WO2005034929A2 - Tissue remodeling and vascularization - Google Patents

Abstract

The present invention relates to methods, compounds, and medicaments for coordinate induction of tissue remodeling and vascularization, and for therapeutic or prophylactic treatment of disorders associated with vascular insufficiency.

Description

TISSUE REMODELING AND VASCULARIZATION

[0001] This application claims the benefit of U.S. Provisional Application Serial

No. 60/510,323, filed on 10 October 2003, which is incorporated by reference herein in its entirety.

FIELD OF THE INVENTION

[0002] The present invention relates to methods, compounds, and medicaments for coordinate induction of tissue remodeling and vascularization, and for therapeutic or prophylactic treatment of disorders associated with vascular insufficiency.

BACKGROUND OF THE INVENTION

[0003] The formation of blood vessels occurs during embryonic development in conjunction with tissue and organ growth. The result is a sufficiently vascularized structure, e.g., heart, skin, lung, kidney, etc., to efficiently serve the needs of the adult organism. Proper vasculogenesis during neonatal development requires a relatively hypoxic environment. Premature delivery can adversely affect vasculogenesis in the infant due to early exposure to a normoxic environment, and can lead to complications including delayed growth and development, hyaline membrane disease (respiratory distress syndrome) and bronchopulmonary dysplasia (BPD), intraventricular hemorrhage in the brain, heart disease, necrotizing enterocolitis, and anemia. Further, oxygen therapy, used to alleviate respiratory distress, can lead to retinopathy with long-term vision loss or blindness.

[0004] Vasculogenesis also occurs in the adult during repair of damage to a tissue or organ, e.g., through injury or due to various conditions and disorders such as hypertension or vascular disease. For example, following myocardial infarction, the size of the resulting infarct, and the recovery of functional heart tissue in the penumbra surrounding the infarct, is affected by the ability to restore blood flow through neovascularization. Similarly, in chronic wounds, e.g., ulcers, the ability to stimulate cellular infiltration, matrix formation, and proper wound closure depends on proper neovascularization. Further, in conditions such as hypertension and diabetes, wherein the vascular system is stressed and prone to degradation, neovascularization can provide compensatory blood flow that prevents possible injury due to closure of a vessel and subsequent cessation of blood flow to a region. In each of these cases, inadequate blood vessel growth leads to reduced circulation, and, if circulation is not properly restored, severe damage and tissue death can result. [0005] An attempt to induce vascular processes using specific growth factors has produced limited success. For example, overexpression of vascular endothelial growth factor (VEGF), a factor known to be important in angiogenesis, resulted in incomplete vessel formation and produced edema, inflammation, and vascular leakage. (See, e.g., Detmar et al. (1998) J Invest Derm 111:1-6; and Larcher et al. (1998) Oncogene 17:303-311.) Therefore, in order to provide complete vasculogenesis, a method of stimulating formation of intact, functional blood vessels in the context of tissue growth and remodeling is required.

[0006] The present invention provides methods for inducing vascular processes in a coordinated response for treating or preventing conditions associated with insufficient blood flow, or associated with vascular damage due to injury, trauma, chronic disorders, e.g., atherosclerosis, diabetes, hypertension, chronic heart disease, etc., or acute conditions, e.g., myocardial infarction, stroke, etc. The methods of the present invention can be applied therapeutically or prophylactically to treat such conditions in a subject. The invention further provides compounds and medicaments for use in the methods described herein.

SUMMARY OF THE INVENTION

[0007] The present invention provides methods of coordinately inducing tissue remodeling and vascularization in a subject. The invention additionally provides methods to induce vascular development in a subject. In one aspect, the invention provides an agent, and use of the agent, to induce tissue remodeling and vascularization in a coordinated fashion. In another aspect, the invention provides an agent, and use of the agent, to induce vascular development in a subject. In one embodiment, the agent stabilizes HIFo;. In another embodiment, the agent inhibits the activity of an enzyme selected from EGLN-1, EGLN-2, EGLN-3, and active fragments thereof. In another aspect, the invention provides for use of the agent in formulation of a medicament.

[0008] In various aspects, the use of the agent and the methods of the invention increase capillary density in a subject. In other aspects, the use of the agent and the methods of the invention increase formation of collateral blood vessels. The increase in capillary density and formation of collateral blood vessels requires coordinated induction of both tissue remodeling and vascularization. In various embodiments therein, the use of the agent and methods provide for increased blood flow to an organ or tissue.

[0009] In another aspect, the invention provides methods to treat or reduce pulmonary insufficiency in a subject. In one embodiment, the method comprises administering an agent that stabilizes HIFo; to the subject, thereby treating or reducing pulmonary insufficiency. In another embodiment, the method comprises administering an agent that inhibits the activity of an enzyme selected from EGLN-1, EG N-2, EGLN-3, and active fragments thereof to a subject, thereby treating or reducing pulmonary insufficiency. In various aspects, the invention provides an agent that stabilizes FflFα, and use of the agent, to treat or reduce pulmonary insufficiency. In one embodiment, the agent inhibits the activity of an enzyme selected from EGLN-1, EGLN-2, EGLN-3, and active fragments thereof. In another aspect, the invention provides for use of the agent in formulation of a medicament. In any of these embodiments and aspects, reduction in pulmonary insufficiency may be measured as an improvement in a pulmonary function selected from the group consisting of pulmonary compliance, arterial-alveolar oxygen gradient, and oxygenation index.

[0010] In various embodiments, the subject may be a tissue, organ, organ system, or whole organism. For example, in some embodiments, the subject is an organ for transplant. In preferred embodiments, the subject is a mammal. In a most preferred embodiment, the subject is a human. In various aspects, the subject may be a preterm infant.

[0011] In some aspects, the subject may be an individual with increased risk for vascular disorders, including, e.g., diabetes, hypertension, atherosclerosis, congestive heart disease, and peripheral vascular disease; as well as individuals suffering from an injury, e.g., due to trauma, myocardial infarction, or stroke. In other aspects, the subject may be a preterm infant having a vascular disorder selected from the group consisting of bronchopulmonary dysplasia (BPD), intraventricular hemorrhage, chronic heart disease, and necrotizing enterocolitis.

[0012] The present invention provides methods that derive from a new understanding of the physiological advantages of coordinated induction of tissue remodeling and vascularization. In particular, application of the present methods results not only in vascular development, but in improved therapeutic outcome, for example, improved cardiac function following ischemic or vascular insult or injury, enhanced tissue repair, improved organ function, enhanced granulation tissue formation, etc. The invention also provides for improved outcome following preterm delivery, for example, by extending coordinated development of organs and tissues with appropriate vascularization.

[0013] Vascular development encompasses a series molecular events: degradation of old and formation of new basement membrane; endothelial cell proliferation, migration, and differentation; fusion of newly formed vessels; initiation of blood flow, etc. The present invention provides methods for inducing one or more of these specific events. In particular embodiments, the present invention provides methods for selectively inducing sets or subsets of vascular factors, such as, e.g., VEGF, Flt-1, angiopoietin-1, Tie-2, PAI-1, adrenomedullin, Cyrβl, etc. In one embodiment, the present invention provides methods for inducing factors that affect the rate of extracellular matrix synthesis and degradation, e.g., PAI-1, collagens, MMPs, elastins, etc. In another embodiment, methods for inducing factors that affect endothelial cell proliferation, migration, and differentiation, e.g., VEGF, are provided.

[0014] Methods for enhancing, facilitating, or increasing blood flow are provided herein. In particular, the present invention provides methods for inducing factors that stimulate vasodilation, e.g., adrenomedullin, iNOS, etc. In addition to providing methods for inducing vasodilatory factors, the present invention provides methods for inducing vasoconstrictive factors, e.g., endothelin-1, angiotensin, etc., which, in appropriate balance, contribute to maintenance of blood vessel stability and function. The invention also provides methods for enhanced granulation tissue formation, which can be applied, e.g., to promote healing of, e.g., chronic wounds, ulcers, etc.

[0015] In various aspects, an agent may stabilize HIFc by inhibiting hydroxylation of one or more amino acid residues of HIFo. The hydroxylation may occur on proline and/or asparagine amino acid residues. In various aspects, the agent for use in the present methods may additionally inhibit the activity of one or more 2-oxoglutarate dioxygenase enzymes. Such enzymes may be selected from the group consisting of procollagen lysyl hydroxylase, procollagen prolyl 3 -hydroxylase, procollagen prolyl 4-hydroxylase, and factor inhibiting HIF. In one particular embodiment, an agent that stabilizes HIFαby inhibiting EGLN enzymes additionally inhibits the activity of FIH.

[0016] In particular aspects, the agent for use in the present methods is a compound selected from the group consisting of iron chelators, 2-oxoglutarate mimetics, and proline analogs. In one embodiment, the agent is an iron chelator selected from substituted or unsubstituted phenanthroline. In another embodiment, the agent is a 2-oxoglutarate mimetic selected from a substituted or unsubstituted heterocyclic carboxamide.

[0017] These and other embodiments of the subject invention will readily occur to those of skill in the art in light of the disclosure herein, and all such embodiments are specifically contemplated. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figures 1A and IB shows the expression of genes encoding vascular factors in various organs. Figure 1A is the gene expression pattern seen in heart, and includes transcript patterns for VEGF-A and -C, Flt-1/VEGF receptor-1, adrenomedullin, and angiotensin-2. Figure IB is the gene expression pattern seen in the lung, and includes transcript patterns for VEGF-C, Flt-1/VEGF receptor-1, adrenomedullin, endothelin-1, plasminogen activator inhibitor (PAI)-1, and Cyrόl.

[0019] Figures 2A and 2B show PAI-1 and iNOS expression, respectively, in liver following treatment using methods of the invention.

[0020] Figures 3 A and 3B show VEGF expression in cells treated with compound of the invention. Figure 3 A shows stimulation of VEGF expression in fibroblasts (HFF) and epithelial cells (293A) treated with various PHIs. Values on the y-axis represent fold- induction relative to control and are reported on a log2 scale, such that a value of 1 represents 2-fold induction. Figure 3B shows that cell types from several different tissues are competent to respond to PHIs stimulation of VEGF expression and secretion.

[0021] Figures 4A and 4B show stimulation of VEGF expression in HLMVEC and A549 cells, respectively, following treatment using methods of the invention.

[0022] Figures 5 A and 5B show effects of the methods of the invention on granulation tissue formation at a wound site. Figure 5A shows an increase in granulation tissue area in treated wounds relative to untreated wounds. Figure 5B shows peak-to-peak distance of wound coverage in treated versus untreated animals.

DESCRIPTION OF THE INVENTION

[0023] Before the present compositions and methods are described, it is to be understood that the invention is not limited to the particular methodologies, protocols, cell lines, assays, and reagents described, as these may vary. It is also to be understood that the terminology used herein is intended to describe particular embodiments of the present invention, and is in no way intended to limit the scope of the present invention as set forth in the appended claims.

[0024] It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless context clearly dictates otherwise. Thus, for example, a reference to "a fragment" includes a plurality of such fragments; a reference to an "antibody" is a reference to one or more antibodies and to equivalents thereof known to those skilled in the art, and so forth.

[0025] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications cited herein are incorporated herein by reference in their entirety for the purpose of describing and disclosing the methodologies, reagents, and tools reported in the publications that might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0026] The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, molecular biology, cell biology, genetics, immunology and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Gennaro, A.R., ed. (1990) Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co.; Hardman, J.G., Limbird, L.E., and Gilman, A.G., eds. (2001) The Pharmacological Basis of Therapeutics, 10th ed., McGraw-Hill Co.; Colowick, S. et al., eds., Methods In Enzymology, Academic Press, Inc.; Weir, D.M., and Blackwell, C.C., eds. (1986) Handbook of Experimental Immunology, Vols. I-IV, Blackwell Scientific Publications; Maniatis, T. et al., eds. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Vols. I-III, Cold Spring Harbor Laboratory Press; Ausubel, F.M. et al., eds. (1999) Short Protocols in Molecular Biology, 4th edition, John Wiley & Sons; Ream et al., eds. (1998) Molecular Biology Techniques: An Intensive Laboratory Course, Academic Press; Newton, C.R., and Graham, A., eds. (1997) PCR (Introduction to Biotechniques Series), 2nd ed., Springer Verlag.

DEFINITIONS

[0027] The term "HIFα" refers to the alpha subunit of hypoxia inducible factor protein. HIFαmay be any human or other mammalian protein, or fragment thereof, including human HIF-lo: (Genbank Accession No. Q16665), HIF-2o; (Genbank Accession No. AAB41495), and HIF-3G! (Genbank Accession No. AAD22668); murine HIF-lo; (Genbank Accession No. Q61221), HIF-2α! (Genbank Accession No. BAA20130 and AAB41496), and fflF-3α (Genbank Accession No. AAC72734); rat HIF-lα (Genbank Accession No. CAA70701), HIF-2o; (Genbank Accession No. CAB96612), and HΣF-3o; (Genbank Accession No. CAB96611); and bovine HIF-lα (Genbank Accession No. BAA78675). HIFo; may also be any non-mammalian protein or fragment thereof, including Xenopus laevis HIF-lα (Genbank Accession No. CAB96628), Drosophila melanogaster HIF-lc (Genbank Accession No. JC4851), and chicken HIF- Ice (Genbank Accession No. BAA34234). HIFα gene sequences may also be obtained by routine cloning techniques, for example by using all or part of a HIFα; gene sequence described above as a probe to recover and determine the sequence of a HIFc gene in another species.

[0028] A fragment of HIFo; includes any fragment retaining at least one functional or structural characteristic of HIFo:. Fragments of HIFα! include, e.g., the regions defined by human HIF-lo; from amino acids 401 to 603 (Huang et al., supra), amino acid 531 to 575 (Jiang et al. (1997) J Biol Chem 272:19253-19260), amino acid 556 to 575 (Tanimoto et al., supra), amino acid 557 to 571 (Srinivas et al. (1999) Biochem Biophys Res Commun 260:557-561), and amino acid 556 to 575 (Ivan and Kaelin (2001) Science 292:464-468). Further, HIFα: fragments include any fragment containing at least one occurrence of the motif LXXLAP, e.g., as occurs in the human HIF-lα! native sequence at L₃₉₇TLLAP and L₅₅₉EMLAP.

[0029] The terms "preterm" and "premature" used in reference to a subject or infant refer to birth prior to complete gestation.

[0030] The terms "disorders" and "diseases" and "conditions" are used inclusively and refer to any condition deviating from normal. For example, preterm infants, which face a greater risk of serious health problems due to a combination of factors including reduced birth weight and incomplete organ development, have a higher risk of death and lasting disabilities, such as mental retardation, cerebral palsy, lung and gastrointestinal problems, and vision and hearing loss. Complications that can affect preterm infants include, but are not limited to, respiratory distress syndrome (RDS), intraventricular hemorrhage (rVH), patent ductus arteriosus (PDA), necrotizing enterocolitis (NEC), retinopathy of prematurity (ROP), jaundice, anemia, bronchopulmonary dysplasia (BPD), and increased risk of infections

INVENTION

[0031] The present invention provides methods to induce, augment, and coordinately regulate tissue remodeling and vascularization. The methods can be use to facilitate and enhance developmental vascularization and neovascularization associated with repair of tissue damage, and encompass stimulating the growth and development of blood vessels and the modeling and/or re-modeling of surrounding tissues. [0032] In one aspect, the methods are used to induce coordinated tissue development and vascularization to facilitate embryonic development. In one embodiment, the methods involve treating an infant delivered before complete gestation, or generally prior to 38 weeks gestation, more particularly prior to 37 weeks gestation. In another embodiment, the methods comprise treating an infant having one or more complications associated with premature birth. Such complications include, but are not limited to, hyaline membrane disease (respiratory distress syndrome), bronchopulmonary dysplasia (BPD), intraventricular hemorrhage, heart disease, necrotizing enterocolitis, and anemia.

[0033] In another aspect, the present methods are used to induce coordinated tissue remodeling and vascularization to facilitate proper repair of damaged tissue. In one embodiment, tissue damage is due to a trauma or injury. In another embodiment, the tissue damage is due to a chronic condition such as atherosclerosis, diabetes, hypertension, etc. In yet another embodiment, the tissue damage is due to an acute condition, such as vascular lesions due to an embolus or thrombus, myocardial infarction, stroke, etc. In another emodiment, tissue damage is due to a medical procedure including, e.g., surgeries such as coronary bypass surgery; repeated or long-term catheterization, medical tests or procedures such as radioconfrast imaging, etc. In still another embodiment, the wound is an ulcer, e.g., as occurs on the skin due to prolonged immobility or as occurs in the gastrointestinal tract due to certain toxins, bacteria, and other irritants.

[0034] Vascular development is induced by a number of factors, but commonly occurs during embryonic development and tissue repair as a result of cellular hypoxia. Hypoxic cells are capable of inducing local tissue remodeling and sprouting of nearby blood vessels. During development, such hypoxic tissues direct and coordinate vascularization of the embryo. However, during normal wound healing in an adult, proper cellular growth, matrix reconstruction, and vascularization must be balanced with rapid wound closure. Too much matrix production in the absence of vascularization can produce an avascular scar. Such scars, in the context of an organ, e.g., the heart, reduces the functional mass of the organ. To regain proper organ function, extracellular matrix production must be coordinately regulated with cell migration, cell differentiation, tissue remodeling, and vascularization.

[0035] The present invention demonstrates that compounds and methods affecting the activity and stability of the alpha subunit of hypoxia inducible factor (HIFα:) improve vascular development both in the context of developmental vasculogenesis and neovascularization associated with repair of tissue damage. The HIF transcription complex consists of an alpha subunit and a beta subunit. The beta subunit is present constitutively within the cell, but the alpha subunit is regulated by environmental stimuli. Specifically, when oxygen levels in the cell are high, HIFα; is hydroxylated on specific residues by at least one of a family of 2- oxoglutarate- and dioxygen-dependent enzymes. These hydroxylation events function to both destabilize and inactivate the HIFα; subunit. However, when oxygen levels are low, HIFα; is not modified and remains stable and active. HIFα; then combines with the HIFjS subunit, and the complex moves into the nucleus and activates transcription of a host of genes. HIF- regulated genes encompass a variety of factors involved in numerous processes, including angiogenesis, erythropoiesis, glucose metabolism, etc. Using the methods of the present invention, HIF stabilization can be regulated under hypoxic and under normoxic conditions to facilitate multi-faceted tissue remodeling and vasculogenic mechanisms resulting in maximum therapeutic benefit.

[0036] Methods for stabilizing HIFo; have been described. (See International Publication No. WO 03/049686, incorporated herein by reference in its entirety.) For example, the enzymes EGLN-1, EGLN-2, and EGLN-3; and FIH hydroxylate proline and asparagine residues, respectively, on the alpha subunit of hypoxia inducible factor (HIFα!) to inactive the HIF transcription factor and target HIFα; for ubiquitination and degradation. Reduced activity of these enzymes leads to stabilization and activation of HIFα!. Thus, in one aspect, the methods of the present invention comprise coordinately inducing tissue remodeling and vascularization by inhibiting EGLN-1, -2, and/or -3, thereby stabilizing HIFα in a subject.

[0037] The EGLN and FIH enzymes are 2-oxoglutarate dioxygenases. All of the enzymes in the 2-oxoglutarate dioxygenase family, which additionally includes procollagen lysyl hydroxylase (cLH), procollagen prolyl 3-hydroxylase (cP3H), procollagen prolyl 4- hydroxylase (cP4H) α(I) and α(II), thymine 7-hydroxylase, aspartyl (asparaginyl) β- hydroxylase, e-N-trimethyllysine hydroxylase, and γ-butyrobetaine hydroxylase require oxygen, as well as Fe²⁺, 2-oxoglutarate, and ascorbic acid, for their activity. (See, e.g., Majamaa et al. (1985) Biochem J 229:127-133; Myllyharju and Kivirikko (1997) EMBO J 16:1173-1180; Thornburg et al. (1993) 32:14023-14033; and Jia et al. (1994) Proc Natl Acad Sci USA 91:7227-7231.)

[0038] In particular embodiments, the methods of the present invention use agents that inhibit EGLN activity, and additionally inhibit at least one other 2-oxoglutarate dioxygenase. For example, the enzymes cLH, cP3H, and cP4H hydroxylate lysine and proline residues, respectively, in procollagen to produce proper triple helix and interchain linkage in mature collagen fibers. Reduced activity of these enzymes decreases the amount of functional extracellular matrix produced. Proper regulation of this group of collagen-modifying enzymes in the context of wound repair, e.g., may facilitate formation of functional, vascularized tissue rather than a non-functional, avascular scar. Using the methods of the present invention, collagen production can be regulated under hypoxic and under normoxic conditions to facilitate multi-faceted tissue remodeling mechanisms resulting in maximum therapeutic benefit.

[0039] In various embodiments, the methods comprise administering to a subject a compound of the invention. In various embodiments, the subject can be a tissue, organ, organ system, or whole organism. In particular embodiments, the subject is a mammal, more particularly a human. In specific embodiments, the subject is delivered prior to full term, i.e., the subject is a premature or preterm infant.

[0040] Thus, in one aspect, the present invention provides therapeutic approaches that derive from a new understanding of the physiological advantages of regulated vascularization through coordinated gene expression and tissue remodeling. In particular, application of the present methods results not only in vascularization, but in improved therapeutic outcome, for example, improved cardiac function following ischemic or vascular insult or injury, enhanced tissue repair, improved organ function, enhanced granulation tissue formation, etc.

[0041] In another aspect, the present invention provides methods that facilitate continued vasculogenesis and organ development in developmentally retarded subjects including, but not limited to, preterm infants. The invention specifically contemplates providing enhanced vasculogenesis in premature infants, especially human infants, who are exposed to a normoxic and/or hyperoxic environment. The methods provide prophylactic care and treatment of various disorders including respiratory distress syndrome (RDS), intraventricular hemorrhage (IVH), patent ductus arteriosus (PDA), necrotizing enterocolitis (NEC), retinopathy of prematurity (ROP), bronchopulmonary dysplasia (BPD), etc. In one embodiment, the method comprises administering a agent that stabilizes HIFα; to a subject, thereby facilitating vasculogenesis and organ development. In a particular embodiment, the agent inhibits an enzyme selected from the group consisting of EGLN-1, EGLN-2, EGLN-3, and FJJH.

[0042] Diminished vascular development is a feature of many of the complications that can affect preterm infants. Embryonic development occurs at low oxygen concentrations (3-5%), and preterm delivery prematurely exposes developing organs to higher levels of oxygen. These higher oxygen levels impair normal endothelial and vascular growth, e.g., branching of distal airways in fetal lung is substantially decreased at 21% oxygen. Therefore, the present invention specifically contemplates providing continued or enhanced vasularization in a developing organ or tissue, particularly a developing organ or tissue prematurely exposed to a normoxic or hyperoxic environment. Such organs may include, but are not limited to, lung, liver, kidney, brain, eye, skin, and heart.

[0043] Additionally, subjects which may exhibit developmental retardation include, e.g., subjects developing in an adverse environment, e.g., nutritional deficiencies in the mother during gestation, and/or exposure to a chemical and/or toxin in utero or adverse environmental conditions, etc., that adversely affect development of one or more organs and/or tissues in the fetus or in the placental tissues. Therefore, the present invention specifically contemplates providing continued or enhanced organ development and vascularization in an infant with developmental deficiencies.

[0044] As well as providing continued vasculogenesis, the methods of the present invention may additionally promote cell survival and facilitate development by expression of additional factors and regulation of additional processes. Such factors may include glycolytic enzymes that promote anaerobic energy utilization in under-vascularized, i.e., ischemic, tissues and organs; and factors that alter the redox value of a cell or tissue prematurely exposed to, e.g., normoxic and/or hyperoxic environments. For example, premature infants are particularly vulnerable to oxidative injury because they are deficient in antioxidant defenses. Therefore, the methods of the invention specifically contemplate providing cell survival in states of under-vascularization and increased oxidative load, e.g., as occurs in preterm infants exposed to normoxic and/or hyperoxic environments. The present invention further contemplates use of the methods in conjunction with or as a replacement to current treatment of preterm infants having respiratory distress syndrome using high concentrations of oxygen (hyperoxia) and/or mechanical ventilation. In particular, the present methods reduce the risk of oxidative damage that can result from such treatment. The present methods are capable of inducing cytoprotective effects that constitute an effective replacement therapy, and when used in combination with high oxygen therapies, can counteract the oxidative damage that might otherwise result.

[0045] Vascular processes encompass a series of molecular events: degradation of old and formation of new basement membrane; endothelial cell proliferation, migration, and differentation; fusion of newly formed vessels; initiation of blood flow, etc. The present invention provides methods for inducing one or more of these specific vascular processes. In particular embodiments, the present invention provides methods for selectively inducing sets or subsets of vascular factors. In one embodiment, the present invention provides methods for inducing factors that affect the rate of extracellular matrix synthesis and degradation, e.g., PAI-1, procollagens, and matrix metalloproteinases (MMPs). (See, e.g., Example 1.) In another embodiment, methods for inducing factors that affect endothelial cell proliferation, migration, and differentiation, e.g., VEGF, are provided. (See, e.g., Example 2.)

[0046] Methods for enhancing, facilitating, or increasing blood flow are provided herein. In particular, the present invention provides methods for inducing factors that stimulate vasodilation, e.g., adrenomedullin and inducible nitric oxide synthase (iNOS). (See, e.g., Example 1.) In addition to providing methods for inducing vasodilatory factors, the present invention provides methods for inducing vasoconstrictive factors, e.g., endothelin-1, angiotensin, etc., which, in appropriate balance, contribute to maintenance of blood vessel stability and function. (See, e.g., Example 1.)

[0047] Methods for providing enhanced granulation tissue formation are also provided. (See, e.g., Example 3.) Granulation tissue involves tissue remodeling and vascularization and is an important step in healing wounds and damaged tissues. The present invention also provides methods for treating chronic and acute conditions associated with vascular insufficiency. In one embodiment, the vascular insufficiency is due to atherosclerosis, formation of a thrombus, or presence of an embolus in a vein or artery. In a particular embodiment, the methods of the invention are used to treat or reduce vascular insufficiency resulting from peripheral vascular disease. (See, e.g., Example 4.) In another embodiment, the vascular insufficiency is associated with myocardial infarction, pulmonary infarction, or stroke. In a particular embodiment, the methods increase the number of myocardial arterioles and/or arteriolar surface area in ischemic heart. (See, e.g., Example 5.)

[0048] In another aspect, the methods of the present invention enhance lung performance in subjects having compromised lung function. Such individuals include preterm infants and subjects having a disorder of the lung. In various embodiments, the methods may be used to improve one or more parameters selected from the group consisting of pulmonary compliance, arterial-alveolar oxygen gradient, and oxygenation index. In a particular embodiment, the methods may be used to increase the incidence of ductus arteriosus closure. (See, e.g., Example 6.)

[0049] The present invention relates to methods for achieving coordinated induction of tissue remodeling and vascularization. In certain aspects, these processes result in collateral blood vessel formation. In other aspects, methods are provided for protecting tissue against ischemia, increasing blood flow to ischemic tissue by forming new blood vessels, and promoting long-term oxygen and nutrient delivery to tissues. Compounds and Medicaments

[0050] The formation of new blood vessels and remodeling of existing vasculature can mitigate tissue damage, both in premature infants due to normoxic exposure and in adults having localized ichemia. The methods of the present invention have potential benefit for the treatment of frank ischemia and vascular insufficiency following myocardial infarct and other vascular diseases such as unstable angina, stroke, acute renal failure, and peripheral vascular disease with intermittent claudication. Stabilization of HIFα! and activation of HIF transcriptional activities can provide coordinated induction of tissue remodeling and vascularization. Inhibition of EGLN and FIH enzyme activities, and more broadly inhibiting 2-oxoglutarate dioxygenase enzyme activities, can modulate extracellular matrix formation while promoting tissue growth and vascularization, resulting in substantial recovery of tissue structure and function.

[0051] Compounds for use in the present methods reduce or otherwise modulate the activity of one or more 2-oxoglutarate dioxygenase enzymes, which generally hydroxylate amino acid residues. Hydroxylation of proline residues is specifically contemplated, although hydroxylation of other amino acids, such as, for example, lysine and/or asparagine, etc., is also encompassed herein. Compounds that can be used in the methods of the invention include, for example, iron chelators, 2-oxoglutarate mimetics, and modified amino acid, e.g., proline, analogs.

[0052] In particular embodiments, the present invention provides for use of structural mimetics of 2-oxoglutarate in the described methods. Such compounds may inhibit the target 2-oxoglutarate dioxygenase enzyme competitively with respect to 2-oxoglutarate and noncompetitively with respect to iron. (Majamaa et al. (1984) Eur J Biochem 138:239-245; and Majamaa et al. (1985) Biochem J 229:127-133.) Compounds specifically contemplated for use in the present methods are described, e.g., in Majamaa et al., supra; Kivirikko and Myllyharju (1998) Matrix Biol 16:357-368; Bickel et al. (1998) Hepatology 28:404-411; Friedman et al. (2000) Proc Natl Acad Sci USA 97:4736-4741; Franklin (1991) Biochem Soc Trans 19):812-815; Franklin et al. (2001) Biochem J 353:333-338; and International Publication No. WO 03/049686, each of which is incorporated by reference herein in its entirety.

[0053] Although compounds that inhibit 2-oxoglutarate dioxygenases are encompassed by the present invention, inhibition of EGLN enzymes including EGLN-1, EGLN-2, EGLN-3, and various isoforms thereof, are particularly included. Inhibition of EGLN enzymes result in HIF stabilization, which leads to transcriptional increase in vasculogenic and arteriogenic genes, such as VEGF (Warnecke, FASEB J, 2003; Vincent, Trends Cardiovasc Med 2002). Members of the Egl-Nine (EGLN) family were described by Taylor (2001, Gene 275:125- 132), and further characterized by Aravind and Koonin (2001, Genome Biol 2:RESEARCH0007), Epstein et al. (2001, Cell 107:43-54), and Bruick and McKnight (2001, Science 294: 1337-1340). Specific examples of EGLN, in the context of the present invention, include human SM-20 (EGLN1) (GenBank Accession No. AAG33965; Dupuy et al. (2000) Genomics 69:348-54), EGLN2 isoform 1 (GenBank Accession No. CAC42510; Taylor, supra), EGLN2 isoform 2 (GenBank Accession No. NP_060025), and EGLN3 (GenBank Accession No. CAC42511; Taylor, supra); mouse EGLN1 (GenBank Accession No. CAC42515), EGLN2 (GenBank Accession No. CAC42511), and EGLN3 (SM-20) (GenBank Accession No. CAC42517); and rat SM-20 (GenBank Accession No. AAA19321). Additionally, EGLN may include Caenorhabditis elegans EGL-9 (GenBank Accession No. AAD56365) and Drosophila melanogaster CGI 114 gene product (GenBank Accession No. AAF52050). EGLN also includes any fragment of the foregoing full-length proteins that retain at least one structural or functional characteristic, specifically the ability to hydroxylate a proline residue in the HIFα! protein. Preferably, the proline residue hydroxylated by EGLN includes the proline found within the motif LXXLAP, e.g., as occurs in the human HIF-lα! native sequence at L₃₉₇TLLAP and L₅₅₉EMLAP.

[0054] Therefore, in specific embodiments, the compounds inhibit activity of a 2- oxoglutarate dioxygenase selected from the group consisting of EGLN-1, EGLN-2, and EGLN-3. As the primary function of these enzymes is to de-stabilize and inactivate the HIF transcription factor, the present invention contemplates stabilization of HIFα; to achieve the primary vasculogenic effects described herein. Such stabilization may be achieved, e.g., by providing stable HIFα! constructs, however such a method may require providing one or more stable forms of HIF-lας HIF-2α; and/or HEF-3α:. The use of a compound that reduces activity of EGLN-1, EGLN-2, and/or EGLN-3 achieves stabilization of HIFα; in a simpler and more controlled manner, and is therefore specifically provided for use in the present methods.

[0055] Exemplary compounds according to the present invention include [(7-chloro-3- hydroxy-quinoline-2-carbonyl)-amino]-acetic acid (compound A), [(l-chloro-4-hydroxy- isoquinoline-3-carbonyl)-amino] -acetic acid (compound B), 4-oxo-l,4-dihydro- [l,10]phenanthroline-3-carboxylic acid (compound C), [(3-hydroxy-6-isopropoxy-quinoline- 2-carbonyl)-amino] -acetic acid (compound D), [(l-bromo-4-hydroxy-7-trifluoromethyl- isoquinoline-3-carbonyl)-amino] -acetic acid (compound E), 4-hydroxy-5-methoxy- [l,10]phenanthroline-3-carboxylic acid ethyl ester (compound F), and [(7-chloro-3-hydroxy- quinolme-2-carbonyl)-amino]-acetic acid, sodium salt (compound G), as described in the Examples, infra, although the use of any of the above-described and other compounds is clearly contemplated.

[0056] In one aspect, a compound of the invention that shows inhibitory activity toward one or more 2-oxoglutarate dioxygenase enzyme may also show inhibitory activity toward one or more additional 2-oxoglutarate dioxygenase enzymes, e.g., a compound that inhibits the activity of a HIF hydroxylase may additionally inhibit the activity of a collagen prolyl hydroyxlase, a compound that inhibits the activity of a HIF prolyl hydroylxase may additionally inhibit the activity of a HIF asparaginyl hydroylxase, etc.

[0057] Compounds may be used in the formulation of a medicament, wherein the compound is combined with other materials, which may include, but are not limited to, carriers, excipients, and solvents. Pharmaceutically acceptable excipients are available in the art, and include those listed in various pharmacopoeias. (See, e.g., the U.S. Pharmacopeia (USP), Japanese Pharmacopoeia (JP), European Pharmacopoeia (EP), and British pharmacopeia (BP); the U.S. Food and Drug Administration (www.fda.gov) Center for Drug Evaluation and Research (CEDR) publications, e.g., Inactive Ingredient Guide (1996); Ash and Ash, Eds. (2002) Handbook of Pharmaceutical Additives, Synapse Information Resources, Inc., Endicott NY; etc.) Additionally, the active compound for purposes of the methods herein may be combined with one or more additional therapeutic agents.

[0058] These and other embodiments of the present invention will readily occur to those of ordinary skill in the art in view of the disclosure herein.

EXAMPLES

[0059] The invention is understood by reference to the following examples, which are intended to be purely exemplary of the invention. The present invention is not limited in scope by the exemplified embodiments, which are intended as illustrations of single aspects of the invention only. Any methods that are functionally equivalent are within the scope of the invention. Various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications fall -within the scope of the appended claims.

Example 1: Expression of genes encoding vascular factors

[0060] To measure primary gene induction in response to the present methods, Swiss

Webster male mice (30-32 g; Simonsen, Inc., Gilroy CA) were treated by oral gavage with either 0.5% carboxymethyl cellulose (CMC; Sigma-Aldrich, St. Louis MO) (0 mg/kg) or 100 mg/kg compound B. At 4, 8, 16, 24, 48, or 72 hours after treatment, animals were anesthetized with isoflurane, sacrificed, and tissue samples of kidney, liver, brain, lung, and heart were isolated and stored in RNALATER solution (Ambion Inc., Austin TX) at -80°C.

[0061] RNA isolation was carried out using the following protocol. A 50 mg section of each organ was diced, 875 μl of RLT buffer (RNEASY kit; Qiagen Inc., Valencia CA) was added, and the pieces were homogenized for about 20 seconds using a rotor-stator POLYTRON homogenizer ( inematica, Inc., Cincinnati OH). The homogenate was micro-centrifuged for 3 minutes to pellet insoluble material, the supernatant was transferred to a new tube and RNA was isolated using an RNEASY kit (Qiagen) according to the manufacturer's instructions. The RNA was eluted into 80μL of water and quantitated with RIBOGREEN reagent (Molecular Probes, Eugene OR). Genomic DNA was then removed from the RNA using a DNA-FREE kit (Ambion) according to the manufacturer's instructions. The absorbance at 260 and 280 nm was measured to determine RNA purity and concentration,

[0062] Alternatively, tissue samples were diced and homogenized in TRIZOL reagent (Invitrogen Life Technologies, Carlsbad CA) using a rotor-stator POLYTRON homogenizer (Kinematica). Homogenates were brought to room temperature, 0.2 volumes chloroform was added, and samples were mixed vigorously. Mixtures were incubated at room temperature for several minutes and then were centrifuged at 12,000g for 15 min at 4°C. The aqueous phase was collected and 0.5 volumes of isopropanol were added. Samples were mixed, incubated at room temperature for 10 minutes, and centrifuged for 10 min at 12,000g at 4°C. The supernatant was removed and the pellet was washed with 75% EtOH and centrifuged at 7,500g for 5 min at 4°C. Genomic DNA was then removed from the RNA using a DNA- FREE kit (Ambion Inc., Austin TX) according to the manufacturer's instructions. The absorbance at 260 and 280 nm was measured to determine RNA purity and concentration.

[0063] RNA was precipitated in 0.3 M sodium acetate (pH 5.2), 50 ng/ l glycogen, and 2.5 volumes of ethanol for one hour at -20°C. Samples were centrifuged and pellets were washed with cold 80% ethanol, dried, and resuspend in water. Double stranded cDNA was synthesized using a T7-(dT)24 first strand primer (Affymetrix, Inc., Santa Clara CA) and the SUPERSCRIPT CHOICE system (Invitrogen) according to the manufacturer's instructions. The final cDNA was extracted with an equal volume of 25:24:1 phenol:chloroform:isoamyl alcohol using a PHASE LOCK GEL insert (Brinkman, Inc., Westbury NY). The aqueous phase was collected and cDNA was precipitated using 0.5 volumes of 7.5 M ammonium acetate and 2.5 volumes of ethanol. Alternatively, cDNA was purified using the GENECHIP sample cleanup module (Affymetrix) according to the manufacturer's instructions.

[0064] Biotin-labeled cRNA was synthesized from the cDNA in an in vitro translation (IVT) reaction using a BIO ARRAY HighYield RNA transcript labeling kit (Enzo Diagnostics, Inc., Farmingdale NY) according to the manufacturer's instructions. Final labeled product was purified and fragmented using the GENECHIP sample cleanup module (Affymetrix) according to the manufacturer's instructions.

[0065] Hybridization cocktail was prepared by bringing 5 μg probe to 100 μl in lx hybridization buffer (100 mM MES, 1 M [Na+], 20 mM EDTA, 0.01% Tween 20), 100 μg/ml herring sperm DNA, 500 μg/ml acetylated BSA, 0.03 nM contol oligo B2 (Affymetrix), and lx GENECHIP eukaryotic hybridization control (Affymetrix). The cocktail was sequentially incubated at 99°C for 5 minutes and 45°C for 5 minutes, and then centrifuged for 5 minutes. The Murine genome U74AV2 array (MG-U74Av2; Affymetrix) was brought to room temperature and then prehybridized with lx hybridization buffer at 45 °C for 10 minutes with rotation. The buffer was then replaced with 80 μ\ hybridization cocktail and the array was hybridized for 16 hours at 45°C at 60 rpm with counter balance. Following hybridization, arrays were washed once with 6x SSPE, 0.1% Tween 20, and then washed and stained using R-phycoerythrin-conjugated streptavidin (Molecular Probes, Eugene OR), goat anti- streptavidin antibody (Vector Laboratories, Burlingame CA), and a GENECHIP Fluidics Station 400 instrument (Affymetrix) according to the manufacturer's micro_lvl protocol (Affymetrix). Arrays were analyzed using a GENEARRAY scanner (Affymetrix) and Microarray Suite software (Affymetrix).

[0066] The Murine Genome U74AV2 array (Affymetrix) represents all sequences (-6,000) in Mouse UniGene database build 74 (National Center for Biotechnology Information, Bethesda MD) that have been functionally characterized and approximately 6,000 unannotated expressed sequence tag (EST) clusters.

[0067] As seen in Figure 1, expression of genes encoding angiogenic proteins was increased in a coordinated fashion after treatment with a compound of the invention in various organs including heart (Figure 1 A) and lung (Figure IB). Transcript patterns represented in Figure 1A include VEGF-A and -C, Flt-1 /VEGF receptor-1, adrenomedullin, and angiotensin-2. Transcript patterns represented in Figure IB include VEGF-C, Flt-1/VEGF receptor-1, adrenomedullin, endothelin-1, plasminogen activator inhibitor (PAI)-1, and Cyr61. In the time course, mRNA levels peak early, then return to control levels after 24 hours. Additionally, expression of chemokines is also induced by the present methods (data not shown).

[0068] Additionally, compounds of the invention induce transcription of extracellular matrix remodeling genes. Tissue remodeling is mediated by regulating expression and activity of enzymes involved in synthesis and degradation of extracellular matrix, and by controlled deposition of extracellular matrix components. Tissue remodeling is a critical element of developmental vascularization and neovascularization, and is induced in response to various stimuli including hypoxia, ischemia, hypertension, etc.

[0069] As shown in Table 1, expression of extracellular matrix remodeling components including elastin (Eln); macrophage elastase (Mmpl4); and collagen type I and type HI are consistently and highly induced by the present methods.

Table 1. Regulation of Tissue Remodeling Transcripts in Mouse Lung

*Fold change vs. controls

[0070] Thus, the methods of the present invention can be used to regulate tissue remodeling by regulation of transcription of extracellular matrix components and of genes regulating the degradation and synthesis of these components. [0071] Expression was also confirmed by select measurement of vascular factors, plasminogen activator inhibitor (PAI)-1, involved, e.g., in arterial wound healing, and inducible nitric oxide synthase (iNOS), involved, e.g., in nitric oxide production and vasodilation, by quantitative PCR. (See, e.g., Carmeliet et al. (1997) Circulation 96:3180- 3191; Nakanishi et al. (2000) Lung 178:137-148.) cDNA synthesis was performed using 1 μM random hexamer primers, 1 μg of total RNA isolated as above, and OMNISCRDPT reverse transcriptase (Qiagen), according to the manufacturer's instructions. Resulting cDNA was diluted 5-fold with water to give 100 μL final volume. Analysis of the relative level of gene expression was performed by quantitative PCR using a FASTSTART DNA MASTER SYBR GREEN I kit (Roche) and gene-specific primers, using a LIGHTCYCLER system (Roche), according to manufacturer's instructions. Samples were heated to 94°C for 6 minutes and then cycled through 95 °C for 15 seconds, 60°C for 5 seconds, and 72°C for 10 seconds for a total of 42 cycles.

[0072] For qPCR of the PAI-1 transcript, the specific primers were as follows: mPAH-Fl GGCAACGGATAGACAGAT mPAH-Rl CGACTTTTCTTACACCCTTTC

[0073] For qPCR of iNOS transcript, the specific primers were as follows: m-iNOS-F2 CCCAGGAGGAGAGAGATCCGATT m-iNOS-R2 AGGTCCCTGGCTAGTGCTTCAGA

[0074] The relative level of 18S ribosomal RNA gene expression was measured as a control. Quantitative PCR was performed using a QUANTITECT SYBR GREEN PCR kit (Qiagen) and gene-specific primers, using a LIGHTCYCLER system (Roche), according to manufacturer's instructions using the cycling protocol described above. Ribosomal RNA- specific primers were as follows: 18S-mouse-3A CGTAGTTCCGACCATAAACGATGC 18S-mouse-3B TCAGCTTTGCAACCATACTCCCC

[0075] Each PCR run included a standard curve and water blank. In addition, a melt curve was run after completion of each PCR run to assess the specificity of the amplification. PAI-1 and iNOS gene expression were normalized relative to the expression level of 18S ribosomal RNA for that sample

[0076] Figure 2A shows PAI-1 expression by qPCR and by array analysis. As can be seen in the Figure, PAI-1 expression follows a similar pattern by both analytical methods, and was increased in response to treatment with compound. As shown in Figure 2B, expression of iNOS increased within 8 hours following treatment with compounds of the present invention, and then returned to control levels thereafter. Further, the induction of iNOS was dose- dependent, which was achieved with two different compounds, compound C and compound

B. These two compounds are exemplary of two different pharmacophores, a phenanthroline derivative and a heterocyclic carboxamide, that can be used in the present methods. These results indicate that the methods of the present invention increase expression of vascular factors, including PAI-1 and iNOS. Therefore, compounds and methods of the present invention are useful for inducing processes associated with blood vessel formation including vasculogenesis and neovascularization.

Example 2: Induction of vascular factors

[0077] Human cells, e.g., adenovirus-transformed fetal kidney epithelium (293A), hepatocellular carcinoma (Hep3B), human foreskin fϊbroblast (HFF), human lung microvascular endothelial cells (HLMVEC), human lung adenocarcinoma cells (A549), squamous cell carcinoma (SCC)-25, and human lung frbroblast (HLF) (see, e.g., American Type Culture Collection, Manassas VA; and Qbiogene, Carlsbad CA) were separately seeded into culture dishes and grown at 37°C, 20% O₂, 5% CO₂ in media as follows: 293A cells in DMEM, 5% FBS; Hep3B cells in Minimal Essential Medium (MEM), Earle's BSS (Mediatech Inc., Herndon VA), 2mM L-glutamine, O.lmM non-essential amino acids, 1 mM sodium pyruvate, 10% FBS; HFF and HLF cells in Dulbecco's Modification of Eagle's Medium (DMEM), 10% fetal bovine serum (FBS); and HLMVEC in RPMI 1640, 10% FBS. When cell layers reached confluence, the media was replaced with OPTI-MEM media (Invitrogen Life Technologies, Carlsbad CA) and cell layers were incubated for in 20% O₂, 5% CO₂ at 37°C. Compound or DMSO (0.5 to 1%) was then added to existing medium, and incubation was continued. Conditioned media was collected and analyzed for VEGF using a QUANTD INE immunoassay (R&D Systems, Inc., Minneapolis MN) according to the manufacturer's instructions.

[0078] As shown in Figure 3 A, HFF and 293A treated with one of compound B, compound

C, or compound D showed an increase in VEGF expression. Values on the y-axis represent fold-induction relative to control and are reported on a log2 scale, such that a value of 1 represents 2-fold induction. Figure 3B shows that additional cell types are also competent to respond to the present methods to express vascular factors, e.g., VEGF. Similarly, as shown in Figure 4, HLMVEC and A549 cells produce VEGF upon stimulation with compounds of the invention. Similar results were seen with both adult and fetal HLMVECs. Example 3: Enhanced Granulation Tissue Formation in Chronic Wounds

[0079] The ability to treat chronic wounds utilized the rabbit cutaneous hyperfrophic scarring model described in Morris et al. (1997, Plast Reconstr Surg 100:674-681) and Marcus et al. (2000, Plast Reconstr Surg 105: 1591-1599). Briefly, female New Zealand White rabbits (n=12; 3-6 months of age) were anesthetized and four, 7-mm dermal ulcer wounds were created on the ventral surface of each ear with removal of the perichondrium. Wounds were treated and covered with TEGADERM semi-occlusive polyurethane dressing (3M Health Care, St. Paul MN). Wounds were treated by topical application of 0.5% or 1% (w/v) compound F in an aqueous 0.5% (w/v) CARBOPOL 971 PNF gel (pH 6.5; Noveon Inc., Cleveland OH) once per day for the first week. When tested in vitro, gels released 50% of the drug within 2 hrs and 95% of the drug within 4 hrs. The treatment ear received either a low- dose treatment (0.5% compound) or a high dose treatment (1% compound), while the control ear received gel alone. Treatment delivery was facilitated by creating a hole in the dressing applied at the time of wounding to prevent irritation of the area surrounding the wound by daily removal of dressing. The hole was then covered by a smaller piece of dressing to prevent wound desiccation. Wounds with obvious desiccation or infection were excluded from the study.

[0080] At post-wounding days 7 and 12, wounds were harvested, bisected, and stained with hemotoxylin-eosin for evaluation of granulation tissue formation and wound epithelialization. Observers blinded to treatment quantitated wound healing parameters in histological sections by the use of a graduated eyepiece reticle. Data were analyzed using the Student's t-test to compare treated and untreated samples. A P<0.05 was considered significant.

[0081] The wounds were evaluated for granulation tissue formation and wound epithelialization; parameters of wound healing that are sensitive ischemia and hypoxia. (Corral et al. (1999) Arch Surg 134:200-205; and Ahn and Mustoe (1990) Ann Plast Surg 24: 17-23.) As shown in Figure 5 A, an increase in granulation tissue area was seen in treated wounds relative to untreated wounds. As can be seen in Figure 5B, there was no difference in the peak-to-peak distance in treated versus untreated animals. The peak-to-peak value is an indicator of wound coverage by granulation tissue. Thus, the methods of the invention can be used to increase vascularization and granulation tissue formation in wounds, such as chronic wounds and ulcers.

Example 4: Enhanced Blood Flow in Peripheral Ischemia

[0082] Peripheral artery disease is common in the aging population. Stages of the disease range from intermittent claudication resulting in exercise intolerance to critical limb ischemia ultimately leading to amputation. The methods of the present invention were used in animal models of peripheral ischemia to demonstrate enhanced recovery of blood flow. Twenty-four male Sprague Dawley Rats (300-325g; Charles River Laboratories, Inc., Wilmington MA) were subjected to left femoral artery ligation with 3-0 surgical silk at a point 0.5 cm proximal to the bifurcation to the saphenous and popliteal arteries. Animals were then orally administered either vehicle control, 15 mg/kg compound E, or 50 mg/kg compound E for 21 days.

[0083] Immediately following ligation, regional blood flow to skeletal muscle in both ischemic and normal hind limbs was measured using fluorescent microspheres. Under general anesthesia, a microsphere solution (2.0 ml/kg, lxlO⁶ beads/ml solution, yellow-green 493/506) was injected into the left ventricle via a PE-50 catheter advanced from the left common carotid artery. The solution was injected at a constant rate for one minute and was then flushed with 0.5ml of 0.9% saline. After 21 days, animals received a second injection of microspheres (2.0 ml/kg, lxlO⁶ beads/ml solution, orange 530/545). To image blood flow, animals were anesthetized with isoflurane, placed on a warm water blanket for temperature control, and hair was removed with a depilatory creme. Animals were then imaged in dorsal recumbency using the PERISCAN PIM II perfusion imager (Perimed AB, Stockholm, Sweden). Mean intensity (measure of flow) for each limb from mid-tibia down was determined using image analysis software (Perimed).

[0084] Blood samples were then collected, animals were sacrificed, and tissue samples were taken and stored. CBC analysis was performed on the Cell-Dyn 3700 blood analyzer (Abbott Laboratories, Abbott Park IL) according to manufacturer's instructions.

[0085] As measured by laser doppler perfusion image analysis, perfusion in the ischemic limb of vehicle-treated animals was reduced by 28% relative to non-ischemic limb. In animals treated with compound, perfusion in the ischemic limb was reduced only 8% relative to non-ischemic limb, a statistically significant difference (p< 0.01) from vehicle control animals. No difference in blood flow was seen in non-ischemic limbs between vehicle control and compound treated groups. Thus, the methods of the invention improved blood flow in the ischemic limb, potentially inducing angiogenesis and collateral blood vessel formation. Further, angiogenesis was limited to the ischemic limb, as there was no difference in flow in the non-ischemic limb between any of the groups. This suggests the methods of the invention may be synergistic with and augment tissue response to hypoxia. [0086] Vascular improvement, increased vascular density, and therapeutic tissue remodeling and neovascularization can also be demonstrated as follows. Muscle tissues obtained from ischemic and non-ischemic animals treated as above are processed to determine embedded microsphere level, which correlates with capillary density. Tissues are weighed, vortexed in ethanolic potassium hydroxide, and incubated at 50°C with agitation for 48 h with a single 20 sec vortex at 24 h. Samples are then vortexed for 30 sec and centrifuged for 20 min at 2000xg. The pellet is resuspended in 1% Triton X-100, mixed for 30 sec, and recentrifuged, and then the pellets are washed in phosphate buffer. Final pellets are resuspended in 2- ethoxyethyl acetate and incubated at room temperature in the dark for 5 days. Samples are then mixed, centrifuged, and the resulting supernatant is analyzed by flourimetry. Fluorescence values of both dyes are recorded for ischemic and non-ischemic limbs, and the result is expressed as a ratio of the ischemic limb to non-ischemic limb, standardized by weight of tissue. Additionally, the ratio of fluorescence values for the two distinct dyes in the hind limb represents the angiogenic effect of treatment in the ischemic hind limb.

Example 5: Enhanced Neovascularization following Myocardial Infarction

[0087] Acute ischemia leads to an infarct and a penumbra of compromised cells around the infarct. Maintenance of the viability of cells in the penumbra requires rapid cellular response including tissue remodeling and neovascularization to restore blood flow. To demonstrate enhanced recovery of blood flow following acute ischemia, the methods of the present invention were used in animal models of myocardial infarction. Adult 6 to 8-week-old male C57BL/6 mice were subjected to myocardial infarction and subsequently maintained in 10% atmospheric oxygen for 48 hours. Animals were administered saline control or compound B daily by intraperitoneal injection for a period of 3 weeks.

[0088] Treatment using methods of the invention increased heart weight relative to body weight following myocardial infarction. The increased heart weight was associated with a statistically significant (p<0.01) increase in the number of arterioles in the left ventricular myocardium in compound-treated animals (9.49 ± 0.9) relative to saline-treated confrols (6.36 ± 0.53). The average area of the ten largest arterioles in left ventricular myocardium was also significantly higher in the compound-treated group (p<0.05). Additionally, there was a statistically significant (p<0.01) increase in the number of capillaries in the myocardium of compound-treated animals (393 ± 40) relative to saline-treated controls (285 ± 27). As seen in the limb ischemia model (Example 4), no significant difference was seen in the number of arterioles in a non-affected organ, e.g., the cerebral cortex, in compound-treated versus saline- treated animals. [0089] The results demonstrate that methods of the present invention increase the number of arterioles and capillaries in ischemic myocardium, which corresponds to a beneficial effect on both arteriole and microvascular density. Thus, the methods of the invention are useful in treating conditions associated with acute ischemia by improving vascularization to damaged tissues.

Example 6: Improved Pulmonary Compliance in Lung

[0090] The lungs of preterm infants are characterized by vascular and alveolar hypoplasia. Similarly, lung disorders, such as bronchopulmonary dysplasia (BPD) and chronic obstructive pulmonary disorder (COPD) either occur due to or lead to similar reduction in vascular and alveolar tissue. The use of the present methods to augment tissue growth and vascularization of underdeveloped or damaged tissue, e.g., lung, was demonstrated as follows.

[0091] Methods and materials were generally as described in (146). Neonatal baboons at gestational day 125 and 21 day pro re nata (PRN) oxygen were twice administered intravenous infusion of 5 mg/kg compound X over 2 hours from a 4 mg compound/ml D5W solution, with infusion starting approximately 2 and 72 hours post-delivery. Mean arterial blood pressure was monitored subsequent to each infusion. At age 120 hours, administration of compound by continuous intravenous drip at 0.6 mg/kg/hour was initiated. Blood samples were collected every 12 hours, i.e., at approximate age 132, 144, 156, and 168 hours, and plasma compound level was measured using liquid chromatography/mass spectrometry in the positive ion mode with selective ion monitoring for the mass of the compound. Compound was administered for a total of 21 days with daily blood sampling. Gas exchange was monitored throughout the treatment period, and pulmonary function was measured on day 7 and 21 using a VT1000 plethysmograph and methods described in (146). Total compliance and resistance of the respiratory system was measured, and tidal volume (VT; corrected for birth weight) and C_dyn (dynamic compliance, corrected for birth weight and measured VT) were determined using at least 10 breaths. Inspired oxygen tension (FiO₂) and pulmonary mechanics including peak airway pressure, PEEP, mean airway pressure, and inspiratory time were recorded continuously. Arterial blood gas (ρO₂, pCO₂), pH, and HCO₃ level were also routinely measured and recorded. Oxygen index was calculated as FiO₂ x mean airway pressure x 100/paO₂, as described in (147).

[0092] At day 21, animals were sacrificed and tissues were collected for biochemical, immunohistochemical, histopathologic, and morphometric analysis. Vascular and alveolar growth are measured morphometrically and lung water is assessed by lung wet/dry weight at time of necropsy. Point and intercept counting is done to determine absolute volume and surface area of alveolar tissue and thickness of alveolar septum (144, 148). Standard morphometric technique are also used to quantitate mean alveolar diameter and linear intercept. Pulmonary vascular development is assessed by quantitative PECAM staining as used previously in the model (7). In addition, differential lectin binding of macro- and microvascular endothelial cells may be used to differentially measure developing macro- and microvasculature. Eyes, brain, and other tissues may also be collected, fixed and stored for subsequent histopathologic examination of, e.g., retinae, to demonstrate therapeutic benefit of the present methods.

[0093] Animals treated using the methods of the present invention showed improved pulmonary compliance, arterial-alveolar oxygen gradient (treated 83.8 ± 12.7 vs. control 120.6 ± 7.7, p <0.01), and oxygenation index (treated 4.0±0.2 vs. control 5.0±0.3, p <0.01). Treatment was also associated with increased incidence of ductus arteriosus closure. Further, treatment using the present methods did not alter ventilation index or pressure-volume curve. These results demonstrate that the methods of the invention can be used to enhance vascularization, pulmonary compliance, and continued or reparative lung growth in various conditions and disorders, such as evolving BPD.

[0094] Various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.

[0095] All references cited herein are hereby incorporated by reference in their entirety.

Claims

What is claimed is:

1. Use of an agent that stabilizes the alpha subunit of hypoxia inducible factor (HIFα!) to coordinately induce tissue remodeling and vascularization in a subject.

2. Use of an agent that stabilizes HIFα in the formulation of a medicament for coordinate induction of tissue remodeling and vascularization in a subject.

3. Use of an agent that stabilizes HIFo; to induce vascular development in a subject.

4. Use of an agent that stabilizes HIFα! in the formulation of a medicament to induce vascular development in a subject.

5. The use of any of claims 1 to 4, wherein the agent inhibits the activity of an enzyme selected from EGLN-1, EGLN-2, EGLN-3, and active fragments thereof.

6. The use of any of claims 1 to 5, wherein the agent increases capillary density.

7. The use of any of claims 1 to 5, wherein the agent increases formation of collateral blood vessels.

8. The use of any of claims 1 to 7, wherein the agent increases blood flow to an organ or tissue.

9. Use of an agent that stabilizes HIFα for treating or reducing pulmonary insufficiency in a subject.

10. Use of an agent that stabilizes HIFα in the formulation of a medicament for treating or reducing pulmonary insufficiency in a subject.

11. The use of claims 9 or 10, wherein the agent inhibits the activity of an enzyme selected from EGLN-1, EGLN-2, EGLN-3, and active fragments thereof.

12. The use of any of claims 1 to 11, wherein the agent improves a measure of pulmonary function selected from the group consisting of pulmonary compliance, arterial-alveolar oxygen gradient, and oxygenation index.

13. The use of any of claims 1 to 12, wherein the subject is a preterm infant having or at risk for having a vascular disorder.

14. The use of claim 13, wherein the vascular disorder is selected from the group consisting of bronchopulmonary dysplasia (BPD), intraventricular hemorrhage, chronic heart disease, and necrotizing enterocolitis.

15. The use of claim 13, wherein the vascular disorder is associated with premature exposure to a normoxic or hyperoxic environment.

16. The use of claim 13 or 15, wherein the vascular disorder is in an organ selected from the group consisting of lung, liver, kidney, brain, eye, skin, and heart

17. The use of any of claims 1 to 12, wherein the subject has or is at risk for having a condition selected from the group consisting of atherosclerosis, diabetes, hypertension, congestive heart disease, and peripheral vascular disease.

18. The use of any one of claims 1 to 17, wherein the agent additionally inhibits the activity of one or more enzymes selected from the group consisting of procollagen lysyl hydroxylase, procollagen prolyl 3 -hydroxylase, procollagen prolyl 4-hydroxylase, and factor inhibiting HIF.

19. The use of any one of claims 1 to 17, wherein the agent additionally inhibits the activity of FIH.

20. The use of any one of claims 1 to 17, wherein the agent inhibits hydroxylation of one or more amino acid residues of HIFα.

21. The use of claim 20, wherein the hydroxylation occurs on an amino acid residue selected from the group consisting of proline and asparagine.

22. The use of any of claims 1 to 21, wherein the agent is a compound selected from the group consisting of iron chelators, 2-oxoglutarate mimetics, and proline analogs.

23. The use of claim 22, wherein the iron chelator is a substituted or unsubstituted phenanthroline.

4. The use of claim 22, wherein the 2-oxoglutarate mimetic is a substituted or unsubstituted heterocyclic carboxamide.