nos. WO 95/13 796, WO 94/23697, and WO 9 1/14445, and EP No. 0 524968.
  • non- viral delivery suitable for use includes mechanical delivery systems such as the approach described in Woffendin et al., Proc. Natl. Acad. Sci. USA 91(24): 11581- 11585 (1994).
  • the coding sequence and the product of expression of such can be delivered through deposition of photopolymerized hydrogel materials.
  • Other conventional methods for gene delivery that can be used for delivery ofthe coding sequence include, for example, use of hand-held gene transfer particle gun, as described in U.S. Patent No. 5,149,655; use of ionizing radiation for activating transferred gene, as described in U.S. Patent No. 5,206,152 and PCT Patent Publication No. WO 92/11033.
  • Example 1 Identification of CICO1-CICO3 Genes Through a collaboration with Analytical Pathology Medical Group (at Grossmont Hospital), IDEC obtained pairs of snap frozen normal and malignant colon tissue removed during surgery.
  • human tentative human consensus sequence (THC) 684921 was identified from the BLAST database.
  • chrl_70_2399.f mRNA Sequence (coding sequence in CAPITALS, no ATG at start) aagttgccccacctctctgagcattggcttccccatctgtgaaagaggag tgctgatgtttgccttctaggggcctagtgaggcttaagggtgagcagca ggcacacagaaagctagaaatacaggatcactgtgggacggtggggctgg ccacctgggcaggccacttacccagcggccccctctgtctccaggtgttc atcggcgtaaactgtctgagcacagacttttcctcacaaaagggggtgaa gggtgtceccctgaacctgcagattgacacctatgactgtggcttg
  • nucleotide sequences of each candidate gene are listed below. The first sequence listed for each candidate gene was obtained directly from the public NCBI database
  • Candidate 1 GENBANK Accession No. W91975 W91975/IMAGE Clone 415310 3' mRNA Sequence
  • Candidate 3 GENBANK Accession No. AI680111 AI680111/IMAGE Clone 22520293' mRNA Sequence TTTTTTTTTTGT- ⁇ teATAAATATATTAGC-AAATGAAT ⁇
  • GAPDH Glyceraldehyde 3 -phosphate dehydrogenase
  • the following primers were used to amplify a 507 base pair product ofthe candidate 3 gene: 5 ' TCCCACCCGCTGTACCTGTGC 3 ' (SEQ ID NO : 58) 5 ' CCTGCAGCTGGCCTGGTACCT 3 ' (SEQ ID NO : 59)
  • RT reverse transcriptase
  • GAPDH GAPDH
  • the positive control for candidate 3 was IMAGE 2324560, obtained from the ATCC.
  • the following primers were used to amplify a 415 base pair product ofthe candidate 3 gene:
  • Example 2 Using the same technology employed in Example 1 to identify the CICO genes, the following sequences were identified as differentially expressed in colon cancer:
  • This protein contains a transmembrane domain as determined by SMART (shown below), SOSUI, and TmPred. SMART also predicts that this protein contains a RING domain, which is a zinc finger domain involved in protein: protein interactions. The stracture ofthe protein is depicted schematically below:
  • EXAMPLE 4 Using the Gene Logic database and the methods described generally in Example 2, the following additional DNA sequences were identified as being overexpressed in colon tumor tissue:
  • Fragment AA781143 was upregulated 4.16-fold in the colon samples when compared to mixed normal tissue. E-Northem analysis of this fragment demonstrates that it is expressed in 69% ofthe colon tumors with greater than 50% malignant cells and shows little or no expression in normal tissues. See Figure 8.
  • the GeneLogic database calls this protein "hypothetical protein from EUROIMAGE 2021883.”
  • EUROIMAGE 2021883 Nucleotide Sequence CCAGAGTTTGTCTTCTACGACCAGCTGAAGCAAGTGATGAATGCGTACAGAGTCAAGCCGGC CGTCTTTGACCTGCTCCTGGCTGTTGGCATTGCTGCCTACCTCGGCATGGCCTACGTGGCTG TCCAGCACTTCAGCCTCCTCTACAAGACCGTCCAGAGGCTGCTCGTGAAGGCCAAGACACAG TGACACAGCCACCCCCACAGCCGGAGCCCCCGCCGCTCCACAGTCCCTGGGGCCGAGCACGA GTGAGTGGACACTGCCCCGCCGCGGGCGGCCCTGCAGGGACAGGGGCCCTCTCTCCCTCCGG CGGTGGTTGGAACACTGAATTACAGAGCTTTTTTCTGTTGCTCTCCGAGACTGGGGGGGGAT TGTTTCTTCTTCCTTGTCTTTGAACTTCCTTGGAGGAGCTTGGGAGACGTCCCGGGGC CAGGCTACGGACTTGCGGACGAGCCCCCCAGTCCTGGGAGCCGGCCAGTCCTGGGG
  • the protein set forth above contains one TM (transmembrane domain) by SMART, SOSUI, and TmPred prediction programs.
  • TM transmembrane domain
  • SOSUI SOSUI
  • TmPred prediction programs TmPred prediction programs.
  • BLAST database and EST sequences suggest that the following alternative nucleotide and protein sequences correspond to AA781143:
  • GENBANK also identifies RefSeq Loc56926 as corresponding to AA781143, which nucleotide and protein sequences are set forth below:
  • Loc56926 in normal and malignant human tissues was further investigated by PCR experiments using commercially available human cDNA panels and cDNA samples prepared in-house from human tissues and cell lines. See Figures 9A-9B, 10A-10B, 11 A- 1 IB, and 12A-12B. Expression of Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was measured in these experiments as a control for cDNA integrity.
  • GAPDH is a housekeeping gene expressed abundantly in all human tissues. The following primers were used to amplify a 482 base pair product ofthe GAPDH gene:
  • the positive confrol for Loc56926 IMAGE clone 4428206 was obtained from the ATCC.
  • Primers used to amplify a 283 base pair product of Loc56926 were: 5 ⁇ AATGCAGTGCTGAACACGGAG 3 ' (SEQ ID NO:64)
  • fragment AW779536 was upregulated 3.7 fold.
  • E- Northern analysis shown in Figure 13 demonstrates that the fragment is expressed in 77% of the tumors and poorly expressed in normal tissue.
  • This gene encodes a protein having the following predicted stracture:
  • fragment AL531683 was found to be upregulated 3.76- fold.
  • the E-Northem analysis shown in Figure 14 demonstrates that the fragment is expressed in 100% ofthe tumors analyzed and poorly expressed in normal tissue.
  • fragment AI202201 was upregulated 3.18-fold.
  • E- Northern analysis shown in Figure 15 demonstrates that the fragment is expressed in 77% of the tumors and poorly expressed in normal tissue.
  • fragment AL389942 was upregulated 3.83-fold.
  • E- Northern analysis shown in Figure 16 demonstrates that the fragment is expressed in 55% of the tumors and poorly expressed in normal tissue.
  • DNA fragment NM_021246 is 5 -fold upregulated as shown by hybridization in the malignant colon when compared with mixed normal samples, greater than 3 -fold upregulated compared with normal kidney, liver and lung, and greater than 2-fold upregulated in all other tissues.
  • NM_021246 Nucleotide Sequence
  • the amino acid sequence for Ly6G6D is set forth below:
  • AI821606 is in the 3 'UTR of predicted genes corresponding to both strands of a chromosome. Based thereon, this fragment could be part ofthe following genes:
  • SMART analysis identified three transmembrane domains (rectangles) and a signal sequence.
  • the predicted stracture ofthe protein is depicted schematically below:

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des acides nucléiques et des protéines qui sont surexprimés dans les tissus de tumeurs du côlon ou de tumeurs colorectales, et qui sont utiles en tant que cibles diagnostiques et thérapeutiques.
PCT/US2003/009534 2002-03-28 2003-03-28 Nouvelles cibles geniques et ligands se liant a celles-ci pour le traitement et le diagnostic de carcinomes du colon WO2003083074A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU2003222103A AU2003222103A1 (en) 2002-03-28 2003-03-28 Novel gene targets and ligands that bind thereto for treatment and diagnosis of colon carcinomas
US10/509,131 US20060089493A1 (en) 2002-04-30 2003-03-28 Novel gene targets and ligands that bind thereto for treatment and diagnosis of colon carcinomas

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US36772702P 2002-03-28 2002-03-28
US60/367,727 2002-03-28
US38132802P 2002-05-20 2002-05-20
US60/381,328 2002-05-20
US38674702P 2002-06-10 2002-06-10
US60/386,747 2002-06-10
US42756402P 2002-11-20 2002-11-20
US60/427,564 2002-11-20

Publications (2)

Publication Number Publication Date
WO2003083074A2 true WO2003083074A2 (fr) 2003-10-09
WO2003083074A9 WO2003083074A9 (fr) 2009-10-08

Family

ID=28679084

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/009534 WO2003083074A2 (fr) 2002-03-28 2003-03-28 Nouvelles cibles geniques et ligands se liant a celles-ci pour le traitement et le diagnostic de carcinomes du colon

Country Status (2)

Country Link
AU (1) AU2003222103A1 (fr)
WO (1) WO2003083074A2 (fr)

Cited By (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1487877A2 (fr) * 2001-09-18 2004-12-22 Genentech, Inc. Compositions et procedes pour le diagnostic et le traitement des tumeurs
EP1923072A1 (fr) * 2005-08-09 2008-05-21 Takeda Pharmaceutical Company Limited Agent prophylactique/thérapeutique pour le cancer
JP2008532477A (ja) * 2005-02-10 2008-08-21 オンコセラピー・サイエンス株式会社 膀胱癌を診断する方法
US7557204B2 (en) * 2004-02-04 2009-07-07 The Chinese University Of Hong Kong CUDR as biomarker for cancer progression and therapeutic response
EP2260858A2 (fr) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Composés de monométhylvaline capable de conjugaison aux lignads.
EP2286844A2 (fr) 2004-06-01 2011-02-23 Genentech, Inc. Conjugués anticorps-médicament et procédés
WO2011031870A1 (fr) 2009-09-09 2011-03-17 Centrose, Llc Conjugués médicamenteux ciblés à visée extracellulaire
WO2011056983A1 (fr) 2009-11-05 2011-05-12 Genentech, Inc. Conjugués d'anticorps modifiés par cystéine, radiomarqués par le zirconium
WO2011130598A1 (fr) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazépines et conjugués de celles-ci
US8057996B2 (en) 2002-08-16 2011-11-15 Agensys, Inc. Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
WO2011156328A1 (fr) 2010-06-08 2011-12-15 Genentech, Inc. Anticorps et conjugués modifiés par la cystéine
WO2012074757A1 (fr) 2010-11-17 2012-06-07 Genentech, Inc. Conjugués d'anticorps alaninyl-maytansinol
WO2012140627A1 (fr) 2011-04-15 2012-10-18 Compugen Ltd. Polypeptides et polynucléotides et leurs utilisations pour un traitement de troubles liés au système immunitaire et du cancer
WO2012155019A1 (fr) 2011-05-12 2012-11-15 Genentech, Inc. Procédé lc-ms/ms de surveillance de réactions multiples pour détecter des anticorps thérapeutiques dans des échantillons animaux à l'aide de peptides de signature d'infrastructure
WO2013130093A1 (fr) 2012-03-02 2013-09-06 Genentech, Inc. Biomarqueurs pour un traitement à base de composés chimiothérapeutiques anti-tubuline
US8552146B2 (en) 2006-10-17 2013-10-08 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing MPHOSPH1 or DEPDC1 polypeptides
WO2014057074A1 (fr) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
WO2014140862A2 (fr) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2014140174A1 (fr) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
WO2014159981A2 (fr) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2015023355A1 (fr) 2013-08-12 2015-02-19 Genentech, Inc. Conjugués anticorps-médicament dimérique 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
US8975086B2 (en) 2008-08-28 2015-03-10 Oncotherapy Science, Inc. Method for treating or preventing bladder cancer using the DEPDC1 polypeptide
WO2015095227A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
WO2015095212A1 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés conjugués anticorps-médicament dimérique à base de 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
WO2015095223A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
WO2016040856A2 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Anticorps et conjugués modifiés génétiquement avec de la cystéine
WO2016040825A1 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Intermédiaires disulfure d'anthracycline, conjugué anticorps-médicaments et procédés
WO2016037644A1 (fr) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazépines et leurs conjugués
WO2016090050A1 (fr) 2014-12-03 2016-06-09 Genentech, Inc. Composés d'amine quaternaire et conjugués anticorps-médicament de ceux-ci
EP3088004A1 (fr) 2004-09-23 2016-11-02 Genentech, Inc. Anticorps et conjugués modifiés au niveau des cystéines
WO2017059289A1 (fr) 2015-10-02 2017-04-06 Genentech, Inc. Conjugués anticorps-médicaments de pyrrolobenzodiazépine et méthodes d'utilisation
WO2017064675A1 (fr) 2015-10-16 2017-04-20 Genentech, Inc. Conjugués médicamenteux à pont disulfure encombré
WO2017068511A1 (fr) 2015-10-20 2017-04-27 Genentech, Inc. Conjugués calichéamicine-anticorps-médicament et procédés d'utilisation
WO2017165734A1 (fr) 2016-03-25 2017-09-28 Genentech, Inc. Dosage multiplexé pour la quantification d'anticorps totaux et de médicaments conjugués à des anticorps
EP3235820A1 (fr) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazépines et conjugués à base de disulfure d'anticorps associés
WO2017201449A1 (fr) 2016-05-20 2017-11-23 Genentech, Inc. Conjugués anticorps-protac et procédés d'utilisation
WO2017205741A1 (fr) 2016-05-27 2017-11-30 Genentech, Inc. Procédé bioanalytique pour la caractérisation de conjugués anticorps-médicament spécifiques d'un site
WO2017214024A1 (fr) 2016-06-06 2017-12-14 Genentech, Inc. Médicaments conjugués d'anticorps silvestrol et procédés d'utilisation
WO2018031662A1 (fr) 2016-08-11 2018-02-15 Genentech, Inc. Promédicaments de pyrrolobenzodiazépine et conjugués d'anticorps de ceux-ci
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2018065501A1 (fr) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Procédés de préparation de conjugués anticorps-médicament
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2019060398A1 (fr) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. Analogues de thailanstatine
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
WO2020049286A1 (fr) 2018-09-03 2020-03-12 Femtogenix Limited Amides polycycliques servant d'agents cytotoxiques
WO2020086858A1 (fr) 2018-10-24 2020-04-30 Genentech, Inc. Inducteurs chimiques conjugués de dégradation et méthodes d'utilisation
US10676508B2 (en) 2015-08-12 2020-06-09 Oncotherapy Science, Inc. DEPDC1-derived peptide and vaccine containing same
WO2020123275A1 (fr) 2018-12-10 2020-06-18 Genentech, Inc. Peptides de photoréticulation pour conjugaison spécifique de site à des protéines contenant fc
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2020157491A1 (fr) 2019-01-29 2020-08-06 Femtogenix Limited Agents cytotoxiques de réticulation g-a
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2022023735A1 (fr) 2020-07-28 2022-02-03 Femtogenix Limited Agents cytotoxiques
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates
WO2024138128A2 (fr) 2022-12-23 2024-06-27 Genentech, Inc. Conjugués d'agent de dégradation de céréblon et leurs utilisations
WO2024220546A2 (fr) 2023-04-17 2024-10-24 Peak Bio, Inc. Anticorps et conjugués anticorps-médicament et procédés d'utilisation, processus synthétiques et intermédiaires

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6527466B2 (ja) 2012-12-21 2019-06-05 メドイミューン・リミテッドＭｅｄＩｍｍｕｎｅ Ｌｉｍｉｔｅｄ 増殖性疾患および自己免疫疾患の治療に使用するための非対称ピロロベンゾジアゼピンニ量体
WO2014096368A1 (fr) 2012-12-21 2014-06-26 Spirogen Sàrl Pyrrolobenzodiazépines et conjugués associés

Cited By (114)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7939268B2 (en) 2001-09-18 2011-05-10 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
EP1487877A4 (fr) * 2001-09-18 2005-08-24 Genentech Inc Compositions et procedes pour le diagnostic et le traitement des tumeurs
EP1487877A2 (fr) * 2001-09-18 2004-12-22 Genentech, Inc. Compositions et procedes pour le diagnostic et le traitement des tumeurs
US7951546B2 (en) 2001-09-18 2011-05-31 Genetech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US8426571B2 (en) 2002-08-16 2013-04-23 Agensys, Inc. Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US8057996B2 (en) 2002-08-16 2011-11-15 Agensys, Inc. Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
EP2489364A1 (fr) 2003-11-06 2012-08-22 Seattle Genetics, Inc. Composés de monométhylvaline conjuguös avec des anticorps
EP2260858A2 (fr) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Composés de monométhylvaline capable de conjugaison aux lignads.
EP3858387A1 (fr) 2003-11-06 2021-08-04 Seagen Inc. Composés de monométhylvaline capables de conjugaison aux ligands
EP2486933A1 (fr) 2003-11-06 2012-08-15 Seattle Genetics, Inc. Composés de monométhylvaline conjugués avec des anticorps
EP2478912A1 (fr) 2003-11-06 2012-07-25 Seattle Genetics, Inc. Conjugués d'auristatin avec des anticorps dirigés contre le HER2 ou le CD22 et leur usage thérapeutique
EP3434275A1 (fr) 2003-11-06 2019-01-30 Seattle Genetics, Inc. Méthode de dépistage de cellules cancéreuses basé sur l'utilisation de conjugués d'auristatin avec anticorps
US8163476B2 (en) 2004-02-04 2012-04-24 The Chinese University Of Hong Kong CUDR as biomarker for cancer progression and therapeutic response
US7557204B2 (en) * 2004-02-04 2009-07-07 The Chinese University Of Hong Kong CUDR as biomarker for cancer progression and therapeutic response
EP2286844A2 (fr) 2004-06-01 2011-02-23 Genentech, Inc. Conjugués anticorps-médicament et procédés
EP3088004A1 (fr) 2004-09-23 2016-11-02 Genentech, Inc. Anticorps et conjugués modifiés au niveau des cystéines
JP2008532477A (ja) * 2005-02-10 2008-08-21 オンコセラピー・サイエンス株式会社 膀胱癌を診断する方法
EP2011885A3 (fr) * 2005-02-10 2009-06-24 Oncotherapy Science, Inc. Procédé de diagnostic de cancer de la vessie
US8685641B2 (en) 2005-02-10 2014-04-01 Oncotherapy Science, Inc. Method of screening compounds for treating bladder cancer
US7998695B2 (en) 2005-02-10 2011-08-16 Oncotherapy Science, Inc. Method of diagnosing bladder cancer
EP1923072A4 (fr) * 2005-08-09 2010-03-03 Takeda Pharmaceutical Agent prophylactique/thérapeutique pour le cancer
EP1923072A1 (fr) * 2005-08-09 2008-05-21 Takeda Pharmaceutical Company Limited Agent prophylactique/thérapeutique pour le cancer
US8653234B2 (en) 2006-10-17 2014-02-18 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing MPHOSPH1 or DEPDC1 polypeptides
US9017688B2 (en) 2006-10-17 2015-04-28 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing MPHOSPH1 or DEPDC1 polypeptides
US9545437B2 (en) 2006-10-17 2017-01-17 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing MPHOSPH1 or DEPDC1 polypeptides
US8552146B2 (en) 2006-10-17 2013-10-08 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing MPHOSPH1 or DEPDC1 polypeptides
US8557955B2 (en) 2006-10-17 2013-10-15 Oncotherapy Science, Inc. Peptide vaccines for cancers expressing MPHOSPH1 or DEPDC1 polypeptides
US8975086B2 (en) 2008-08-28 2015-03-10 Oncotherapy Science, Inc. Method for treating or preventing bladder cancer using the DEPDC1 polypeptide
WO2011031870A1 (fr) 2009-09-09 2011-03-17 Centrose, Llc Conjugués médicamenteux ciblés à visée extracellulaire
WO2011056983A1 (fr) 2009-11-05 2011-05-12 Genentech, Inc. Conjugués d'anticorps modifiés par cystéine, radiomarqués par le zirconium
WO2011130598A1 (fr) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazépines et conjugués de celles-ci
WO2011156328A1 (fr) 2010-06-08 2011-12-15 Genentech, Inc. Anticorps et conjugués modifiés par la cystéine
WO2012074757A1 (fr) 2010-11-17 2012-06-07 Genentech, Inc. Conjugués d'anticorps alaninyl-maytansinol
WO2012140627A1 (fr) 2011-04-15 2012-10-18 Compugen Ltd. Polypeptides et polynucléotides et leurs utilisations pour un traitement de troubles liés au système immunitaire et du cancer
US9409987B2 (en) 2011-04-15 2016-08-09 Compugen Ltd Polypeptides and polynucleotides, and uses thereof for treatment of immune related disorders and cancer
WO2012155019A1 (fr) 2011-05-12 2012-11-15 Genentech, Inc. Procédé lc-ms/ms de surveillance de réactions multiples pour détecter des anticorps thérapeutiques dans des échantillons animaux à l'aide de peptides de signature d'infrastructure
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2013130093A1 (fr) 2012-03-02 2013-09-06 Genentech, Inc. Biomarqueurs pour un traitement à base de composés chimiothérapeutiques anti-tubuline
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US11690918B2 (en) 2012-10-12 2023-07-04 Medimmune Limited Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
WO2014057074A1 (fr) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
US10994023B2 (en) 2012-10-12 2021-05-04 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10799596B2 (en) 2012-10-12 2020-10-13 Adc Therapeutics S.A. Pyrrolobenzodiazepine-antibody conjugates
US10780181B2 (en) 2012-10-12 2020-09-22 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
EP2839860A1 (fr) 2012-10-12 2015-02-25 Spirogen Sàrl Pyrrolobenzodiazépines et ses conjugués
US11701430B2 (en) 2012-10-12 2023-07-18 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10722594B2 (en) 2012-10-12 2020-07-28 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10646584B2 (en) 2012-10-12 2020-05-12 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US11771775B2 (en) 2012-10-12 2023-10-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11779650B2 (en) 2012-10-12 2023-10-10 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10335497B2 (en) 2012-10-12 2019-07-02 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US12121590B2 (en) 2012-10-12 2024-10-22 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9889207B2 (en) 2012-10-12 2018-02-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2014159981A2 (fr) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2014140174A1 (fr) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
WO2014140862A2 (fr) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2015023355A1 (fr) 2013-08-12 2015-02-19 Genentech, Inc. Conjugués anticorps-médicament dimérique 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2015095212A1 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés conjugués anticorps-médicament dimérique à base de 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
WO2015095227A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
WO2015095223A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
US10188746B2 (en) 2014-09-10 2019-01-29 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016037644A1 (fr) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazépines et leurs conjugués
WO2016040856A2 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Anticorps et conjugués modifiés génétiquement avec de la cystéine
WO2016040825A1 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Intermédiaires disulfure d'anthracycline, conjugué anticorps-médicaments et procédés
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
EP3235820A1 (fr) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazépines et conjugués à base de disulfure d'anticorps associés
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2016090050A1 (fr) 2014-12-03 2016-06-09 Genentech, Inc. Composés d'amine quaternaire et conjugués anticorps-médicament de ceux-ci
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates
US10676508B2 (en) 2015-08-12 2020-06-09 Oncotherapy Science, Inc. DEPDC1-derived peptide and vaccine containing same
US11673915B2 (en) 2015-08-12 2023-06-13 Oncotherapy Science, Inc. DEPDC1-derived peptide and vaccine containing same
WO2017059289A1 (fr) 2015-10-02 2017-04-06 Genentech, Inc. Conjugués anticorps-médicaments de pyrrolobenzodiazépine et méthodes d'utilisation
WO2017064675A1 (fr) 2015-10-16 2017-04-20 Genentech, Inc. Conjugués médicamenteux à pont disulfure encombré
WO2017068511A1 (fr) 2015-10-20 2017-04-27 Genentech, Inc. Conjugués calichéamicine-anticorps-médicament et procédés d'utilisation
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
EP4273551A2 (fr) 2016-03-25 2023-11-08 F. Hoffmann-La Roche AG Dosage multiplexé pour la quantification d'anticorps totaux et de médicaments conjugués à des anticorps
WO2017165734A1 (fr) 2016-03-25 2017-09-28 Genentech, Inc. Dosage multiplexé pour la quantification d'anticorps totaux et de médicaments conjugués à des anticorps
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
WO2017201449A1 (fr) 2016-05-20 2017-11-23 Genentech, Inc. Conjugués anticorps-protac et procédés d'utilisation
WO2017205741A1 (fr) 2016-05-27 2017-11-30 Genentech, Inc. Procédé bioanalytique pour la caractérisation de conjugués anticorps-médicament spécifiques d'un site
WO2017214024A1 (fr) 2016-06-06 2017-12-14 Genentech, Inc. Médicaments conjugués d'anticorps silvestrol et procédés d'utilisation
WO2018031662A1 (fr) 2016-08-11 2018-02-15 Genentech, Inc. Promédicaments de pyrrolobenzodiazépine et conjugués d'anticorps de ceux-ci
WO2018065501A1 (fr) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Procédés de préparation de conjugués anticorps-médicament
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US11813335B2 (en) 2017-02-08 2023-11-14 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
US11938192B2 (en) 2017-06-14 2024-03-26 Medimmune Limited Dosage regimes for the administration of an anti-CD19 ADC
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2019060398A1 (fr) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. Analogues de thailanstatine
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
WO2020049286A1 (fr) 2018-09-03 2020-03-12 Femtogenix Limited Amides polycycliques servant d'agents cytotoxiques
WO2020086858A1 (fr) 2018-10-24 2020-04-30 Genentech, Inc. Inducteurs chimiques conjugués de dégradation et méthodes d'utilisation
WO2020123275A1 (fr) 2018-12-10 2020-06-18 Genentech, Inc. Peptides de photoréticulation pour conjugaison spécifique de site à des protéines contenant fc
WO2020157491A1 (fr) 2019-01-29 2020-08-06 Femtogenix Limited Agents cytotoxiques de réticulation g-a
WO2022023735A1 (fr) 2020-07-28 2022-02-03 Femtogenix Limited Agents cytotoxiques
WO2024138128A2 (fr) 2022-12-23 2024-06-27 Genentech, Inc. Conjugués d'agent de dégradation de céréblon et leurs utilisations
WO2024220546A2 (fr) 2023-04-17 2024-10-24 Peak Bio, Inc. Anticorps et conjugués anticorps-médicament et procédés d'utilisation, processus synthétiques et intermédiaires

Also Published As

Publication number Publication date
WO2003083074A9 (fr) 2009-10-08
AU2003222103A8 (en) 2009-11-19
AU2003222103A1 (en) 2003-10-13

Similar Documents

Publication Publication Date Title
US20080213166A1 (en) Novel Gene Targets and Ligands that Bind Thereto for Treatment and Diagnosis of Colon Carcinomas
WO2003083074A2 (fr) Nouvelles cibles geniques et ligands se liant a celles-ci pour le traitement et le diagnostic de carcinomes du colon
US20020051990A1 (en) Novel gene targets and ligands that bind thereto for treatment and diagnosis of ovarian carcinomas
US20070104718A1 (en) Gene BRCC-1 and diagnostic and therapeutic uses thereof
US20110104252A1 (en) Anti-apoptotic gene scc-s2 and diagnostic and therapeutic uses thereof
EP1657256B1 (fr) Compositions et méthodes pour traitement des tumeurs
CA2367125A1 (fr) Reactifs et procedes utiles pour detecter les maladies de la prostate
US7442520B2 (en) Gene BRCC-3 and diagnostic and therapeutic uses thereof
KR20090111307A (ko) 전립선 특이적 전사물 및 전립선암의 치료 및 진단에 사용되는 이의 용도
US7253272B2 (en) Gene BRCC-2 and diagnostic and therapeutic uses thereof
US7351811B2 (en) Gene SCC-112 and diagnostic and therapeutic uses thereof
EP1642907B1 (fr) Composition et procédés de diagnostic de tumeurs
US7244565B2 (en) Gene shinc-3 and diagnostic and therapeutic uses thereof
US7138512B2 (en) Gene SHINC-2 and diagnostic and therapeutic uses thereof
WO2003070889A2 (fr) Genes specifiques de la prostate et leur utilisation dans la conception ou la therapie
US20060089493A1 (en) Novel gene targets and ligands that bind thereto for treatment and diagnosis of colon carcinomas
US20020061552A1 (en) Mammalian dishevelled-associated proteins
US20040161775A1 (en) Gene SHINC-1 and diagnostic and therapeutic uses thereof
WO2003059256A2 (fr) Genes surexprimes par le cancer de l'ovaire et leur utilisation dans l'elaboration de nouvelles therapies notamment des anticorps
US20030186232A1 (en) Human and non-human primate homologues of Nkd protein, nucleic acid sequences encoding, and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase
ENP Entry into the national phase in:

Ref document number: 2006089493

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10509131

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10509131

Country of ref document: US

NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)