US20030153503A1 - Methods of increasing endogenous erythropoietin (EPO) - Google Patents

Methods of increasing endogenous erythropoietin (EPO) Download PDF

Info

Publication number
US20030153503A1
US20030153503A1 US10/313,643 US31364302A US2003153503A1 US 20030153503 A1 US20030153503 A1 US 20030153503A1 US 31364302 A US31364302 A US 31364302A US 2003153503 A1 US2003153503 A1 US 2003153503A1
Authority
US
United States
Prior art keywords
alkyl
subject
epo
compound
alkoxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/313,643
Other languages
English (en)
Inventor
Stephen Klaus
Al Lin
Thomas Neff
Qingjian Wang
Volkmar Guenzler-Pukall
Michael Arend
Lee Flippin
Alex Melekhov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fibrogen Inc
Original Assignee
Fibrogen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27502557&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20030153503(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to US10/313,643 priority Critical patent/US20030153503A1/en
Application filed by Fibrogen Inc filed Critical Fibrogen Inc
Publication of US20030153503A1 publication Critical patent/US20030153503A1/en
Assigned to FIBROGEN, INC. reassignment FIBROGEN, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: NEFF, THOMAS B., GUENZLER-PUKALL, VOLKMAR, FLIPPIN, LEE A., KLAUS, STEPHEN J., WANG, QINGJIAN, AREND, MICHAEL P., LIN, AL Y., MELEKHOV, ALEX
Priority to US11/405,734 priority patent/US20060183695A1/en
Priority to US11/406,484 priority patent/US20060178317A1/en
Priority to US11/406,023 priority patent/US20060178316A1/en
Priority to US12/932,151 priority patent/US20110166178A1/en
Priority to US13/614,917 priority patent/US20130203805A1/en
Priority to US14/332,814 priority patent/US20150080425A1/en
Priority to US15/424,479 priority patent/US20170312268A1/en
Priority to US17/394,602 priority patent/US20210369702A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4738—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/17—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4375—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having nitrogen as a ring heteroatom, e.g. quinolizines, naphthyridines, berberine, vincamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4418—Non condensed pyridines; Hydrogenated derivatives thereof having a carbocyclic group directly attached to the heterocyclic ring, e.g. cyproheptadine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/472—Non-condensed isoquinolines, e.g. papaverine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4738—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/63—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/08—Vasodilators for multiple indications
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/505—Erythropoietin [EPO]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G01N33/746—Erythropoetin

Definitions

  • the present invention relates to methods for increasing endogenous erythropoietin, ex vivo and in vivo, and to compounds that can be used in the methods.
  • EPO Erythropoietin
  • erythrocytes red blood cells
  • hypooxia hypooxia
  • All types of anemia are characterized by the blood's reduced capacity to carry oxygen, and thus are associated with similar signs and symptoms, including pallor of the skin and mucous membranes, weakness, dizziness, easy fatigability, and drowsiness, leading to a decrease in quality of life.
  • Subjects with severe cases of anemia show difficulty in breathing and heart abnormalities.
  • Anemia is typically associated with a condition in which the blood is deficient in red blood cells or in hemoglobin.
  • Anemia can also develop in association with chronic diseases, e.g., in inflammatory disorders, including disorders with consequent inflammatory suppression of marrow, etc.
  • Anemia may be caused by loss of blood, for example, due to accidents, surgery, or gastrointestinal bleeding caused by medications such as aspirin and ibuprofen. Excessive blood loss can also be seen in women with heavy menstrual periods, and in people with stomach ulcers, duodenal ulcers, hemorrhoids, or cancer of the stomach or large intestine, etc.
  • erythrocytes Various conditions can cause the destruction of erythrocytes (hemolysis), thus leading to anemia.
  • allergic-type reactions to bacterial toxins and various chemical agents such as sulfonamides and benzene can cause hemolysis.
  • Hemolytic anemia is often caused by chemical poisoning, parasites, infection, or sickle-cell anemia.
  • Any disease or injury to the bone marrow can cause anemia, since that tissue is the site of erythropoiesis, i.e. erythrocyte synthesis.
  • Irradiation, disease, or various chemical agents can also cause bone marrow destruction, producing aplastic anemia.
  • Cancer patients undergoing chemotherapy often have aplastic anemia.
  • Anemia is also associated with renal dysfunction, the severity of the anemia correlating highly with the extent of the dysfunction. Most patients with renal failure undergoing dialysis suffer from chronic anemia.
  • erythropoietin is produced by astrocytes and neurons in the central nervous system (CNS), and EPO and EPO receptors are expressed at capillaries of the brain-periphery interface.
  • systemically administered EPO crosses the blood-brain barrier and reduces neuronal cell loss in response to cerebral and spinal chord ischemia, mechanical trauma, epilepsy, excitotoxins, and neuroinflamination.
  • EPO genetically engineered EPO for the treatment of anemia in chronic renal failure patients.
  • EPO is also administered to cancer patients undergoing radiation and/or chemotherapy, decreasing the need for blood transfusions.
  • EPO is used to treat anemia associated with HIV infection or azidothymidine (AZT) therapy.
  • AZT azidothymidine
  • recombinant EPO therapy requires intravenous administration of EPO one to three times per week for up to twelve weeks, a treatment regimen that limits self-administration and is inconvenient for the patient.
  • human serum EPO shows size heterogeneity due to extensive and varied glycosylation not reproduced in any recombinant human EPO.
  • the present invention relates generally to methods for increasing endogenous erythropoietin.
  • the present invention provides a method of increasing endogenous erythropoietin (EPO) in a subject, the method comprising stabilizing the alpha subunit of hypoxia inducible factor (HIF ⁇ ).
  • the present invention provides a method of increasing endogenous EPO in a subject, the method comprising inhibiting hydroxylation of HIF ⁇
  • a method of increasing endogenous EPO in a subject, the method comprising inhibiting 2-oxoglutarate dioxygenase enzyme activity is provided.
  • the present invention provides in a further aspect a method of increasing endogenous EPO levels in a subject, the method comprising inhibiting HIF prolyl hydroxylase enzyme activity.
  • the subject can be, in various embodiments, an animal, a mammal, a human, a cell, a tissue, an organ, etc.
  • the invention provides a method of increasing endogenous EPO, the method comprising stabilizing HIF ⁇ , wherein the stabilizing takes place in vivo.
  • a method of increasing endogenous EPO, the method comprising stabilizing HIF ⁇ , wherein the stabilizing takes place in vitro, is also contemplated.
  • the HIF ⁇ is selected from the group consisting of HIF-1 ⁇ , HIF-2 ⁇ , HIF-3 ⁇ , and any fragment thereof.
  • the HIF ⁇ is endogenous to the subject.
  • the 2-oxoglutarate dioxygenase enzyme is selected from the group consisting of EGLN1, EGLN2, EGLN3, procollagen prolyl 4-hydroxylase, procollagen prolyl 3-hydroxylase, procollagen lysyl hydroxylase, PHD4, FIH-1, and any subunit or fragment thereof.
  • the HIF prolyl hydroxylase enzyme is selected from the group consisting of EGLN1, EGLN2, EGLN3, and any subunit or fragment thereof are contemplated.
  • a preferred method for increasing endogenous EPO comprises administering to the subject a compound that increases endogenous EPO.
  • the compound stabilizes HIF ⁇ .
  • the compound inhibits hydroxylation of HIF ⁇
  • the compound inhibits 2-oxoglutarate dioxygenase enzyme activity.
  • the compound inhibits HIF prolyl hydroxylase enzyme activity.
  • the present invention provides a method for increasing endogenous EPO in a subject, the method comprising administering to the subject a compound selected from the group consisting of heterocyclic carboxamides, phenanthrolines, hydroxamates, and physiologically active salts and prodrugs derived therefrom.
  • the compound is a heterocyclic carboxamide selected from the group consisting of pyridine carboxamides, quinoline carboxamides, isoquinoline carboxamides, cinnoline carboxamides, and beta-carboline carboxamides.
  • the compound is delivered to the subject in the form of an oral formulation.
  • the compound is delivered in a transdermal formulation.
  • the present invention provides a method for treating, preventing, or pretreating an EPO-associated disorder, the method comprising increasing endogenous EPO.
  • a method for treating, preventing, or pretreating an EPO-associated disorder in a subject, the method comprising stabilizing HIF ⁇ is provided.
  • a method of treating, preventing, or pretreating an EPO-associated disorder in a subject comprises inhibiting hydroxylation of HIF ⁇ .
  • the invention provides a method of treating, preventing, or pretreating an EPO-associated disorder in a subject, the method comprising inhibiting 2-oxoglutarate dioxygenase enzyme activity.
  • a method for treating, preventing, or pretreating an EPO-associated disorder in a subject, the method comprising inhibiting HIF prolyl hydroxylase enzyme activity is contemplated.
  • the present invention specifically relates to methods for treating, preventing, or pretreating anemia in a subject.
  • the method comprises increasing endogenous EPO, including, in various embodiments, stabilizing HIF ⁇ , inhibiting 2-oxoglutarate dioxygenase enzyme activity, inhibiting HIF prolyl hydroxylase enzyme activity, etc.
  • the invention provides methods for treatment, prevention, and pretreatment/preconditioning of anemia, wherein the anemia is associated with abnormal hemoglobin or erythrocytes.
  • the anemia is associated with a condition selected from the group consisting of diabetes, cancer, ulcers, kidney disease, immunosuppressive disease, infection, and inflammation.
  • the anemia is associated with a procedure or treatment selected from the group consisting of radiation therapy, chemotherapy, dialysis, and surgery.
  • methods for treatment, prevention, and pretreatment/preconditioning of anemia, wherein the anemia is associated with blood loss are provided.
  • the blood less is associated with bleeding disorders, trauma, injury, surgery, etc.
  • the anemia can be associated with defects in iron transport, processing, or utilization.
  • Methods of pretreating/preconditioning, preventing, or treating anemia, the methods comprising increasing endogenous EPO, and further comprising administering to the subject a compound selected from the group consisting of, e.g., an iron supplement, vitamin B 12 , folic acid, exogenous erythropoietin, and granulocyte-colony stimulating factor, etc., are also contemplated.
  • the present invention further relates to a method of treating, preventing, or pretreating a neurological disorder in a subject, the method comprising increasing endogenous EPO.
  • the method comprises stabilizing HIF ⁇ , inhibiting 2-oxoglutarate dioxygenase enzyme activity, and inhibiting HIF prolyl hydroxylase enzyme activity.
  • the invention contemplates in certain aspects that the neurological disorder is associated with a condition selected from the group consisting of stroke, trauma, epilepsy, and neurodegenerative disease.
  • the present invention includes a method of enhancing oxygen consumption in a subject, the method comprising increasing endogenous EPO.
  • the invention contemplates a method of identifying a compound that increases endogenous EPO, the method comprising administering a compound to a subject; measuring EPO in the subject or in a sample from the subject; and comparing the EPO in the subject or in the sample to a standard, wherein an increase in the EPO in the subject or in the sample relative to the standard is indicative of a compound that increases endogenous EPO.
  • the methods of the invention increase endogenous erythropoietin ex vivo, e.g., in cell culture, or in vivo, e.g., in an animal.
  • the animal is a mammal, e.g., a cat or dog, and, more preferably, the animal is a human.
  • the methods of the invention increase synthesis of endogenous erythropoietin in tissues including, but not limited to, renal, hepatic, hematopoietic, and/or neural tissues.
  • the methods of the invention are used to prevent, pretreat, or treat erythropoietin-associated conditions including neurological disorders and anemia.
  • Erythropoietin-associated conditions associated with anemia include, but are not limited to, polycystic kidney disease, chronic renal failure, diabetes, cancer, ulcers, and immunosuppressive conditions such as AIDS.
  • the methods of the invention are used to treat anemia associated with procedures or treatments including, but not limited to, radiation therapy, chemotherapy, kidney dialysis, or surgery.
  • the methods of the invention are used to increase endogenous erythropoietin levels in an HIV-infected anemic subject being treated with zidovudine or other reverse transcriptase inhibitors.
  • the methods are used to increase endogenous erythropoietin levels in an anemic cancer patient receiving cyclic cisplatin- or non-cisplatin-containing chemotherapy. In further embodiments, the methods are used to increase endogenous erythropoietin levels in an anemic patient scheduled to undergo elective, noncardiac, nonvascular surgery, thereby reducing the need for allogenic blood transfusions or to facilitate banking of blood prior to surgery. In one specific embodiment, the method is used to increase endogenous erythropoietin levels in a subject prior to procedures such as, e.g., surgery requiring aortic clamping such as thoracoabdominal aortic surgery. In yet another embodiment, the method is used to increase endogenous erythropoietin produced by cells in vitro.
  • the invention provides compounds that increase endogenous erythropoietin plasma levels.
  • a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient is administered to a subject having an erythropoietin-associated condition.
  • a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient is administered to a patient having anemia.
  • Preferred embodiments of the invention comprise methods using oral and transdermal delivery mechanisms. Such mechanisms could provide advantages over current therapies, e.g., increased ease of administration, self-administration by patient, reduced cost, fewer physician visits, and reduced risks due to infection and immunogenic complications, minimizing the adverse reactions some subjects develop in response to dosing with recombinant EPO.
  • the present methods involve oral administration of a compound that increases endogenous erythropoietin levels.
  • the present invention also provides an oral formulation comprising a compound of the invention.
  • the present methods involve transdermal administration of a compound that increases endogenous erythropoietin levels.
  • the present invention also provides a transdermal patch or pad comprising a compound of the invention.
  • the invention provides compounds that increase endogenous erythropoietin produced by cells in culture and methods of using the compounds to produce erythropoietin using in vitro cell culture technologies.
  • the method comprises adding an effective amount of the compound or a pharmaceutically acceptable salt thereof to cells in culture under conditions suitable for production of erythropoietin, and collecting and purifying the erythropoietin produced thereby.
  • cells that produce erythropoietin in vitro include hepatic cells such as Hep3B hepatocarcinoma cells.
  • compounds used in the methods of the invention are selected from a compound of the formula (I)
  • A is 1,2-arylidene, 1,3-arylidene, 1,4-arylidene; or (C 1 -C 4 )-alkylene, optionally substituted by one or two halogen, cyano, nitro, trifluoromethyl, (C 1 -C 6 )-alkyl, (C 1 -C 6 )-hydroxyalkyl, (C 1 -C 6 )-alkoxy, —O—[CH 2 ] x —C f H (2f+1 ⁇ g) Hal g , (C 1 -C 6 )-fluoroalkoxy, (C 1 -C 8 )-fluoroalkenyloxy, (C 1 -C 8 )-fluoroalkynyloxy, —OCF 2 Cl, —O—CF 2 —CHFCl; (C 1 -C 6 )-alkylmercapto, (C 1 -C 6 )-alkylsulfinyl, (C 1
  • B is —CO 2 H, —NH 2 , —NHSO 2 CF 3 , tetrazolyl, imidazolyl, 3-hydroxyisoxazolyl, —CONHCOR′′′, —CONHSOR′′′, CONHSO 2 R′′′, where R′′′ is aryl, heteroaryl, (C 3 -C 7 )-cycloalkyl, or (C 1 -C 4 )-alkyl, optionally monosubstituted by (C 6 -C 12 )-aryl, heteroaryl, OH, SH, (C 1 -C 4 )-alkyl, (C 1 -C 4 )-alkoxy, (C 1 -C 4 )-thioalkyl, (C 1 -C 4 )-sulfinyl, (C 1 -C 4 )-sulfonyl, CF 3 , Cl, Br, F, I, NO 2 , —COOH, (C 2 -
  • X is O or S
  • Q is O, S, NR′, or a bond
  • R 4 is halogen, nitrile, or trifluoromethyl
  • R 4 is hydrogen, (C 1 -C 10 )-alkyl radical, (C 2 -C 10 )-alkenyl radical, (C 2 -C 10 )-alkynyl radical, wherein alkenyl or alkynyl radical contains one or two C—C multiple bonds; unsubstituted fluoroalkyl radical of the formula —[CH 2 ] x —C f H (2f+1 ⁇ g) —F g , (C 1 -C 8 )-alkoxy-(C 1 -C 6 )-alkyl radical, (C 1 -C 6 )-alkoxy-(C 1 -C 4 )-alkoxy-(C 1 -C 4 )-alkyl radical, aryl radical, heteroaryl radical, (C 7 -C 11 )-aralkyl radical, or a radical of the formula Z
  • E is a heteroaryl radical, a (C 3 -C 8 )-cycloalkyl radical, or a phenyl radical of the formula F
  • v is 0-6,
  • w is 0 or 1
  • t is 0-3
  • R 7 , R 8 , R 9 , R 10 , and R 11 are identical or different and are hydrogen, halogen, cyano, nitro, trifluoromethyl, (C 1 -C 6 )-alkyl, (C 3 -C 8 )-cycloalkyl, (C 1 -C 6 )-alkoxy, —O—[CH 2 ] x —C f H (2f+1 ⁇ g) —F g , —OCF 2 —Cl, —O—CF 2 —CHFCl, (C 1 -C 6 )-alkylmercapto, (C 1 -C 6 )-hydroxyalkyl, (C 1 -C 6 )-alkoxy-(C 1 -C 6 )-alkoxy, (C 1 -C 6 )-alkoxy-(C 1 -C 6 )-alkyl, (C 1 -C 6 )-alkylsulfinyl, (C 1 -C
  • R 4 is alternatively R′′, where R′ and R′′ are identical or different and are hydrogen, (C 6 -C 12 )-aryl, (C 7 -C 11 )-aralkyl, (C 1 -C 8 )-alkyl, (C 1 -C 8 )-alkoxy-(C 1 -C 8 )-alkyl, (C 7 -C 12 )-aralkoxy-(C 1 -C 8 )-alkyl, (C 1 -C 12 )-aryloxy-(C 1 -C 8 )-alkyl, (C 1 -C 10 )-alkylcarbonyl, optionally substituted (C 7 -C 16 )-aralkylcarbonyl, or optionally substituted C 6 -C 12 )-arylcarbonyl; or R′ and R′′ together are —[CH 2 ] h , in which a CH 2 group can be replaced by O,
  • Y is N or CR 3 ;
  • R 1 , R 2 and R 3 are identical or different and are hydrogen, hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl, (C 1 -C 20 )-alkyl, (C 3 -C 8 )-cycloalkyl, (C 3 -C 8 )cycloalkyl-(C 1 -C 12 )-alkyl, (C 3 -C 8 )-cycloalkoxy, (C 3 -C 8 )-Cycloalkyl-(C 1 -C 12 )-alkoxy, (C 3 -C 8 )-cycloalkyl-(C 1 -C 12 )-alkyl, (C 3 -C 8 )-cycloalkyloxy-(C 1 -C 12 )-alkoxy, (C 3 -C 8 )-cycloalkyl-(C 1 -C 8 )-alkyl-(C 1 -C 6 )-alk
  • R x and R v are each independently selected from hydrogen, (C 1 -C 6 )-alkyl, (C 3 -C 7 )-cycloalkyl, aryl, or the substituent of an ⁇ -carbon of an ⁇ -amino acid, to which the L- and D-ammo acids belong,
  • T is OH, or NR*R**, and R*, R** and R*** are identical or different and are selected from hydrogen, (C 6 -C 12 )-aryl, (C 7 -C 11 )-aralkyl, (C 1 -C 8 )-alkyl, (C 3 -C 8 )-cycloalkyl, (+)-dehydroabietyl, (C 1 -C 8 )-alkoxy-(C 1 -C 8 )-alkyl, (C 7 -C 12 )-aralkoxy-(C 1 -C 8 )-alkyl, (C 6 -C 12 )-aryloxy-(C 1 -C 8 )-alkyl, (C 1 -C 10 )-alkanoyl, optionally substituted (C 7 -C 16 )-aralkanoyl, optionally substituted (C 6 -C 12 )-aroyl; or R* and R** together are —[
  • R 1 and R 2 , or R 2 and R 3 form a chain [CH 2 ] o , which is saturated or unsaturated by a C ⁇ C double bond, in which 1 or 2 CH 2 groups are optionally replaced by O, S, SO, SO 2 , or NR′, and R′ is hydrogen, (C 6 -C 12 )-aryl, (C 1 -C 8 )-alkyl, (C 1 -C 8 )-alkoxy-(C 1 -C 8 )-alkyl, (C 7 -C 12 )-aralkoxy-(C 1 -C 8 )-alkyl, (C 6 -C 12 )-aryloxy-(C 1 -C 8 )-alkyl, (C 1 -C 10 )-alkanoyl, optionally substituted (C 7 -C 16 )-aralkanoyl, or optionally substituted (C6-C12)-aroyl; and o is 3, 4
  • R 1 and R 2 , or R 2 and R 3 form a carbocyclic or heterocyclic 5- or 6-membered aromatic ring;
  • R 1 and R 2 , or R 2 and R 3 together with the pyridine or pyridazine carrying them, form an optionally substituted heterocyclic ring systems selected from thienopyridines, furanopyridines, pyridopyridines, pyrimidinopyridines, imidazopyridines, thiazolopyridines, oxazolopyridines, quinoline, isoquinoline, and cinnoline; where quinoline, isoquinoline or cinnoline preferably satisfy the formulae Ia, Ib and Ic:
  • V is S, O, or NR k
  • R k is selected from hydrogen, (C 1 -C 6 )-alkyl, aryl, or benzyl; where an aryl radical may be optionally substituted by 1 to 5 substituents as defined above;
  • R 24 , R 25 , R 26 , and R 27 in each case independently of each other have the meaning of R 1 , R 2 and R 3 ;
  • f is 1 to 8;
  • g is 0 or 1 to (2f+1);
  • x is 0 to 3;
  • h is 3 to 7;
  • compounds of Formula (I) as defined above include, but are not limited to, N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine; N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine; N-((3-hydroxy-6-(2-propyloxy)-quinolin-2-yl)-carbonyl)-glycine; and N-((7-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine; [(3-methoxy-pyridine-2-carbonyl)-amino]-acetic acid; 3-methoxypyridine-2-carboxylic acid N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride, 3-methoxypyridine-2-carboxylic acid N-(((1-octyloxy)-carbony
  • compounds of Formula (Ia) as defined above include, but are not limited to, N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine, N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine, N-((3-hydroxy-6-(2-propyloxy)-quinolin-2-yl)-carbonyl)-glycine, N-((7-chloro-3-hydroxy-quinoline-2-carbonyl)-amino]-acetic acid, [(3-benzyloxy-7-chloro-quinoline-2-carbonyl)-amino]-acetic acid, [(3-hydroxy-6-isopropoxy-quinoline-2-carbonyl)-amino]-acetic acid, [(3-hydroxy-6-phenoxy-quinoline-2-carbonyl)-amino]-acetic acid, and [(3-hydroxy-6-trifluo
  • compounds of Formula (Ib) as defined above include, but are not limited to, N-((1-chloro-4-hydroxy-7-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine, N-((7-bromo-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic acid, N-((1-chloro-4-hydroxy-6-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine, N-((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl)-carbonyl)-glycine, N-((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl)-carbonyl)-glycine, [(7-butoxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic acid, N-((7-benzyl)-a
  • a compound of the invention increases endogenous erythropoietin plasma levels by increasing synthesis of erythropoietin in tissues, such as renal, hepatic, hematopoietic, and/or neural tissues, in vivo or ex vivo.
  • the compound increases erythropoietin synthesis by inhibiting hydroxylation of the alpha subunit of hypoxia inducible factor (HIF ⁇ ), thereby stabilizing HIF within a cell.
  • the agent inhibits hydroxylation of the HIF-1 ⁇ P 564 residue or a homologous proline in another HIF ⁇ isoform.
  • the agent inhibits hydroxylation of the HIF-1 ⁇ P 402 residue or a homologous proline in another HIF ⁇ isoform.
  • the compound may additionally inhibit hydroxylation of HIF ⁇ asparagine residues.
  • the agent inhibits hydroxylation of the HIF-1 ⁇ N 803 residue or a homologous asparagine residue in another HIF ⁇ isoform.
  • the present invention also provides methods for identifying compounds that increase endogenous erythropoietin plasma levels, the methods comprising administering a compound of interest to, e.g., an animal or to cultured cells and measuring erythropoietin in, e.g., the blood or conditioned culture media, respectively.
  • a compound of interest e.g., an animal or to cultured cells
  • measuring erythropoietin in e.g., the blood or conditioned culture media, respectively.
  • An increase in EPO in treated animals or cells relative to untreated controls is indicative of a compound that increases endogenous EPO.
  • the methods identify compounds that indirectly increase synthesis of erythropoietin by stabilizing HIF ⁇ in cells.
  • the methods and compounds of the invention can be administered in combination with various other therapeutic approaches.
  • the compound is administered with an iron supplement, e.g., ferrous sulfate, vitamin B 12 , and/or folic acid.
  • the compound is administered in conjunction with administration of exogenous erythropoietin, e.g., recombinant human erythropoietin, and/or granulocyte-colony stimulating factor (G-CSF), e.g., recombinant G-CSF.
  • G-CSF granulocyte-colony stimulating factor
  • FIG. 1 shows erythropoietin induction in vitro in response to compounds of the invention.
  • Cells in culture were treated with compounds at the concentrations indicated.
  • Cell types shown in the figure are human liver cells derived from a hepatocellular carcinoma (Hep3B).
  • FIGS. 2A, 2B, and 2 C show erythropoietin induction and subsequent hematocrit increase in animals treated with a compound of the invention.
  • FIG. 2A shows expression of erythropoietin transcript in the liver and kidney of animals treated for 3 days with either a vehicle control (0 mg compound/kg body weight/day) or a compound of the invention.
  • FIG. 2B shows erythropoietin levels in plasma
  • FIG. 2C shows blood hematocrit, in blood samples collected 4 hours after final treatment from the same animals represented in FIG. 2A.
  • FIGS. 3A and 3B show increase in plasma erythropoietin and resulting increase in hematocrit in animals treated with compounds of the invention.
  • FIG. 3A shows an increase in plasma erythropoietin two days after treatment with compound.
  • FIG. 3B shows the increase in hematocrit 2 and 7 days after treatment with various compounds of the invention.
  • FIGS. 4A, 4B, 4 C, and 4 D show changes in serum erythropoietin, circulating blood reticulocytes, blood hemoglobin level, and hematocrit, respectively, in animals treated with variable dosing regimens of a compound of the invention.
  • FIGS. 5A and 5B show changes in hematocrit and circulating blood reticulocytes in animals exposed to a single dose of cisplatin and subsequently treated with a compound of the invention.
  • FIG. 6A, 6B, and 6 C show expression of erythropoietin transcripts in the brain, liver, and kidney, respectively, in animals treated with a compound of the invention.
  • FIG. 7 shows increases in endogenous erythropoietin levels in sham-operated and bilaterally nephrectomized animals treated with a compound of the invention relative to untreated sham and BN controls.
  • anemia refers to any abnormality in hemoglobin or erythrocytes that leads to reduced oxygen levels in the blood.
  • Anemia can be associated with abnormal production, processing, or performance of erythrocytes and/or hemoglobin.
  • the term anemia refers to any reduction in the number of red blood cells and/or level of hemoglobin in blood relative to normal blood levels.
  • Anemia can arise due to conditions such as acute or chronic kidney disease, infections, inflammation, cancer, irradiation, toxins, diabetes, and surgery. Infections may be due to, e.g., virus, bacteria, and/or parasites, etc. Inflammation may be due to infection, autoimmune disorders, such as rheumatoid arthritis, etc. Anemia can also be associated with blood loss due to, e.g., stomach ulcer, duodenal ulcer, hemorrhoids, cancer of the stomach or large intestine, trauma, injury, surgical procedures, etc. Anemia is further associated with radiation therapy, chemotherapy, and kidney dialysis.
  • Anemia is also associated with HIV-infected patients undergoing treatment with azidothymidine (zidovudine) or other reverse transcriptase inhibitors, and can develop in cancer patients undergoing chemotherapy, e.g., with cyclic cisplatin- or non-cisplatin-containing chemotherapeutics.
  • Aplastic anemia and myelodysplastic syndromes are diseases associated with bone marrow failure that result in decreased production of erythrocytes.
  • anemia can result from defective or abnormal hemoglobin or erythrocytes, such as in disorders including microcytic anemia, hypochromic anemia, etc.
  • Anemia can result from disorders in iron transport, processing, and utilization, see, e.g., sideroblastic anemia, etc.
  • disorders and “diseases” and “conditions” are used inclusively and refer to any condition deviating from normal.
  • anemic conditions and “anemic disorders” refer to any condition, disease, or disorder associated with anemia. Such disorders include, but are not limited to, those disorders listed above. Anemic disorders further include, but are not limited to, aplastic anemia, autoimmune hemolytic anemia, bone marrow transplantation, Churg-Strauss syndrome, Diamond Blackfan anemia, Fanconi's anemia, Felty syndrome, graft versus host disease, hematopoietic stem cell transplantation; hemolytic uremic syndrome, myelodysplasic syndrome, nocturnal paroxysmal hemoglobinuria, osteomyelofibrosis, pancytopenia, pure red-cell aplasia, purpura Schoenlein-Henoch, sideroblastic anemia, refractory anemia with excess of blasts, rheumatoid arthritis, Shwachman syndrome, sickle cell disease, thalassemia major, thalassemia minor, thrombocytopenic
  • erythropoietin-associated conditions is used inclusively and refers to any condition associated with below normal, abnormal, or inappropriate modulation of erythropoietin.
  • Erythropoietin-associated conditions include any condition wherein an increase in EPO level would provide therapeutic benefit. Levels of erythropoietin associated with such conditions can be determined by any measure accepted and utilized by those of skill in the art. Erythropoietin-associated conditions include anemic conditions such as those described above.
  • Erythropoietin-associated conditions further include neurological disorders and/or injuries, including cases of stroke, trauma, epilepsy, neurodegenerative disease and the like, wherein erythropoietin may provide a neuroprotective effect.
  • Neurodegenerative diseases contemplated by the invention include Alzheimer's disease, Parkinson's disease, Huntington's disease, and the like.
  • erythropoietin refers to any recombinant or naturally occurring erythropoietin including, e.g., human erythropoietin (GenBank Accession No. AAA52400; Lin et al. (1985) Proc Natl Acad Sci USA 82:7580-7584), EPOETIN human recombinant erythropoietin (Amgen, Inc., Thousand Oaks Calif.), ARANESP human recombinant erythropoietin (Amgen), PROCRIT human recombinant erythropoietin (Ortho Biotech Products, L.P., Raritan N.J.), etc.
  • HIF ⁇ refers to the alpha subunit of hypoxia inducible factor protein.
  • HIF ⁇ may be any human or other mammalian protein, or fragment thereof, including human HIF-1 ⁇ (Genbank Accession No. Q16665), HIF-2 ⁇ (Genbank Accession No. AAB41495), and HIF-3 ⁇ (Genbank Accession No. AAD22668); murine HIF-1 ⁇ (Genbank Accession No. Q61221), HIF-2 ⁇ (Genbank Accession No. BAA20130 and AAB41496), and HIF-3 ⁇ (Genbank Accession No. AAC72734); rat HIF-1 ⁇ (Genbank Accession No. CAA70701), HEF-2 ⁇ (Genbank Accession No.
  • HIF ⁇ may also be any non-mammalian protein or fragment thereof, including Xenopus laevis HIF-1 ⁇ (Genbank Accession No. CAB96628), Drosophila melanogaster HIF-1 ⁇ (Genbank Accession No. JC4851), and chicken HIF-1 ⁇ (Genbank Accession No. BAA34234).
  • HIF ⁇ gene sequences may also be obtained by routine cloning techniques, for example by using all or part of a HIF ⁇ gene sequence described above as a probe to recover and determine the sequence of a HIF ⁇ gene in another species.
  • a fragment of HIF ⁇ includes any fragment retaining at least one functional or structural characteristic of HIF ⁇ Fragments of HIF ⁇ include, e.g., the regions defined by human HIF-1 ⁇ from amino acids 401 to 603 (Huang et al., supra), amino acid 531 to 575 (Jiang et al. (1997) J Biol Chem 272:19253-19260), amino acid 556 to 575 (Tanimoto et al., supra), amino acid 557 to 571 (Srinivas et al. (1999) Biochem Biophys Res Commun 260:557-561), and amino acid 556 to 575 (Ivan and Kaelin (2001) Science 292:464-468).
  • HIF ⁇ fragments include any fragment containing at least one occurrence of the motif LXXLAP, e.g., as occurs in the human HIF-1 ⁇ native sequence at L 397 TLLAP and L 559 EMLAP.
  • a HIF peptide for use in the screening assay of Example 9 may comprise [methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO: 5).
  • amino acid sequence or “polypeptide” as used herein, e.g., to refer to HIF ⁇ and fragments thereof, contemplate an oligopeptide, peptide, or protein sequence, or to a fragment of any of these, and to naturally occurring or synthetic molecules. “Fragments” can refer to any portion of a sequence that retains at least one structural or functional characteristic of the protein. Immunogenic fragments or antigenic fragments are fragments of polypeptides, preferably, fragments of about five to fifteen amino acids in length, that retain at least one biological or immunological activity. Where “amino acid sequence” is used to refer to the polypeptide sequence of a naturally occurring protein molecule, “amino acid sequence” and like terms are not meant to limit the amino acid sequence to the complete native sequence associated with the recited protein molecule.
  • related proteins encompasses other 2-oxoglutarate dioxygenase enzymes, especially those family members that similarly require Fe 2+ , 2-oxoglutarate, and oxygen to maintain hydroxylase actitity.
  • Such enzymes include, but are not limited to, e.g., procollagen lysyl hydroxylase, procollagen prolyl 4-hydroxylase, and Factor Inhibiting HIF (FIH), an asparaginyl hydroxylase responsible for regulating transactivation of HIF ⁇ (GenBank Accession No. AAL27308; Mahon et al.
  • HIF prolyl hydroxylase and “HIF PH” refer to any enzyme capable of hydroxylating a proline residue in the HIF protein.
  • the proline residue hydroxylated by HIF PH includes the proline found within the motif LXXLAP, e.g., as occurs in the human HIF-1 ⁇ native sequence at L 397 TLLAP and L 559 EMLAP.
  • HIF PH includes members of the Egl-Nine (EGLN) gene family described by Taylor (2001, Gene 275:125-132), and characterized by Aravind and Koonin (2001, Genome Biol 2:RESEARCH0007), Epstein et al.
  • HIF PH enzymes include human SM-20 (EGLN1) (GenBank Accession No. AAG33965; Dupuy et al. (2000) Genomics 69:348-54), EGLN2 isoform 1 (GenBank Accession No. CAC42510; Taylor, supra), EGLN2 isoform 2 (GenBank Accession No. NP — 060025), and EGLN3 (GenBank Accession No. CAC42511; Taylor, supra); mouse EGLN1 (GenBank Accession No. CAC42515), EGLN2 (GenBank Accession No.
  • HIF PH may include Caenorhabditis elegans EGL-9 (GenBank Accession No. AAD56365) and Drosophila melanogaster CG1114 gene product (GenBank Accession No. AAF52050). HIF PH also includes any fragment of the foregoing full-length proteins that retain at least one structural or functional characteristic.
  • agonist refers to a molecule that increases or prolongs the duration of the effect of a particular molecule.
  • Agonists may include proteins, nucleic acids, carbohydrates, or any other molecules that increase the effect(s) of the target molecule.
  • Antagonist refers to a molecule which decreases the extent or duration of the effect of the biological or immunological activity of a particular molecule. Antagonists may include proteins, nucleic acids, carbohydrates, antibodies, or any other molecules that decrease the effect(s) of the target molecule.
  • microarray refers to any arrangement of nucleic acids, amino acids, antibodies, etc., on a substrate.
  • the substrate can be any suitable support, e.g., beads, glass, paper, nitrocellulose, nylon, or any appropriate membrane, etc.
  • a substrate can be any rigid or semi-rigid support including, but not limited to, membranes, filters, wafers, chips, slides, fibers, beads, including magnetic or nonmagnetic beads, gels, tubing, plates, polymers, microparticles, capillaries, etc.
  • the substrate can provide a surface for coating and/or can have a variety of surface forms, such as wells, pins, trenches, channels, and pores, to which the nucleic acids, amino acids, etc., may be bound.
  • excipient means an inert or inactive substance used in the production of pharmaceutical products or other tablets, including without limitation any substance used as a binder, disintegrant, coating, compression/encapsulation aid, cream or lotion, lubricant, parenteral, sweetener or flavoring, suspending/gelling agent, or wet granulation agent.
  • Binders include, e.g., carbopol, povidone, xanthan gum, etc.; coatings include, e.g., cellulose acetate phthalate, ethylcellulose, gellan gum, maltodextrin, etc.; compression/encapsulation aids include, e.g., calcium carbonate, dextrose, fructose de, honey dc, lactose (anhydrate or monohydrate; optionally in combination with aspartame, cellulose, or microcrystalline cellulose), starch dc, sucrose, etc.; disintegrants include, e.g., croscarmellose sodium, gellan gum, sodium starch glycolate, etc.; creams and lotions include, e.g., maltodextrin, carrageenans, etc.; lubricants include, e.g., magnesium stearate, stearic acid, sodium stearyl fumarate, etc.; materials for chewable tablets include, e.g.,
  • loading dose refers to a single or multiple dose administered initially to rapidly achieve the desired pharmacological level.
  • a loading dose in reference to the methods of the invention refers to an initial dosing regimen that rapidly increases, e.g., the plasma concentration of a compound of the invention to a pharmaceutically active level.
  • induction dose refers to a repeated dose strength administered initially to rapidly achieve the desired physiological response.
  • an induction dose in reference to the methods of the invention refers to an initial dosing regimen that rapidly increases the hematocrit or hemoglobin level to within a target range, which may be at or below normal hematocrit/hemoglobin levels.
  • maintenance dose refers to the dose level administered after a loading or induction dose in order to maintain a desired physiological response.
  • a maintenance dose in reference to the methods of the invention refers to a dosing regimen that maintains hematocrit and/or hemoglobin within a desired target range, which may be at or below normal hematocrit/hemoglobin levels.
  • sample is used herein in its broadest sense. Samples may be derived from any source, for example, from bodily fluids, secretions, tissues, cells, or cells in culture including, but not limited to, saliva, blood, urine, serum, plasma, vitreous, synovial fluid, cerebral spinal fluid, amniotic fluid, and organ tissue (e.g., biopsied tissue); from chromosomes, organelles, or other membranes isolated from a cell; from genomic DNA, cDNA, RNA, mRNA, etc.; and from cleared cells or tissues, or blots or imprints from such cells or tissues.
  • organ tissue e.g., biopsied tissue
  • Samples may be derived from any source, such as, for example, a human subject, or a non-human mammalian subject, etc. Also contemplated are samples derived from any animal model of disease.
  • a sample can be in solution or can be, for example, fixed or bound to a substrate.
  • a sample can refer to any material suitable for testing for the presence of erythropoietin or HIF ⁇ or to fragments thereof, or suitable for screening for molecules that increase endogenous levels of erythropoietin or HIF ⁇ or to fragments thereof. Methods for obtaining such samples are within the level of skill in the art.
  • subject is used herein in its broadest sense.
  • Subjects may include isolated cells, either prokaryotic or eukaryotic, or tissues grown in culture.
  • a subject is an animal, particularly an animal selected from a mammalian species including rat, rabbit, bovine, ovine, porcine, canine, feline, murine, equine, and primate, particularly human.
  • the present invention provides methods of increasing endogenous erythropoietin (EPO). These methods can be applied in vivo, e.g., in blood plasma, or in vitro, e.g., in cell culture conditioned media.
  • the invention further provides methods of increasing endogenous EPO levels to prevent, pretreat, or treat EPO-associated conditions, including, e.g., conditions associated with anemia and neurological disorders.
  • Conditions associated with anemia include disorders such as acute or chronic kidney disease, diabetes, cancer, ulcers, infection with virus, e.g., HIV, bacteria, or parasites; inflammation, etc.
  • Anemic conditions can further include those associated with procedures or treatments including, e.g., radiation therapy, chemotherapy, dialysis, and surgery.
  • Disorders associated with anemia additionally include abnormal hemoglobin and/or erythrocytes, such as found in disorders such as microcytic anemia, hypochromic anemia, aplastic anemia, etc.
  • the present methods can be used to increase endogenous EPO in a subject undergoing a specific treatment or procedure, prophylactically or concurrently, for example, an HIV-infected anemic patient being treated with azidothymidine (zidovudine) or other reverse transcriptase inhibitors, an anemic cancer patient receiving cyclic cisplatin- or non-cisplatin-containing chemotherapeutics, or an anemic or non-anemic patient scheduled to undergo surgery.
  • Methods of increasing endogenous EPO can also be used to prevent, pretreat, or treat EPO-associated conditions associated with nerve damage or neural tissue degeneration including, but not limited to, stroke, trauma, epilepsy, spinal cord injury, and neurodegerative disorders.
  • the methods can be used to increase endogenous EPO levels in an anemic or non-anemic patient scheduled to undergo surgery to reduce the need for allogenic blood transfusions or to facilitate banking of blood prior to surgery.
  • the small decreases in hematocrit that typically occur after presurgical autologous blood donation do not stimulate an increase in endogenous EPO or in compensatory erythropoiesis.
  • preoperative stimulation of endogenous EPO would effectively increase erythrocyte mass and autologous donation volumes while maintaining higher hematocrit levels, and such methods are specifically contemplated herein.
  • the methods of the invention could be applied to reduce allogeneic blood exposure. (Crosby (2002) Amer J Therap 9:371-376.)
  • the methods of the invention can also be used to enhance athletic performance, improve exercise capacity, and facilitate or enhance aerobic conditioning. Such methods can be used, e.g., by athletes to facilitate training and by soldiers to improve, e.g., stamina and endurance.
  • the methods of the invention have been shown to increase endogenous erythropoietin levels in media from cultured cells treated in vitro and in blood plasma from animals treated in vivo.
  • the kidney is the major source of erythropoietin in the body
  • other organs including brain, liver, and bone marrow, can and do synthesize erythropoietin upon appropriate stimulation.
  • endogenous erythropoietin expression can be increased in various organs of the body, including brain, kidney, and liver. Indeed, methods of the invention even increase endogenous erythropoietin levels in animals that have undergone bilateral nephrectomy.
  • the methods of the invention demonstrate that erythropoietin levels can be increased even when kidney function is compromised.
  • the invention is not to be limited by the mechanism by which erythropoietin is produced, the decrease in erythropoietin secretion typically seen during kidney failure may be due to hyperoxia in renal tissue due to increased flowthrough/reperfusion. (Priyadarshi et al. (2002) Kidney Int 61:542-546.)
  • the methods of the invention increase the hematocrit and blood hemoglobin level in animals treated in vivo.
  • the increases in plasma EPO, hematocrit, and blood hemoglobin in response to the compounds used in the methods of the invention are dose-sensitive; however, dosing regimes can be established which produce a constant, controlled level of response to the compounds of the invention.
  • treatment with compounds of the invention can correct anemia, for example, induced by a toxic compound such as the chemotherapeutic agent cisplatin, or due to blood loss, e.g., trauma, injury, parasites, or surgery.
  • the increase in hematocrit and blood hemoglobin in animals treated with compounds of the invention is preceded by an increase in the percentage of circulating immature red blood cells (reticulocytes) within the blood.
  • reticulocytes circulating immature red blood cells
  • the invention contemplates the use of the compounds of the invention in methods to increase reticulocyte levels in the blood of animals for production of cell-free reticulocyte lysates as described by, e.g., Pelham and Jackson.
  • Circulating reticulocyte levels are increased in animals, e.g., rabbits, etc., by treatment with compounds of the invention, alone or in combination with another compound such as, e.g., acetylphenylhydrazine, etc.
  • the blood is collected, and reticulocytes are pelleted by centrifugation and lysed with distilled water. Extracts can be further processed using any appropriate methodology known to those skilled in the art. (See, e.g., Jackson and Hunt (1983) Methods Enzymol 96:50-74.)
  • the invention also contemplates increasing iron transport, processing, and utilization using the methods of the invention.
  • the methods of the invention may increase enzymes and proteins involved in iron uptake, transport, and processing.
  • enzymes and proteins include, but are not limited to, transferrin and transferrin receptor, which together facilitate iron transport to and uptake by, e.g., erythroid tissue, and ceruloplasmin, a ferroxidase required to oxidize ferrous iron to ferric iron.
  • ceruloplasmin is important for supply of iron to tissues.
  • the ability of the methods of the invention to increase both endogenous erythropoietin and transport and utilization of iron in a single course of treatment provides benefits not addressed by current anemia therapeutics, such as administration of recombinant erythropoietin, in the treatment of anemic disorders including, but not limited to, rheumatoid arthritis, sideroblastic anemia, etc.
  • the invention is not limited by the method in which endogenous erythropoietin is induced, one specifically contemplated mechanism by which the compounds increase synthesis of endogenous erythropoietin is by inhibiting hydroxylation of the alpha subunit of hypoxia inducible factor (HIF ⁇ ). More specifically, the compounds inhibit hydroxylation of HIF ⁇ proline residues, e.g., the P 564 residue in HIF-1 ⁇ or a homologous proline in another HIF ⁇ isoform, or the P 402 residue in HIF-1 ⁇ or a homologous proline in another HIF ⁇ isoform. Additionally, the compounds may be used to inhibit hydroxylation of HIF ⁇ asparagine residues, e.g., the N 803 residue of HIF-1 ⁇ or a homologous asparagine residue in another HIF ⁇ isoform.
  • HIF ⁇ proline residues e.g., the P 564 residue in HIF-1 ⁇ or a homologous proline in another HIF ⁇ is
  • the enzyme responsible for HIF ⁇ hydroxylation is a member of the 2-oxoglutarate dioxygenase family.
  • Such enzymes include, but are not limited to, procollagen lysyl hydroxylase, procollagen prolyl 3-hydroxylase, procollagen prolyl 4-hydroxylase ⁇ (I) and ⁇ (II), thymine 7-hydroxylase, aspartyl (asparaginyl) ⁇ -hydroxylase, ⁇ -N-trimethyllysine hydroxylase, ⁇ -butyrobetaine hydroxylase, etc.
  • Compounds that can be used in the methods of the invention include, e.g., structural mimetics of 2-oxoglutarate. Such compounds may inhibit the target 2-oxoglutarate dioxygenase family member competitively with respect to 2-oxoglutarate and noncompetitively with respect to iron. (Majamaa et al. (1984) Eur J Biochem 138:239-45; and Majamaa et al., supra.)
  • compounds used in the methods of the invention are selected from a compound of the formula (I)
  • A is 1,2-arylidene, 1,3-arylidene, 1,4-arylidene; or (C 1 -C 4 )-alkylene, optionally substituted by one or two halogen, cyano, nitro, trifluoromethyl, (C 1 -C 6 )-alkyl, (C 1 -C 6 )-hydroxyalkyl, (C 1 -C 6 )-alkoxy, —O—[CH 2 ] x —C f H (2f+1 ⁇ g) Hal g , (C 1 -C 6 )-fluoroalkoxy, (Cl-C 8 )-fluoroalkenyloxy, (C 1 -C 8 )-fluoroalkynyloxy, —OCF 2 Cl, —O—CF 2 —CHFCl; (C 1 -C 6 )-alkylmercapto, (C 1 -C 6 )-alkylsulfinyl, (C 1 -C 6
  • B is —CO 2 H, —NH 2 , —NHSO 2 CF 3 , tetrazolyl, imidazolyl, 3-hydroxyisoxazolyl, —CONHCOR′′′, —CONHSOR′′′, CONHSO 2 R′′′, where R′′′ is aryl, heteroaryl, (C 3 -C 7 )-cycloalkyl, or (C 1 -C 4 )-alkyl, optionally monosubstituted by (C 6 -C 12 )-aryl, heteroaryl, OH, SH, (C 1 -C 4 )-alkyl, (C 1 -C 4 )-alkoxy, (C 1 -C 4 )-thioalkyl, (C 1 -C 4 )-sulfinyl, (C 1 -C 4 )-sulfonyl, CF 3 , Cl, Br, F, I, NO 2 , —COOH, (C 2 -
  • X is O or S
  • Q is O, S, NR′, or a bond
  • R 4 is halogen, nitrile, or trifluoromethyl
  • R 4 is hydrogen, (C 1 -C 10 )-alkyl radical, (C 2 -C 10 )-alkenyl radical, (C 2 -C 10 )-alkynyl radical, wherein alkenyl or alkynyl radical contains one or two C—C multiple bonds; unsubstituted fluoroalkyl radical of the formula —[CH 2 ] x —C f H (2f+1 ⁇ g) F g , (C 1 -C 8 )-alkoxy-(C 1 -C 6 )-alkyl radical, (C 1 -C 6 )-alkoxy-(C 1 -C 4 )-alkoxy-(C 1 -C 4 )-alkyl radical, aryl radical, heteroaryl radical, (C 7 -C 11 )-aralkyl radical, or a radical of the formula Z
  • E is a heteroaryl radical, a (C 3 -C 8 )-cycloalkyl radical, or a phenyl radical of the formula F
  • v is 0-6,
  • w is 0 or 1
  • R 7 , R 8 , R 9 , R 10 , and R 11 are identical or different and are hydrogen, halogen, cyano, nitro, trifluoromethyl, (C 1 -C 6 )-alkyl, (C 3 -C 8 )-cycloalkyl, (C 1 -C 6 )-alkoxy, —O—[CH 2 ] x —C f H (2f+1 ⁇ g) —F g , —OCF 2 —Cl, —O—CF 2 —CHFCl, (C 1 -C 6 )-alkylmercapto, (C 1 -C 6 )-hydroxyalkyl, (C 1 -C 6 )-alkoxy-(C 1 -C 6 )-alkoxy, (C 1 -C 6 )-alkoxy-(C 1 -C 6 )-alkyl, (C 1 -C 6 )-alkylsulfinyl, (C 1 -C
  • R 4 is alternatively R′, where R′ and R′′ are identical or different and are hydrogen, (C 6 -C 12 )-aryl, (C 7 -C 11 )-aralkyl, (C 1 -C 8 )-alkyl, (C 1 -C 8 )-alkoxy-(C 1 -C 8 )-alkyl, (C 7 -C 12 )-aralkoxy-(C 1 -C 8 )-alkyl, (C 6 -C 12 )-aryloxy-(C 1 -C 8 )-alkyl, (C 1 -C 10 )-alkylcarbonyl, optionally substituted (C 7 -C 16 )-aralkylcarbonyl, or optionally substituted C 6 -C 12 )-arylcarbonyl; or R′ and R′′ together are —[CH 2 ] h , in which a CH 2 group can be replaced by O,
  • Y is N or CR 3 ;
  • R 1 , R 2 and R 3 are identical or different and are hydrogen, hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl, (C 1 -C 20 )-alkyl, (C 3 -C 8 )-cycloalkyl, (C 3 -C 8 )cycloalkyl-(C 1 -C 12 )-alkyl, (C 3 -C 8 )-cycloalkoxy, (C 3 -C 8 )-cycloalkyl-(C 1 -C 12 )-alkoxy, (C 3 -C 8 )-cycloalkyloxy-(C 1 -C 12 )-alkyl, (C 3 -C 8 )-cycloalkyloxy-(C 1 -C 12 )-alkoxy, (C 3 -C 8 )-cycloalkyl-(C 1 -C 8 )-alkoxy, (C 3 -C 8 )-cycloalkyl
  • R x and R v are each independently selected from hydrogen, (C 1 -C 6 )-alkyl, (C 3 -C 7 )-cycloalkyl, aryl, or the substituent of an et-carbon of an ⁇ -amino acid, to which the L- and D-amino acids belong,
  • T is OH, or NR*R**, and R*, R** and R*** are identical or different and are selected from hydrogen, (C 6 -C 12 )-aryl, (C 7 -C 11 )-aralkyl, (C 1 -C 8 )-alkyl, (C 3 -C 8 )-cycloalkyl, (+)-dehydroabietyl, (C 1 -C 8 )-alkoxy-(C 1 -C 8 )-alkyl, (C 7 -C 12 )-aralkoxy-(C 1 -C 8 )-alkyl, (C 6 -C 12 )-aryloxy-(C 1 -C 8 )-alkyl, (C 1 -C 10 )-alkanoyl, optionally substituted (C 7 -C 16 )-aralkanoyl, optionally substituted (C 6 -C 12 )-aroyl; or R* and R** together are —[
  • R 1 and R 2 , or R 2 and R 3 form a chain [CH 2 ] o , which is saturated or unsaturated by a C ⁇ C double bond, in which 1 or 2 CH 2 groups are optionally replaced by O, S, SO, SO 2 , or NR′, and R′ is hydrogen, (C 6 -C 12 )-aryl, (C 1 -C 8 )-alkyl, (C 1 -C 8 )-alkoxy-(C 1 -C 8 )-alkyl, (C 7 -C 12 )-aralkoxy-(C 1 -C 8 )-alkyl, (C 6 -C 12 )-aryloxy-(C 1 -C 8 )-alkyl, (C 1 -C 10 )-alkanoyl, optionally substituted (C 7 -C 16 )-aralkanoyl, or optionally substituted (C6-C12)-aroyl; and o is 3, 4
  • R 1 and R 2 , or R 2 and R 3 form a carbocyclic or heterocyclic 5- or 6-membered aromatic ring;
  • R 1 and R 2 , or R 2 and R 3 together with the pyridine or pyridazine carrying them, form an optionally substituted heterocyclic ring systems selected from thienopyridines, furanopyridines, pyridopyridines, pyrimidinopyridines, imidazopyridines, thiazolopyridines, oxazolopyridines, quinoline, isoquinoline, and cinnoline; where quinoline, isoquinoline or cinnoline preferably satisfy the formulae Ia, Ib and Ic:
  • V is S, O, or NR k
  • R k is selected from hydrogen, (C 1 -C 6 )-alkyl, aryl, or benzyl; where an aryl radical may be optionally substituted by 1 to 5 substituents as defined above;
  • R 24 , R 25 , R 26 , and R 27 in each case independently of each other have the meaning of R 1 , R 2 and R 3 ;
  • f is 1 to 8;
  • g is O or 1 to (2f+1);
  • x is 0 to 3;
  • h is 3 to 7;
  • Exemplary compounds according to Formula (I) are described in European Patent Nos. EP0650960 and EP0650961. All compounds listed in EP0650960 and EP0650961, in particular, those listed in the compound claims and the final products of the working examples, are hereby incorporated into the present application by reference herein. An exemplary compound contained therein is [(3-methoxy-pyridine-2-carbonyl)-amino]-acetic acid.
  • Exemplary compounds of Formula (I) include, but are not limited to, 3-methoxypyridine-2-carboxylic acid N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride, 3-methoxypyridine-2-carboxylic acid N-(((1-octyloxy)-carbonyl)-methyl)-amide, 3-methoxypyridine-2-carboxylic acid N-(((hexyloxy)-carbonyl)-methyl)-amide, 3-methoxypyridine-2-carboxylic acid N-((butyloxy)-carbonyl)-methyl)-amide, 3-methoxypyridine-2-carboxylic acid N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate, 3-methoxypyridine-2-carboxylic acid N-((heptyloxy)-carbonyl)-methyl)-amide, 3-benzyloxypyridine-2-carboxylic acid N-((
  • Additional compounds accordinging to Formula (I) are substituted heterocyclic carboxyamides described in U.S. Pat. No. 5,620,995; 3-hydroxypyridine-2-carboxamidoesters described in U.S. Pat. No. 6,020,350; sulfonamidocarbonylpyridine-2-carboxamides described in U.S. Pat. No. 5,607,954; and sulfonamidocarbonyl-pyridine-2-carboxamides and sulfonamidocarbonyl-pyridine-2-carboxesteramides described in U.S. Pat. Nos. 5,610,172 and 5,620,996.
  • Exemplary compounds of Formula (I) include, but are not limited to, 3-methoxypyridine-2-carboxylic acid N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride, 3-methoxypyridine-2-carboxylic acid N-(((1-octyloxy)-carbonyl)-methyl)-amide, 3-methoxypyridine-2-carboxylic acid N-(((hexyloxy)-carbonyl)-methyl)-amide, 3-methoxypyridine-2-carboxylic acid N-(((butyloxy)-carbonyl)-methyl)-amide, 3-methoxypyridine-2-carboxylic acid N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate, 3-methoxypyridine-2-carboxylic acid N-((2-nonyloxy)-carbonyl)-methyl)-amide racemate, 3-methoxypyridine-2-carboxylic acid N
  • exemplary compounds of Formula (I) include, but are not limited to, 3-hydroxypyridine-2-carboxylic acid N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride, 3-hydroxypyridine-2-carboxylic acid N-(((1-octyloxy)-carbonyl)-methyl)-amide, 3-hydroxypyridine-2-carboxylic acid N-(((hexyloxy)-carbonyl)-methyl)-amide, 3-hydroxypyridine-2-carboxylic acid N-(((butyloxy)-carbonyl)-methyl)-amide, 3-hydroxypyridine-2-carboxylic acid N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate, 3-hydroxypyridine-2-carboxylic acid N-(((heptyloxy)-carbonyl)-methyl)-amide, 3-benzyloxypyridine-2-carboxylic acid N-(((octylic acid), 3-(
  • Exemplary compounds of Formula (Ia) include, but are not limited to, N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine, N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine, N-((3-hydroxy-6-(2-propyloxy)-quinolin-2-yl)-carbonyl)-glycine, N-((7-chloro-3-hydroxy-quinoline-2-carbonyl)-amino]-acetic acid, [(3-benzyloxy-7-chloro-quinoline-2-carbonyl)-amino]-acetic acid (Compound D), [(3-hydroxy-6-isopropoxy-quinoline-2-carbonyl)-amino]-acetic acid (Compound E), [(3-hydroxy-6-phenoxy-quinoline-2-carbonyl)-amino]-acetic acid (Compound F), and [(3
  • Exemplary compounds of Formula (Ib) include, but are not limited to, N-((1-chloro-4-hydroxy-7-(2-propyloxy) isoquinolin-3-yl)-carbonyl)-glycine, N-((7-bromo-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic acid, N-((1-chloro-4-hydroxy-6-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine, N-((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl)-carbonyl)-glycine (Compound J), N-((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl)-carbonyl)-glycine, [(7-butoxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic acid, N-((7-benzyl
  • compounds for use in the methods of the invention are compounds described by Majamaa et al. (1984, Eur J Biochem 138:239-245; and 1985, Biochem J 229:127-133), Kivirikko and Myllyharju (1998, Matrix Biol 16:357-368), Bickel et al. (1998, Hepatology 28:404411), Friedman et al. (2000, Proc Natl Acad Sci USA 97:4736-4741), and Franklin et al. (2001, Biochem J 353:333-338), all of which are incorporated by reference herein in their entirety.
  • the invention provides additional exemplary compounds wherein, e.g., position A and B together may be, e.g., hexanoic acid, cyanomethyl, 2-aminoethyl, benzoic acid, 1H-benzoimidazol-2-ylmethyl, etc.
  • compounds used in the methods of the invention are selected from a compound of the formula (II)
  • R 28 is hydrogen, nitro, amino, cyano, halogen, (C 1 -C 4 )-alkyl, carboxy or a metabolically labile ester derivative thereof; (C 1 -C 4 )-alkylamino, di-(C 1 -C 4 )-alkylamino, (C 1 -C 6 )-alkoxycarbonyl, (C 2 -C 4 )-alkanoyl, hydroxy-(C 1 -C 4 )-alkyl, carbamoyl, N—(C 1 -C 4 )-alkylcarbamoyl, (C 1 -C 4 )-alkylthio, (C 1 -C 4 )-alkylsulfinyl, (C, -C 4 )-alkylsulfonyl, phenylthio, phenylsulfinyl, phenylsulfonyl, said phenyl or
  • R 29 is hydrogen, hydroxy, amino, cyano, halogen, (C 1 -C 4 )-alkyl, carboxy or metabolically labile ester derivative thereof, (C 1 -C 4 )-alkylamino, di-(C 1 -C 4 )-alkylamino, (C 1 -C 6 )-alkoxycarbonyl, (C 2 -C 4 )-alkanoyl, (C 1 -C 4 )-alkoxy, carboxy-(C 1 -C 4 )-alkoxy, (C 1 -C 4 )-alkoxycarbonyl-(C 1 -C 4 )-alkoxy, carbamoyl, N—(C 1 -C 8 )-alkylcarbamoyl, N,N-di-(C 1 -C 8 )-alkylcarbamoyl, N-[amino-(C 2 -C 8 )-alkyl]-
  • R 30 is hydrogen, (C 1 -C 4 )-alkyl, (C 2 -C 4 )-alkoxy, halo, nitro, hydroxy, fluoro-(1-4C)alkyl, or pyridinyl;
  • R 31 is hydrogen, (C 1 -C 4 )-alkyl, (C 2 -C 4 )-alkoxy, halo, nitro, hydroxy, fluoro-(C 1 -C 4 )-alkyl, pyridinyl, or methoxy;
  • R 32 is hydrogen, hydroxy, amino, (C 1 -C 4 )-alkylamino, di-(C 1 -C 4 )-alkylamino, halo, (C 1 -C 4 )-alkoxy-(C 2 -C 4 )-alkoxy, fluoro-(C 1 -C 6 )-alkoxy, pyrrolidin-1-yl, piperidino, piperazin-1-yl, or morpholino, wherein the heterocyclic group is optionally substituted with 1 to 4 identical or different (C 1 -C 4 )-alkyl or benzyl; and
  • R 33 and R 34 are individually selected from hydrogen, (C 1 -C 4 )-alkyl, and (C 1 -C 4 )-alkoxy; including pharmaceutically-acceptable salts and pro-drugs derived therefrom.
  • Exemplary compounds of Formula (II) are described in U.S. Pat. Nos. 5,916,898 and 6,200,974, and International Publication No. WO 99/21860. All compounds listed in the foregoing patents and publication, in particular, those listed in the compound claims and the final products of the working examples, are hereby incorporated into the present application by reference herein. Exemplary compounds contained therein are 3-carboxy-4-oxo-3,4-dihydro-1,10-phenanthroline (see, e.g., Seki et al. (1974) Chem Abstracts 81:424, No.
  • compounds used in the methods of the invention are selected from a compound of the formula (III)
  • a is an integer from 1 to 4.
  • b is an integer from 0 to 4.
  • c is an integer from 0 to 4.
  • Z is selected from the group consisting of (C 3 -C 10 )cycloalkyl, (C 3 -C 10 )cycloalkyl independently substituted with one or more Y 1 , 3-10 membered heterocycloalkyl and 3-10 membered heterocycloalkyl independently substituted with one or more Y 1 ; (C 5 -C 20 )aryl, (C 5 -C 20 ) aryl independently substituted with one or more Y 1 , 5-20 membered heteroaryl and 5-20 membered heteroaryl independently substituted with one or more Y 1 ;
  • Ar 1 is selected from the group consisting of (C 5 -C 20 )aryl, (C 5 -C 20 )aryl independently substituted with one or more Y 2 , 5-20 membered heteroaryl and 5-20 membered heteroaryl independently substituted with one or more Y 2 ;
  • each Y 1 is independently selected from the group consisting of a lipophilic functional group, (C 5 -C 20 )aryl, (C 6 -C 26 )alkaryl, 5-20 membered heteroaryl and 6-26 membered alk-heteroaryl;
  • each Y 2 is independently selected from the group consisting of —R′, —OR′, —OR′′, —SR′, —SR′′, —NR′R′, —NO 2 , —CN, -halogen, -trihalomethyl, trihalomethoxy, —C(O)R′, —C(O)OR′, —C(O)NR′R′, —(O)NR′OR′, —C(NR′R′) ⁇ NOR′, —NR′—C(O)R′, —SO 2 R′, —SO 2 R′, —NR′—SO 2 —R′, —NR′C(O)—NR′R′, tetrazol-5-yl, —NR′C(O)—OR′, —C(NR′R′) ⁇ NR′, —S(O)—R′, —S(O)—R′′, and —NR′—C(S)—NR′R′; and
  • each R′ is independently selected from the group consisting of —H, (C 1 -C 8 )alkyl, (C 2 -C 8 )alkenyl, and (C 2 -C 8 )alkynyl;
  • each R′′ is independently selected from the group consisting of (C 5 -C 20 )aryl and (C 5 -C 20 )aryl independently substituted with one or more —OR′, —SR′, —NR′R′, —NO 2 , —CN, halogen or trihalomethyl groups,
  • a, b, and Z are as defined above;
  • R 35 and R 36 are each independently selected from the group consisting of hydrogen, (C 1 -C 8 )alkyl, (C 2 -C 8 )alkenyl, (C 2 -C 8 )alkynyl, (C 3 -C 10 )cycloalkyl, (C 5 -C 20 )aryl, (C 5 -C 20 ) substituted aryl, (C 6 -C 26 )alkaryl, (C 6 -C 26 ) substituted alkaryl, 5-20 membered heteroaryl, 5-20 member substituted heteroaryl, 6-26 membered alk-heteroaryl, and 6-26 membered substituted alk-heteroaryl; and
  • R 37 is independently selected from the group consisting of hydrogen, (C 1 -C 8 )alkyl, (C 2 -C 8 )alkenyl, and (C 2 -C 8 )alkynyl.
  • Exemplary compounds of Formula (III) include, but are not limited to, 3- ⁇ [4-(3,3-dibenzyl-ureido)-benzenesulfonyl]-[2-(4-methoxy-phenyl)-ethyl]-amino ⁇ -N-hydroxy-propionamide (Compound B), 3- ⁇ 4-[3-(4-chloro-phenyl)-ureido]-benzenesulfonyl ⁇ -[2-(4-methoxy-phenyl)-ethyl]-amino ⁇ -N-hydroxy-propionamide, and 3- ⁇ 4-[3-(1,2-diphenyl-ethyl)-ureido]-benzenesulfonyl ⁇ -[2-(4-methoxy-phenyl)-ethyl]-amino ⁇ -N-hydroxy-propionamide.
  • the invention provides methods for treating, preventing, or pretreating erythropoietin-associated conditions, for example, anemic and neurological conditions. Methods using the compounds described herein are specifically contemplated. Further, the invention provides methods for treating a patient having anemia associated with particular courses of treatment such as, e.g., chemotherapy, dialysis, etc. In specific embodiments, these methods involve the use of compounds such as those described herein. Additionally, the invention provides methods for producing endogenous erythropoietin using in vitro cell culture technologies. The invention also contemplates methods of increasing the number of circulating reticulocytes in animals for the production of cell-free reticulocyte lysates for in vitro messenger RNA translation.
  • the present invention provides methods of increasing endogenous erythropoietin, thereby increasing erythropoiesis.
  • the methods can be used to prevent, pretreat, or treat erythropoietin-associated conditions such as conditions and disorders associated with anemia, neurological disorders, etc. Such conditions and disorders include those described herein, supra.
  • the present invention also provides methods of increasing endogenous erythropoietin to prevent, pretreat, or treat erythropoietin-associated neurological disorders including, but not limited to, acute disorders such as stroke, trauma, epilepsy, and spinal cord injury, and chronic disorders such as neurodegenerative disease.
  • the methods can be used to treat neurological disorders associated with procedures including, but not limited to, surgery such as thoracoabdominal aortic surgery.
  • the invention provides compounds that can be used in the methods described above.
  • a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient can be administered to a patient having or at risk of developing an erythropoietin-associated disorder such as, e.g., anemia.
  • the anemia can be due to a condition or disorder including, but not limited to, acute or chronic kidney disease, diabetes, cancer, ulcers; infection with virus, bacteria, or parasites; inflammation, etc.; or can be associated with a medical procedure or treatment including, e.g., radiation therapy, chemotherapy, kidney dialysis, surgery, etc.
  • a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient may be administered to an HIV-infected patient being treated with zidovudine or other reverse transcriptase inhibitors.
  • a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient may be administered to an anemic cancer patient receiving cyclic cisplatin- or non-cisplatin-containing chemotherapy.
  • a therapeutically effective amount of the compound or a pharmaceutically acceptable salt thereof, alone or in combination with a pharmaceutically acceptable excipient may be administered to an anemic or non-anemic patient scheduled to undergo surgery to reduce the need for allogenic blood transfusions.
  • Preferred routes of administration include oral and transdermal delivery mechanisms. Such mechanisms provide benefit over current EPO replacement therapies by allowing for, e.g., ease of administration, self-administration by patient, reduced cost, fewer physician visits, and reduced risks due to infection and immunogenic complications, minimizing the adverse reactions some patients develop in response to dosing with recombinant EPO.
  • a compound of the invention inhibits one or more 2-oxoglutarate dioxygenase enzymes.
  • the compound inhibits at least two 2-oxoglutarate dioxygenase family members, e.g., HIF prolyl hydroxylase and HIF asparagine-hydroxylase (FIH-1), etc., with either the same specificity or with differential specificity.
  • the compound is specific for one 2-oxoglutarate dioxygenase, e.g., HIF prolyl hydroxylase, and shows little to no specificity for other family members.
  • the compounds of the invention can be administered in combination with various other therapeutic approaches.
  • the compound is administered with another 2-oxoglutarate dioxygenase inhibitor, wherein the two compounds have differential specificity for individual 2-oxoglutarate dioxygenase family members.
  • the two compounds may be administered at the same time as a ratio of one relative to the other. Determination of a ratio appropriate to a given course of treatment or a particular subject is within the level of skill in the art.
  • the two compounds may be administered consecutively during a treatment time course, e.g., following myocardial infarction.
  • one compound specifically inhibits HIF prolyl hydroxylase enzyme activity, and a second compound specifically inhibits procollagen prolyl 4-hydroxylase enzyme activity.
  • one compound specifically inhibits HIF prolyl hydroxylase enzyme activity, and a second compound specifically inhibits HIF asparaginyl-hydroxylase enzyme activity.
  • the compound can be administered with another agent such as an iron supplement, e.g., ferrous sulfate, vitamin B 12 , and/or folic acid, etc.
  • the compound can also be administered in conjunction with exogenous erythropoietin, e.g., EPOGEN or ARANESP recombinant human erythropoietin (Amgen, Inc., Thousand Oaks Calif.), and/or granulocyte-colony stimulating factor (G-CSF), e.g., NEUPOGEN or NEULASTA recombinant G-CSF (Amgen).
  • exogenous erythropoietin e.g., EPOGEN or ARANESP recombinant human erythropoietin (Amgen, Inc., Thousand Oaks Calif.
  • G-CSF granulocyte-colony stimulating factor
  • compositions of the present invention can be delivered directly or in pharmaceutical compositions along with suitable carriers or excipients, as is well known in the art.
  • Present methods of treatment can comprise administration of an effective amount of a compound of the invention to a subject having or at risk for anemia due to, e.g., chronic renal failure, diabetes, cancer, AIDS, radiation therapy, chemotherapy, kidney dialysis, or surgery.
  • the subject is a mammalian subject, and in a most preferred embodiment, the subject is a human subject.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, nasal, or intestinal administration and parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.
  • the agent or composition thereof may be administered in a local rather than a systemic manner.
  • a suitable agent can be delivered via injection or in a targeted drug delivery system, such as a depot or sustained release formulation.
  • compositions of the present invention may be manufactured by any of the methods well-known in the art, such as by conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the compositions of the present invention can include one or more physiologically acceptable carriers such as excipients and auxiliaries that facilitate processing of active molecules into preparations for pharmaceutical use.
  • the composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer.
  • physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the present compounds are prepared in a formulation intended for oral administration.
  • the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject.
  • the compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • compositions for oral use can be obtained as solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
  • fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol
  • cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium
  • disintegrating agents such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • wetting agents such as sodium dodecyl sulfate may be included.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions for oral administration include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.
  • the compounds of the present invention can be administered transdermally, such as through a skin patch, or topically.
  • the transdermal or topical formulations of the present invention can additionally comprise one or multiple penetration enhancers or other effectors, including agents that enhance migration of the delivered compound. Transdermal or topical administration could be preferred, for example, in situations in which location specific delivery is desired.
  • the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or any other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or any other suitable gas.
  • the appropriate dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, for example, gelatin, for use in an inhaler or insufflator may be formulated. These typically contain a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions formulated for parenteral administration by injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Formulations for parenteral administration include aqueous solutions or other compositions in water-soluble form.
  • Suspensions of the active compounds may also be prepared as appropriate oily injection suspensions.
  • suitable lipophilic solvents or vehicles include fatty oils such as sesame oil and synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • compositions of the present invention may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection.
  • the present compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • suitable carriers for the hydrophobic molecules of the invention are well known in the art and include co-solvent systems comprising, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • the co-solvent system may be the VPD co-solvent system.
  • VPD is a solution of 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant polysorbate 80, and 65% w/v polyethylene glycol 300, made up to volume in absolute ethanol.
  • the VPD co-solvent system (VPD:5W) consists of VPD diluted 1:1 with a 5% dextrose in water solution. This co-solvent system is effective in dissolving hydrophobic compounds and produces low toxicity upon systemic administration. Naturally, the proportions of a co-solvent system may be varied considerably without destroying its solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components may be varied.
  • polysorbate 80 may be used instead of polysorbate 80
  • fraction size of polyethylene glycol may be varied
  • other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone, and other sugars or polysaccharides may substitute for dextrose.
  • hydrophobic molecules may be employed.
  • Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophobic drugs. Liposomal delivery systems are discussed above in the context of gene-delivery systems. Certain organic solvents such as dimethylsulfoxide also may be employed, although usually at the cost of greater toxicity.
  • the compounds may be delivered using sustained-release systems, such as semi-permeable matrices of solid hydrophobic polymers containing the effective amount of the composition to be administered.
  • sustained-release materials are established and available to those of skill in the art. Sustained-release capsules may, depending on their chemical nature, release the compounds for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
  • a therapeutically effective dose can be estimated initially using a variety of techniques well known in the art.
  • a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC 50 as determined in cell culture.
  • Dosage ranges appropriate for human subjects can be determined, for example, using data obtained from cell culture assays and other animal studies.
  • a therapeutically effective dose of an agent refers to that amount of the agent that results in amelioration of symptoms or a prolongation of survival in a subject. Toxicity and therapeutic efficacy of such molecules can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, which can be expressed as the ratio LD 50 /ED 50 . Agents that exhibit high therapeutic indices are preferred.
  • Dosages preferably fall within a range of circulating concentrations that includes the ED 50 with little or no toxicity. Dosages may vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration, and dosage should be chosen, according to methods known in the art, in view of the specifics of a subject's condition.
  • Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety that are sufficient to modulate endogenous erythropoietin plasma levels as desired, i.e. minimal effective concentration (MEC).
  • MEC minimal effective concentration
  • the MEC will vary for each compound but can be estimated from, for example, in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Agents or compositions thereof should be administered using a regimen which maintains plasma levels above the MEC for about 10-90% of the duration of treatment, preferably about 30-90% of the duration of treatment, and most preferably between 50-90%. In cases of local administration or selective uptake, the effective local concentration of the drug may not be related to plasma concentration.
  • stimulation of endogenous erythropoietin may be achieved by 1) administering a loading dose followed by a maintenance dose, 2) administering an induction dose to rapidly achieve erythropoietin levels within a target range, followed by a lower maintenance dose to maintain hematocrit within a desired target range, or 3) repeated intermittent dosing.
  • agent or composition administered will, of course, be dependent on a variety of factors, including the sex, age, and weight of the subject being treated, the severity of the affliction, the manner of administration, and the judgment of the prescribing physician.
  • compositions may, if desired, be presented in a pack or dispenser device containing one or more unit dosage forms containing the active ingredient.
  • a pack or device may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • Compositions comprising a compound of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition. Suitable conditions indicated on the label may include treatment of conditions, disorders, or diseases in which anemia is a major indication.
  • the present invention provides methods of screening for and identifying additional compounds that increase endogenous erythropoietin.
  • methods of identifying compounds that increase endogenous EPO plasma levels are provided.
  • Various assays and screening techniques can be used to identify small molecules that increase the level of endogenous erythropoietin.
  • One assay that is particularly useful involves treating animals with a compound of interest and measuring erythropoietin levels in plasma. (See, e.g., Example 2.) Assays will typically provide for detectable signals associated with the consumption of a reaction substrate or production of a reaction product.
  • Detection can involve, for example, fluorophores, radioactive isotopes, enzyme conjugates, and other detectable labels well known in the art.
  • the results may be qualitative or quantitative. Isolation of the reaction product may be facilitated by a label such as biotin or a histidine tag that allows purification from other reaction components via precipitation or affinity chromatography.
  • assays used to identify small molecules that modulate (e.g., increase or decrease) the level or activity of HIF ⁇ are contemplated.
  • Assays for HIF ⁇ hydroxylation may involve measuring hydroxylated proline or asparagine residues in HIF ⁇ or a fragment thereof, or measuring formation of succinate from 2-oxoglutarate in the presence of enzyme and HIF ⁇ or a fragment thereof.
  • Substrate molecules may include HIF ⁇ or a fragment thereof, e.g., HIF(556-575); for example, an exemplary substrate for use in the assay described in Example 7 is [methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO: 5).
  • Enzyme may include, e.g., HIF ⁇ prolyl hydroxylase (see, e.g., GenBank Accession No. AAG33965, etc.), obtained from any source. Enzyme may also be present in a crude cell lysate or in a partially purified form. Measuring and comparing enzyme activity in the absence and presence of the compound identifies compounds that inhibit hydroxylation of HIF ⁇ .
  • compounds of the invention can be identified by any of a variety of screening techniques known in the art. Such screening methods may allow for target polypeptides or the compounds to be free in solution, affixed to a solid support, borne on a cell surface, located within a cell, etc. For example, test compounds may be arrayed on a surface and analyzed for activity in a manner analogous to array methods currently available in the art.
  • Such screening methods may allow for target polypeptides or the compounds to be free in solution, affixed to a solid support, borne on a cell surface, located within a cell, etc.
  • test compounds may be arrayed on a surface and analyzed for activity in a manner analogous to array methods currently available in the art.
  • Shalon et al. (1995) International Publication No. WO 95/35505 Baldeschweiler et al. (1995) International Publication No. WO 95/251116
  • the invention provides methods for producing endogenous erythropoietin using in vitro cell culture technologies.
  • cells derived from animal tissues, preferably human tissues, capable of expressing erythropoietin when stimulated by compounds of the invention are cultured, using any of the various techniques available to one of skill in the art, for the in vitro production of endogenous proteins.
  • Cells contemplated for use in such methods include, but are not limited to, cells derived from hepatic, hematopoietic, renal, and neural tissues, etc.
  • An exemplary cell line for production of endogenous erythropoietin according to the present invention is Hep3B derived from hepatic tissue.
  • Cell culture techniques are generally available in the art and include any method that maintains cell viability and facilitates expression of endogenous proteins.
  • Cells are typically cultured in a growth medium optimized for cell growth, viability, and protein production.
  • Cells may be in suspension or attached to a substrate, and medium may be supplied in batch feed or continuous flow-through regimens.
  • Compounds of the invention are added to the culture medium at levels that stimulate erythropoietin production without compromising cell viability. Erythropoietin produced by the cells is secreted into the culture medium. The medium is then collected and the erythopoietin is purified using methods known to those of skill in the art. (See, e.g., Lai et al. (1987) U.S. Pat. No. 4,667,016; and Egrie (1985) U.S. Pat. No. 4,558,006.)
  • Hep3B Human cells derived from hepatocarcinoma (Hep3B) tissue (see, e.g., American Type Culture Collection, Manassas Va.) were seeded into 35 mm culture dishes and grown at 37° C., 20% 02, 5% CO 2 in Minimal Essential Medium (MEM), Earle's balanced salt solution (Mediatech Inc., Herndon Va.), 2 mM L-glutamine, 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, and 10% FBS.
  • liver-derived cells showed significant increase in expression of erythropoietin when treated with compounds of the invention.
  • compounds of the invention increase erythropoietin expression in vitro in cells derived from tissues that normally produce erythropoietin in animals.
  • mice Twelve Swiss Webster male mice (30-32 g) were obtained from Simonsen, Inc. (Gilroy Calif.), and treated by oral gavage two times per day for 2.5 days (5 doses) with a 4 ml/kg volume of either 0.5% carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis Mo.) (0 mg/kg/day) or 2.5% Compound C (25 mg/ml in 0.5% CMC) (200 mg/kg/day).
  • CMC carboxymethyl cellulose
  • Compound C 25 mg/ml in 0.5% CMC
  • MICROTAINER serum separator tube (Becton-Dickinson, Franklin Lakes N.J.), and incubated at room temperature for 30 minutes, centrifuged at 8,000 rpm at 4° C. for 10 minutes. The serum fraction was then processed and analyzed for erythropoietin (EPO) expression using a QUANTIKINE immunoassay (R&D Systems) according to the manufacturer's instructions.
  • EPO erythropoietin
  • R&D Systems QUANTIKINE immunoassay
  • the second blood sample was collected into a MICROTAINER EDTA-2K tube (Becton-Dickinson) for hematocrit analysis. Hematocrit was measured by drawing EDTA-blood into a 75 mm ⁇ 1.1-1.2 mm I.D.
  • capillary tube Chose Scientific Glass, Inc., Rockwood tenn.
  • One end of the tube was sealed with CRITOSEAL sealant (Sherwood Medical Company) and the tube was centrifuged in a J-503M MICROHEMATOCRIT centrifuge (Jorgensen Laboratories, Inc., Loveland Colo.) at 12,000 rpm for 5 minutes. Hematocrit was read against a reader card. The mice were then sacrificed and approximately 150 mg of liver and each kidney were isolated and stored in RNALATER solution (Ambion) at ⁇ 20° C.
  • RNA isolation was carried out using the following protocol. Tissue slices were cut into small pieces, 1.75 ml of RLT lysis buffer (RNEASY kit; Qiagen Inc., Valencia Calif.) was added, and the pieces were homogenized for about 20 seconds using a rotor-stator POLYTRON homogenizer (Kinematica, Inc., Cincinnati Ohio). A 350 ⁇ l volume of homogenate was micro-centrifuged for 3 minutes to pellet insoluble material, the supernatant was transferred to a new tube and RNA was isolated using an RNEASY kit (Qiagen) according to the manufacturer's instructions.
  • RNEASY kit Qiagen Inc., Valencia Calif.
  • RNA was eluted into 80 ⁇ l of water and quantitated with RIBOGREEN reagent (Molecular Probes, Eugene Oreg.). Genomic DNA was then removed from the RNA using a DNA-FREE kit (Ambion Inc., Austin Tex.) according to the manufacturer's instructions. The absorbance at 260 and 280 nm was measured to determine RNA purity and concentration.
  • cDNA synthesis was performed using 1 ⁇ M random hexamer primers, 1 ⁇ g of total RNA, and OMNISCRIPT reverse transcriptase (Qiagen), according to the manufacturer's instructions. Resulting cDNA was diluted 5-fold with water to give 100 ⁇ L final volume. Analysis of the relative level of erythropoietin gene expression was performed by quantitative PCR using a FASTSTART DNA MASTER SYBR GREEN I kit (Roche) and gene-specific primers, using a LIGHTCYCLER system (Roche), according to manufacturer's instructions. Samples were heated to 94° C. for 6 minutes and then cycled through 95° C. for 15 seconds, 60° C.
  • Erythropoietin-specific primers were as follows: mEPO-R3 TTCTGGCCCCGAGGATGTCA (SEQ ID NO:1) mEPO-F3 ACGAACTTGCTCCCCGTCACTG (SEQ ID NO:2)
  • the relative level of 18S ribosomal RNA gene expression was measured as a control. Quantitative PCR was performed using a QUANTITECT SYBR GREEN PCR kit (Qiagen) and gene-specific primers, using a LIGHTCYCLER system (Roche), according to manufacturer's instructions. Samples were heated to 95° C. for 15 minutes and then cycled through 94° C. for 15 seconds, 60° C. for 20 seconds, 72° C. for 10 seconds for a total of 42 cycles.
  • Ribosomal RNA-specific primers were as follows: 18S-rat-2B TAGGCACGGCGACTACCATCGA (SEQ ID NO:3) 18S-rat-2A CGGCGGCTTTGGTGACTCTAGAT (SEQ ID NO:4)
  • Each PCR run included a standard curve and water blank.
  • a melt curve was run after completion of each PCR run to assess the specificity of the amplification. Erythropoietin gene expression was normalized relative to the expression level of 18S ribosomal RNA for that sample.
  • erythropoietin gene expression was induced in both the kidney and liver in treated animals relative to untreated controls.
  • the liver showed an approximately 32-fold increase and the kidney showed an approximately 580-fold increase over background in EPO transcript level relative to the untreated liver and kidney, respectively (y-axis units are arbitrary).
  • FIG. 2B the same animals showed a significant increase in erythropoietin plasma level in the treated group relative to untreated controls.
  • the increase in endogenous erythropoietin induced by the compound of the invention significantly increased hematocrit in the treated animals relative to untreated controls.
  • mice Male Swiss Webster mice (29-34 g) were obtained from Simonson, Inc., and were treated by oral gavage once per day for 2.5 days (5 doses) with a 4 ml/kg volume of either 0.5% carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis Mo.) (0 mg/kg/day) or one of compounds E or K at 100 mg/kg/day for 3 days. Blood samples were collected and tissues were processed as for Experiment I (supra). Alternatively, mice were treated with 0.5% CMC or one of compounds F or J at 60 mg/kg/day for 5 days. Forty-eight hours after the final treatment, blood samples were collected, mice were sacrificed, and tissues were harvested as described above.
  • CMC carboxymethyl cellulose
  • FIG. 3A plasma erythropoietin levels were increased over controls after 2 days of treatment with compounds of the invention. Also, as seen in FIG. 3B, hematocrit was measurably higher after 2 and 7 days in animals treated with compound relative to untreated controls.
  • CMC carboxymethyl cellulose
  • groups (2) and (3) received a total of 700 mg compound/kg body weight over the first 7 days, no treatment from days 8 to 14, and then 60 mg/kg/day for another 5 days. Animals were monitored for change in body weight and signs of toxicity. Blood samples (2 ⁇ 0.5 ml) were collected on days 1, 3, 7, 10, 17 and 21 as follows. Animals were anesthetized with isoflurane and 0.5 ml of blood was collected from the tail vein of each animal into each of two MICROTAINER EDTA-2K tubes (Becton-Dickinson). Blood samples were processed for erythropoietin levels, hemoglobin, and hematocrit as described above.
  • the compound significantly increased serum erythropoietin level within 1 day of treatment.
  • the increase in serum EPO led to a subsequent increase in immature blood cells (reticulocytes), demonstrating that the compound stimulates new red blood cell formation.
  • the compound increased blood hemoglobin levels and hematocrit, respectively. Further, the increase in hemoglobin and hematocrit was maintained over an extended period of time with lower doses of the compound.
  • Blood samples (0.2 ml) were collected on days 5, 9, and 16 as follows. Animals were anesthetized with isoflurane and 0.2 ml of blood was collected from the tail vein into a MICROTAINER EDTA-2K tube (Becton-Dickinson). Blood samples were processed for hematocrit as described above to determine the degree of anemia produced in each animal.
  • Blood samples (0.5 ml) were collected as described above immediately prior to treatment and 4 days after treatment initiation. Blood samples were analyzed for CBC and reticulocyte counts as described above. On day 9 after initiation of oral treatment, a blood sample (0.1 ml) was collected and processed for hematocrit as described above.
  • FIG. 5A shows that, prior to treatment with the methods of the invention, exposure to 7 and 10 mg/kg CP reduced hematocrit by 14 and 22%, respectively, relative to controls by day 19.
  • the compound of the invention however, increased hematocrit in the CP-treated animals 4 days after initiating treatment with compound, and hematocrits were significantly higher than non-treated counterparts by day 9 post-treatment.
  • FIG. 5A hematocrit levels in animals initially exposed to 7 mg/kg CP and subsequently treated with the compound of the invention were at or above normal control values by day 9.
  • FIG. 5B shows that the increase in hematocrit was due to the formation of new red blood cells, as the number of circulating reticulocytes was also increased in animals treated with the compound.
  • Hemolytic anemia can be caused by numerous factors including, but not limited to, exposure to toxins, hemodialysis, etc.
  • the ability of a compound of the invention to treat hemolytic anemia is assayed using a procedure described by Rencricca et al. (1970, Blood 36:764-71.) Briefly, mice are treated by oral gavage 2 times per day for 5 days with a 2 ml/kg volume of either 0.5% CMC (Sigma-Aldrich) (group A) or a compound of the invention. Beginning at day 3, mice are treated with 3 consecutive daily subcutaneous doses of either saline or 60 mg/kg phenylhydrazine (PHZ).
  • CMC Sigma-Aldrich
  • mice On day 8, blood is drawn from each of the experimental animals by cardiac puncture and the hematocrit is measured. Mice that receive PHZ alone should exhibit the lowest hematocrit levels (approximately 50% of control) 4 days after the first PHZ administration. Hematocrit levels return to normal in about 8 days. Treatment with the compound of the invention should minimize the drop in hematocrit levels in mice as compared to the vehicle-treated controls.
  • rats are treated using a procedure described by Criswell et al. (2000, J Appl Toxicol 20:25-34.) The procedure is essentially as described above for mice, except rats are given 50 mg/kg PHZ by intraperitoneal injection instead of by subcutaneous administration. Maximum decreases (68%) in red blood counts are expected on day three in PHZ-treated animals.
  • a compound of the invention to treat anemia associated with ischemic acute renal failure is assayed using a procedure described by Nemoto et al. (2001, Kidney Int 59:246-51.) Briefly, rats are treated by oral gavage two times per day with a 2 ml/kg volume of either 0.5% CMC (Sigma-Aldrich) (group A) or 5% a compound of the invention. Rats are subjected to clamping of the right kidney with a vascular clip with simultaneous nephrectomy of the left kidney. After each occlusion, the clip is released at either 30 (moderate) or 45 (severe) minutes, and reperfusion is observed.
  • CMC Sigma-Aldrich
  • mice 35-38 g were obtained from Simonson, Inc., and treated by oral gavage once per day for 2.5 days (5 doses) with a 4 ml/kg volume of either 0.5% carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis Mo.) (0 mg/kg/day), compound C at 30 or 100 mg/kg/day for 4 days, or blood was collected daily from animals as described above to induce anemia. Blood samples were collected and kidney, liver, brain, lung, heart, and skeletal muscle tissues were harvested and processed as for Example 2, Experiment I (supra).
  • CMC carboxymethyl cellulose
  • RNA isolation was carried out using the following protocol. A 50 mg section of each organ was diced, 875 ⁇ l of RLT buffer (RNEASY kit; Qiagen Inc., Valencia Calif.) was added, and the pieces were homogenized for about 20 seconds using a rotor-stator POLYTRON homogenizer (Kinematica, Inc., Cincinnati Ohio). The homogenate was micro-centrifuged for 3 minutes to pellet insoluble material, the supernatant was transferred to a new tube and RNA was isolated using an RNEASY kit (Qiagen) according to the manufacturer's instructions.
  • RLT buffer RNEASY kit
  • Qiagen Inc. Qiagen Inc., Valencia Calif.
  • RNA was eluted into 80 ⁇ L of water and quantitated with RIBOGREEN reagent (Molecular Probes, Eugene Oreg.). Genomic DNA was then removed from the RNA using a DNA-FREE kit (Ambion Inc., Austin Tex.) according to the manufacturer's instructions. The absorbance at 260 and 280 nm was measured to determine RNA purity and concentration.
  • T7-(dT)24 first strand primer Affymetrix, Inc., Santa Clara Calif.
  • SUPERSCRIPT CHOICE system Invitrogen
  • the final cDNA was extracted with an equal volume of 25:24:1 phenol:chloroform:isoamyl alcohol using a PHASE LOCK GEL insert (Brinkman, Inc., Westbury N.Y.). The aqueous phase was collected and cDNA was precipitated using 0.5 volumes of 7.5 M ammonium acetate and 2.5 volumes of ethanol. Alternatively, cDNA was purified using the GENECHIP sample cleanup module (Affymetrix) according to the manufacturer's instructions.
  • GENECHIP sample cleanup module Affymetrix
  • Biotin-labeled cRNA was synthesized from the cDNA in an in vitro translation (IVT) reaction using a BIOARRAY HighYield RNA transcript labeling kit (Enzo Diagnostics, Inc., Farmingdale N.Y.) according to the manufacturer's instructions. Final labeled product was purified and fragmented using the GENECHIP sample cleanup module (Affymetrix) according to the manufacturer's instructions.
  • Hybridization cocktail was prepared by bringing 5 ⁇ g probe to 100 ⁇ l in 1 ⁇ hybridization buffer (100 mM MES, 1 M [Na + ], 20 mM EDTA, 0.01% Tween 20), 100 ⁇ g/ml herring sperm DNA, 500 ⁇ g/ml acetylated BSA, 0.03 nM contol oligo B2 (Affymetrix), and 1 ⁇ GENECHIP eukaryotic hybridization control (Affymetrix). The cocktail was sequentially incubated at 99° C. for 5 minutes and 45° C. for 5 minutes, and then centrifuged for 5 minutes.
  • 1 ⁇ hybridization buffer 100 mM MES, 1 M [Na + ], 20 mM EDTA, 0.01% Tween 20
  • 100 ⁇ g/ml herring sperm DNA 500 ⁇ g/ml acetylated BSA, 0.03 nM contol oligo B2 (Affymetri
  • the Murine genome U74AV2 array (MG-U74Av2; Affymetrix) was brought to room temperature and then prehybridized with 1 ⁇ hybridization buffer at 45° C. for 10 minutes with rotation. The buffer was then replaced with 80 ⁇ l hybridization cocktail and the array was hybridized for 16 hours at 45° C. at 60 rpm with counter balance.
  • arrays were washed once with 6 ⁇ SSPE, 0.1% Tween 20, and then washed and stained using R-phycoerythrin-conjugated streptavidin (Molecular Probes, Eugene OR), goat anti-streptavidin antibody (Vector Laboratories, Burlingame Calif.), and a GENECHIP Fluidics Station 400 instrument (Affymetrix) according to the manufacturer's micro 1v1 protocol (Affymetrix). Arrays were analyzed using a GENEARRAY scanner (Affymetrix) and Microarray Suite software (Affymetrix).
  • the Murine Genome U74AV2 array (Affymetrix) represents all sequences ( ⁇ 6,000) in Mouse UniGene database build 74 (National Center for Biotechnology Information, Bethesda Md.) that have been functionally characterized and approximately 6,000 unannotated expressed sequence tag (EST) clusters.
  • FIGS. 6A, 6B, and 6 C a dose-dependent increase in erythropoietin transcript was seen in brain, kidney, and liver tissues, respectively.
  • the level of expression was equivalent to or exceeded the level of transcription seen with bleed-induced anemia in the same tisssue.
  • the compounds used in the methods of the invention can penetrate and induce endogenous erythropoietin production in organs that normally produce erythropoietin in animals.
  • the compound significantly increased serum erythropoietin levels in sham-operated animals. Further, serum erythropoietin levels noticably increased in bilaterally nephrectomized animals treated with the compound relative to untreated BN and sham controls (FIG. 7).
  • Compounds that increase endogenous erythropoietin levels can be identified using the procedure described in Example 1. Additional compounds that inhibit HIF-specific prolyl hydroxylase activity and stabilize HIF ⁇ , increasing endogenous erythropoietin, can be identified and characterized using the following assay.
  • the beads are washed three times with 0.5-1 ml 20 mM Tris HCl (pH 7.2).
  • the peptide is then eluted from the beads with 5 ⁇ l 2 mM biotin in 20 mM Tris HCl (pH 7.2) for 1 hour.
  • the tubes are centrifuged to pellet the resin and 40-50 ⁇ l of supernatant is removed and an equal volume of acetonitrile is added.
  • the peptide is attached to methoxycoumarin, a pH insensitive fluorophore.
  • the fluorophore may provide sensitivity and specificity to enhance detection in assays run with crude cell lysate.
  • An exemplary HIF peptide for use in the screening assay may comprise [methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO: 5).
  • the non-hydroxylated hydroxylated and hydroxylated peptides are then separated by reverse-phase HPLC on a C18 column with UV detection at 214 nm.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • Cardiology (AREA)
  • Toxicology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Diabetes (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Endocrinology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
US10/313,643 2001-12-06 2002-12-06 Methods of increasing endogenous erythropoietin (EPO) Abandoned US20030153503A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US10/313,643 US20030153503A1 (en) 2001-12-06 2002-12-06 Methods of increasing endogenous erythropoietin (EPO)
US11/405,734 US20060183695A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/406,484 US20060178317A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/406,023 US20060178316A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US12/932,151 US20110166178A1 (en) 2001-12-06 2011-02-17 Methods for treating anemia using inhibitors of hypoxia-inducible factor (HIF) hydroxylase
US13/614,917 US20130203805A1 (en) 2001-12-06 2012-09-13 Methods for treating anemia using inhibitors of hypoxia-inducible factor (HIF) hydroxylase
US14/332,814 US20150080425A1 (en) 2001-12-06 2014-07-16 Methods for treating anemia in subjects having kidney failure using inhibitors of hypoxia-inducible factor (hif) hydroxylase
US15/424,479 US20170312268A1 (en) 2001-12-06 2017-02-03 Methods for treating a neurological disorder in a subject using inhibitors of hypoxia-inducible factor (hif) proyl hydroxylase
US17/394,602 US20210369702A1 (en) 2001-12-06 2021-08-05 Methods for treating anemia in subjects having kidney failure using inhibitors of hypoxia-inducible factor (hif) hydroxylase

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US33708201P 2001-12-06 2001-12-06
US34965902P 2002-01-16 2002-01-16
US35968302P 2002-02-25 2002-02-25
US38648802P 2002-06-05 2002-06-05
US10/313,643 US20030153503A1 (en) 2001-12-06 2002-12-06 Methods of increasing endogenous erythropoietin (EPO)

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US11/406,484 Continuation US20060178317A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/406,023 Continuation US20060178316A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/405,734 Continuation US20060183695A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)

Publications (1)

Publication Number Publication Date
US20030153503A1 true US20030153503A1 (en) 2003-08-14

Family

ID=27502557

Family Applications (15)

Application Number Title Priority Date Filing Date
US10/313,643 Abandoned US20030153503A1 (en) 2001-12-06 2002-12-06 Methods of increasing endogenous erythropoietin (EPO)
US10/313,551 Abandoned US20030176317A1 (en) 2001-12-06 2002-12-06 Stabilization of hypoxia inducible factor (HIF) alpha
US11/406,484 Abandoned US20060178317A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/405,734 Abandoned US20060183695A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/406,023 Abandoned US20060178316A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/495,036 Abandoned US20060258660A1 (en) 2001-12-06 2006-07-28 Stabilization of hypoxia inducible factor (HIF) alpha
US11/495,118 Abandoned US20060258702A1 (en) 2001-12-06 2006-07-28 Stabilization of hypoxia inducible factor (HIF) alpha
US11/494,978 Abandoned US20060270699A1 (en) 2001-12-06 2006-07-28 Stabilization of hypoxia inducible factor (HIF) alpha
US12/928,119 Expired - Lifetime US8466172B2 (en) 2001-12-06 2010-12-02 Stabilization of hypoxia inducible factor (HIF) alpha
US12/932,151 Abandoned US20110166178A1 (en) 2001-12-06 2011-02-17 Methods for treating anemia using inhibitors of hypoxia-inducible factor (HIF) hydroxylase
US13/614,917 Abandoned US20130203805A1 (en) 2001-12-06 2012-09-13 Methods for treating anemia using inhibitors of hypoxia-inducible factor (HIF) hydroxylase
US13/897,207 Abandoned US20130245037A1 (en) 2001-12-06 2013-05-17 Stabilization of Hypoxia Inducible Factor (HIF) Alpha
US14/332,814 Abandoned US20150080425A1 (en) 2001-12-06 2014-07-16 Methods for treating anemia in subjects having kidney failure using inhibitors of hypoxia-inducible factor (hif) hydroxylase
US15/424,479 Abandoned US20170312268A1 (en) 2001-12-06 2017-02-03 Methods for treating a neurological disorder in a subject using inhibitors of hypoxia-inducible factor (hif) proyl hydroxylase
US17/394,602 Abandoned US20210369702A1 (en) 2001-12-06 2021-08-05 Methods for treating anemia in subjects having kidney failure using inhibitors of hypoxia-inducible factor (hif) hydroxylase

Family Applications After (14)

Application Number Title Priority Date Filing Date
US10/313,551 Abandoned US20030176317A1 (en) 2001-12-06 2002-12-06 Stabilization of hypoxia inducible factor (HIF) alpha
US11/406,484 Abandoned US20060178317A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/405,734 Abandoned US20060183695A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/406,023 Abandoned US20060178316A1 (en) 2001-12-06 2006-04-17 Methods of increasing endogenous erythropoietin (EPO)
US11/495,036 Abandoned US20060258660A1 (en) 2001-12-06 2006-07-28 Stabilization of hypoxia inducible factor (HIF) alpha
US11/495,118 Abandoned US20060258702A1 (en) 2001-12-06 2006-07-28 Stabilization of hypoxia inducible factor (HIF) alpha
US11/494,978 Abandoned US20060270699A1 (en) 2001-12-06 2006-07-28 Stabilization of hypoxia inducible factor (HIF) alpha
US12/928,119 Expired - Lifetime US8466172B2 (en) 2001-12-06 2010-12-02 Stabilization of hypoxia inducible factor (HIF) alpha
US12/932,151 Abandoned US20110166178A1 (en) 2001-12-06 2011-02-17 Methods for treating anemia using inhibitors of hypoxia-inducible factor (HIF) hydroxylase
US13/614,917 Abandoned US20130203805A1 (en) 2001-12-06 2012-09-13 Methods for treating anemia using inhibitors of hypoxia-inducible factor (HIF) hydroxylase
US13/897,207 Abandoned US20130245037A1 (en) 2001-12-06 2013-05-17 Stabilization of Hypoxia Inducible Factor (HIF) Alpha
US14/332,814 Abandoned US20150080425A1 (en) 2001-12-06 2014-07-16 Methods for treating anemia in subjects having kidney failure using inhibitors of hypoxia-inducible factor (hif) hydroxylase
US15/424,479 Abandoned US20170312268A1 (en) 2001-12-06 2017-02-03 Methods for treating a neurological disorder in a subject using inhibitors of hypoxia-inducible factor (hif) proyl hydroxylase
US17/394,602 Abandoned US20210369702A1 (en) 2001-12-06 2021-08-05 Methods for treating anemia in subjects having kidney failure using inhibitors of hypoxia-inducible factor (hif) hydroxylase

Country Status (13)

Country Link
US (15) US20030153503A1 (zh)
EP (7) EP3520784A1 (zh)
JP (5) JP2005524612A (zh)
CN (7) CN102526044A (zh)
AU (3) AU2002362065B2 (zh)
CA (4) CA2467689C (zh)
DK (3) DK2298301T3 (zh)
ES (3) ES2686625T3 (zh)
HK (1) HK1069845A1 (zh)
HU (1) HU229475B1 (zh)
IL (2) IL162085A0 (zh)
NO (1) NO343732B1 (zh)
WO (2) WO2003053997A2 (zh)

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050020487A1 (en) * 2003-06-06 2005-01-27 Klaus Stephen J. Enhanced erythropoiesis and iron metabolism
US20050282751A1 (en) * 2004-03-19 2005-12-22 Ajinomoto Co., Inc. Therapeutic agent for renal anemia
WO2006084210A2 (en) * 2005-02-04 2006-08-10 Regents Of The University Of California, San Diego Hif modulating compounds and methods of use thereof
US20060276477A1 (en) * 2005-06-06 2006-12-07 Fibrogen, Inc. Treatment method for anemia
US20070004627A1 (en) * 2005-06-15 2007-01-04 Fibrogen, Inc. Compounds and methods for treatment of cancer
WO2007038571A2 (en) * 2005-09-26 2007-04-05 Smithkline Beecham Corporation Prolyl hydroxylase antagonists
US20070155784A1 (en) * 2003-06-06 2007-07-05 Fibrogen, Inc. Novel nitrogen-containing heteroaryl compounds and methods of use thereof
US20070185045A1 (en) * 2006-02-06 2007-08-09 Ratcliffe Peter J Inhibitors of 2-oxoglutarate dioxygenase as gamma globin inducers
US20070275882A1 (en) * 2003-12-22 2007-11-29 Hans Meijer Nature-Identical Erythropoietin
US20070292433A1 (en) * 2006-06-15 2007-12-20 Fibrogen, Inc. Compounds and methods for treatment of chemotherapy-induced anemia
US20070293575A1 (en) * 2006-06-15 2007-12-20 Fibrogen, Inc. Compounds and methods for treatment of cancer-related anemia
US20070299086A1 (en) * 2006-06-26 2007-12-27 The Procter & Gamble Company Prolyl hydroxylase inhibitors and methods of use
US20070298104A1 (en) * 2006-01-27 2007-12-27 Fibrogen, Inc. Cyanoisoquinoline compounds and methods of use thereof
US20080004309A1 (en) * 2006-04-04 2008-01-03 Fibrogen, Inc. Pyrrolo- and thiazolo-pyridine compounds, and methods of use thereof
US20080188407A1 (en) * 2007-02-07 2008-08-07 Hung Li Treating cerebrovascular diseases with erythropoietin and granulocyte-colony stimulating factor jointly
US20080227848A1 (en) * 2004-03-26 2008-09-18 Isis Innovation Limited Assays
US20090088475A1 (en) * 2007-04-18 2009-04-02 Amgen Inc. Indanone derivatives that inhibit prolyl hydroxylase
US20090093483A1 (en) * 2006-12-18 2009-04-09 Amgen Inc. Naphthalenone compounds exhibiting prolyl hydroxylase inhibitory activity, compositions, and uses thereof
US20090099171A1 (en) * 2007-05-04 2009-04-16 Amgen Inc. Diazaquinolones that inhibit prolyl hydroxylase activity
US20090111806A1 (en) * 2006-12-18 2009-04-30 Amgen Inc. Azaquinolone based compounds exhibiting prolyl hydroxylase Inhibitory activity, compositions, and uses thereof
US20090156633A1 (en) * 2007-05-04 2009-06-18 Amgen Inc. Heterocyclic quinolone derivatives that inhbit prolyl hydroxylase activity
US20090156605A1 (en) * 2007-04-18 2009-06-18 Amgen Inc. Quinolones and azaquinolones that inhbit prolyl hydroxylase
WO2009089039A1 (en) * 2008-01-09 2009-07-16 Cho Daniel J Use of blood flow parameters to monitor or control the dosing of erythropoiesis-stimulating agents
US20090208475A1 (en) * 2005-09-26 2009-08-20 Isis Innovation Limited Mina53 assays
US20090240475A1 (en) * 2006-03-07 2009-09-24 Artem Gennady Evdokimov Three dimensional coordinates of hypoxia inducible factor 1 alpha (hif-1 alpha) prolyl hydroxylase (egln1) and uses thereof
US20100047367A1 (en) * 2008-08-20 2010-02-25 Fibrogen, Inc. Compounds and methods for their use
US20100113444A1 (en) * 2006-06-23 2010-05-06 Smithkline Beecham Corporation Prolyl hydroxylase inhibitors
US20100303928A1 (en) * 2007-12-03 2010-12-02 Fibrogen, Inc. Isoxazolopyridine derivatives for use in the treatment of hif-mediated conditions
US20100330199A1 (en) * 2008-01-11 2010-12-30 Fibrogen, Inc. Isothiazole-pyridine derivates as modulators of hif (hypoxia inducible factor) activity
WO2011041582A2 (en) 2009-09-30 2011-04-07 President And Fellows Of Harvard College Methods for modulation of autophagy through the modulation of autophagy-inhibiting gene products
US20110112055A1 (en) * 2009-11-06 2011-05-12 Gardner Joseph H Compositions and methods for treating colitis
WO2012110789A1 (en) 2011-02-15 2012-08-23 Isis Innovation Limited Method for assaying ogfod1 activity
US8324405B2 (en) 2008-02-05 2012-12-04 Fibrogen, Inc. Chromene derivatives and use thereof as HIF hydroxylase activity inhibitors
WO2013014449A1 (en) 2011-07-28 2013-01-31 Isis Innovation Limited Assay for histidinyl hydroxylase activity
USRE44613E1 (en) 2007-01-12 2013-11-26 Glaxosmithkline Llc N-substituted glycine derivatives: hydroxylase inhibitors
US8883823B2 (en) 2012-07-16 2014-11-11 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
WO2014197660A1 (en) 2013-06-06 2014-12-11 Fibrogen, Inc. Pharmaceutical formulations of a hif hydroxylase inhibitor
US8927591B2 (en) 2008-11-14 2015-01-06 Fibrogen, Inc. Thiochromene derivatives as HIF hydroxylase inhibitors
US9115085B2 (en) 2012-07-16 2015-08-25 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US9340511B2 (en) 2012-07-16 2016-05-17 Fibrogen, Inc. Process for making isoquinoline compounds
US20160143891A1 (en) * 2013-06-13 2016-05-26 Akebia Therapeutics, Inc. Compositions and methods for treating anemia
US9409892B2 (en) 2012-03-09 2016-08-09 Fibrogen, Inc. 4-hydroxy-isoquinoline compounds as HIF hydroxylase inhibitors
US9643928B2 (en) 2013-01-24 2017-05-09 Fibrogen, Inc. Crystalline forms of {[1-cyano-5-(4-chlorophenoxy)-4-hydroxy-isoquinoline-3-carbonyl]-amino}-acetic acid
US9987262B2 (en) 2013-11-15 2018-06-05 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino}acetic acid, compositions, and uses thereof
US10150734B2 (en) 2015-01-23 2018-12-11 Akebia Therapeutics, Inc. Solid forms of 2-(5-(3-fluorophenyl)-3-hydroxypicolinamido)acetic acid, compositions, and uses thereof
US10246416B2 (en) 2011-06-06 2019-04-02 Akebia Therapeutics, Inc. Process for preparing [(3-hydroxypyridine-2-carbonyl)amino] alkanoic acids, esters and amides
US20200170244A1 (en) * 2013-02-01 2020-06-04 Conradus Ghosal Gho Methods for preserving, transporting and storing living biological materials
US11324734B2 (en) 2015-04-01 2022-05-10 Akebia Therapeutics, Inc. Compositions and methods for treating anemia
US11524939B2 (en) 2019-11-13 2022-12-13 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino} acetic acid
US11713298B2 (en) 2018-05-09 2023-08-01 Akebia Therapeutics, Inc. Process for preparing 2-[[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino]acetic acid

Families Citing this family (84)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6855510B2 (en) * 2001-03-20 2005-02-15 Dana Farber Cancer Institute, Inc. Pharmaceuticals and methods for treating hypoxia and screening methods therefor
JP4590157B2 (ja) * 2001-03-21 2010-12-01 アイシス イノヴェイション リミテッド アッセイ、方法および手段
US8318703B2 (en) 2001-12-06 2012-11-27 Fibrogen, Inc. Methods for improving kidney function
DK2298301T3 (en) 2001-12-06 2018-10-01 Fibrogen Inc MEDICINALS FOR TREATMENT OF ANEMIA ASSOCIATED WITH Kidney Disease
EP2295060B1 (en) 2001-12-06 2018-10-31 Fibrogen, Inc. Treatment or prevention of ischemic or hypoxic conditions
US8124582B2 (en) 2002-12-06 2012-02-28 Fibrogen, Inc. Treatment of diabetes
US7618940B2 (en) 2002-12-06 2009-11-17 Fibrogen, Inc. Fat regulation
WO2005007192A2 (en) * 2003-06-06 2005-01-27 Fibrogen, Inc. Cytoprotection through the use of hif hydroxylase inhibitors
US20070042937A1 (en) * 2003-08-01 2007-02-22 Fibrogen, Inc. Inhibitors of 2-oxoglutarate dioxygenase as gamma globin inducers
WO2005034929A2 (en) * 2003-10-10 2005-04-21 Fibrogen, Inc. Tissue remodeling and vascularization
US20050136125A1 (en) * 2003-10-22 2005-06-23 Roth Mark B. Methods, compositions and devices for inducing stasis in cells, tissues, organs, and organisms
US20050170019A1 (en) * 2003-10-22 2005-08-04 Fred Hutchinson Cancer Research Center Methods, compositions and devices for inducing stasis in cells
EP1684579A1 (en) * 2003-10-22 2006-08-02 Fred Hutchinson Cancer Research Center Methods, compositions and devices for inducing stasis in cells, tissues, organs, and organisms
US7248843B2 (en) * 2003-11-07 2007-07-24 Ge Medical Systems Information Technologies, Inc. Antenna selection system and method
NZ551632A (en) * 2004-05-28 2009-09-25 Fibrogen Inc HIF prolyl hydroxylase activity assay
US7718624B2 (en) * 2004-09-01 2010-05-18 Sitkovsky Michail V Modulation of immune response and inflammation by targeting hypoxia inducible factors
US20060074182A1 (en) * 2004-09-30 2006-04-06 Depuy Products, Inc. Hydrogel composition and methods for making the same
JP4792048B2 (ja) * 2005-03-02 2011-10-12 ファイブロゲン インコーポレイティッド チエノピリジン化合物およびその使用方法
AR055319A1 (es) * 2005-03-17 2007-08-15 Wyeth Corp Derivados de isoquinoleina, composiciones farmaceuticas y usos
PL1879599T3 (pl) * 2005-04-20 2014-03-31 Hutchinson Fred Cancer Res Sposoby, kompozycje i wyroby do zwiększania przeżywalności komórek, tkanek, narządów i organizmów
DE102005019712A1 (de) * 2005-04-28 2006-11-09 Bayer Healthcare Ag Dipyridyl-dihydropyrazolone und ihre Verwendung
WO2007047194A2 (en) * 2005-10-11 2007-04-26 Dana-Farber Cancer Institute, Inc. Methods for treating mitf-related disorders
CN100418574C (zh) * 2005-10-26 2008-09-17 王成球 一类封闭人类HIF-1α基因和调控网络中下游相关基因的染色质肽
AU2006318449B2 (en) 2005-11-23 2012-07-05 Acceleron Pharma Inc. Activin-actRIIa antagonists and uses for promoting bone growth
US8128933B2 (en) 2005-11-23 2012-03-06 Acceleron Pharma, Inc. Method of promoting bone growth by an anti-activin B antibody
US20070122448A1 (en) * 2005-11-28 2007-05-31 Alireza Rezania Compositions and methods to create a vascularized environment for cellular transplantation
JP5202327B2 (ja) * 2005-12-09 2013-06-05 アムジエン・インコーポレーテツド プロリルヒドロキシラーゼ阻害活性を示すキノロンベースの化合物、およびこの組成物、およびこの使用
CN101420980A (zh) 2006-02-16 2009-04-29 菲布罗根公司 治疗中风的化合物和方法
US8454948B2 (en) 2006-09-14 2013-06-04 Medgenics Medical Israel Ltd. Long lasting drug formulations
AU2007294858B2 (en) 2006-09-14 2011-05-12 Medgenics Medical Israel, Ltd Long lasting drug formulations
US20090011051A1 (en) * 2006-09-28 2009-01-08 Roth Mark B Methods, Compositions and Articles of Manufacture for HIF Modulating Compounds
US8895016B2 (en) 2006-12-18 2014-11-25 Acceleron Pharma, Inc. Antagonists of activin-actriia and uses for increasing red blood cell levels
US20100056429A1 (en) * 2007-01-10 2010-03-04 Miller Guy M Treatment of respiratory chain disorders using compounds having erythropoietin or thrombopoietin activity
CL2008000065A1 (es) * 2007-01-12 2008-09-22 Smithkline Beecham Corp Compuestos derivados de glicina n-sustituida, inhibidores de hif prolil hidroxilasas; su proceso de preparacion; composicion farmaceutica que comprende a dichos compuestos; y su uso en el tratamiento de la anemia.
WO2009045469A2 (en) 2007-10-02 2009-04-09 Amgen Inc. Increasing erythropoietin using nucleic acids hybridizable to micro-rna and precursors thereof
US7601399B2 (en) 2007-01-31 2009-10-13 Surface Modification Systems, Inc. High density low pressure plasma sprayed focal tracks for X-ray anodes
TWI782836B (zh) 2007-02-02 2022-11-01 美商艾瑟勒朗法瑪公司 衍生自ActRIIB的變體與其用途
FI20075320A0 (fi) * 2007-05-07 2007-05-07 Panu Jaakkola Uusia käyttökelpoisia inhibiittoreita
US8962530B2 (en) 2007-06-27 2015-02-24 Regents Of The University Of Colorado Inflammatory bowel disease therapies
WO2009041072A1 (ja) 2007-09-27 2009-04-02 Kowa Company, Ltd. テトラヒドロキノリン化合物を有効成分とする貧血の予防及び／又は治療剤
CN101917996A (zh) * 2007-11-02 2010-12-15 法布罗根股份有限公司 降低血压的方法
JP2011505367A (ja) * 2007-11-30 2011-02-24 グラクソスミスクライン・リミテッド・ライアビリティ・カンパニー プロリルヒドロキシラーゼ阻害剤
CN101983384A (zh) * 2007-11-30 2011-03-02 葛兰素史密斯克莱有限责任公司 脯氨酰羟化酶抑制剂
WO2009108496A1 (en) * 2008-02-25 2009-09-03 Merck & Co., Inc. Tetrahydrofuropyridones
CA2724841A1 (en) * 2008-05-22 2009-11-26 Edison Pharmaceuticals, Inc. Treatment of mitochondrial diseases with an erythropoietin mimetic
US8216997B2 (en) 2008-08-14 2012-07-10 Acceleron Pharma, Inc. Methods for increasing red blood cell levels and treating anemia using a combination of GDF traps and erythropoietin receptor activators
SI3750552T1 (sl) 2008-08-14 2023-10-30 Acceleron Pharma Inc. GDF pasti
WO2010024911A1 (en) * 2008-08-26 2010-03-04 Fibrogen, Inc. Methods for increasing neurogenesis
US20110263642A1 (en) * 2008-08-26 2011-10-27 Fibrogen, Inc. Methods for treatment of multiple sclerosis
US10098857B2 (en) 2008-10-10 2018-10-16 The Board Of Trustees Of The Leland Stanford Junior University Topical and transdermal delivery of HIF-1 modulators to prevent and treat chronic wounds
JP6091752B2 (ja) 2008-12-04 2017-03-08 クルナ・インコーポレーテッド Ｅｐｏに対する天然アンチセンス転写物の抑制によるエリスロポエチン（ｅｐｏ）関連疾患の治療
WO2010113498A1 (ja) 2009-03-31 2010-10-07 興和株式会社 テトラヒドロキノリン化合物を有効成分とする貧血の予防及び／又は治療剤
EP3845239A1 (en) 2009-06-08 2021-07-07 Acceleron Pharma Inc. Use of anti-actriib proteins for increasing thermogenic adipocytes
CN107267520A (zh) 2009-06-12 2017-10-20 阿塞勒隆制药公司 截短的actriib‑fc融合蛋白
CN102655872B (zh) * 2009-08-13 2016-01-20 阿塞勒隆制药公司 Gdf捕获物和促红细胞生成素受体激活剂联合应用以增加红细胞水平
WO2011048611A1 (en) 2009-10-07 2011-04-28 Torrent Pharmaceuticals Limited Novel fused pyridazine derivatives
US9205129B2 (en) * 2009-10-09 2015-12-08 University Of Rochester Methods of treatment and screening assays for HIF-1α regulation
TWI500623B (zh) 2009-10-13 2015-09-21 Torrent Pharmaceuticals Ltd 新穎稠合噻唑及噁唑嘧啶酮
JP5718236B2 (ja) 2009-10-21 2015-05-13 第一三共株式会社 ５−ヒドロキシピリミジン−４−カルボキサミド誘導体
WO2011056725A1 (en) * 2009-11-05 2011-05-12 Crystalgenomics, Inc. Pyridine derivatives and methods of use thereof
US8710016B2 (en) 2009-11-17 2014-04-29 Acceleron Pharma, Inc. ActRIIB proteins and variants and uses therefore relating to utrophin induction for muscular dystrophy therapy
US8541430B2 (en) 2009-11-27 2013-09-24 Torrent Pharmaceuticals Limited Fused thiazolo and oxazolo pyrimidinones
WO2011123572A1 (en) 2010-03-31 2011-10-06 The Scripps Research Institute Reprogramming cells
AU2011268458B2 (en) 2010-06-15 2014-06-12 Medgenics Medical Israel Ltd. Long lasting drug formulations
WO2012106472A1 (en) 2011-02-02 2012-08-09 Fibrogen, Inc. Naphthyridine derivatives as inhibitors of hypoxia inducible factor (hif) hydroxylase
EP2717870B1 (en) 2011-06-06 2017-09-27 Akebia Therapeutics Inc. Composition for stabilizing hypoxia inducible factor-2 alpha useful for treating cancer
US9446031B2 (en) 2012-01-18 2016-09-20 National University Of Singapore Compositions and methods for neovascularization
WO2013134632A2 (en) * 2012-03-09 2013-09-12 Fibrogen, Inc. Treatment for high cholesterol
CA2890217C (en) 2012-11-02 2021-07-20 Yifu FANG Activin-actrii antagonists and uses for treating bone and other disorders
WO2015089416A1 (en) * 2013-12-12 2015-06-18 Cornell University Prolylhydroxylase/atf4 inhibitors for treating neural cell injury
EP2915878A1 (en) 2014-03-07 2015-09-09 Institut Pasteur Method and device for conserving viable and functional human polymorphonuclear neutrophils
WO2015192111A1 (en) 2014-06-13 2015-12-17 Acceleron Pharma, Inc. Methods and compositions for treating ulcers
ES2693602T3 (es) 2014-07-11 2018-12-12 Grifols Worldwide Operations Limited Transferrina para su utilización en el tratamiento de trastornos neurodegenerativos asociados al factor inducible por hipoxia (HIF)
WO2016054806A1 (en) * 2014-10-10 2016-04-14 Merck Sharp & Dohme Corp. Substittued pyridine inhibitors of hif prolyl hydroxylase
CN106146395B (zh) * 2015-03-27 2019-01-01 沈阳三生制药有限责任公司 3-羟基吡啶化合物、其制备方法及其制药用途
CN105296631A (zh) * 2015-11-04 2016-02-03 吴艾霖 流式液相芯片急性高原病脯氨酰羟化酶基因rs480902位点检测试剂盒
US11510917B2 (en) 2016-02-19 2022-11-29 Cornell University HIF-stabilization and prevention of hyperoxia-induced neonatal lung disease
CN108245687A (zh) * 2016-12-29 2018-07-06 贾中芝 一种IpostC在抗肠再灌注损伤中所起作用的实验方法
WO2019055490A1 (en) 2017-09-14 2019-03-21 The Board Of Trustees Of The Leland Stanford Junior University PACKAGING OF IRRADIED FABRIC FOR FAT GREETING RETENTION
US11225660B2 (en) * 2017-10-12 2022-01-18 Emory University Methods and compositions for managing vascular conditions using miR-483 mimics and HIF1alpha pathway inhibitors
US10500318B1 (en) * 2018-07-03 2019-12-10 Temple Therapeutics BV Dosing regimens for treating hypoxia-associated tissue damage
WO2020156571A1 (zh) * 2019-02-02 2020-08-06 杭州华东医药集团新药研究院有限公司 一种哒嗪衍生物及其制备方法和医药用途
CN113826614B (zh) * 2021-09-30 2023-03-14 佛山市第一人民医院（中山大学附属佛山医院） 一种器官保存液
WO2023137422A1 (en) * 2022-01-13 2023-07-20 Fibrogen, Inc. Treatment for congestive heart failure

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4558006A (en) * 1983-02-04 1985-12-10 Kirin-Amgen, Inc. A.T.C.C. HB8209 and its monoclonal antibody to erythropoietin
US4667016A (en) * 1985-06-20 1987-05-19 Kirin-Amgen, Inc. Erythropoietin purification
US5607954A (en) * 1992-03-24 1997-03-04 Hoechst Aktiengesellschaft Sulfonamido- and sulfonamidocarbonylpyridine-2-carboxamides and their pyridine-n-oxides, process for their preparation and their use as pharmaceuticals
US5610172A (en) * 1994-03-25 1997-03-11 Hoechst Aktiengesellschaft Sulfonamidocarbonylpyridine-2-carboxamides and pyridine-n-oxides which are useful as pharmaceuticals
US5620995A (en) * 1993-12-30 1997-04-15 Hoechst Aktiengesellschaft Substituted heterocyclic carboxyamides, their preparation and their use as pharmaceuticals
US5620996A (en) * 1994-03-25 1997-04-15 Hoechst Aktiengesellschaft Sulfonamidocarbonyl pyridine-2-carboxesteramides and their pyridine-N-oxide compounds and their use as pharmaceuticals
US5658933A (en) * 1993-11-02 1997-08-19 Hoechst Aktiengesellschaft Substituted heterocyclic carboxamide esters, their preparation and their use as pharmaceuticals
US5719164A (en) * 1995-09-28 1998-02-17 Hoechst Aktiengesellschaft Substituted quinoline-2-carboxamides, their preparation and their use as pharmaceuticals, and intermediates
US5916898A (en) * 1997-10-24 1999-06-29 Zeneca Limited Phenanthroline derivatives
US6020350A (en) * 1996-12-04 2000-02-01 Hoechst Aktiengesellschaft 3-hydroxypyridine-2-carboxamidoesters, their preparation and their use as pharmaceuticals
US6093730A (en) * 1997-10-20 2000-07-25 Hoechst Marion Roussel Deutschland Gmbh Substituted isoquinoline-3-carboxamides, their preparation and their use as pharmaceuticals
US6200974B1 (en) * 1997-10-24 2001-03-13 Zeneca Limited Phenanthroline derivatives
US6566088B1 (en) * 2001-10-04 2003-05-20 Board Of Regents, The University Of Texas System Prolyl-4-hydroxylases

Family Cites Families (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1261335A (en) * 1984-08-29 1989-09-26 Hoffmann-La Roche Limited/Hoffmann-La Roche Limitee Ethylenediamine monoamide derivatives
GB8530602D0 (en) * 1985-12-12 1986-01-22 Fujisawa Pharmaceutical Co Heterocyclic compounds
FI884418A (fi) * 1987-10-05 1989-04-06 Fujisawa Pharmaceutical Co Hjaertskyddande aemne och ett terapeutiskt aemne foer ischemiska sjukdomar omfattande n-innehaollande heterocykliska foereningar, och ett foerfarande foer framstaellning av dessa foereningar.
DE4015255A1 (de) * 1990-05-12 1991-11-14 Hoechst Ag Oxalyl-aminosaeurederivate, verfahren zu ihrer herstellung und ihrer verwendung als arzneimittel zur inhibierung der prolyl-hydroxylase
US5474796A (en) 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
US5605662A (en) 1993-11-01 1997-02-25 Nanogen, Inc. Active programmable electronic devices for molecular biological analysis and diagnostics
US5550124A (en) * 1991-12-10 1996-08-27 University Of Southern California Use of peripheral-type benzodiazpine sites for treatment of CNS trauma or disease
DK0650961T3 (da) † 1993-11-02 1997-09-15 Hoechst Ag Substituerede heterocykliske carboxylsyreamider, deres fremstilling og deres anvendelse som lægemidler.
US6015880A (en) 1994-03-16 2000-01-18 California Institute Of Technology Method and substrate for performing multiple sequential reactions on a matrix
US5508463A (en) 1994-03-17 1996-04-16 Trustees Of The University Of Pennsylvania α-aminophosphonates
US5807522A (en) 1994-06-17 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods for fabricating microarrays of biological samples
EP0716077A1 (de) * 1994-12-08 1996-06-12 Ciba-Geigy Ag Aromatisch substituierte Omega-Aminoalkansäureamide und Alkansäurediamide und ihre Verwendung als Renininhibitoren
WO1997009976A2 (en) * 1995-09-01 1997-03-20 Washington University Method of reducing neurotoxic injury with zinc chelators
US5846528A (en) * 1996-01-18 1998-12-08 Avigen, Inc. Treating anemia using recombinant adeno-associated virus virions comprising an EPO DNA sequence
JP2000509047A (ja) * 1996-04-30 2000-07-18 ヘキスト・アクチエンゲゼルシヤフト ３―アルコキシピリジン―２―カルボキサミドエステル類、その製法および薬剤としてのその使用
WO1998029109A1 (en) * 1996-12-30 1998-07-09 Johns Hopkins University Methods and compositions for identification of autoantigens
EP0878480A1 (en) * 1997-05-14 1998-11-18 H.W. Prof. Dr. Müller A method for the improvement of neuronal regeneration
JP2003522093A (ja) * 1997-10-24 2003-07-22 ファイブロゲン インコーポレイテッド フェナントロリン誘導体
CA2311643C (en) * 1997-12-04 2009-04-07 Genzyme Corporation Compositions and methods for inducing gene expression
US6124131A (en) * 1998-08-25 2000-09-26 The Johns Hopkins University School Of Medicine Mutant hypoxia inducible factor-1 HIF-1
CN1324234A (zh) * 1998-09-25 2001-11-28 格利科克斯有限公司 果糖胺氧化酶,拮抗剂和抑制剂
US6506936B1 (en) 1999-02-25 2003-01-14 Fibrogen, Inc. N-substituted arylsulfonylamino hydroxamic acids useful as inhibitors of c-proteinase and for treating or preventing disorders related to unregulated collagen production
BR0010316A (pt) * 1999-05-11 2004-04-27 Ortho Mcnell Pharmaceutical In Método e sistema para obtenção de regimes de dosagem otimizados de epo para uma resposta farmacodinâmica/farmacocinética desejada em um paciente
GB9911047D0 (en) * 1999-05-12 1999-07-14 Isis Innovation Assay method and means
CZ299516B6 (cs) * 1999-07-02 2008-08-20 F. Hoffmann-La Roche Ag Konjugát erythropoetinového glykoproteinu, zpusobjeho výroby a použití a farmaceutická kompozice sjeho obsahem
PE20010288A1 (es) * 1999-07-02 2001-03-07 Hoffmann La Roche Derivados de eritropoyetina
DE10010430A1 (de) † 2000-03-03 2001-09-06 Bayer Ag Substituierte 5-Ethyl-dihydropyridazinone und ihre Verwendung
DE10010425A1 (de) † 2000-03-03 2001-09-06 Bayer Ag Substituierte 5-Methyldihydropyridazinone und ihre Verwendung
DE10010423A1 (de) * 2000-03-03 2001-09-06 Bayer Ag Substituierte 2,5-Dimethyldihydropyridazinone und ihre Verwendung
DE10010426A1 (de) * 2000-03-03 2001-09-06 Bayer Ag Verwendung von 6-[4-Aminopheny]-dihydropyridazinonen
JP2005506292A (ja) * 2001-03-08 2005-03-03 エモリー　ユニバーシティ ｐＨに依存するＮＭＤＡレセプターアンタゴニスト
US6849718B2 (en) 2001-03-20 2005-02-01 Dana Farber Cancer Institute, Inc. Muteins of hypoxia inducible factor alpha and methods of use thereof
US6855510B2 (en) 2001-03-20 2005-02-15 Dana Farber Cancer Institute, Inc. Pharmaceuticals and methods for treating hypoxia and screening methods therefor
JP4590157B2 (ja) † 2001-03-21 2010-12-01 アイシス イノヴェイション リミテッド アッセイ、方法および手段
GB0108770D0 (en) * 2001-04-06 2001-05-30 Eisai London Res Lab Ltd Inhibitors
US6878729B2 (en) 2001-05-04 2005-04-12 The Procter & Gamble Company Medicinal uses of dihydropyrazoles
US6660737B2 (en) 2001-05-04 2003-12-09 The Procter & Gamble Company Medicinal uses of hydrazones
AU2002345796A1 (en) * 2001-06-26 2003-03-03 Beth Israel Deaconess Medical Center Compositions and methods for inhibiting platelet activation and thrombosis
DK2298301T3 (en) * 2001-12-06 2018-10-01 Fibrogen Inc MEDICINALS FOR TREATMENT OF ANEMIA ASSOCIATED WITH Kidney Disease
US6994981B2 (en) * 2002-02-19 2006-02-07 The Buck Institute Modulators of paraptosis and related methods
WO2003075910A1 (en) * 2002-03-08 2003-09-18 Protemix Corporation Limited Preventing and/or treating vascular disease, cardiomyopathy and/or associated heart failure
US8614204B2 (en) 2003-06-06 2013-12-24 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
KR101084635B1 (ko) * 2006-04-04 2011-11-18 피브로겐, 인크. Ｈｉｆ 조절제로서 피롤로- 및 티아졸로-피리딘 화합물
KR101130592B1 (ko) † 2006-06-26 2012-04-02 워너 칠콧 컴퍼니 엘엘씨 프롤릴 히드록실라제 저해제 및 사용 방법

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4558006A (en) * 1983-02-04 1985-12-10 Kirin-Amgen, Inc. A.T.C.C. HB8209 and its monoclonal antibody to erythropoietin
US4667016A (en) * 1985-06-20 1987-05-19 Kirin-Amgen, Inc. Erythropoietin purification
US5607954A (en) * 1992-03-24 1997-03-04 Hoechst Aktiengesellschaft Sulfonamido- and sulfonamidocarbonylpyridine-2-carboxamides and their pyridine-n-oxides, process for their preparation and their use as pharmaceuticals
US5658933A (en) * 1993-11-02 1997-08-19 Hoechst Aktiengesellschaft Substituted heterocyclic carboxamide esters, their preparation and their use as pharmaceuticals
US5620995A (en) * 1993-12-30 1997-04-15 Hoechst Aktiengesellschaft Substituted heterocyclic carboxyamides, their preparation and their use as pharmaceuticals
US5610172A (en) * 1994-03-25 1997-03-11 Hoechst Aktiengesellschaft Sulfonamidocarbonylpyridine-2-carboxamides and pyridine-n-oxides which are useful as pharmaceuticals
US5620996A (en) * 1994-03-25 1997-04-15 Hoechst Aktiengesellschaft Sulfonamidocarbonyl pyridine-2-carboxesteramides and their pyridine-N-oxide compounds and their use as pharmaceuticals
US5719164A (en) * 1995-09-28 1998-02-17 Hoechst Aktiengesellschaft Substituted quinoline-2-carboxamides, their preparation and their use as pharmaceuticals, and intermediates
US5726305A (en) * 1995-09-28 1998-03-10 Hoechst Aktiengesellschaft Substituted quinoline-2-carboxamides, their preparation and their use as pharmaceuticals, and intermediates
US6020350A (en) * 1996-12-04 2000-02-01 Hoechst Aktiengesellschaft 3-hydroxypyridine-2-carboxamidoesters, their preparation and their use as pharmaceuticals
US6093730A (en) * 1997-10-20 2000-07-25 Hoechst Marion Roussel Deutschland Gmbh Substituted isoquinoline-3-carboxamides, their preparation and their use as pharmaceuticals
US5916898A (en) * 1997-10-24 1999-06-29 Zeneca Limited Phenanthroline derivatives
US6200974B1 (en) * 1997-10-24 2001-03-13 Zeneca Limited Phenanthroline derivatives
US6566088B1 (en) * 2001-10-04 2003-05-20 Board Of Regents, The University Of Texas System Prolyl-4-hydroxylases

Cited By (155)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7863292B2 (en) 2003-06-06 2011-01-04 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US8278325B2 (en) 2003-06-06 2012-10-02 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US10092558B2 (en) 2003-06-06 2018-10-09 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US8017625B2 (en) 2003-06-06 2011-09-13 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US8604013B2 (en) 2003-06-06 2013-12-10 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US8604012B2 (en) * 2003-06-06 2013-12-10 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US8609646B2 (en) 2003-06-06 2013-12-17 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US8614204B2 (en) * 2003-06-06 2013-12-24 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US20070155784A1 (en) * 2003-06-06 2007-07-05 Fibrogen, Inc. Novel nitrogen-containing heteroaryl compounds and methods of use thereof
US8629131B2 (en) 2003-06-06 2014-01-14 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US20110038950A1 (en) * 2003-06-06 2011-02-17 Klaus Stephen J Enhanced erythropoiesis and iron metabolism
US20070185159A1 (en) * 2003-06-06 2007-08-09 Fibrogen, Inc. Novel Nitrogen-Containing Heteroaryl Compounds And Methods of Use Thereof
US20110039886A1 (en) * 2003-06-06 2011-02-17 Klaus Stephen J Enhanced erythropoiesis and iron metabolism
US8765956B2 (en) 2003-06-06 2014-07-01 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US20050020487A1 (en) * 2003-06-06 2005-01-27 Klaus Stephen J. Enhanced erythropoiesis and iron metabolism
US11680048B2 (en) 2003-06-06 2023-06-20 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US10626090B2 (en) 2003-06-06 2020-04-21 Fibrogen Inc. Enhanced erythropoiesis and iron metabolism
US8916585B2 (en) 2003-06-06 2014-12-23 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US20100278941A1 (en) * 2003-06-06 2010-11-04 Klaus Stephen J Enhanced erythropoiesis and iron metabolism
US11680047B2 (en) 2003-06-06 2023-06-20 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US20100280044A1 (en) * 2003-06-06 2010-11-04 Klaus Stephen J Enhanced erythropoiesis and iron metabolism
US9339527B2 (en) 2003-06-06 2016-05-17 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US20080293763A1 (en) * 2003-06-06 2008-11-27 Fibrogen, Inc. Novel nitrogen-containing heteroaryl compounds and methods of use thereof
US9920011B2 (en) 2003-06-06 2018-03-20 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US11229637B2 (en) 2003-06-06 2022-01-25 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US10927081B2 (en) 2003-06-06 2021-02-23 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US10894774B2 (en) 2003-06-06 2021-01-19 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US10882827B2 (en) 2003-06-06 2021-01-05 Fibrogen, Inc. Enhanced erythropoiesis and iron metabolism
US10646482B2 (en) 2003-06-06 2020-05-12 Fibrogen, Inc. Nitrogen-containing heteroaryl compounds and methods of use thereof
US20070275882A1 (en) * 2003-12-22 2007-11-29 Hans Meijer Nature-Identical Erythropoietin
US20050282751A1 (en) * 2004-03-19 2005-12-22 Ajinomoto Co., Inc. Therapeutic agent for renal anemia
US7638295B2 (en) 2004-03-26 2009-12-29 Isis Innovation Limited Assays for identifying modulators of the hydroxylation of ankyrin repeat proteins by 2-oxoglutarate dependent oxygenase and methods of using the same
US20080227848A1 (en) * 2004-03-26 2008-09-18 Isis Innovation Limited Assays
WO2006084210A3 (en) * 2005-02-04 2007-04-19 Univ California San Diego Hif modulating compounds and methods of use thereof
US20080213404A1 (en) * 2005-02-04 2008-09-04 Johnson Randall S Hif Modulating Compounds and Methods of Use Thereof
WO2006084210A2 (en) * 2005-02-04 2006-08-10 Regents Of The University Of California, San Diego Hif modulating compounds and methods of use thereof
US20060276477A1 (en) * 2005-06-06 2006-12-07 Fibrogen, Inc. Treatment method for anemia
US20100331362A1 (en) * 2005-06-06 2010-12-30 Fibrogen, Inc. Treatment method for anemia
WO2006133391A2 (en) * 2005-06-06 2006-12-14 Fibrogen, Inc. Improved treatment for anemia using a hif-alpha stabilising agent
WO2006133391A3 (en) * 2005-06-06 2007-08-02 Fibrogen Inc Improved treatment for anemia using a hif-alpha stabilising agent
US20070004627A1 (en) * 2005-06-15 2007-01-04 Fibrogen, Inc. Compounds and methods for treatment of cancer
US8530404B2 (en) * 2005-06-15 2013-09-10 Fibrogen, Inc. Compounds and methods for treatment of cancer
US8148100B2 (en) 2005-09-26 2012-04-03 Isis Innovation Limited Mina53 assays
WO2007038571A3 (en) * 2005-09-26 2007-10-11 Smithkline Beecham Corp Prolyl hydroxylase antagonists
US20090208475A1 (en) * 2005-09-26 2009-08-20 Isis Innovation Limited Mina53 assays
WO2007038571A2 (en) * 2005-09-26 2007-04-05 Smithkline Beecham Corporation Prolyl hydroxylase antagonists
US20070298104A1 (en) * 2006-01-27 2007-12-27 Fibrogen, Inc. Cyanoisoquinoline compounds and methods of use thereof
US7928120B2 (en) 2006-01-27 2011-04-19 Fibrogen, Inc. Cyanoisoquinoline compounds and methods of use thereof
US20110212959A1 (en) * 2006-01-27 2011-09-01 Fibrogen, Inc. Cyanoisoquinoline Compounds and Methods of Use Thereof
US8759373B2 (en) 2006-01-27 2014-06-24 Fibrogen, Inc. Cyanoisoquinoline compounds and methods of use thereof
US9174976B2 (en) 2006-01-27 2015-11-03 Fibrogen, Inc. Cyanoisoquinoline compounds and methods of use thereof
US20070185045A1 (en) * 2006-02-06 2007-08-09 Ratcliffe Peter J Inhibitors of 2-oxoglutarate dioxygenase as gamma globin inducers
US8050873B2 (en) 2006-03-07 2011-11-01 Warner Chilcott Company Crystal of hypoxia inducible factor 1 alpha prolyl hydroxylase
US8512972B2 (en) 2006-03-07 2013-08-20 Akebia Therapeutics, Inc. Crystal of hypoxia inducible factor 1 alpha prolyl hydroxylase
US20090240475A1 (en) * 2006-03-07 2009-09-24 Artem Gennady Evdokimov Three dimensional coordinates of hypoxia inducible factor 1 alpha (hif-1 alpha) prolyl hydroxylase (egln1) and uses thereof
US7696223B2 (en) 2006-04-04 2010-04-13 Fibrogen, Inc. Pyrrolo- and Thiazolo-pyridine compounds, and methods of use thereof
US20080004309A1 (en) * 2006-04-04 2008-01-03 Fibrogen, Inc. Pyrrolo- and thiazolo-pyridine compounds, and methods of use thereof
US20100204269A1 (en) * 2006-06-15 2010-08-12 Fibrogen, Inc. Compounds and methods for treatment of chemotherapy-induced anemia
US20110015223A1 (en) * 2006-06-15 2011-01-20 Fibrogen, Inc. Compounds and methods for treatment of cancer-related anemia
US20070292433A1 (en) * 2006-06-15 2007-12-20 Fibrogen, Inc. Compounds and methods for treatment of chemotherapy-induced anemia
US20070293575A1 (en) * 2006-06-15 2007-12-20 Fibrogen, Inc. Compounds and methods for treatment of cancer-related anemia
US7713986B2 (en) * 2006-06-15 2010-05-11 Fibrogen, Inc. Compounds and methods for treatment of chemotherapy-induced anemia
US8815884B2 (en) 2006-06-23 2014-08-26 Glaxosmithkline Llc Prolyl hydroxylase inhibitors
US8557834B2 (en) 2006-06-23 2013-10-15 Glaxosmithkline Llc Prolyl hydroxylase inhibitors
US20100113444A1 (en) * 2006-06-23 2010-05-06 Smithkline Beecham Corporation Prolyl hydroxylase inhibitors
US8324208B2 (en) 2006-06-23 2012-12-04 Glaxosmithkline Llc Prolyl hydroxylase inhibitors
US11643397B2 (en) 2006-06-23 2023-05-09 Glaxosmithkline Llc Prolyl hydroxylase inhibitors
US10336711B2 (en) 2006-06-23 2019-07-02 Glaxosmithkline Llc Prolyl hydroxylase inhibitors
US10035779B2 (en) 2006-06-23 2018-07-31 GlaxoSmithKline, LLC Prolyl hydroxylase inhibitors
US8323671B2 (en) 2006-06-26 2012-12-04 Akebia Therapeutics Inc. Prolyl hydroxylase inhibitors and methods of use
US8598210B2 (en) 2006-06-26 2013-12-03 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and methods of use
US8722895B2 (en) 2006-06-26 2014-05-13 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and method of use
US11883386B2 (en) 2006-06-26 2024-01-30 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and methods of use
US20070299086A1 (en) * 2006-06-26 2007-12-27 The Procter & Gamble Company Prolyl hydroxylase inhibitors and methods of use
US10729681B2 (en) 2006-06-26 2020-08-04 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and methods of use
US9598370B2 (en) 2006-06-26 2017-03-21 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and methods of use
US8940773B2 (en) 2006-06-26 2015-01-27 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and methods of use
US8343952B2 (en) 2006-06-26 2013-01-01 Akebia Therapeutics Inc. Prolyl hydroxylase inhibitors and methods of use
US7811595B2 (en) 2006-06-26 2010-10-12 Warner Chilcott Company, Llc Prolyl hydroxylase inhibitors and methods of use
US20100331303A1 (en) * 2006-06-26 2010-12-30 Richard Masaru Kawamoto Prolyl hydroxylase inhibitors and methods of use
US20100331374A1 (en) * 2006-06-26 2010-12-30 Shengde Wu Prolyl hydroxylase inhibitors and methods of use
USRE47437E1 (en) 2006-06-26 2019-06-18 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and methods of use
US11426393B2 (en) 2006-06-26 2022-08-30 Akebia Therapeutics, Inc. Prolyl hydroxylase inhibitors and methods of use
US8048892B2 (en) 2006-12-18 2011-11-01 Amgen Inc. Azaquinolone based compounds exhibiting prolyl hydroxylase inhibitory activity, compositions, and uses thereof
US20090093483A1 (en) * 2006-12-18 2009-04-09 Amgen Inc. Naphthalenone compounds exhibiting prolyl hydroxylase inhibitory activity, compositions, and uses thereof
US7635715B2 (en) 2006-12-18 2009-12-22 Amgen Inc. Naphthalenone compounds exhibiting prolyl hydroxylase inhibitory activity, compositions, and uses thereof
US7928139B2 (en) 2006-12-18 2011-04-19 Amgen Inc. Naphthalenone compounds exhibiting prolyl hydroxylase inhibitory activity, compositions, and uses thereof
US20090111806A1 (en) * 2006-12-18 2009-04-30 Amgen Inc. Azaquinolone based compounds exhibiting prolyl hydroxylase Inhibitory activity, compositions, and uses thereof
US20100048572A1 (en) * 2006-12-18 2010-02-25 Amgen Inc. Naphthalenone compounds exhibiting prolyl hydroxylase inhibitory activity, compositions, and uses thereof
USRE44613E1 (en) 2007-01-12 2013-11-26 Glaxosmithkline Llc N-substituted glycine derivatives: hydroxylase inhibitors
US7618938B2 (en) * 2007-02-07 2009-11-17 Academia Sinica Treating cerebrovascular diseases with erythropoietin and granulocyte-colony stimulating factor jointly
US20080188407A1 (en) * 2007-02-07 2008-08-07 Hung Li Treating cerebrovascular diseases with erythropoietin and granulocyte-colony stimulating factor jointly
US8349868B2 (en) 2007-04-18 2013-01-08 Amgen Inc. Azaquinolones that inhibit prolyl hydroxylase
US20090156605A1 (en) * 2007-04-18 2009-06-18 Amgen Inc. Quinolones and azaquinolones that inhbit prolyl hydroxylase
US7569726B2 (en) 2007-04-18 2009-08-04 Amgen Inc. Indanone derivatives that inhibit prolyl hydroxylase
US20110224248A1 (en) * 2007-04-18 2011-09-15 Amgen Inc. Azaquinolones that inhibit prolyl hydroxylase
US20090088475A1 (en) * 2007-04-18 2009-04-02 Amgen Inc. Indanone derivatives that inhibit prolyl hydroxylase
US8048894B2 (en) 2007-04-18 2011-11-01 Amgen Inc. Quinolones and azaquinolones that inhibit prolyl hydroxylase
US20090156633A1 (en) * 2007-05-04 2009-06-18 Amgen Inc. Heterocyclic quinolone derivatives that inhbit prolyl hydroxylase activity
US20090099171A1 (en) * 2007-05-04 2009-04-16 Amgen Inc. Diazaquinolones that inhibit prolyl hydroxylase activity
US8030346B2 (en) 2007-05-04 2011-10-04 Amgen Inc. Heterocyclic quinolone derivatives that inhibit prolyl hydroxylase activity
US8097620B2 (en) 2007-05-04 2012-01-17 Amgen Inc. Diazaquinolones that inhibit prolyl hydroxylase activity
US20100303928A1 (en) * 2007-12-03 2010-12-02 Fibrogen, Inc. Isoxazolopyridine derivatives for use in the treatment of hif-mediated conditions
US8269008B2 (en) 2007-12-03 2012-09-18 Fibrogen, Inc. Oxazolopyridine and isoxazolopyridine derivatives for use in the treatment of HIF-mediated conditions
WO2009089039A1 (en) * 2008-01-09 2009-07-16 Cho Daniel J Use of blood flow parameters to monitor or control the dosing of erythropoiesis-stimulating agents
US9387200B2 (en) 2008-01-11 2016-07-12 Fibrogen, Inc. Isothiazole-pyridine derivatives as modulators of HIF (hypoxia inducible factor) activity
US20100330199A1 (en) * 2008-01-11 2010-12-30 Fibrogen, Inc. Isothiazole-pyridine derivates as modulators of hif (hypoxia inducible factor) activity
US8952160B2 (en) 2008-01-11 2015-02-10 Fibrogen, Inc. Isothiazole-pyridine derivatives as modulators of HIF (hypoxia inducible factor) activity
US8324405B2 (en) 2008-02-05 2012-12-04 Fibrogen, Inc. Chromene derivatives and use thereof as HIF hydroxylase activity inhibitors
US20100047367A1 (en) * 2008-08-20 2010-02-25 Fibrogen, Inc. Compounds and methods for their use
US8217043B2 (en) 2008-08-20 2012-07-10 Fibrogen, Inc. Compounds and methods for their use
US9149476B2 (en) 2008-11-14 2015-10-06 Fibrogen, Inc. Thiochromene derivatives as HIF hydroxylase inhibitors
US8927591B2 (en) 2008-11-14 2015-01-06 Fibrogen, Inc. Thiochromene derivatives as HIF hydroxylase inhibitors
WO2011041584A2 (en) 2009-09-30 2011-04-07 President And Fellows Of Harvard College Methods for modulation of autophagy through the modulation of autophagy-enhancing gene products
WO2011041582A2 (en) 2009-09-30 2011-04-07 President And Fellows Of Harvard College Methods for modulation of autophagy through the modulation of autophagy-inhibiting gene products
US20110111058A1 (en) * 2009-11-06 2011-05-12 Robert Shalwitz Methods for increasing the stabilization of hypoxia inducible factor-1 alpha
US20110112055A1 (en) * 2009-11-06 2011-05-12 Gardner Joseph H Compositions and methods for treating colitis
US8883774B2 (en) 2009-11-06 2014-11-11 Aerpio Therapeutics Inc. Methods for increasing the stabilization of hypoxia inducible factor-1 alpha
US8778412B2 (en) 2009-11-06 2014-07-15 Aerpio Therapeutics Inc. Methods for increasing the stabilization of hypoxia inducible factor-1 alpha
US9540326B2 (en) 2009-11-06 2017-01-10 Aerpio Therapeutics, Inc. Prolyl hydroxylase inhibitors
US8309537B2 (en) 2009-11-06 2012-11-13 Aerpio Therapeutics Inc. Compositions and methods for treating colitis
US9045495B2 (en) 2009-11-06 2015-06-02 Aerpio Therapeutics Inc. Prolyl hydroxylase inhibitors
US10562854B2 (en) 2009-11-06 2020-02-18 Aerpio Therapeutics, Inc. Prolyl hydroxylase inhibitors
US8536181B2 (en) 2009-11-06 2013-09-17 Aerpio Therapeutics Inc. Prolyl hydroxylase inhibitors
WO2012110789A1 (en) 2011-02-15 2012-08-23 Isis Innovation Limited Method for assaying ogfod1 activity
US11267785B2 (en) 2011-06-06 2022-03-08 Akebia Therapeutics, Inc. Process for preparing [(3-hydroxypyridine-2-carbonyl)amino]alkanoic acids, esters and amides
US10738010B2 (en) 2011-06-06 2020-08-11 Akebia Therapeutics, Inc. Process for preparing [(3-hydroxypyridine-2-carbonyl)amino] alkanoic acids, esters and amides
US10246416B2 (en) 2011-06-06 2019-04-02 Akebia Therapeutics, Inc. Process for preparing [(3-hydroxypyridine-2-carbonyl)amino] alkanoic acids, esters and amides
WO2013014449A1 (en) 2011-07-28 2013-01-31 Isis Innovation Limited Assay for histidinyl hydroxylase activity
US9409892B2 (en) 2012-03-09 2016-08-09 Fibrogen, Inc. 4-hydroxy-isoquinoline compounds as HIF hydroxylase inhibitors
US8883823B2 (en) 2012-07-16 2014-11-11 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US10272078B2 (en) 2012-07-16 2019-04-30 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US10118897B2 (en) 2012-07-16 2018-11-06 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US9115085B2 (en) 2012-07-16 2015-08-25 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US9617218B2 (en) 2012-07-16 2017-04-11 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US9918977B2 (en) 2012-07-16 2018-03-20 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US9708269B2 (en) 2012-07-16 2017-07-18 Fibrogen, Inc. Process for making isoquinoline compounds
US9371288B2 (en) 2012-07-16 2016-06-21 Fibrogen, Inc. Crystalline forms of a prolyl hydroxylase inhibitor
US9340511B2 (en) 2012-07-16 2016-05-17 Fibrogen, Inc. Process for making isoquinoline compounds
US9643928B2 (en) 2013-01-24 2017-05-09 Fibrogen, Inc. Crystalline forms of {[1-cyano-5-(4-chlorophenoxy)-4-hydroxy-isoquinoline-3-carbonyl]-amino}-acetic acid
US20200170244A1 (en) * 2013-02-01 2020-06-04 Conradus Ghosal Gho Methods for preserving, transporting and storing living biological materials
EP3708154A1 (en) 2013-06-06 2020-09-16 Fibrogen, Inc. Pharmaceutical formulations of a hif hydroxylase inhibitor
WO2014197660A1 (en) 2013-06-06 2014-12-11 Fibrogen, Inc. Pharmaceutical formulations of a hif hydroxylase inhibitor
US20160143891A1 (en) * 2013-06-13 2016-05-26 Akebia Therapeutics, Inc. Compositions and methods for treating anemia
US11857543B2 (en) * 2013-06-13 2024-01-02 Akebia Therapeutics, Inc. Compositions and methods for treating anemia
US11690836B2 (en) 2013-11-15 2023-07-04 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino}acetic acid, compositions, and uses thereof
US9987262B2 (en) 2013-11-15 2018-06-05 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino}acetic acid, compositions, and uses thereof
US10596158B2 (en) 2013-11-15 2020-03-24 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino}acetic acid, compositions, and uses thereof
US11065237B2 (en) 2013-11-15 2021-07-20 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino}acetic acid, compositions, and uses thereof
US10149842B2 (en) 2013-11-15 2018-12-11 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino}acetic acid, compositions, and uses thereof
US10150734B2 (en) 2015-01-23 2018-12-11 Akebia Therapeutics, Inc. Solid forms of 2-(5-(3-fluorophenyl)-3-hydroxypicolinamido)acetic acid, compositions, and uses thereof
US11844756B2 (en) 2015-04-01 2023-12-19 Akebia Therapeutics, Inc. Compositions and methods for treating anemia
US11324734B2 (en) 2015-04-01 2022-05-10 Akebia Therapeutics, Inc. Compositions and methods for treating anemia
US11713298B2 (en) 2018-05-09 2023-08-01 Akebia Therapeutics, Inc. Process for preparing 2-[[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino]acetic acid
US11524939B2 (en) 2019-11-13 2022-12-13 Akebia Therapeutics, Inc. Solid forms of {[5-(3-chlorophenyl)-3-hydroxypyridine-2-carbonyl]amino} acetic acid

Also Published As

Publication number Publication date
JP5469572B2 (ja) 2014-04-16
EP2289531A2 (en) 2011-03-02
EP2295059A3 (en) 2013-04-03
AU2002357096B2 (en) 2008-10-16
JP2006137763A (ja) 2006-06-01
CN102526044A (zh) 2012-07-04
AU2009200018C1 (en) 2013-02-07
EP2298301B1 (en) 2018-07-04
US20060270699A1 (en) 2006-11-30
US20150080425A1 (en) 2015-03-19
JP5341293B2 (ja) 2013-11-13
EP2324834A2 (en) 2011-05-25
EP1463823A4 (en) 2005-11-16
CN1599618A (zh) 2005-03-23
EP2324834B1 (en) 2019-05-08
CA3094774A1 (en) 2003-07-03
CA2916093C (en) 2020-11-03
WO2003049686A3 (en) 2004-06-24
JP2005526010A (ja) 2005-09-02
EP2324834A3 (en) 2013-02-13
EP1463823B1 (en) 2013-03-06
CN100522946C (zh) 2009-08-05
EP1487472A2 (en) 2004-12-22
NO20042804L (no) 2004-09-06
WO2003053997A2 (en) 2003-07-03
AU2002362065A1 (en) 2003-06-23
AU2002362065B2 (en) 2007-12-06
DK2298301T3 (en) 2018-10-01
JP2011046733A (ja) 2011-03-10
US20130245037A1 (en) 2013-09-19
CN102552262A (zh) 2012-07-11
HU229475B1 (en) 2014-01-28
JP5498918B2 (ja) 2014-05-21
CA2468083A1 (en) 2003-07-03
EP2289531A3 (en) 2013-03-13
ES2686626T3 (es) 2018-10-18
EP1487472A4 (en) 2005-11-16
CN1602360A (zh) 2005-03-30
AU2009200018B2 (en) 2012-05-24
DK2289531T3 (en) 2018-10-01
CA2916093A1 (en) 2003-07-03
IL162085A0 (en) 2005-11-20
US20210369702A1 (en) 2021-12-02
JP4804131B2 (ja) 2011-11-02
DK1463823T3 (da) 2013-06-03
EP2298301A3 (en) 2013-03-13
CA2467689A1 (en) 2003-06-19
EP2298301B2 (en) 2022-11-16
EP1487472B1 (en) 2019-06-26
US20130203805A1 (en) 2013-08-08
CA2467689C (en) 2013-10-01
EP2289531B1 (en) 2018-07-04
US20060258660A1 (en) 2006-11-16
HK1069845A1 (en) 2005-06-03
EP3520784A1 (en) 2019-08-07
US20110166145A1 (en) 2011-07-07
JP2005524612A (ja) 2005-08-18
US20060178316A1 (en) 2006-08-10
WO2003053997A3 (en) 2004-06-17
CN102526045A (zh) 2012-07-04
CA2468083C (en) 2016-02-23
US20110166178A1 (en) 2011-07-07
AU2002357096A1 (en) 2003-07-09
NO343732B1 (no) 2019-05-27
EP2295059A2 (en) 2011-03-16
US20060183695A1 (en) 2006-08-17
US20170312268A1 (en) 2017-11-02
CN102552261A (zh) 2012-07-11
CN102552263A (zh) 2012-07-11
ES2686625T3 (es) 2018-10-18
EP2298301A2 (en) 2011-03-23
US8466172B2 (en) 2013-06-18
ES2414706T3 (es) 2013-07-22
AU2009200018A1 (en) 2009-02-05
EP1463823A2 (en) 2004-10-06
US20060258702A1 (en) 2006-11-16
HUP0500643A3 (en) 2010-03-29
HUP0500643A2 (hu) 2005-10-28
IL162085A (en) 2016-10-31
US20030176317A1 (en) 2003-09-18
US20060178317A1 (en) 2006-08-10
WO2003049686A2 (en) 2003-06-19
JP2011037862A (ja) 2011-02-24

Similar Documents

Publication Publication Date Title
US20210369702A1 (en) Methods for treating anemia in subjects having kidney failure using inhibitors of hypoxia-inducible factor (hif) hydroxylase
US8318703B2 (en) Methods for improving kidney function
EP2295060B1 (en) Treatment or prevention of ischemic or hypoxic conditions

Legal Events

Date Code Title Description
AS Assignment

Owner name: FIBROGEN, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KLAUS, STEPHEN J.;LIN, AL Y.;NEFF, THOMAS B.;AND OTHERS;REEL/FRAME:014382/0957;SIGNING DATES FROM 20030203 TO 20030801

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION