ES2340879T3 - Proteinas fosfatasas realacionadas con el estres y metodos de utilizacion en plantas. - Google Patents

Proteinas fosfatasas realacionadas con el estres y metodos de utilizacion en plantas. Download PDF

Info

Publication number
ES2340879T3
ES2340879T3 ES07017995T ES07017995T ES2340879T3 ES 2340879 T3 ES2340879 T3 ES 2340879T3 ES 07017995 T ES07017995 T ES 07017995T ES 07017995 T ES07017995 T ES 07017995T ES 2340879 T3 ES2340879 T3 ES 2340879T3
Authority
ES
Spain
Prior art keywords
ester
phsrp
nucleic acid
plant
gt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
ES07017995T
Other languages
English (en)
Inventor
Hans J. Bohnert
Ruoying Chen
Oswaldo Da Costa E Silva
Manabu Ishitani
Nocha Van Thielen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF Plant Science GmbH
Original Assignee
BASF Plant Science GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US19600100P priority Critical
Priority to US196001P priority
Application filed by BASF Plant Science GmbH filed Critical BASF Plant Science GmbH
Application granted granted Critical
Publication of ES2340879T3 publication Critical patent/ES2340879T3/es
Application status is Active legal-status Critical
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8217Gene switch
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)

Abstract

Una célula de una planta transgénica transformada por ácido nucleico que codifica una Proteína Fosfatasa Relacionada con el Estrés (PHSRP) el cual es Proteína Fosfatasa 2A-2, en donde la expresión del ácido nucleico en la célula de la planta resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de la célula de la planta de tipo silvestre, en donde la PHSRP es una PP2A-2 como se define en la SEQ ID NO: 11 o secuencias que son al menos aproximadamente 50 - 60% idénticas a la secuencia entera de aminoácidos mostrada en la SEQ ID NO:11.

Description

Proteínas fosfatasas relacionadas con el estrés y métodos de utilización en plantas.

Antecedentes de la invención Campo de la invención

Esta invención se relaciona generalmente con secuencias de ácido nucleico que codifican proteínas que están asociadas con respuestas al estrés abiótico y tolerancia al estrés abiótico en plantas. En particular, esta invención se relaciona con secuencias de ácido nucleico que codifican proteínas que le confieren a las plantas tolerancia a la sequía y/o a la temperatura.

Estado del arte

Los estreses ambientales abióticos, tales como el estrés por sequía, el estrés por salinidad, el estrés por calor, y el estrés por frío, son los principales factores limitantes del crecimiento y la productividad de la planta. Las pérdidas de cultivos y las pérdidas de rendimiento de la mayoría de los cultivos tales como arroz, maíz y trigo provocadas por estos estreses representan un factor económico y político significativo y contribuyen a la escasez de alimentos en muchos países no desarrollados.

Las plantas están típicamente expuestas durante su ciclo de vida a condiciones de un contenido reducido de agua en el medio ambiente. La mayoría de las plantas tienen estrategias evolucionadas para protegerse contras estas condiciones de desecación. Sin embargo, si la severidad y la duración de las condiciones de sequía son muy grandes, los efectos sobre el desarrollo, crecimiento y rendimiento de la mayoría de las plantas son profundos. Además, la mayoría de las plantas de cultivo son muy susceptibles a altas concentraciones de sal en el suelo. La exposición continua a la sequía y a altas concentraciones de sal provoca alteraciones importantes en el metabolismo de las plantas. Estos grandes cambios en el metabolismo

\hbox{conducen en
última instancia a la muerte  celular y por consiguiente a pérdidas
en el rendimiento.}

El desarrollo de plantas tolerantes al estrés es una estrategia que tiene el potencial de resolver o de mediar al menos algunos de estos problemas. Sin embargo, las estrategias tradicionales de fitomejoramiento para desarrollar nuevas líneas de plantas que exhiben resistencia (tolerancia) a esos tipos de estrés son relativamente lentas y requieren líneas resistentes específicas para cruzamiento con la línea deseada. Los recursos limitados de germoplasma para tolerancia al estrés e incompatibilidad en cruzamientos entre especies de plantas relacionadas en forma distante representan problemas significativos encontrados en la crianza tradicional. Adicionalmente, los procesos celulares que conducen a tolerancia a la sequía, al frío y a la sal en plantas modelo tolerantes a la sequía y/o a la sal son de naturaleza compleja e involucran múltiples mecanismos de adaptación celular y numerosas rutas metabólicas. Esta tolerancia al estrés de naturaleza múltiple ha hecho que la tolerancia al estrés sea no solamente poco exitosa, sino que también tiene una habilidad limitada para modificar por medio de ingeniería genética plantas tolerantes al estrés utilizando métodos biotecnológicos.

Está bien reconocido que la fosforilación reversible de proteínas controla muchos procesos celulares en plantas y animales. El estatus de la fosforilación de proteínas está regulado por las actividades opuestas de proteína quinasas y proteína fosfatasas. La fosforilación de proteína eucariota ocurre predominantemente sobre residuos de serina y treonina, y en menor grado, sobre residuos de tirosina. En animales, la fosforilación de proteína juega papeles bien conocidos en diversos procesos celulares tales como el metabolismo del glicógeno, el control del ciclo celular, y la transducción de señales (Smith, R. D. y Walker, J. C., 1996, Annu. Rev. Plant Physiol Plant Mol. Biol. 47: 101 - 125).

Las actividades de la proteína fosfatasa han sido reportadas en la mayoría de los compartimientos subcelulares de la planta, incluidos mitocondria, cloroplasto, núcleos y el citosol, y están asociadas con diferentes fracciones de membrana y de partículas. Algunas proteína fosfatasas están pobremente caracterizadas y pueden representar nuevas enzimas que son únicas para las plantas. Otras tienen propiedades bioquímicas que son muy similares a proteína fosfatasas de mamífero bien conocidas, tales como proteína serina/treonina fosfatasas citosólicas (MacKintosh C. y Cohen P. 1989 Biochem. J. 262: 335 - 339). Dos de tales serina/treonina fosfatasas de la planta se ha identificado que funcionan de manera similar a la proteína serina/treonina fosfatasas tipo 1 (PP1) y tipo 2 (PP2) de mamífero. Estudios bioquímicos y genéticos en plantas implican actividad de PP1 y/o PP2 en transducción de señales, regulación hormonal, mitosis, y control del metabolismo del carbono y del nitrógeno (Smith, R. D. y Walker, J. C., 1996, Annu. Rev. Plant Physiol Plant Mol. Biol. 47: 101 - 125).

Evidencia experimental ha implicado la participación de proteína fosfatasas en la cascada de señalización por estrés de la planta, y más particularmente, en la percepción del estrés y transducción de la señal enlazada a mecanismos fisiológicos de adaptación en plantas. Por ejemplo, la proteína fosfatasa 2C (PP2C) ha demostrado estar involucrada en respuestas al estrés en plantas (Sheen, J. 1998 Proc. Natl Acad. Sci. USA 95: 975 - 980). Se ha demostrado también que, en levadura, la PP2B fosfatasa calcineurina (CaN) es un componente central de una ruta para transducción de la señal que depende de Ca^{2+} que media la tolerancia al Na^{+}, Li^{-}, y Mn^{2+} de Saccharomyces cerevisiae (Cunningham, K. W. y Fink, G. R. 1996 Mol. Cell. Biol. 16: 2226 - 2237). CaN actúa para limitar la acumulación intracelular de Na^{+} por medio de procesos de regulación que restringen la afluencia y mejoran el eflujo de este catión a través de la membrana plasmática.

CaN también participa en homeostasis citosólica de Ca^{2+} a través de la regulación positiva del aparato de Golgi y de bombas de iones de tipo P localizadas en la membrana vacuolar y del control negativo de un intercambiador vacuolar de H^{+}/Ca^{2+}. En forma muy interesante, la sobreexpresión de CaN de levadura confiere tolerancia a la sal en las plantas, lo cual indica fuertemente que la modulación de las rutas de señalización del estrés por medio de la expresión de una proteína fosfatasa activada mejora sustancialmente la tolerancia al estrés por parte de la planta (Pardo, J. M. y colaboradores.1998 Proc. Natl. Acad. Sci. USA 95: 9681 - 9686).

Aunque algunos genes que están involucrados en respuestas al estrés en las plantas han sido caracterizados, la caracterización y clonación de genes de plantas que confieren tolerancia al estrés sigue siendo muy incompleta y fragmentada. Por ejemplo, ciertos estudios han indicado que el estrés por sequía y sal en algunas plantas puede ser debido a efectos génicos aditivos, en contraste con otra investigación que indica que genes específicos son transcripcionalmente activados en tejido vegetativo de plantas bajo condiciones de estrés osmótico. Aunque generalmente se asume que las proteínas inducidas por estrés juegan un papel en la tolerancia, se carece aún de evidencia directa, y las funciones de muchos genes sensibles al estrés son desconocidas.

Andreeva A y colaboradores, 1999 (Journal of Plant Physiology, vol. 155, no. 2, Agosto 1999, páginas 153 - 158), divulgan la detección de cuatro isoformas de Proteína Fosfatasa 2A en Physcomitrella patens. La detección se lleva a cabo utilizando reacción en cadena de la polimerasa sobre ADNc y genómico de Physcomitrella patens.

Hendershot J. D. y colaboradores, 1999 (DATABASE UniProt 1 Noviembre 1999, "subunidad reguladora B de 62 kDa de la Proteína Fosfatasa 2A" XP-002458411 recuperada del EBI, acceso no. Q9XGR4, Base de Datos con acceso no. Q9XGR4-ARATH), divulgan el suplemento regulador B de 62 kDa de la Proteína Fosfatasa 2A de Arabidopsis thaliana.

Hendrix. P. y colaboradores, 1994 (DATABASE UniProt 1 Junio 1994, "Subunidad reguladora B de 72/130 kDa de la proteína fosfatasa 2A de Serina/Treonina" XP-002458413 recuperada del EBI acceso no. G106190, Base de Datos con acceso no. P2R3A_HUMAN), divulgan el suplemento regulador B de 72/130 kDa de la Proteína Fosfatasa 2A de serina/treonina de Homo sapiens.

Por lo tanto existe la necesidad de identificar genes expresados en plantas tolerantes al estrés que tengan la capacidad para conferir resistencia al estrés a su planta hospedadora y a otra especie de planta. Las plantas tolerantes al estrés recientemente generadas tendrán muchas ventajas, tales como el de incrementar el rango en que las plantas de cultivo pueden ser cultivadas, por ejemplo, disminuyendo los requerimientos de agua de una especie de planta.

Resumen de la invención

Esta invención cumple en parte con la necesidad de identificar fosfatasas únicas nuevas capaces de conferir tolerancia al estrés a las plantas por sobreexpresión. Lo que la presente invención proporciona es una célula de una planta transgénica transformada por medio de ácido nucleico que codifica una Proteína Fosfatasa Relacionada con el Estrés (PHSRP por sus siglas en inglés), en donde la expresión de la secuencia de ácido nucleico en la célula de la planta resulta en una mayor tolerancia al estrés por sequía y/o por temperatura comparado con una variedad de tipo silvestre de la célula de la planta, en donde la PHSRP es una PP2A-2 como se define en la SEQ ID No: 11 o secuencias que son al menos 50-60% homólogas a la secuencia total del aminoácido mostrada en la SEQ ID No: 11. Particularmente, se describe aquí la proteína fosfatasa. Proteína Fosfatasa 2A-2 (PP2A-2) del Physcomitrella patens.

La invención establece en algunas modalidades que la PHSRP y el ácido nucleico codificador son aquellos encontrados en los miembros del género Physcomitrella. En otra modalidad preferida, el ácido nucleico y la proteína son de una Physcomitrella patens. La invención establece que el estrés ambiental puede ser por sequía o temperatura.

La invención proporciona además una semilla producida por una planta transgénica transformada por un ácido nucleico que codifica la PHSRP, en donde la planta es una línea genéticamente pura para mayor tolerancia al estrés por sequía y/o temperatura comparada con una variedad de la planta de tipo silvestre. La invención proporciona además una semilla producida por una planta transgénica que expresa una PHSRP, en donde la planta de línea genéticamente pura para mayor tolerancia al estrés

\hbox{por sequía y/o temperatura comparada con una variedad  de
la planta de tipo silvestre.}

La invención proporciona además un producto agrícola producido a partir de cualquiera de las plantas transgénicas descritas anteriormente, parte de la planta o semillas. La invención proporciona además una PHSRP aislada como se describe más adelante. La invención proporciona además un ácido nucleico aislado que codifica la PHSRP, en donde el ácido nucleico que codifica la PHSRP codifica para una PHSRP como se describe a continuación.

La invención proporciona además un vector de expresión recombinante aislado que comprende un ácido nucleico que codifica la PHSRP como se describe más abajo, en donde la expresión del vector en una célula huésped resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la célula huésped. La invención proporciona además una célula huésped que contiene al vector y una planta que contiene la célula huésped.

La invención proporciona además un método para la producción de una planta transgénica con un ácido nucleico que codifica la PHSRP, en donde la expresión del ácido nucleico en la planta resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta que comprende: (a) la transformación de una célula de una planta con un vector de expresión que comprende un ácido nucleico que codifica la PHSRP, y (b) la generación a partir de la célula de una planta de una planta transgénica con una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta. En una modalidad preferida, la PHSRP y el ácido nucleico que codifica la PHSRP son como se describe más abajo.

La presente descripción proporciona además un método de identificación de una nueva PHSRP, que comprende (a) elevar una respuesta específica del anticuerpo a una PHSRP, o un fragmento de la misma, como se describe más arriba; (b) la selección de material de PHSRP putativa con el anticuerpo, en donde el enlazamiento específico del anticuerpo al material indica la presencia de una PHSRP potencialmente novedosa; y (c) la identificación del material unido a una nueva PHSRP en comparación con la PHSRP conocida. Alternativamente, se puede utilizar la hibridación con sondas del ácido nucleico como se describe más abajo para identificar los ácidos nucleicos de la nueva PHSRP.

La presente invención también proporciona métodos para modificar la tolerancia al estrés por sequía y/o temperatura de una planta que comprenden, modificar la expresión de una PHSRP en la planta, en donde la PHSRP es como se describe más abajo. La invención estable que este método se puede realizar de modo que se incremente o disminuya la tolerancia al estrés. Preferiblemente, se incrementa la tolerancia al estrés en una planta a través del incremento de la expresión de una PHSRP.

Breve descripción de los dibujos

La Figura 1 muestra las secuencias parciales de ADNc de PP2A-2 (SEQ ID NO: 1) de Physcomitrella patens.

La Figura 2 muestra las secuencias de longitud completa del ADNc de PP2A-2 (SEQ ID NO: 6) de Physcomitrella patens.

La Figura 3 muestra las secuencias deducidas de aminoácidos de PP2A-2 (SEQ ID NO: 11) de Physcomitrella patens.

La Figura 4 muestra un diagrama del vector de expresión de la planta pBPSsc022 que contiene al súper promotor que se deriva de la expresión de la SEQ ID NO: 6 ("Gen Deseado"). Los componentes son: gen de resistencia a la kanamicina NPTHII (Bevan M, Nucleic Acids Res. 26: 8711 - 21, 1984), promotor AtAct2-i (An YQ y colaboradores, Plant J 10: 107 - 121, 1996), terminador OCS3 (During K, Transgenic Res. 3: 138 - 140, 1994), terminador NOSpA (Jefferson y colaboradores, EMBO J 6: 3901 - 71987).

La Figura 5 muestra los resultados de una prueba de estrés por sequía con plantas transgénicas que sobreexpresan PpPP2A-2 y líneas de Arabidopsis de tipo silvestre. Las líneas transgénicas muestran un fenotipo tolerante. Se muestran las líneas transformantes individuales.

La Figura 6 muestra los resultados de una prueba de estrés a la congelación con plantas transgénicas que sobreexpresan PpPP2A-2 y líneas de Arabidopsis de tipo silvestre. Las líneas transgénicas muestran un fenotipo tolerante. Se muestran las líneas transformantes individuales.

Descripción detallada de la invención

Obsérvese que a través de la descripción el término "homólogo" significa "idéntico".

La presente invención se puede entender más fácilmente por referencia a la siguiente descripción detallada de las modalidades preferidas de la invención y los Ejemplos incluidos aquí. También se debe entender que la terminología utilizada aquí tiene el propósito de describir modalidades específicas únicamente y no tiene la intención de ser una limitante. En particular, la designación de la secuencia de aminoácidos como proteína "Proteínas Fosfatasa Relacionadas con el Estrés" (PHSRP), de ninguna manera limita la funcionalidad de aquellas secuencias.

La presente invención proporciona una célula de una planta transgénica transformada por un ácido nucleico que codifica la PHSRP, que es la Proteína Fosfatasa 2A-2, en donde la expresión de la secuencia de ácido nucleico en la célula de la planta resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la célula de la planta, en donde la PHSRP es una PP2A-2 como se define en la SEQ ID No: 11 o secuencias que sean

\hbox{al menos 50-60%
idénticas a la secuencia completa de aminoácidos  mostrada en la SEQ
ID No: 11.}

La invención proporciona además partes de la planta transgénica y plantas transgénicas que contienen las células de la planta descritas aquí. También se proporciona una semilla de la planta producida por una planta transgénica transformada por un ácido nucleico que codifica la PHSRP, en donde la semilla contiene al ácido nucleico que codifica la PHSRP, y en donde la planta es una línea genéticamente pura para mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta. La invención proporciona además una semilla producida por una planta transgénica que expresa una PHSRP, en donde la semilla contiene la PHSRP, y en donde la planta es una línea genéticamente pura para mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta. La invención también proporciona un producto agrícola producido a partir de cualquiera de las

\hbox{plantas
transgénicas descritas anteriormente  o más adelante, partes de la
planta y semillas de la planta.}

Como se lo utiliza aquí, el término "variedad" se refiere a un grupo de plantas dentro de una especie que comparte caracteres constantes que las separa de la forma típica y de otras variedades posibles dentro de esa especie. Aunque poseen al menos un rasgo distintivo, una variedad se caracteriza también por alguna variación entre individuos dentro de la variedad, con base fundamentalmente en la segregación Mendeliana de rasgos entre la progenie de sucesivas generaciones. Una variedad se considera una "línea genéticamente pura" para un rasgo particular si es genéticamente homocigota para este rasgo al grado que, cuando la variedad de línea genéticamente pura es autopolinizada, no se observa una cantidad significativa de segregación independiente del rasgo entre la progenie. En la presente invención, el rasgo surge de la expresión transgénica de una o más secuencias del ADN introducidas en una variedad de planta.

La presente invención describe por primera vez que la PHSRP PP2A-2 de Physcomitrella patens es útil para incrementar la tolerancia de una planta al estrés por sequía y/o temperatura. La PHSRP PP2A-2 es homologa a la subunidad reguladora de la proteína fosfatasa 2A como se muestra en la Tabla 2. Por lo tanto, la presente invención incluye una célula de una planta transgénica transformada por un ácido nucleico que codifica la PHSRP, en donde la expresión de la secuencia del ácido nucleico en la célula de la planta resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la célula de la planta y en donde la PHSRP es una proteína fosfatasa 2A o un homólogo o un ortólogo de la misma.

Como se lo utiliza aquí, el término "estrés por sequía y/o temperatura" se refiere a cualquier condición de crecimiento por debajo del óptimo e incluye, pero no se limita a, condiciones por debajo del óptimo asociadas con sequía, temperatura o combinaciones de las mismas. En modalidades preferidas, el estrés por sequía puede ser bajo contenido de agua y el estrés por temperatura puede ser baja temperatura. También se debe entender que como se utiliza en la especificación y en las reivindicaciones, "un" puede significar uno o más, dependiendo del contexto en el cual es utilizado. Así, por ejemplo, la referencia a "una célula" puede significar que al menos se puede utilizar una célula.

La divulgación describe además una PHSRP aislada. La PHSRP se aísla a partir de la planta del género Physcomitrella. La PHSRP es de una planta Physcomitrella patens (P. patens). La presente invención describe por primera vez la proteína PP2A-2 predicha de P. patens (SEQ ID NO: 11) que es homóloga a la proteína fosfatasa 2A. En una modalidad preferida adicional, la PHSRP es seleccionada del grupo que consiste de PP2A-2 (SEQ ID NO: 11) y de los homólogos y ortólogos de la misma. Los

\hbox{homólogos y
ortólogos de las secuencias de aminoácidos  se definen más
abajo.}

La PHSRP preferiblemente se produce por medio de técnicas de ADN recombinante. Por ejemplo, se clona una molécula de ácido nucleico que codifica la proteína en un vector de expresión (como se describe más adelante), se introduce el vector de expresión en una célula huésped (como se describe más abajo) y la PHSRP se expresa en la célula huésped. Se puede aislar luego la PHSRP de las células por medio de un esquema apropiado de purificación utilizando técnicas estándar de purificación de proteínas. En forma alternativa a la expresión recombinante, se puede sintetizar químicamente un polipéptido de PHSRP, o un péptido utilizando técnicas estándar de síntesis de péptidos. Adicionalmente, se puede aislar la PHSRP nativa de las células (por ejemplo, Physcomitrella patens), por ejemplo utilizando un anticuerpo anti-PHSRP, que puede ser producido por medio de técnicas estándar utilizando una PHSRP o un fragmento de la misma, respectivamente.

Además de la PHSRP PP2-A-2 aislada, la invención proporciona un ácido nucleico aislado que codifica la PHSRP PP2-A-2. Como se utiliza aquí, los términos "ácido nucleico" y "molécula de ácido nucleico" tienen la intención de incluir las moléculas de ADN (por ejemplo, ADNc o ADN genómico) y moléculas de ARN (por ejemplo, ARNm) y los análogos del ADN o ARN generados utilizando los análogos del nucleótido. Este término también abarca una secuencia no traducida localizada en ambos extremos 3' y 5' de la región de codificación del gen: al menos aproximadamente 1000 nucleótidos de la secuencia, secuencia arriba del extremo 5' de la región de codificación y al menos aproximadamente 200 nucleótidos de la secuencia, secuencia abajo del extremo 3' de la región de codificación del gen. La molécula del ácido nucleico puede ser monocatenaria o bicatenaria, pero preferiblemente es ADN bicatenario.

Una molécula "aislada" de ácido nucleico es aquella que está sustancialmente separada de otras moléculas de ácido nucleico que están presentes en la fuente natural del ácido nucleico. Preferiblemente, un ácido nucleico "aislado" está libre de alguna de las secuencias que naturalmente flanquean al ácido nucleico (es decir, secuencias localizadas en los extremos 5' y 3' del ácido nucleico) en el ADN genómico del organismo del cual se deriva el ácido nucleico. Por ejemplo, en varias modalidades, la molécula aislada de ácido nucleico para PHSRP puede contener aproximadamente menos de 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0,5 kb ó 0,1 kb de las secuencias de nucleótidos que naturalmente flanquean a la molécula del ácido nucleico en el ADN genómico de la célula, a partir de la cual se deriva el ácido nucleico (por ejemplo, una célula de Physcomitrella patens). Además, una molécula "aislada" de ácido nucleico, tal como una molécula de ADNc, puede estar libre de algún otro material celular con el cual está naturalmente asociado, o medio de cultivo cuando se produce por medio de técnicas recombinantes, o precursores químicos u otros productos químicos cuando se sintetiza químicamente.

Una molécula de ácido nucleico de la presente invención, por ejemplo, una molécula de ácido nucleico que tiene una secuencia de nucleótidos de la SEQ ID NO: 6 o una porción de la misma, se puede aislar utilizando técnicas estándar de biología molecular y la información de la secuencia proporcionada aquí. Por ejemplo, se puede aislar un ADNc para PHSRP de P. patens de una genoteca de P. patens utilizando toda o una porción de la secuencia de la SEQ ID NO: 1. Además, una molécula de ácido nucleico que abarca toda o una porción de las secuencias de la SEQ ID NO: 1 se puede aislar por medio de la reacción en cadena de la polimerasa utilizando iniciadores de oligonucleótido diseñados con base en esta secuencia. Por ejemplo, se puede aislar ARNm de células de la planta (por ejemplo, por medio del procedimiento de extracción de guanidinio-tiocianato de Chirgwin y colaboradores, 1979 Biochemistry 18: 5294 - 5299) y se puede preparar ADNc utilizando transcriptasa inversa (por ejemplo, transcriptasa inversa MLV de Moloney, disponible con Gibco/BRL, Bethesda, MD; o transcriptasa inversa AMV, disponible con Seikagaku America, Inc., St. Petersburg, FL). Se pueden diseñar los iniciadores sintéticos del oligonucleótido para la reacción en cadena de amplificación de la polimerasa con base en la secuencia de nucleótidos mostrada en la SEQ ID NO: 1. Una molécula de ácido nucleico de la invención puede ser amplificada utilizando ADNc o, alternativamente, ADN genómico, como molde y los iniciadores apropiados del oligonucleótido de acuerdo con técnicas estándar de amplificación por PCR. La molécula de ácido nucleico así amplificada puede ser clonada en un vector apropiado y caracterizada por medio de un análisis de secuencia del ADN. Adicionalmente, se pueden preparar los oligonucleótidos correspondientes a una secuencia de nucleótidos para PHSRP por medio de técnicas estándar de síntesis, por ejemplo, utilizando un sintetizador automatizado de ADN.

En una modalidad preferida, una molécula de ácido nucleico aislado de la invención comprende la secuencia de nucleótidos mostrada en la SEQ ID NO: 6. Este ADNc comprende una secuencia que codifica la PHSRP (es decir, la "región de codificación", indicada en la Tabla 1), así como secuencias no traducidas 5' y secuencias no traducidas 3'. Se debe entender que la SEQ ID NO: 6 comprende tanto regiones de codificación como las regiones no traducidas 5' y 3'. Alternativamente, la molécula de ácido nucleico de la presente invención puede comprender únicamente la región de codificación de la secuencia en la SEQ ID NO: 6 o puede contener todos los fragmentos genómicos aislados a partir del ADN genómico. Una región de codificación de esta secuencia se indica como una "posición del ORF". La presente invención también

\hbox{incluye un ácido nucleico que codifica la PHSRP que 
codifica la PHSRP PP2A-2 (SEQ ID NO: 11).}

Además, la molécula de ácido nucleico puede comprender solamente una porción de la región que codifica la secuencia en la SEQ ID NO: 6, por ejemplo, un fragmento que puede ser utilizado como una sonda o iniciador o un fragmento que codifica una porción biológicamente activa de una PHSRP. Las secuencias de nucleótidos determinadas a partir de la clonación de los genes para la PHSRP de P. patens permiten la generación de sondas e iniciadores diseñados para ser utilizados en la identificación y/o clonación de homólogos de la PHSRP en otros tipos de células y organismos, así como homólogos de la PHSRP de otra especie relacionada y de musgos.

Las porciones de las proteínas codificadas por las moléculas de ácido nucleico para PHSRP de la invención son preferiblemente porciones biológicamente activas de una de las PHSRP descritas aquí. Como se lo utiliza aquí, el término "porción biológicamente activa de" una PHSRP se pretende que incluya una porción, por ejemplo, un dominio/motivo, de una PHSRP que participa en una respuesta de tolerancia al estrés en una planta, tiene una actividad como la expuesta en la Tabla 1, o participa en la transcripción de una proteína involucrada en una respuesta de tolerancia al estrés en una planta. Para determinar si una PHSRP, o una porción biológicamente activa de la misma, pueden participar en la transcripción de una proteína involucrada en una respuesta de tolerancia al estrés en una planta, se puede realizar un análisis de estrés de una planta que contiene la PHSRP. Tales métodos de análisis son bien conocidos por aquellos capacitados en el arte, como se detalla en el Ejemplo 7. Más específicamente, se pueden preparar fragmentos de ácido nucleico que codifican porciones biológicamente activas de una PHSRP por medio del aislamiento de una porción de la secuencia en la SEQ ID NO: 11, que expresa la porción codificada de la PHSRP o el péptido (por ejemplo, por medio de expresión recombinante in vitro) y evaluar la actividad de la porción codificada de la PHSRP o el péptido.

Las porciones biológicamente activas de una PHSRP incluyen péptidos que comprenden secuencias de aminoácidos derivadas de la secuencia de aminoácidos de una PHSRP, de la SEQ ID NO: 11, o de la secuencia de aminoácidos de una proteína homóloga u ortóloga a una PHSRP, que incluye menos aminoácidos que una PHSRP de longitud completa o la proteína de longitud completa que es homóloga u ortóloga a una PHSRP, y exhibe al menos la actividad de una PHSRP. Típicamente, las porciones biológicamente activas (por ejemplo, péptidos que son, por ejemplo, de 5, 10, 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 o más aminoácidos de longitud) comprenden un dominio o motivo al menos con la actividad de una PHSRP. Además, otras porciones biológicamente activas en las cuales otras regiones de la proteína se suprimen, pueden ser preparadas por medio de técnicas recombinantes y evaluadas por una o más de las actividades descritas aquí. Preferiblemente, las porciones biológicamente activas de una PHSRP incluyen uno o más dominios/motivos seleccionados o porciones de los mismos que tienen actividad biológica.

También se contemplan proteínas de fusión o quiméricas de PHSRP. Como se utiliza aquí, una "proteína quimérica" o "proteína de fusión" de PHSRP comprende un polipéptido de PHSRP operativamente enlazado a un polipéptido que no es de PHSRP. Un polipéptido de PHSRP se refiere a un polipéptido que tiene una secuencia del aminoácidos correspondiente a una PHSRP, mientras que un polipéptido que no es de PHSRP se refiere a un polipéptido que tiene una secuencia de aminoácidos correspondiente a una proteína que no es sustancialmente homóloga a la PHSRP, por ejemplo, una proteína que es diferente de la PHSRP y se deriva del mismo organismo o de uno diferente. Dentro de las proteínas de fusión, el término "operativamente enlazado" tiene por objeto indicar que el polipéptido de PHSRP y el polipéptido que no es de PHSRP están fusionados entre sí de tal manera que ambas secuencias cumplen a cabalidad la función propuesta atribuida a la secuencia utilizada. El polipéptido que no es de PHSRP se puede fusionar al terminal N o al terminal C del polipéptido de la PHSRP. Por ejemplo, en una modalidad, la proteína de fusión es una proteína de fusión GST-PHSRP en la cual las secuencias de PHSRP se fusionan al terminal C de las secuencias de GST. Tales proteínas de fusión pueden facilitar la purificación de las PHSRP recombinantes. En otra modalidad, la proteína de fusión es una PHSRP que contiene una secuencia señal heteróloga en su terminal N. En ciertas células huésped (por ejemplo, células huésped de mamífero), la expresión y/o secreción de una PHSRP se puede incrementar a través del uso de una secuencia señal heteróloga.

Preferiblemente, una proteína quimérica o de fusión de PHSRP se produce por medio de técnicas estándar de ADN recombinante. Por ejemplo, los fragmentos de ADN que codifican para las diferentes secuencias del polipéptido se ligan juntas en el marco de acuerdo con técnicas convencionales, por ejemplo empleando terminales de extremo romo o de extremo en zigzag para la unión, digestión con enzima de restricción para proporcionar los terminales apropiados, rellenando de extremos cohesivos según sea conveniente, tratamiento con fosfatasa alcalina para evitar una unión indeseable y ligación enzimática. En otra modalidad, se puede sintetizar el gen de fusión por medio de técnicas convencionales incluyendo sintetizadores automatizados de ADN. Alternativamente, se puede llevar a cabo amplificación por PCR de los fragmentos del gen utilizando iniciadores de anclaje que dan origen a salientes complementarias entre dos fragmentos consecutivos del gen que pueden posteriormente aparearse y amplificarse nuevamente para generar secuencias quiméricas del gen (ver, por ejemplo, Current Protocols in Molecular Biology, Eds. Ausubel y colaboradores. JohnWiley & Sons: 1992). Además, se encuentran disponibles muchos vectores de expresión que ya codifican una fracción de fusión (por ejemplo, un polipéptido de GST). Se puede clonar un ácido nucleico que codifica la PHSRP en dicho vector de expresión de modo que la fracción de fusión se liga en el marco a la PHSRP.

Adicionalmente de los fragmentos y las proteínas de fusión de las PHSRP descritas aquí, también están contemplados los homólogos y análogos de ocurrencia natural de las PHSRP y los ácidos nucleicos que codifican la PHSRP en una planta. Los "homólogos" se definen aquí como dos ácidos nucleicos o proteínas que tienen secuencias de aminoácidos o de nucleótidos similares, u "homólogas", respectivamente. Los homólogos incluyen variantes alélicas, ortólogos, parálogos, agonistas y antagonistas de las PHSRP como se define aquí más adelante. El término "homólogo" abarca además moléculas de ácido nucleico que difieren de la secuencia de nucleótidos mostrada en la SEQ ID NO: 6 (y porciones de la misma) debido a la degeneración del código genético y de esta manera codifican la misma PHSRP como aquella codificada por la secuencia de nucleótido mostrada en la SEQ ID NO: 6.

Un agonista de la PHSRP puede retener sustancialmente la misma, o un subconjunto, de las actividades biológicas de la PHSRP. Un antagonista de la PHSRP puede inhibir una o más de las actividades de la forma de PHSRP de ocurrencia natural. Por ejemplo, el antagonista de PHSRP puede enlazarse competitivamente a un miembro secuencia abajo o secuencia arriba de la cascada metabólica componente de la membrana celular que incluye la PHSRP, o enlazarse a una PHSRP que medie el transporte de compuestos a través de tales membranas, evitando por consiguiente la translocación del lugar de toma.

Como se utiliza aquí una PHSRP "de ocurrencia natural" se refiere a una secuencia de aminoácidos de PHSRP que se presenta en la naturaleza. Preferiblemente, una PHSRP de ocurrencia natural comprende la secuencia del aminoácido de la SEQ ID NO: 11.

Las moléculas de ácido nucleico correspondientes a variantes alélicas naturales y los análogos, ortólogos y parálogos de un ADNc para la PHSRP se pueden aislar con base en su identidad con los ácidos nucleicos para la PHSRP de Physcomitrella patens descritos aquí utilizando los ADNc para la PHSRP, respectivamente, o una porción de los mismos, como una sonda de hibridación de acuerdo con técnicas estándar de hibridación bajo condiciones estrictas de hibridación. En una modalidad alternativa, los homólogos de la PHSRP se pueden identificar por selección bibliotecas combinatorias de mutantes, por ejemplo, mutantes de truncamiento, de la PHSRP para actividad agonista o antagonista de PHSRP. En una modalidad, se genera una genoteca abigarrada de las variantes de PHSRP por medio de mutagénesis combinatoria a nivel del ácido nucleico y es codificada por medio de una genoteca abigarrada del gen. Se puede producir una genoteca abigarrada de variantes de PHSRP, por ejemplo, ligando enzimáticamente una mezcla de oligonucleótidos sintéticos en secuencias de genes de modo que un conjunto degenerado de secuencias potenciales de PHSRP sea expresable como polipéptidos individuales, o alternativamente, como un conjunto de proteínas de fusión mayores (por ejemplo, para despliegue de fagos) que contienen el conjunto de secuencias de PHSRP en esta. Existe una variedad de métodos que pueden ser utilizados para producir bibliotecas de homólogos potenciales de PHSRP a partir de una secuencia degenerada de oligonucleótidos. La síntesis química de una secuencia degenerada de genes se puede llevar a cabo en un sintetizador automático de ADN, y se liga luego el gen sintético en un vector de expresión apropiado. El uso de un conjunto degenerado de genes permite la provisión, en una mezcla, de todas las secuencias que codifican al conjunto deseado de las secuencias potenciales de PHSRP. Los métodos para sintetizar oligonucleótidos degenerados son conocidos en el arte (ver, por ejemplo, Narang, S. A., 1983 Tetrahedron 39: 3; Itakura y colaboradores, 1984 Annu. Rev. Biochem. 53: 323; Itakura y colaboradores, 1984 Science 198: 1056; Ike y colaboradores, 1983 Nucleic Acid Res. 11: 477).

Además, se pueden utilizar bibliotecas de fragmentos de las regiones de codificación de la PHSRP para generar una población abigarrada de fragmentos de PHSRP para cribado y posterior selección de homólogos de una PHSRP. En una modalidad, se puede generar una genoteca de fragmentos de secuencia de codificación tratando un fragmento bicatenario de la PCR de una secuencia que codifica PHSRP con una nucleasa bajo condiciones en donde ocurre corte solo aproximadamente una vez por molécula, desnaturalizando del ADN bicatenario, renaturalizando el ADN para formar ADN bicatenario, que pueden incluir pares sentido/antisentido de diferentes productos de corte, removiendo porciones monocatenarias de dobletes reformados por medio de tratamiento con nucleasa S1, y uniendo la genoteca del fragmento resultante en un vector de expresión. Por medio de este método, se puede derivar una genoteca de expresión que codifica fragmentos N-terminales, C-terminales y fragmentos internos de varios tamaños de la PHSRP.

Se conocen varias técnicas en el arte para la selección de productos génicos de bibliotecas combinatorias hechas por medio de mutaciones o truncamientos puntuales, y para la selección de bibliotecas de ADNc para productos génicos que tienen una característica seleccionada. Tales técnicas pueden adaptarse para selección rápida de las bibliotecas génicas generadas por medio de la mutagénesis combinatoria de los homólogos de PHSRP. La técnicas más ampliamente utilizadas, que son sensibles a un análisis de alto rendimiento, para la selección de grandes bibliotecas génicas incluyen típicamente clonación de la genoteca en vectores de expresión reproducibles, transformación de células apropiadas con la biblioteca de vectores resultante, y que expresa los genes combinatorios bajo condiciones en las cuales la detección de una actividad deseada facilita el aislamiento del vector que codifica al gen cuyo producto se detectó. La mutagénesis recursiva de conjunto (REM), una nueva técnica que incrementa la frecuencia de mutantes funcionales en las bibliotecas, puede ser utilizada en combinación con los ensayos de selección para identificar los homólogos de PHSRP (Arkin y Yourvan, 1992 PNAS 89: 7811 - 7815; Delgrave y colaboradores, 1993 Protein Engineering 6(3): 327 - 331). En otra modalidad, se pueden explotar los ensayos basados en células para analizar una genoteca abigarrada de PHSRP, utilizando métodos bien conocidos en el arte. Un método para identificación de una PHSRP novedosa, comprende (a) la elevación de una respuesta específica del anticuerpo con una PHSRP, o un fragmento de la misma, como se describió arriba; (b) la selección del material de PHSRP putativa con el anticuerpo, en donde el enlazamiento específico del anticuerpo con el material indica la presencia de una PHSRP potencialmente novedosa; y (c) el análisis del material enlazado en comparación con la PHSRP conocida, para determinar su novedad.

Para determinar el porcentaje de homología de dos secuencias de aminoácidos (por ejemplo, una de las secuencias de la SEQ ID NO: 11 y una forma mutante de la misma), se alinean las secuencias para propósitos de comparación óptima (por ejemplo, se pueden introducir vacíos en la secuencia de una proteína o de un ácido nucleico para un alineamiento óptimo con la otra proteína o ácido nucleico). Se comparan luego los residuos de aminoácidos en las posiciones de los aminoácidos correspondientes o las posiciones de los nucleótidos. Cuando una posición en una secuencia (por ejemplo, la secuencia de la SEQ ID NO: 11) es ocupada por el mismo residuo de aminoácido que la posición correspondiente en la otra secuencia (por ejemplo, una forma mutante de la secuencia del polipéptido de la SEQ ID NO: 11), entonces las moléculas son homólogas en esa posición (es decir, como se lo utiliza aquí, "homología" del aminoácido o del ácido nucleico es equivalente a la "identidad" del aminoácido o del ácido nucleico). Se puede hacer el mismo tipo de comparación entre dos secuencias de ácido nucleico.

El porcentaje de homología entre las dos secuencias es una función del número de posiciones idénticas compartidas por las secuencias (es decir, % de homología = número de posiciones idénticas/número total de posiciones x 100). La secuencia de aminoácidos incluida en la presente invención es aproximadamente del 70 - 80%, 80 - 90%, 90 - 95%, y lo más preferible aproximadamente al menos 96%, 97%, 98%, 99% o más de homología con una secuencia completa de aminoácidos mostrada en la SEQ ID NO: 11. En aún otra modalidad, aproximadamente al menos 70 - 80%, 80 - 90%, 90 - 95%, y lo más preferible aproximadamente al menos 96%, 97%, 98%, 99% o más de homología con una secuencia completa de aminoácidos codificada por una secuencia de ácido nucleico mostrada en la SEQ ID NO: 6.

En otra modalidad preferida, una molécula aislada de ácido nucleico de la invención comprende una secuencia de nucleótidos que es aproximadamente al menos 70 - 80%, 80 - 90%, ó 90 - 95%, e incluso más preferiblemente aproximadamente al menos 95%, 96%, 97%, 98%, 99% o más homología con una secuencia de nucleótidos mostrada en la SEQ ID NO: 6 o una porción de la misma. La longitud de la secuencia de comparación para ácidos nucleicos es la longitud completa de la región de codificación.

También es preferible que una molécula homóloga de ácido nucleico codifique una proteína, o porción de la misma, que incluya una secuencia de aminoácidos que sea suficientemente homóloga con una secuencia de aminoácidos de la SEQ ID N0: 11 de modo que la proteína o una porción de la misma mantengan la misma o una función similar que la secuencia de aminoácidos con la cual se compara. Las funciones de la secuencias de aminoácidos de la PHSRP de la presente invención incluyen la habilidad para participar en una respuesta de tolerancia al estrés por sequía y/o temperatura en una planta, o más particularmente, para participar en la transcripción de una proteína involucrada en una respuesta de tolerancia al estrés en una planta de Physcomitrella patens.

Además de los métodos descritos arriba, una determinación del porcentaje de homología entre dos secuencias se puede lograr utilizando un algoritmo matemático. Un ejemplo preferido, no-limitante de un algoritmo matemático utilizado para la comparación de dos secuencias es el algoritmo de Karlin y Altschul (1990, Proc. Natl. Acad. Sci. USA 90: 5873 - 5877). Dicho algoritmo está incorporado en los programas NBLAST y XBLAST de Altschul, y colaboradores. (1990, J. Mol. Biol. 215: 403 - 410).

Las búsquedas de ácido nucleico por BLAST se pueden realizar con el programa NBLAST, puntuación = 100, longitud de la palabra = 12 para obtener las secuencias del ácido nucleico homólogas a las moléculas de ácido nucleico de la PHSRP de la invención. Adicionalmente, las búsquedas de la proteína por BLAST se puede realizar con el programa XBLAST, puntuación = 50, longitud de la palabra = 3 para obtener la secuencia de aminoácidos homóloga a las PHSRP de la presente invención. Para obtener alineaciones incompletas para propósitos de comparación, se puede utilizar, Gapped BLAST como lo describen Altschul y colaboradores (1997 Nucleic Acids Res. 25: 3389 - 3402). Cuando se utilizan los programas BLAST y Gapped BLAST, se pueden usar los parámetros por defecto de los programas respectivos (por ejemplo, XBLAST y NBLAST). Otro ejemplo no limitante preferido de un algoritmo matemático utilizado para la comparación de secuencias es el algoritmo de Myers y Miller (CABIOS 1989). Tal algoritmo está incorporado en el programa ALIGN (versión 2.0) que es parte del paquete del programa de alineación de secuencias GCG. Cuando se utiliza el programa ALIGN para comparar las secuencias de aminoácidos, se pueden utilizar una tabla del residuo de peso PAM120, una penalización por longitud de vacío de 12 y una penalización por vacío de 4, para obtener las secuencias de aminoácidos homólogas a las PHSRP de la presente invención. Para obtener alineaciones discontinuas para propósitos de comparación, se puede utilizar Gapped BLAST como lo describen Altschul y colaboradores (1997 Nucleic Acids Res. 25: 3389 - 3402). Cuando se utilizan los programas BLAST y Gapped BLAST, se pueden utilizar los parámetros por defecto de los programas respectivos (por ejemplo, XBLAST y NBLAST). Otro ejemplo no limitante preferido de un algoritmo matemático utilizado para la comparación de secuencias es el algoritmo de Myers y Miller (CABIOS 1989). Tal algoritmo está incorporado en el programa ALIGN (versión 2.0) que es parte del paquete del programa de alineamiento de secuencias GCG. Cuando se utiliza el programa ALIGN para comparar las secuencias de aminoácidos, se pueden utilizar, una tabla del residuo de peso PAM120, una penalización por longitud del vacío de 12 y una penalización por vacío de 4.

Finalmente, se puede determinar también la homología entre las secuencias de ácido nucleico utilizando técnicas de hibridación conocidas por aquellos capacitados en el arte. Por consiguiente, una molécula aislada de ácido nucleico comprende una secuencia de nucleótidos que hibrida, por ejemplo, hibrida bajo condiciones estrictas, a la secuencia de nucleótido mostrada en la SEQ ID NO: 6 o una porción de la misma. Más particularmente, una molécula aislada de ácido nucleico tiene al menos 15 nucleótidos de longitud e hibrida bajo condiciones rigurosas a la molécula de ácido nucleico que comprende una secuencia de nucleótidos de la SEQ ID NO: 6. En otras modalidades, el ácido nucleico tiene al menos 30, 50, 100, 250 o más nucleótidos de longitud.

Como se lo utiliza aquí, el término "hibrida bajo condiciones rigurosas" pretende describir condiciones para hibridación y lavado bajo las cuales las secuencias de nucleótidos son al menos 60% homólogas entre sí permanecen típicamente hibridadas entre sí. Preferiblemente, las condiciones son tales que las secuencias al menos aproximadamente 65%, más preferiblemente al menos aproximadamente 70%, y aún más preferiblemente al menos aproximadamente 75% o más homólogas entre sí, usualmente permanecen hibridadas entre sí. Tales condiciones rigurosas son conocidas por aquellos capacitados en el arte y pueden encontrarse en Current Protocols in Molecular Biology, 6.3.1 - 6.3.6, John Wiley & Sons, N.Y. (1989). Un ejemplo preferido no limitante de las condiciones estrictas de hibridación son, hibridación en 6X cloruro de sodio/citrato de sodio (SSC) aproximadamente a 45ºC, seguido por uno o más lavados en 0,2 X SSC, 0,1% de SDS a 50 - 65ºC. Preferiblemente, una molécula aislada de ácido nucleico que hibrida bajo condiciones rigurosas a una secuencia de la SEQ ID NO: 6 corresponde a una molécula de ácido nucleico de ocurrencia natural. Como se utiliza aquí, una molécula de ácido nucleico "de ocurrencia natural" se refiere a una molécula de ARN o ADN que tiene una secuencia de nucleótidos que está presente en la naturaleza (por ejemplo, codifica una proteína natural). En una modalidad,

\hbox{el ácido nucleico codifica una  PHSRP de
 Physcomitrella patens  de ocurrencia natural.}

Utilizando los métodos anteriormente descritos, y otros conocidos por aquellos capacitados en el arte, alguien ordinariamente entrenado en el oficio puede aislar homólogos de la PHSRP que comprenden una secuencia de aminoácidos mostrada en la SEQ ID NO: 11 y los ácidos nucleicos para PHSRP que comprenden una secuencia del ácido nucleico como se muestra en la SEQ ID NO: 6. Un subconjunto de estos homólogos son variantes alélicas. Como se lo utiliza aquí, el término "variante alélica" se refiere a una secuencia de nucleótidos que contiene polimorfismos que conducen a cambios en las secuencias de aminoácidos de una PHSRP y que existe dentro de una población natural (por ejemplo, una especie o variedad de planta). Tales variaciones alélicas naturales pueden resultar usualmente en una variación de 1 - 5% en un ácido nucleico para PHSRP. Las variantes alélicas se pueden identificar por secuenciación de la secuencia del ácido nucleico de interés en una cantidad de plantas diferentes, que se pueden realizar fácilmente utilizando sondas de hibridación para identificar el mismo locus genético para PHSRP en aquellas plantas. Cualquiera y todas las variaciones de ácido nucleico y los polimorfismos o variaciones de aminoácido resultantes en una PHSRP que son el resultado de la variación alélica natural y que no alteran la actividad funcional de una PHSRP, se pretende que estén dentro del alcance de la invención.

Además, se contemplan también las moléculas de ácido nucleico que codifican las PHSRP a partir de la misma o de otras especies tales como análogos, ortólogos y parálogos de PHSRP. Como se lo utiliza aquí, el término "análogos" se refiere a dos ácidos nucleicos que tienen la misma o una función similar, pero que han evolucionado separadamente en organismos no relacionados.

Como se utiliza aquí, el término "ortólogos" se refiere a dos ácidos nucleicos de diferentes especies, pero que han evolucionado a partir de un gen ancestral común por especiación. Normalmente, los ortólogos codifican proteínas que tienen la misma o funciones similares. Como también se utiliza aquí, el término "parálogos" se refiere a dos ácidos nucleicos que se relacionan por duplicación dentro de un genoma. Los parálogos usualmente tienen diferentes funciones, pero estas funciones pueden estar relacionadas (Tatusov, R. L. y colaboradores. 1997 Science 278 (5338): 631 - 637). Los análogos, ortólogos y parálogos de una PHSRP de ocurrencia natural puede diferir de la PHSRP de ocurrencia natural por modificaciones postranslacionales, por diferencias en la secuencia de aminoácidos, o por ambos. Las modificaciones postranslacionales incluyen derivatización química in vivo e in vitro de polipéptidos, por ejemplo, acetilación, carboxilación, fosforilación, o glicosilación, y tales modificaciones pueden ocurrir durante la síntesis o procesamiento del polipéptido o después del tratamiento con enzimas modificadas aisladas. En particular, los ortólogos de la invención generalmente exhibirán al menos 80 - 85%, más preferiblemente 90%, y lo más preferible 95%, 96%, 97%, 98% o incluso 99% de identidad u homología con todo o parte de una secuencia de aminoácidos de PHSRP de ocurrencia natural y exhibirán una función similar a una PHSRP. Los ortólogos de la presente invención también son capaces preferiblemente de participar en la respuesta al estrés en plantas. En una modalidad, los ortólogos de PHSRP mantienen la habilidad de participar en el metabolismo de los compuestos necesarios para la construcción de membranas celulares en Physcomitrella patens, o en el transporte de moléculas a través de estas membranas.

Además de las variantes de ocurrencia natural de una secuencia de PHSRP que puede existir en la población, la persona entrenada se dará cuenta además de que se pueden introducir cambios por mutación en una secuencia de nucleótido de la SEQ ID NO: 6, conduciendo por consiguiente a cambios en la secuencia de aminoácidos de la PHSRP codificada, sin alterar la capacidad funcional de la PHSRP. Por ejemplo, las sustituciones de nucleótidos que conducen a sustituciones de aminoácidos en los residuos de aminoácidos "no esenciales" se pueden hacer en una secuencia de la SEQ ID NO: 6. Un residuo de aminoácido "no esencial" es un residuo que se puede alterar a partir de la secuencia de tipo silvestre de una de las PHSRP sin alterar la actividad de dicha PHSRP, mientras que se requiere de un residuo de un aminoácido "esencial" para la actividad de PHSRP. Otros residuos de aminoácidos, sin embargo, (por ejemplo, aquellos que no se conservan o que solamente se conservan a medias en el dominio que tiene actividad de PHSRP) pueden no ser esenciales para la actividad y de esta manera probablemente sean susceptibles de alteración, sin alterar la actividad de PHSRP.

Por lo tanto, otro aspecto de la descripción hace referencia a las moléculas de ácido nucleico que codifican las PHSRP que contienen cambios en los residuos de aminoácidos que no son esenciales para la actividad de PHSRP. Tales PHSRP difieren en la secuencia del aminoácido a partir de una secuencia contenida en la SEQ ID NO: 11, retienen aún al menos una de las actividades de PHSRP descritas aquí. En una modalidad, la molécula aislada de ácido nucleico comprende una secuencia de nucleótidos que codifica una proteína, al menos aproximadamente 70 - 80%, 80 - 90%, 90 - 95% homóloga a una de las secuencias de la SEQ ID NO: 11 y lo más preferible al menos aproximadamente 96%, 97%, 98%, ó 99% homóloga a una de las secuencias de la SEQ ID NO: 11. Los homólogos preferidos de PHSRP de la presente invención son preferiblemente capaces de participar en la respuesta de tolerancia al estrés por sequía y/o temperatura en una planta, o más particularmente, participar en la transcripción de una proteína involucrada en una respuesta de tolerancia al estrés en una planta de Physcomitrella patens.

Se puede crear una molécula aislada de ácido nucleico que codifica una PHSRP homóloga a una proteína de la secuencia SEQ ID NO: 11 por medio de la introducción de una o más sustituciones, adiciones o supresiones de nucleótidos en una secuencia de nucleótido de la SEQ ID NO: 6 de tal manera que una o más sustituciones, adiciones o supresiones de aminoácidos se introducen en la proteína codificada. Se pueden introducir mutaciones en la secuencia de la SEQ ID NO: 6, por medio de técnicas estándar, tales como mutagénesis dirigida al sitio y mutagénesis mediadas por FCR. Preferiblemente, las sustituciones conservadoras de aminoácidos se hacen en uno o más residuos predichos de aminoácidos no esenciales. Una "sustitución conservadora de aminoácidos" es una en la cual el residuo del aminoácido se reemplaza con un residuo de aminoácido que tiene una cadena lateral similar.

Las familias de residuos de aminoácidos que tienen cadenas laterales similares han sido definidas en el arte. Estas familias incluyen aminoácidos con cadenas laterales básicas (por ejemplo, lisina, arginina, histidina), cadenas laterales ácidas (por ejemplo, ácido aspártico, ácido glutámico), cadenas laterales polares sin carga (por ejemplo, glicina, asparagina, glutamina, serina, treonina, tirosina, cisteína), cadenas laterales no polares (por ejemplo, alanina, valina, leucina, isoleucina, prolina, fenilalanina, metionina, triptófano), cadenas laterales beta-ramificadas (por ejemplo, treonina, valina, isoleucina) y cadenas laterales aromáticas (por ejemplo, tirosina, fenilalanina, triptófano, histidina). Por lo tanto, un residuo de aminoácido no esencial predicho en una PHSRP preferiblemente se reemplaza con otro residuo de aminoácido de la misma familia de cadena lateral. Alternativamente, en otra modalidad, se pueden introducir mutaciones en forma aleatoria a lo largo de toda o de parte de una secuencia que codifica para PHSRP, tal como por medio de mutagénesis por saturación, y se pueden seleccionar los mutantes resultantes por medio de la actividad de la PHSRP descrita aquí para identificar los mutantes que retienen la actividad de PHSRP. Después de la mutagénesis de la secuencia de la SEQ ID NO: 6 la proteína codificada se puede expresar de manera recombinante y se puede determinar la actividad de la proteína analizando la tolerancia al estrés de una planta que expresa las proteínas como se describe en el Ejemplo 7.

Además de las moléculas de ácido nucleico que codifican las PHSRP descritas arriba, otro aspecto de la descripción se refiere a moléculas aisladas de ácido nucleico que son antisentido a estas. Un ácido nucleico "antisentido" comprende una secuencia de nucleótidos que es complementaria a un ácido nucleico "sentido" que codifica una proteína, por ejemplo, complementaria a la cadena de codificación de una molécula de ADNc bicatenaria o complementaria a una secuencia de ARNm. Por consiguiente, un ácido nucleico antisentido puede enlazar hidrógeno a un ácido nucleico sentido. El ácido nucleico antisentido puede ser complementario a una cadena completa que codifica PHSRP, o únicamente a una porción de la misma. En una modalidad, una molécula de ácido nucleico antisentido es antisentido a una "región de codificación" de la cadena de codificación de una secuencia de nucleótidos que codifica una PHSRP. El término "región de codificación" se refiere a la región de la secuencia de nucleótidos que incluye codones que son traducidos en residuos de aminoácidos (por ejemplo, la región entera de codificación de..... comprende los nucleótidos 1 a ....). En otra modalidad, la molécula de ácido nucleico antisentido es antisentido a una "región no codificadora" de la cadena de codificación de una secuencia de nucleótidos que codifica una PHSRP. El término "región de codificación" se refiere a las secuencias 5' y 3' que flanquean la región de codificación, que no son traducidas en aminoácidos (es decir, también denominadas como regiones 5' y 3' no traducidas).

En una modalidad preferida, una molécula aislada de ácido nucleico de la descripción comprende una molécula de ácido nucleico que es un complemento de la secuencia de nucleótidos mostrada en la SEQ ID NO: 6, o una porción de la misma. Una molécula de ácido nucleico que es complementaria a la secuencia de nucleótidos mostrada en la SEQ ID NO: 6 es una que es suficientemente complementaria a la secuencia de nucleótidos mostrada en la SEQ ID NO: 6 de modo que puede hibridar a la secuencia

\hbox{de nucleótido mostrada en la SEQ ID NO: 6,
formando  así un dúplex estable.}

Dadas las secuencias de la cadena de codificación que codifican la PHSRP divulgadas aquí (por ejemplo, la secuencia expuesta en la SEQ ID NO: 6), se pueden diseñar ácidos nucleicos antisentido de acuerdo con las reglas de apareamiento de bases de Watson y Crick. La molécula de ácido nucleico antisentido puede ser complementaria a la región completa de codificación de un ARNm para PHSRP, pero más preferiblemente es un oligonucleótido el cual es antisentido únicamente a una porción de la región de codificación o que no es de codificación de un ARNm para PHSRP. Por ejemplo, el oligonucleótido antisentido puede ser complementario a la región circundante del sitio inicial de traducción del ARNm para PHSRP. Un oligonucleótido antisentido puede tener, por ejemplo, aproximadamente 5, 10, 15, 20, 25, 30, 35, 40, 45 ó 50 nucleótidos de longitud.

Un ácido nucleico antisentido se puede construir utilizando síntesis química y reacciones de unión enzimática utilizando procedimientos conocidos en el arte. Por ejemplo, un ácido nucleico antisentido (por ejemplo, un oligonucleótido antisentido) puede ser sintetizado químicamente utilizando nucleótidos de ocurrencia natural o nucleótidos modificados de diferente modo, diseñados para incrementar la estabilidad biológica de las moléculas o para incrementar la estabilidad física del dúplex formado entre los ácidos nucleicos sentido y antisentido, por ejemplo, se pueden utilizar, derivados de fosforotioato y nucleótidos sustituidos de acridina. Los ejemplos de nucleótidos modificados que se pueden utilizar para generar el ácido nucleico antisentido incluyen 5-fluorouracilo, 5-bromouracilo, 5-clorouracilo, 5-yodouracilo, hipoxantina, xantina, 4-acetilcitosina, 5-(carboxihidroxilmetil)uracilo, 5-carboximetilaminometil-2-tiouridina, 5-carboximetilaminometil uracilo, dihidrouracilo, beta-D-galactosilqueosina, inosina, N-6-isopenteniladenina, 1-metilguanina, 1-metilinosina, 2,2-dimetilguanina, 2-metiladenina, 2-metilguanina, 3-metilcitosina, 5-metilcitosina, N-6-adenina, 7-metilguanina, 5-metilaminometiluracilo, 5-metoxiaminometil-2-tiouracilo, beta-D-manosilqueosina, 5'-metoxicarboximetiluracilo, 5-metoxiuracilo, 2-metiltio-N6-isopenteniladenina, ácido uracil-5-oxiacético (v), wybutoxosina, seudouracilo, queosina, 2-tiocitosina, 5-metil-2-tiouracilo, 2-tiouracilo, 4-tiouracilo, 5-metiluracilo, éster metílico del ácido uracil-5-oxiacético, ácido uracil-5-oxiacético (v), 5-metil-2-tiouracilo, 3-(3-amino-3-N-2-carboxipropil)uracilo, (acp3)w, y 2,6-diaminopurina. Como alternativa, el ácido nucleico antisentido puede ser producido biológicamente utilizando un vector de expresión en el cual un ácido nucleico ha sido subclonado en una orientación antisentido (es decir, el ARN transcrito a partir del ácido nucleico insertado será de una orientación antisentido a un ácido nucleico objetivo de interés, descrito además en el siguiente apartado).

Las moléculas de ácido nucleico antisentido usualmente se administran a una célula o se generan in situ de modo que hibriden con o se unan a un ARNm celular y/o un ADN genómico que codifica a una PHSRP para inhibir así la expresión de la proteína, por ejemplo, inhibiendo la transcripción y/o la traducción. La hibridación puede ser por medio de complementariedad convencional del nucleótidos para formar un dúplex estable, o, por ejemplo, en el caso de una molécula de ácido nucleico antisentido que se una a dúplex de ADN, a través de interacciones específicas en la acanaladura principal de la doble hélice. La molécula antisentido se puede modificar de tal modo que esta se enlace específicamente a un receptor o a un antígeno expresados sobre una superficie celular seleccionada, por ejemplo, por medio del enlazamiento de la molécula del ácido nucleico antisentido a un péptido o un anticuerpo que se enlaza a un receptor o antígeno de la superficie de la célula. También se puede suministrar la molécula de ácido nucleico antisentido a las células utilizando los vectores descritos aquí. Para lograr concentraciones intracelulares suficientes de las moléculas antisentido, se prefieren construcciones de vectores en las cuales la molécula de ácido nucleico antisentido se coloca bajo el control de un promotor procariota, viral, o eucariota fuerte (incluida una
planta).

En aún otra modalidad, la molécula de ácido nucleico antisentido es una molécula de ácido nucleico \alpha-anomérica. Una molécula de ácido nucleico \alpha-anomérica forma híbridos bicatenarios específicos con ARN complementario en el cual, contrario a las unidades \beta usuales, las cadenas corren paralelas entre sí (Gaultier y colaboradores, 1987, Nucleic Acids. Res. 15: 6625 - 6641). La molécula de ácido nucleico antisentido también puede contener un 2'-o-metilribonucleótido (Inoue y colaboradores, 1987, Nucleic Acids Res. 15: 6131 - 6148) o una análogo quimérico de ARN-ADN (Inoue y colaboradores, 1987, FEBS Lett. 215: 327 - 330).

En aún otra modalidad, un ácido nucleico antisentido es una ribozima. Las ribozimas son moléculas catalíticas de ARN con actividad de ribonucleasa que son capaces de escindir un ácido nucleico monocatenario, tal como un ARNm, con el cual ellas tienen una región complementaria. Así, las ribozimas (por ejemplo, las ribozimas de cabeza de martillo descritas en Haselhoff y Gerlach, 1988, Nature 334: 585 - 591) pueden ser utilizadas para escindir catalíticamente los transcriptos de ARNm para PHSRP para inhibir así la traducción del ARNm para PHSRP. Una ribozima que tiene especificidad por un ácido nucleico que codifica PHSRP se puede diseñar con base en la secuencia de nucleótidos de un ADNc para la PHSRP, como se revela aquí (es decir, la SEQ ID NO: 6) o con base en una secuencia heteróloga que se aísla de acuerdo con los métodos explicados en esta descripción. Por ejemplo, un derivado de un ARN L-19 IVS de Tetrahymena se puede construir de tal manera que la secuencia de nucleótidos del sitio activo sea complementaria a la secuencia de nucleótidos que es escindida en un ARNm que codifica para PHSRP. Ver, por ejemplo, Cech y colaboradores. Patente Estadounidense No. 4.987.071 y Cech y colaboradores. Patente Estadounidense No. 5.116.742. Como alternativa, se puede utilizar ARNm para PHSRP para seleccionar un ARN catalítico que tenga actividad específica de ribonucleasa a partir de una fuente de moléculas de ARN. (Ver, por ejemplo, Bartel, D. y Szostak, J. W., 1993, Science 261: 1411 - 1418).

Alternativamente, se puede inhibir la expresión del gen para PHSRP dirigiendo las secuencias de nucleótidos complementarias a la región reguladora de una secuencia de nucleótidos para PHSRP (por ejemplo, un promotor y/o potenciador para PHSRP) para formar estructuras helicoidales triples que prevengan la transcripción de un gen para PHSRP en células objetivo. Ver generalmente, Helene, C., 1991, Anticancer Drug Des. 6(6): 569 - 84; Helene, C. y colaboradores, 1992, Ann. N. Y. Acad. Sci. 660: 27 - 36; y Maher, L. J., 1992, Bioassays 14(12): 807 - 15.

Además de los ácidos nucleicos y proteínas de PHSRP descritos arriba, también se contemplan estos ácidos nucleicos y proteínas unidos a una fracción. Estas fracciones incluyen, pero no se limitan a, fracciones de detección, fracciones de hibridación, fracciones de purificación, fracciones de suministro, fracciones de reacción, fracciones de enlazamiento, y similares. Un ácido nucleico típico unido a una fracción es una sonda/iniciador. La sonda/iniciador típicamente incluye una región de una secuencia de nucleótidos que hibrida bajo condiciones rigurosas hasta aproximadamente al menos 12, preferiblemente aproximadamente 25, más preferiblemente aproximadamente 40, 50 ó 75 nucleótidos consecutivos de una cadena sentido de la secuencia expuesta en la SEQ ID NO: 6, una secuencia antisentido de la secuencia expuesta en la SEQ ID NO: 6, o mutantes de las mismas de ocurrencia natural. Se pueden utilizar iniciadores basados en una secuencia de nucleótidos de la SEQ ID NO: 6 en reacciones PCR para clonar homólogos de PHSRP. Las sondas basadas en las secuencias de nucleótidos de PHSRP pueden ser utilizadas para detectar transcripciones o secuencias genómicas que codifican las mismas o proteínas homólogas. En modalidades preferidas, la sonda incluye además un grupo marcador unido a las mismas, por ejemplo el grupo marcador puede ser un isótopo radioactivo, un compuesto fluorescente, una enzima, o un cofactor enzimático. Tales sondas se pueden utilizar como parte de un kit de prueba de un marcador genómico para identificar células que expresan una PHSRP, tal como por medio de la medición del nivel de un ácido nucleico que codifica PHSRP, respectivamente, en una muestra de células, por ejemplo, detectando los niveles de ARNm

\hbox{para la PHSRP o determinando si un  gen para PHSRP
genómico ha sido mutado o suprimido.}

En particular, un método útil para comprobar el nivel de transcripción del gen (un indicador de la cantidad de ARNm disponible para la traducción al producto génico) es llevando a cabo una transferencia tipo Northern (para referencia ver, por ejemplo, Ausubel y colaboradores, 1988 Current Protocols in Molecular Biology, Wiley: New York). Esta información demuestra al menos parcialmente el grado de transcripción del gen transformado. El ARN celular total se puede preparar a partir de células, tejidos u órganos por medio de varios métodos, todos bien conocidos en el arte, tal como el que se describe en Bormann, E. R. y colaboradores, 1992, Mol. Microbiol. 6: 317 - 326. Para evaluar la presencia o la cantidad relativa de proteína traducida a partir de este ARNm, se pueden emplear técnicas estándar, tales como transferencias tipo Western. Estas técnicas son bien conocidas por alguien ordinariamente capacitado en el arte. (Ver, por ejemplo,

\hbox{Ausubel y colaboradores,  1988 Current Protocols in
Molecular Biology, Wiley: New York).}

La invención proporciona además un vector de expresión recombinante aislado que comprende un ácido nucleico para PHSRP como se describe arriba, en donde la expresión del vector en una célula huésped resulta en una mayor tolerancia al estrés por sequía y/o temperatura comparado con una variedad de tipo silvestre de la célula huésped. Como se lo utiliza aquí, el término "vector" se refiere a una molécula de ácido nucleico capaz de transportar otro ácido nucleico al cual ha sido enlazado. Un tipo de vector es un "plásmido", que se refiere a un bucle de ADN bicatenario circular dentro del cual se pueden ligar segmentos adicionales de ADN. Otro tipo de vector es un vector viral, en donde se pueden ligar segmentos adicionales de ADN dentro del genoma viral. Ciertos vectores tienen la capacidad de replicación autónoma en una célula huésped dentro de la cual se introducen (por ejemplo, vectores bacterianos que tienen un origen bacteriano de replicación y vectores episomales de mamífero). Otros vectores (por ejemplo, vectores no episomales de mamífero) se integran dentro el genoma de una célula huésped después de la introducción en la célula huésped, y por consiguiente se replican junto con el genoma huésped. Además, ciertos vectores son capaces de dirigir la expresión de genes con los cuales ellos están operativamente enlazados. Tales vectores se denominan aquí como "vectores de expresión". En general, los vectores de expresión de utilidad en técnicas de ADN recombinante están a menudo en la forma de plásmidos. En la presente especificación, "plásmido" y "vector" se pueden utilizar de forma intercambiable ya que el plásmido es la forma de vector más comúnmente utilizada. Sin embargo, la invención pretende incluir tales otras formas de vectores de expresión, tales como vectores virales (por ejemplo, retrovirus de replicación defectuosa, adenovirus y virus adenoasociados), que prestan funciones equivalentes.

Los vectores de expresión recombinante de la invención comprenden un ácido nucleico de la invención en una forma adecuada para expresión del ácido nucleico en una célula huésped, lo cual significa que los vectores de expresión recombinante incluyen una o más secuencias reguladoras, seleccionadas con base en las células huésped que se utilizan para expresión, que están operativamente enlazadas a la secuencia de ácido nucleico que va a ser expresada. Dentro de un vector de expresión recombinante, "operativamente enlazado" pretende significar que la secuencia de nucleótidos de interés está enlazada a la(s) secuencia(s) reguladora(s) en una forma que permite la expresión de la secuencia de nucleótidos (por ejemplo, en un sistema de transcripción/traducción in vitro o en una célula huésped cuando se introduce el vector en la célula huésped). El término "secuencia reguladora" pretende incluir promotores, potenciadores y otros elementos para control de la expresión (por ejemplo, señales de poliadenilación). Tales secuencias reguladoras son descritas, por ejemplo, en Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990) o ver: Gruber y Crosby, en: Methods in Plant Molecular Biology and Biotechnology, eds. Glick y Thompson, Capítulo 7, 89 - 108, CRC Press: Boca Ratón, Florida, incluidas las referencias citadas allí. Las secuencias reguladoras incluyen a aquellas que dirigen la expresión constitutiva de una secuencia de nucleótidos en muchos tipos de células huésped y aquellas que dirigen la expresión de la secuencia de nucleótidos únicamente en ciertas células huésped o bajo ciertas condiciones. Se apreciará por parte de aquellos capacitados en el arte que el diseño del vector de expresión puede depender de factores tales como la escogencia de la célula huésped que va a ser transformada, del nivel de expresión de la proteína deseada, etc. Los vectores de expresión de la invención se pueden introducir en células huésped para producir así proteínas o péptidos, incluidas proteínas de fusión o péptidos, codificados por un ácido nucleico según se describe aquí (por ejemplo, PHSRP, formas mutantes de PHSRP, proteínas de fusión, etc.).

Los vectores de expresión recombinante de la invención se pueden diseñar para la expresión de las PHSRP en células procariotas o eucariotas. Por ejemplo, los genes para PHSRP se pueden expresar en células bacterianas tal como C. glutamicum, células de insecto (utilizando vectores de Expresión de baculovirus), levadura y otras células de hongos (ver Romanos, M.A. y colaboradores, 1992, Foreign gene expression in yeast: a review, Yeast 8: 423 - 488; van den Hondel, C. A. M. J. J. y colaboradores, 1991, Heterologous gene expression in filamentous fungi, en: More Gene Manipulations in Fungi, J. W. Bennet & L. L. Lasure, eds., páginas 396 - 428: Academic Press: San Diego; y van den Hondel, C. A. M. J. J. & Punt, P. J., 1991, Gene transfer systems and vector development for filamentous fungi, en: Applied Molecular Genetics of Fungi, Peberdy, J. F. y colaboradores, eds., páginas 1 - 28, Cambridge University Press: Cambridge), algas (Falciatore y colaboradores, 1999, Marine Biotechnology 1(3): 239 - 251), ciliados de los tipos: Holotrichia, Peritrichia, Spirotrichia, Suctoria, Tetrahymena, Paramecium, Colpidium, Glaucoma, Platyophrya, Potomacus, Pseudocohnilembus, Euplotes, Engelmaniella, y Stylonychia, especialmente del género Stylonychia lemnae con vectores siguiendo un método de transformación como se describe en WO 98/01572 y células de plantas multicelulares (ver Schmidt, R. y Willmitzer, L., 1988, High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants, Plant Cell Rep. 583 - 586); Plant Molecular Biology and Biotechnology, C Press, Boca Ratón, Florida, capítulo 6/7, S.71 - 119 (1993); F. F. White, B. Jenes y colaboradores, Techniques for Gene Transfer, en: Transgenic Plants, Vol. 1, Engineering and Utilization, eds. Kung und R. Wu, 128 - 43, Academic Press: 1993; Potrykus, 1991 Annu. Rev. Plant Physiol. Plant Molec. Biol. 42: 205 - 225 y las referencias citadas allí) o células de mamífero. Las células huésped apropiadas se discuten además en Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press: San Diego, CA (1990). Alternativamente, el vector de expresión recombinante se puede transcribir y traducir in vitro, por ejemplo utilizando secuencias reguladoras del promotor T7 y polimerasa T7.

La expresión de proteínas en procariotas la mayoría de las veces se realiza con vectores que contienen promotores constitutivos o inducibles que dirigen la expresión ya sea de proteínas de fusión o que no son de fusión. Los vectores de fusión añaden una cantidad de aminoácidos a una proteína codificada allí, usualmente al terminal amino de la proteína recombinante pero también al terminal C o fusionados dentro de regiones apropiadas en las proteínas. Tales vectores de fusión típicamente sirven tres propósitos: 1) para incrementar la expresión de una proteína recombinante; 2) para incrementar la solubilidad de una proteína recombinante; y 3) para ayudar en la purificación de una proteína recombinante actuando como un ligando en purificación por afinidad. A menudo, en los vectores de expresión por fusión, se introduce un sitio de escisión proteolítica en la unión de la fracción de fusión y la proteína recombinante para permitir la separación de la proteína recombinante de la fracción de fusión después de la purificación de la proteína de fusión. Tales enzimas, y sus

\hbox{secuencias de  reconocimiento del cognado, incluyen al
Factor Xa, trombina y enteroquinasa.}

Los vectores típicos de expresión por fusión incluyen pGEX (Pharmacia Biotech Inc; Smith, D. B. y Johnson, K. S., 1988 Gene 67: 31 - 40), pMAL (New England Biolabs, Beverly, MA) y pRIT5 (Pharmacia, Piscataway, NJ) que fusionan la glutationa S-transferasa (GST), proteína de enlazamiento de maltosa B, o proteína A, respectivamente, a la proteína recombinante objetivo. En una modalidad, la secuencia de codificación de la PHSRP es clonada dentro de un vector de expresión pGEX para crear un vector que codifica una proteína de fusión que comprende, desde el terminal N al C-terminal, la proteína con el sitio X de escisión de trombina por GST. La proteína de fusión se puede purificar por medio de cromatografía de afinidad utilizando resina de glutationa-agarosa. La PHSRP recombinante no fusionada a GST se puede recuperar por escisión de la proteína de fusión con trombina.

Los ejemplos de vectores de expresión adecuados inducibles sin fusión de E. coli incluyen pTrc (Amann y colaboradores, 1988, Gene 69: 301 - 315) y pET 11d (Studier y colaboradores, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60 - 89). La expresión del gen objetivo del vector pTrc se basa en la transcripción de la ARN polimerasa del huésped a partir de un promotor híbrido de fusión trp-lac. La expresión del gen objetivo a partir del vector pET 11d se basa en la transcripción de un promotor de fusión T7 gn10-lac mediado por una ARN polimerasa viral co-expresada (T7 gn1). Esta polimerasa viral es suministrada por las cepas huésped BL21(DE3) o HMS174(DE3) de un profago residente \lambda que hospeda un gen T7 gn1 bajo el control transcripcional del promotor lacUV 5.

Una estrategia para maximizar la expresión de la proteína recombinante es expresar la proteína en una bacteria huésped con una capacidad desmejorada para escindir proteolíticamente la proteína recombinante (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119 - 128). Otra estrategia es alterar la secuencia del ácido nucleico que va a ser insertado en un vector de expresión de tal manera que los codones individuales para cada aminoácido sean aquellos utilizados preferentemente en la bacteria escogida para la expresión, tal como C. glutamicum (Wada y colaboradores, 1992, Nucleic Acids Res. 20: 2111 - 2118). Tal alteración de secuencias de ácido nucleico de la invención se puede llevar a cabo por medio de técnicas estándar de síntesis de ADN.

En otra modalidad, el vector de expresión de PHSRP es un vector de expresión de levadura. Los ejemplos de vectores para la expresión en levadura S. cerevisiae incluyen pYepSec1 (Baldari, y colaboradores, 1987, Embo J. 6: 229 - 234), pMFa (Kurjan y Herskowitz, 1982, Cell 30: 933 - 943), pJRY88 (Schultz y colaboradores, 1987, Gene 54: 113 - 123), y pYES2 (Invitrogen Corporation, San Diego, CA). Los vectores y métodos para la construcción de vectores apropiados para uso en otros hongos, tales como el hongo filamentoso, incluyen a aquellos detallados en: van den Hondel, C. A. M. J. J. & Punt, P. J. (1991) "Gene transfer systems and vector development for filamentous fungi", en: Applied Molecular Genetics of Fungi, J. F. Peberdy, y colaboradores, eds., páginas 1 - 28, Cambridge University Press: Cambridge.

Alternativamente, las PHSRP de la invención se pueden expresar en células de insecto utilizando vectores de expresión baculovirus. Los vectores baculovirus disponibles para la expresión de proteínas en células de insecto cultivadas (por ejemplo, células Sf 9) incluyen la serie pAc (Smith y colaboradores, 1983, Mol. Cell Biol. 3: 2156 - 2165) y la serie pVL (Lucklow y Summers, 1989, Virology 170: 31 - 39).

Aún en otra modalidad, un ácido nucleico para PHSRP de la invención se expresa en células de mamífero utilizando un vector de expresión de mamífero. Los ejemplos de vectores de expresión de mamífero incluyen pCDM8 (Seed, B., 1987, Nature 329: 840) y pMT2PC (Kaufman y colaboradores, 1987, EMBO J. 6: 187 - 195). Cuando se los utiliza en células de mamífero, las funciones de control del vector de expresión son a menudo proporcionadas por elementos reguladores virales. Por ejemplo, los promotores comúnmente utilizados de derivan de polioma, Adenovirus 2, citomegalovirus y Virus Simio 40. Para otros sistemas apropiados de expresión tanto para células procariotas como eucariotas ver los capítulos 16 y 17 de Sambrook, J., Fritsh, E. F., y Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor-Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

En otra modalidad, el vector de expresión recombinante de mamífero es capaz de dirigir la expresión del ácido nucleico preferentemente en un tipo particular de célula (por ejemplo, se utilizan elementos reguladores específicos del tejido para expresar el ácido nucleico). Los elementos reguladores específicos del tejido son conocidos en el arte. Los ejemplos no limitantes de promotores apropiados específicos del tejido incluyen al promotor de albúmina (específico del hígado; Pinkert y colaboradores, 1987, Genes Dev. 1: 268 - 277), promotores específicos linfoideos (Calame e Eaton, 1988, Adv. Immunol. 43: 235 - 275), en particular promotores de los receptores de células T (Winoto y Baltimore, 1989, EMBO J. 8: 729 - 733) e inmunoglobulinas (Banerji y colaboradores, 1983 Cell 33: 729 - 740; Queen y Baltimore, 1983 Cell 33: 741 - 748), promotores específicos de neuronas (por ejemplo, el promotor del neurofilamento; Byrne y Ruddle, 1989 PNAS 86: 5473 - 5477), promotores específicos del páncreas (Edlund y colaboradores, 1985, Science 230: 912 - 916), y promotores específicos de glándulas mamarias (por ejemplo, promotor del suero de la leche; Patente Estadounidense No. 4.873.316 y Publicación de la Solicitud Europea No. 264.166). También se abarcan los promotores de desarrollo regulados, por ejemplo, los promotores hox de múrido (Kessel y Gruss, 1990, Science 249: 374 - 379) y el promotor de fetoproteína (Campes y Tilghman, 1989, Genes Dev. 3: 537 - 546).

En otra modalidad, las PHSRP de la invención se pueden expresar en células de plantas unicelulares (tal como algas) (ver Falciatore y colaboradores, 1999, Marine Biotechnology 1(3): 239 - 251 y las referencias citadas allí) y células de plantas de plantas superiores (por ejemplo, los espermatofitos, tal como plantas de cultivo). Los ejemplos de vectores de expresión de plantas incluyen a aquellos detallados en: Becker, D., Kemper, E., Schell, J. y Masterson, R., 1992, New plant binary vectors with selectable markers located proximal to the left border, Plant Mol. Biol. 20: 1195 - 1197; y Bevan, M. W., 1984, Binary Agrobacterium vectors for plant transformation, Nucl. Acid. Res. 12: 8711 - 8721; Vectors for Gene Transfer in Higher Plants; en: Transgenic Plants, Vol. 1, Engineering and Utilization, eds.: Kung y R. Wu, Academic Press, 1993, S. 15 - 38.

Un casete de expresión de la planta contiene preferiblemente secuencias reguladoras capaces de dirigir la expresión génica en células de planta y enlazarlas operablemente de tal manera que cada secuencia pueda cumplir su función, por ejemplo, la terminación de la transcripción por medio de señales de poliadenilación. Las señales de poliadenilación preferidas son aquellas que se originan a partir del t-ADN de Agrobacterium tumefaciens tal como el gen 3 conocido como octopina sintasa del Ti-plásmido pTiACH5 (Gielen y colaboradores, 1984, EMBO J. 3: 835) o equivalentes funcionales del mismo pero también son adecuados todos los otros terminadores funcionalmente activos en plantas.

Como la expresión génica de la planta muy frecuente no se limita a niveles transcripcionales, un casete de expresión de la planta contiene preferiblemente otras secuencias operativamente enlazadas como reforzadoras de la traducción tal como la secuencia que hace funcionar más allá de la capacidad normal que contiene la secuencia líder no traducida 5' del virus del mosaico del tabaco que refuerza la proteína por proporción de ARN (Gallie y colaboradores, 1987, Nucl. Acids Research 15: 8693 - 8711).

La expresión génica de la planta debe estar operativamente enlazada a un promotor apropiado que confiere expresión génica en una forma oportuna específica de la célula o el tejido. Se prefieren los promotores que dirigen la expresión constitutiva (Benfey y colaboradores, 1989, EMBO J. 8: 2195 - 2202) como los derivados de virus de las plantas como el CAMV 35S (Franck y colaboradores, 1980, Cell 21: 285 - 294), el CaMV 19S (ver también la Patente Estadounidense No. 5.352.605 y la Solicitud PCT No. WO 8402913) o promotores de la planta como aquellos de la pequeña subunidad de Rubisco descritos en la Patente Estadounidense No. 4.962.028.

Otras secuencias preferidas para uso en casetes de expresión génica de la planta son secuencias objetivo necesarias para dirigir el producto génico en su compartimiento celular apropiado (para revisión ver Kermode, 1996, Crit. Rev. Plant Sci. 15(4): 285 - 423 y las referencias citadas allí) tal como la vacuola, el núcleo, todos los tipos de plástidos como amiloplastos, cloroplastos, cromoplastos, el espacio extracelular, mitocondria, el retículo endoplasmático, cuerpos oleosos, peroxisomas y otros compartimientos de las células de la planta.

La expresión génica de la planta también se pueden facilitar a través de un promotor inducible (para revisión ver Gatz, 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol. 48: 89 - 108). Los promotores químicos inducibles son especialmente apropiados si se quiere que la expresión génica se produzca en un momento específico. Los ejemplos de tales promotores son un promotor inducible de ácido salicílico (Solicitud PCT No. WO 95/19443), un promotor inducible de tetraciclina (Gatz y colaboradores, 1992, Plant J. 2: 397 - 404) y un promotor inducible de etanol (Solicitud PCT No. WO 93/21334).

También, los promotores apropiados que responden a condiciones de estrés biótico o abiótico son aquellos tales como el promotor del gen PRP1 inducible por un patógeno (Ward y colaboradores, 1993, Plant. Mol. Biol. 22: 361 - 366), el promotor de hsp80 inducible por calor del tomate (Patente Estadounidense No. 5.187.267), el promotor de alfa-amilasa inducible por frío de la patata (Solicitud PCT No. WO 96/12814) o el promotor de pinII inducible por lesiones (Patente Europea No. 375091). Para otros ejemplos de promotores inducibles por sequía, frío, y sal, tales como el promotor RD29A, ver Yamaguchi-Shinozalei y colaboradores. (1993 Mol. Gen. Genet. 236: 331 - 340).

Se prefieren especialmente aquellos promotores que confieren expresión génica en tejidos y órganos específicos, tales como células protectoras y las células de la raíz del cabello. Los promotores apropiados incluyen al promotor del gen de napina de semilla de colza (Patente Estadounidense No. 5.608.152), al promotor de USP de Vicia faba (Baeumlein y colaboradores, 1991, Mol Gen Genet. 225(3): 459 - 67), al promotor de oleosina de Arabidopsis (Solicitud PCT No. WO 98/45461), al promotor de faseolina de Phaseolus vulgaris (Patente Estadounidense No. 5.504.200), al promotor de Bce4 de Brassica (Solicitud PCT No.WO91/13980) o al promotor B4 de legumina (LeB4; Baeumlein y colaboradores, 1992 Plant Journal, 2(2): 233 - 9) así como los promotores que confieren expresión específica de la semilla en plantas monocotiledóneas como el maíz, cebada, trigo, centeno, arroz, etc. Los promotores apropiados para tener en cuenta son el promotor del gen lpt2 o lpt1 de cebada (Solicitud PCT No. WO 95/15389 y Solicitud PCT No. WO 95/23230) o aquellos descritos en la Solicitud PCT No.WO99/16890 (promotores del gen de la hordeína de la cebada, el gen de la glutelina del arroz, el gen de la orizina del arroz, el gen de la prolamina del arroz, el gen de gliadina del trigo, el gen de glutelina del trigo, el gen de zeína del maíz, el gen de glutelina de la avena, el gen de kasirina del Sorgo y el gen de secalina del centeno).

También son especialmente apropiados los promotores que confieren expresión génica específica del plástico, ya que los plástidos son el compartimiento donde se lleva a cabo la biosíntesis de lípidos. Los promotores adecuados son el promotor de polimerasa de ARN viral descrito en la Solicitud PCT No.WO95/16783 y en la Solicitud PCT No.WO97/06250 y el promotor de clpP de Arabidopsis descrito en la Solicitud PCT No. WO 99/46394.

También se contempla un vector de expresión recombinante que comprende una molécula de ADN de PHSRP de la invención clonada dentro el vector de expresión en una orientación antisentido. Es decir, la molécula de ADN está operativamente enlazada a una secuencia reguladora de una manera que permite la expresión (por transcripción de la molécula de ADN) de una molécula de ARN que es antisentido a un ARNm de PHSRP. Las secuencias reguladoras operativamente enlazadas a una molécula de ácido nucleico clonada en la orientación antisentido pueden ser seleccionadas para que dirijan la expresión continua de la molécula de ARN antisentido en una variedad de tipos de células. Por ejemplo, se pueden escoger promotores y/o potenciadores virales, o secuencias reguladoras para dirigir la expresión constitutiva, específica del tipo de célula o específica del tejido de ARN antisentido. El vector de expresión antisentido puede estar en la forma de un plásmido recombinante, fagémido o virus atenuado en donde los ácidos nucleicos antisentido se producen bajo el control de una región reguladora de alta eficiencia. La actividad de la región reguladora se puede determinar por medio del tipo de célula dentro de la cual se introduce el vector. Para una discusión de la regulación de la expresión génica utilizando genes antisentido ver Weintraub, H. y colaboradores, Antisense RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1 (1) 1986 y Mol y colaboradores, 1990, FEBS Letters 268: 427 - 430.

Otro aspecto de la invención se relaciona con células huésped en las cuales se ha introducido un vector de expresión recombinante de la invención. Los términos "célula huésped" y "célula huésped recombinante" se utilizan de forma intercambiable aquí. Se entiende que dichos términos no solamente se refieren a la célula de un individuo particular sino que se aplican también a la progenie o progenie potencial de dicha célula. Debido a que pueden presentarse ciertas modificaciones en generaciones sucesivas debido ya sea a mutación o a influencias ambientales, tal progenie puede, de hecho, no ser idéntica a la célula progenitora, pero no obstante está incluida dentro del alcance del término como se lo utiliza aquí.

Una célula huésped puede ser cualquier célula procariota o eucariota. Por ejemplo, una PHSRP se puede expresar en células bacterianas tal como C. glutamicum, células de insecto, células de hongos o células de mamífero (tales como células de ovario de hámster chino (CHO) o células COS), algas, ciliados, células de planta, hongos u otros microorganismos como C. glutamicum.

\hbox{Otras células huésped adecuadas son
conocidas por aquellos  capacitados en el arte.}

Se puede introducir un ADN vector en las células procariotas o eucariotas a través de técnicas convencionales de transformación o de transfección. Como se utiliza aquí, los términos "transformación", "transfección", "conjugación" y "transducción" pretenden hacer referencia a una variedad de técnicas reconocidas en el arte para la introducción de ácido nucleico foráneo (por ejemplo, ADN) en una célula huésped, incluyendo coprecipitación con fosfato de calcio o cloruro de calcio, transfección mediada por dextrano - DEAE, lipofección, competencia natural, transferencia químicamente mediada y electroporación. Los métodos apropiados para la transformación o transfección de células huésped incluidas células de planta pueden encontrarse en Sambrook, y colaboradores. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) y en otros manuales de laboratorio tales como Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, ed: Gartland y Davey, Humana Press, Totowa, New Jersey. Como la tolerancia al estrés biótico y abiótico es un rasgo general que se desea que sea heredado en una amplia variedad de plantas como maíz, trigo, centeno, avena, triticale, arroz, cebada, soja, maní, algodón, semilla de colza y canola, yuca, pimienta, girasol y tagetes, plantas solanáceas como patata, tabaco, berenjena, y tomate, especie Vicia, guisante, alfalfa, plantas de arbusto (café, cacao, té), especie Salix, árboles (palma aceitera, coco), pastos perennes y cultivos de forraje, estas plantas de cultivo también son plantas objetivo preferidas para una modificación por ingeniería genética como una modalidad adicional de la presente invención.

En particular, la invención proporciona un método para la producción de una planta transgénica con un ácido nucleico que codifica PHSRP, en donde la expresión de ácido(s) nucleico(s) en la planta resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta, que comprende: (a) la transformación de una célula de una planta con un vector de expresión que contiene un ácido nucleico para PHSRP, y (b) la generación a partir de la célula de una planta de una planta transgénica con una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta. La invención también proporciona un método para incrementar la expresión de un gen de interés dentro de una célula huésped en comparación con una variedad de tipo silvestre de la célula huésped, en donde el gen de interés es transcrito en respuesta a una PHSRP, que comprende: (a) la transformación de la célula huésped con un vector de expresión que comprende un ácido nucleico que codifica la PHSRP, y (b) la expresión de la PHSRP dentro de la célula huésped, incrementando por lo tanto la expresión del gen transcrito en respuesta a la PHSRP, en comparación con una variedad de tipo silvestre de la célula huésped.

Para dicha transformación de la planta, se pueden utilizar vectores binarios tales como pBinAR (Höfgen y Willmitzer, 1990, Plant Science 66: 221 - 230). La construcción de los vectores binarios se puede realizar por medio de la unión del ADNc en orientación sentido o antisentido dentro del T-ADN. 5 prima del ADNc, un promotor de una planta activa la transcripción del ADNc. Una secuencia de poliadenilación se localiza en el 3 prima del ADNc. La expresión específica del tejido se puede lograr por medio del uso de un promotor específico del tejido. Por ejemplo, la expresión específica de la semilla se puede lograr por medio de clonación del promotor de napina o LeB4 o USP 5 prima del ADNc. También se puede utilizar cualquier otro elemento promotor específico de la semilla. Para expresión constitutiva dentro de la planta completa, se puede utilizar el promotor 35S de CaMV. La proteína expresada puede ser dirigida a un compartimiento celular utilizando un péptido señal, por ejemplo para plástidos, mitocondria o retículo endoplasmático (Kermode, 1996, Crit. Rev. Plant Sci. 4 (15): 285 - 423). El péptido señal se clona 5 prima en el marco del ADNc para archivar la localización subcelular de la proteína de fusión. Adicionalmente, los promotores que son sensibles a estrés abiótico se pueden utilizar, tal como el promotor RD29A de Arabidopsis, con las secuencias de ácido nucleico divulgadas aquí. Alguien capacitado en el arte reconocerá que el promotor utilizado debería estar operativamente enlazado al ácido nucleico de tal manera que el promotor provoque la transcripción del ácido nucleico lo cual resulta en la síntesis de un ARNm que codifica un polipéptido. Alternativamente, el ARN puede ser un ARN antisentido para afectar la expresión posterior del mismo o de otro gen o genes.

Los métodos alternativos de transfección incluyen la transferencia directa del ADN dentro de las flores en desarrollo a través electroporación o transferencia génica mediada por Agrobacterium. La transformación de la planta mediada por Agrobacterium se puede realizar utilizando por ejemplo la cepa GV3101(pMP90) (Koncz y Schell, 1986, Mol. Gen. Genet. 204: 383 - 396) o LBA4404 (Clontech) de Agrobacterium tumefaciens. La transformación se puede realizar por medio de técnicas estándar de transformación y regeneración (Deblaere y colaboradores, 1994, Nucl. Acids. Res. 13: 4777 - 4788; Gelvin, Stanton B. y Schilperoort, Robert A, Plant Molecular Biology Manual, 2nd Ed. - Dordrecht: Kluwer Academic Publ., 1995, en Sect., Ringbuc Zentrale Signatur: BT11-P ISBN 0-7923-2731-4; Glick, Bernard R.; Thompson, John E., Methods in Plant Molecular Biology and Biotechnology, Boca Raton: CRC Press, 1993. - 360 S., ISBN 0-8493-5164-2). Por ejemplo, la semilla de colza se puede transformar a través de transformación del cotiledón o del hipocotiledón (Moloney y colaboradores, 1989, Plant cell Report 8: 238 - 242; De Block y colaboradores, 1989 Plant Physiol. 91: 694 - 701). El uso de antibióticos para la selección de la planta y del Agrobacterium depende del vector binario y de la cepa de Agrobacterium utilizada para la transformación. La selección de la semilla de colza normalmente se realiza utilizando kanamicina como un marcador seleccionable de la planta. La transferencia génica mediada por Agrobacterium para lino se puede realizar utilizando, por ejemplo, una técnica descrita por Mlynarova y colaboradores, 1994, Plant Cell Report 13: 282 - 285. Adicionalmente, la transformación de la soja se puede realizar utilizando por ejemplo una técnica descrita en la Patente Europea No. 0424 047, Patente Estadounidense No. 5.322.783, Patente Europea Aplicación No. 0397 687, en la Patente Estadounidense No. 5.376.543 o en la Patente Estadounidense No. 5.169.770. La transformación del maíz se puede lograr por bombardeo de partículas, incorporación del ADN mediada por polietilén glicol o a través de la técnica de la fibra de carburo de silicio. (Ver, por ejemplo, Freeling y Walbot "The maize handbook" Springer Verlag: New York (1993) ISBN 3-540-97826-7). Un ejemplo específico de la transformación del maíz se encuentra en la Patente Estadounidense No. 5.990.387 y un ejemplo específico de la transformación del trigo se puede encontrar en la Solicitud PCT No. WO 93/07256.

Para la transfección estable de células de mamífero, se sabe que, dependiendo del vector de expresión y de la técnica de transfección utilizada, únicamente una pequeña fracción de células puede integrar el ADN foráneo en su genoma. Con el fin de identificar y seleccionar estos integrantes, se introduce generalmente un gen que codifica un marcador seleccionable (por ejemplo, de resistencia a los antibióticos) en las células huésped junto con el gen de interés. Los marcadores seleccionables preferidos incluyen a aquellos que confieren resistencia a los fármacos, tales como G418, higromicina y metotrexato o en plantas que confieren resistencia a un herbicida tal como glifosato o glufosinato. Las moléculas de ácido nucleico que codifican un marcador seleccionable se pueden introducir en una célula huésped en el mismo vector que aquel que codifica una PHSRP o se puede introducir en un vector separado. Las células transfectadas en forma estable con la molécula de ácido nucleico introducida se pueden identificar, por ejemplo, por medio de selección del fármaco (por ejemplo, las células que tienen incorporado el gen del marcador seleccionable sobrevivirán, mientras que las otras células morirán).

Para crear un microorganismo recombinante homólogo, se prepara un vector que contiene al menos una porción de un gen para PHSRP en el cual se ha introducido una supresión, adición o sustitución para alterar así, por ejemplo, al gen para PHSRP, funcionalmente interrumpido. Preferiblemente, el gen para PHSRP es un gen para PHSRP de Physcomitrella patens, pero, puede ser un homólogo de una planta relacionada o incluso de una fuente de mamífero, levadura, o insecto. En una modalidad preferida, se diseña preferiblemente el vector de modo que, por recombinación homóloga, el gen endógeno para PHSRP esté funcionalmente interrumpido (es decir, ya no codifique más una proteína funcional; también denominado como un vector desactivado). Alternativamente, se puede diseñar el vector de modo que, por recombinación homóloga, se mute o bien se altere el gen endógeno para PHSRP pero aún codifique una proteína funcional (por ejemplo, se puede alterar la región reguladora secuencia arriba para alterar así la expresión de la PHSRP endógena). Para crear una mutación puntual a través de recombinación homóloga, se pueden utilizar los híbridos de ADN-ARN en una técnica conocida como quimeroplastia (Cole-Strauss y colaboradores, 1999, Nucleic Acids Research 27(5): 1323 - 1330 y Kmiec, 1999, Gene therapy American Scientist. 87(3): 240 - 247). Los procedimientos de recombinación homóloga en Physcomitrella patens son también bien conocidos en el arte y se contempla su uso aquí.

Mientras que en el vector de recombinación homóloga, la porción alterada del gen para PHSRP está flanqueado en sus extremos 5' y 3' por una molécula adicional de ácido nucleico del gen para PHSRP para permitir que se produzca la recombinación homóloga entre el gen exógeno para PHSRP transportado por el vector y un gen endógeno para PHSRP, en un microorganismo o planta. La molécula adicional que flanquea al ácido nucleico para PHSRP es de una longitud suficiente para la exitosa recombinación homóloga con el gen endógeno. Típicamente, varios cientos de pares de bases hasta kilobases del ADN de flanqueo (tanto en el extremo 5' como en el extremo 3') están incluidos en el vector (ver por ejemplo, Thomas, K. R., y Capecchi, M. R., 1987, Cell 51: 503 para una descripción de vectores de recombinación homóloga o Strepp y colaboradores, 1998, PNAS, 95 (8): 4368 - 4373 para ADNc con base en la recombinación en Physcomitrella patens). Se introduce el vector en un microorganismo o célula de una planta (por ejemplo, a través de ADN mediado por polietilén glicol), y se seleccionan las células en las cuales el gen introducido para PHSRP se ha recombinado en forma homóloga con el gen endógeno para PHSRP utilizando técnicas conocidas en el arte.

En otra modalidad, se pueden producir microorganismos recombinantes que contengan sistemas seleccionados que permitan la expresión regulada del gen introducido. Por ejemplo, la inclusión de un gen para PHSRP sobre un vector colocándolo bajo el control del operón lac permite la expresión del gen para PHSRP solamente en presencia de IPTG. Tales sistemas reguladores son bien conocidos en el arte.

Se puede utilizar una célula huésped de la invención, tal como una célula huésped procariota o eucariota en cultivo, para producir (es decir, expresar) una PHSRP. Por consiguiente, la descripción proporciona además métodos para la producción de las PHSRP utilizando las células huésped de la invención. En una modalidad, el método comprende el cultivo de la célula huésped de la invención (en la cual se ha introducido un vector de expresión recombinante que codifica una PHSRP, o en cuyo genoma se ha introducido un gen que codifica una PHSRP de tipo silvestre o alterada) en un medio apropiado hasta que se produce la PHSRP. En otra modalidad, el método comprende además el aislamiento de las PHSRP del medio o de la célula huésped.

Otro aspecto de la invención se relaciona con la PP2A-2 aislada. Una proteína "aislada" o "purificada" o una porción biológicamente activa de la misma están libres de algo del material celular cuando se las produce por medio de técnicas de ADN recombinante, o de precursores químicos o de otros productos químicos cuando se sintetizan químicamente. La expresión "sustancialmente libre de material celular" incluye preparaciones de PHSRP en las que se separa la proteína de alguno de los componentes celulares de las células en las cuales se produce en forma natural o recombinante. En una modalidad, la expresión "sustancialmente libre de material celular" incluye preparaciones de una PHSRP que tiene aproximadamente menos del 30% (en peso seco) de material que no es PHSRP (también se lo denomina aquí como una "proteína contaminante"), más preferiblemente aproximadamente menos del 20% de material que no es PHSRP, aún más preferiblemente aproximadamente menos del 10% de material que no es PHSRP, y más preferiblemente aproximadamente menos del 5% de material que no es PHSRP.

Cuando se produce en forma recombinante la PHSRP o una porción biológicamente activa de la misma, también está preferiblemente sustancialmente libre de medio de cultivo, es decir, que el medio de cultivo representa aproximadamente menos del 20%, más preferiblemente aproximadamente menos del 10%, y más preferiblemente aproximadamente menos del 5% del volumen de la preparación de la proteína. La expresión "sustancialmente libre de precursores químicos o de otros productos químicos" incluye preparaciones de PHSRP en las que la proteína se separa a partir de precursores químicos o de otros productos químicos que están involucrados en la síntesis de la proteína. En una modalidad, la expresión "sustancialmente libre de precursores químicos o de otros productos químicos" incluye preparaciones de una PHSRP que tienen aproximadamente menos del 30% (en peso seco) de precursores químicos o de productos químicos que no son PHSRP, más preferiblemente aproximadamente menos del 20% de precursores químicos o de productos químicos que no son PHSRP, aún más preferiblemente aproximadamente menos del 10% de precursores químicos o de productos químicos que no son PHSRP, y lo más preferible aproximadamente menos del 5% de precursores químicos o de productos químicos que no son PHSRP. En modalidades preferidas, las proteínas aisladas, o porciones biológicamente activas de estas, carecen de proteínas contaminantes del mismo organismo del cual se deriva la PHSRP. Típicamente, tales proteínas se producen por expresión recombinante, por ejemplo, de una PHSRP de Physcomitrella patens en plantas diferentes de Physcomitrella patens o de microorganismos tales como C. glutamicum, ciliados, algas u hongos.

Las moléculas de ácido nucleico, proteínas, homólogos de proteína, proteínas de fusión, iniciadores, vectores, y células huésped descritas aquí se pueden utilizar en uno o más de los siguientes métodos: identificación de Physcomitrella patens y de organismos relacionados; mapeo de genomas de organismos relacionados con Physcomitrella patens; identificación y localización de secuencias de interés de Physcomitrella patens; estudios evolutivos; determinación de regiones de PHSRP requeridas para la función; modulación de una actividad de PHSRP; modulación del metabolismo de una o más funciones de la célula; modulación del transporte a través de la membrana de uno o más compuestos; y modulación de la resistencia al estrés.

El musgo Physcomitrella patens representa un miembro de los musgos. Esta relacionado con otros musgos tales como el Ceratodon purpureus que es capaz de crecer en ausencia de luz. Los musgos como Ceratodon y Physcomitrella comparten un alto grado de homología en la secuencia de ADN y el nivel de polipéptido permitiendo el uso de la selección heteróloga de moléculas de ADN con sondas que evolucionan a partir de otros musgos u organismos, permitiendo de esta manera la derivación de una secuencia de consenso apropiada para la selección heteróloga o anotación funcional y predicción de funciones del gen en una tercera especie. La habilidad para identificar tales funciones puede tener por consiguiente una relevancia significativa, por ejemplo, la predicción de la especificidad del sustrato de enzimas. Además, estas moléculas de ácido nucleico pueden servir como puntos de referencia para el mapeo de genomas de musgo, o de genomas de organismos relacionados.

Las moléculas de ácido nucleico para PHSRP de la invención tienen una variedad de usos. Lo más importante, las secuencias del ácido nucleico y del aminoácido de la presente invención se pueden utilizar para transformar plantas, induciendo por consiguiente tolerancia a estreses tales como sequía. La presente invención proporciona por lo tanto una planta transgénica transformada por un ácido nucleico para PHSRP, en donde la expresión de la secuencia del ácido nucleico en la planta resulta en un mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta. La planta transgénica puede ser una monocotiledónea o una dicotiledónea. La invención permite además que se pueda seleccionar la planta transgénica a partir de maíz, trigo, centeno, avena, triticale, arroz, cebada, soja, maní, algodón, semilla de colza, canola, yuca, pimienta, girasol, tagetes, plantas solanáceas, patata, tabaco, berenjena, tomate, especie Vicia, guisante, alfalfa, café, cacao, té, especie Salix, palma oleaginosa, coco, hierba perenne y cultivos de forraje, por ejemplo.

En particular, la presente invención describe el uso de la expresión de PP2A-2 (SEQ ID NO: 11) de Physcomitrella patens para modificar por medio de ingeniería genética plantas tolerantes a la sequía. Esta estrategia ha sido demostrada aquí para Arabidopsis thaliana, Semilla de colza/Canola, soja, maíz y trigo pero su aplicación no se restringe a estas plantas. Por consiguiente, la invención proporciona una planta transgénica que contiene una PHSRP seleccionada de una proteína fosfatasa 2A en donde el estrés ambiental es sequía o disminución de la temperatura.

La presente invención también proporciona métodos para modificar la tolerancia al estrés de una planta que comprenden, modificar la expresión de una PHSRP en la planta. La invención establece que este método se puede realizar de tal manera que o bien se aumente o se disminuya la tolerancia al estrés. En particular, la presente invención proporciona métodos para la producción de una planta transgénica que tiene una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta que comprende el aumento de la expresión de una PHSRP en una planta.

Los métodos para aumentar la expresión de las PHSRP se pueden utilizar en donde la planta sea o bien transgénica o no transgénica. En los casos en los cuales la planta es transgénica, se puede transformar la planta con un vector que contiene cualquiera de los ácidos nucleicos que codifican la PHSRP descrita arriba, o se puede transformar la planta con un promotor que dirige la expresión de la PHSRP nativa en la planta, por ejemplo. La invención establece que dicho promotor puede ser específico del tejido. Adicionalmente, tal promotor puede ser regulado por desarrollo. Alternativamente, las plantas no transgénicas pueden tener la expresión nativa de PHSRP modificada por inducción de un promotor nativo.

La expresión de PP2A-2 (SEQ ID NO: 11) en plantas objetivo se puede lograr por, pero no se limita a, uno de los siguientes ejemplos: (a) un promotor constitutivo, (b) un promotor inducible por estrés, (c) un promotor químicamente inducido, y (d) sobreexpresión del promotor modificado por medio de ingeniería genética por ejemplo factores de transcripción derivados de un dedo de zinc (Greisman y Pabo, 1997, Science 275: 657). El último caso involucra la identificación de los homólogos de PP2A-2 (SEQ ID NO: 11) en la planta objetivo así como de su promotor. Los factores de transcripción recombinante que contienen el dedo de zinc se modifican por medio de ingeniería genética para interactuar específicamente con el homólogo de PP2A-2 (SEQ ID NO: 11) y se activa la transcripción del gen correspondiente.

Además de la introducción de las secuencias del ácido nucleico para PHSRP en las plantas transgénicas, estas secuencias también se pueden utilizar para identificar un organismo como la Physcomitrella patens o un familiar cercano de este. También, se pueden utilizar para identificar la presencia de Physcomitrella patens o de un familiar de este en una población mixta de microorganismos. La descripción proporciona las secuencias de ácido nucleico de una cantidad de genes de Physcomitrella patens; por medio del sondeo del ADN genómico extraído de un cultivo de una población única o mixta de microorganismos bajo condiciones rigurosas con un sonda que abarca una región de un gen de Physcomitrella patens que es único para este organismo, se puede comprobar si este organismo está
presente.

Adicionalmente, las moléculas de ácido nucleico y de proteína de la invención pueden servir como marcadores para regiones específicas del genoma. Esto tiene utilidad no solamente en el mapeo del genoma, sino también en estudios funcionales de las proteínas de Physcomitrella patens. Por ejemplo, para identificar la región del genoma a la cual se enlaza una proteína particular de enlazamiento de ADN de Physcomitrella patens, se puede digerir el genoma de Physcomitrella patens, e incubar los fragmentos con la proteína que enlaza al ADN. Aquellos fragmentos que enlazan la proteína pueden ser adicionalmente sondeados con las moléculas de ácido nucleico de la invención, preferiblemente con marcadores fácilmente detectables. El enlazamiento de tal molécula de ácido nucleico con el fragmento del genoma permite la localización del fragmento en el mapa del genoma de Physcomitrella patens, y, cuando se realiza múltiples veces con diferentes enzimas, se facilita una determinación rápida de la secuencia del ácido nucleico a la cual se enlaza la proteína. Adicionalmente, las moléculas de ácido nucleico de la invención pueden ser suficientemente homólogas a las secuencias de especies relacionadas de modo que estas moléculas de ácido nucleico pueden servir como marcadores para la construcción de un mapa genómico en musgos relacionados.

Las moléculas de ácido nucleico de PHSRP de la invención también son útiles para estudios evolutivos y estructurales de la proteína. Los procesos metabólicos y de transporte en los cuales participan las moléculas de la invención, son utilizados por una amplia variedad de células procariotas y eucariotas; compactando las secuencias de las moléculas de ácido nucleico de la presente invención con aquellas que codifican enzimas similares de otros organismos, se puede evaluar la relación evolutiva de los organismos. De manera similar, tal comparación permite una valoración de cuales regiones de la secuencia se conservan y cuáles no, cuáles puede ayudar a determinar aquellas regiones de la proteína que son esenciales para el funcionamiento de la enzima. Este tipo de determinación es valiosa para los estudios de modificación por medio de ingeniería genética de proteínas y puede dar una indicación de lo que la proteína puede tolerar en términos de mutagénesis sin perder su función.

La manipulación de las moléculas de ácido nucleico para PHSRP de la invención puede resultar en la producción de las PHSRP que tienen diferencias funcionales con relación a las PHSRP de tipo silvestre. Estas proteínas se pueden mejorar en eficiencia o actividad, pueden estar presentes en grandes números en la célula por encima de lo usual, o pueden disminuir en eficiencia o en actividad.

Existen una cantidad de mecanismos por medio de los cuales la alteración de una PHSRP de la invención puede afectar directamente la respuesta al estrés y/o la tolerancia al estrés. En el caso de plantas que expresan las PHSRP, un mayor transporte puede conducir a mejorar la repartición de la sal y/o del soluto dentro de los tejidos y los órganos de la planta. Ya sea por medio de un incremento del número o de la actividad de las moléculas transportadoras que exportan moléculas iónicas de la célula, puede ser posible afectar la tolerancia de la célula a la sal.

El efecto de la modificación genética en plantas, C. glutamicum, hongos, algas, o ciliados con respecto a la tolerancia al estrés se puede evaluar por medio del crecimiento del microorganismo o de la planta modificada bajo condiciones menos apropiadas y luego analizar las características de crecimiento y/o metabolismo de la planta. Tales técnicas de análisis son bien conocidas por alguien capacitado en el arte, e incluyen peso seco, peso húmedo, síntesis de proteína, síntesis de carbohidratos, síntesis de lípidos, índices de evapotranspiración, rendimiento general de la planta y/o del cultivo, floración, reproducción, puesta de semillas, crecimiento de la raíz, tasas de respiración, tasas de fotosíntesis, etc. (Applications of HPLC in Biochemistry en: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17; Rehm y colaboradores, 1993, Biotechnology, vol. 3, Capítulo III: Product recovery and purification, páginas 469 - 714, VCH: Weinheim; Belter, P. A. y colaboradores, 1988, Bioseparations: downstream processing for biotechnology, John Wiley and Sons; Kennedy, J. F. y Cabral, J. M. S., 1992, Recovery processes for biological materials, JohnWiley and Sons; Shaeiwitz, J. A. y Henry, J. D., 1988, Biochemical separations, en: Ulmann's Encyclopedia of Industrial Chemistry, vol. B3, Capítulo 11, páginas 1 - 27, VCH: Weinheim y Dechow, F. J. (1989) Separation and purification techniques in biotechnology, Noyes Publications).

Por ejemplo, los vectores de expresión de levadura que comprenden los ácidos nucleicos divulgados aquí, o fragmentos de los mismos, se pueden construir y transformar en Saccharomyces cerevisiae utilizando protocolos estándar. Las células transgénicas resultantes se pueden analizar luego por la falla o alteración de su tolerancia al estrés por sequía, sal y temperatura. De manera similar, los vectores de expresión de la planta que contienen los ácidos nucleicos revelados aquí, o fragmentos de los mismos, se pueden construir y transformar en una célula apropiada de una planta tal como Arabidopsis, soja, colza, maíz, trigo, Medicago truncatula, etc., utilizando protocolos estándar. Las células y/o plantas transgénicas resultantes derivadas de allí, se pueden analizar luego por la falla o alteración de su tolerancia al estrés por sequía, sal y temperatura.

La modificación por medio de ingeniería genética de uno o más genes para PHSRP de la invención puede resultar también en las PHSRP que tienen actividades alteradas, que impactan indirectamente la respuesta al estrés y/o la tolerancia al estrés de algas, plantas, ciliados u hongos u otros microorganismos como C. glutamicum. Por ejemplo, los procesos bioquímicos normales del metabolismo resultan en la producción de una variedad de productos (por ejemplo, peróxido de hidrógeno y otra especie reactiva de oxígeno) que puede interferir activamente con estos mismos procesos metabólicos (por ejemplo, se sabe que el peroxinitrito nitra las cadenas laterales de tirosina, inactivando así algunas enzimas que tienen tirosina en el sitio activo (Groves, J. T., 1999, Curr. Opin. Chem. Biol. 3(2): 226 - 235). Aunque típicamente estos productos son excretados, se pueden alterar genéticamente las células para transportar más productos lo que es típico para una célula de tipo silvestre. Optimizando la actividad de una o más de las PHSRP de la invención que están involucradas en la exportación de moléculas específicas, tal como moléculas de sal, puede ser posible mejorar la tolerancia al estrés por parte de la célula.

\newpage

\global\parskip0.900000\baselineskip

Adicionalmente, se pueden utilizar las secuencias divulgadas aquí, o fragmentos de las mismas, para generar mutaciones desactivadas en los genomas de diferentes organismos, tales como bacterias, células de mamífero, células de levadura, y células de planta (Girke, T., 1998, The Plant Journal 15: 39 - 48). Las células desactivadas resultantes se pueden evaluar luego por su habilidad o capacidad para tolerar diferentes condiciones de estrés, su respuesta a diferentes condiciones de estrés, y el efecto sobre el fenotipo y/o el genotipo de la mutación. Para otros métodos de inactivación génica ver la Patente Estadounidense No. 6.004.804, "Non-Chimeric Mutational Vectors" y Puttaraju y colaboradores,

\hbox{1999,
Spliceosome-mediada RNA transsplicing as a tool for
gen therapy  Nature Biotechnology 17: 246 - 252.}

Las estrategias de mutagénesis citadas anteriormente para las PHSRP que resultan en una mayor resistencia al estrés no pretenden ser limitantes; las variaciones sobre estas estrategias serán evidentes para alguien capacitado en el arte. Utilizando tales estrategias, e incorporando los mecanismos revelados aquí, se pueden utilizar las moléculas de ácido nucleico y de proteína de la invención para generar algas, ciliados, plantas, hongos u otros microorganismos como C. glutamicum que expresan moléculas mutadas de proteína y de ácido nucleico de PHSRP de modo que se mejore la tolerancia al estrés.

La presente descripción también proporciona anticuerpos que se enlazan específicamente a una PHSRP, o a una porción de la misma, como los codificados por un ácido nucleico descrito aquí. Los anticuerpos se pueden elaborar por medio de muchos métodos bien conocidos (Ver, por ejemplo Harlow y Lane, "Antibodies; A Laboratory Manual" Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1988)).En resumen, se puede inyectar el antígeno purificado en un animal en una cantidad y en intervalos suficientes para obtener una respuesta inmune. Los anticuerpos pueden ser ya sea purificados directamente, o se pueden obtener células de bazo del animal. Se pueden fusionar luego las células con una línea de células inmortales y seleccionar la secreción de anticuerpos. Los anticuerpos se pueden utilizar para seleccionar las bibliotecas de clones de ácido nucleico para células que secretan el antígeno. Aquellos clones positivos pueden ser luego secuenciados. (Ver, por ejemplo, Kelly y colaboradores, 1992, Bio/Technology 10: 163 - 167; Bebbington y colaboradores, 1992, Bio/Technology 10: 169 - 175).

Las expresiones se "enlaza selectivamente" y se "enlaza específicamente" con el polipéptido se refieren a una reacción de enlazamiento que es determinativa de la presencia de la proteína en una población heterogénea de proteínas y otros compuestos biológicos. Por lo tanto, bajo las condiciones designadas del inmunoensayo, los anticuerpos especificados enlazados con una proteína particular no se enlazan en una cantidad significativa a otras proteínas presentes en la muestra. El enlace selectivo de un anticuerpo bajo tales condiciones puede requerir de un anticuerpo que sea seleccionado por su especificidad por una proteína particular. Se pueden utilizar una variedad de formatos de inmunoensayo para seleccionar los anticuerpos que selectivamente se enlazan con una proteína particular. Por ejemplo, se utilizan rutinariamente inmunoensayos de ELISA en fase sólida para seleccionar los anticuerpos selectivamente inmunoreactivos con una proteína. Ver Harlow y Lane "Antibodies, A Laboratory Manual" Cold Spring Harbor Publications, New York, (1988), para una descripción de formatos de inmunoensayo y las condiciones que podrían utilizarse para determinar el enlazamiento selectivo.

En algunos casos, es deseable preparar anticuerpos monoclonales de varios huéspedes. Una descripción de técnicas para preparar tales anticuerpos monoclonales se puede encontrar en Stites y colaboradores, editors, "Basic and Clinical Immunology," (Lange Medical Publications, Los Altos, Calif., Fourth Edition) y las referencia citadas allí, y en Harlow y Lane ("Antibodies, A Laboratory Manual" Cold Spring Harbor Publications, New York, 1988).

La invención se ilustra además por medio de los siguientes ejemplos, que no se deben interpretar de ninguna manera como la imposición de limitaciones del alcance de la misma.

Ejemplos

Ejemplo 1

Crecimiento de cultivos de Physcomitrella patens

Para este estudio, se utilizaron plantas de la especie Physcomitrella patens (Hedw.) B.S.G. de la colección de la sección de estudios genéticos de la Universidad de Hamburgo.

Ellas se originaron a partir de la cepa 16/14 recolectada por H. L. K. Whitehouse en Gransden Wood, Huntingdonshire (Inglaterra), las cuales fueron subcultivadas a partir de una espora por Engel (1968, Am. J. Bot. 55, 438 - 446). La proliferación de las plantas se realizó por medio de esporas y por medio de regeneración de los gametofitos. El protonema desarrollado a partir de la espora haploide como un cloronema rico en cloroplastos y un caulonema bajo en cloroplastos, sobre los cuales se formaron los brotes aproximadamente después de 12 días. Estos crecieron para producir gametóforos que tienen anteridios y arquegonios. Después de la fertilización, resultó el esporofito diploide con una seta corta y la cápsula de esporas, en el cual maduraron las meiosporas.

El cultivo se llevó a cabo en una cámara climática a temperatura ambiente de 25ºC y una intensidad de luz de 55 micromoles^{-lm2} (luz blanca; tubo fluorescente Philips TL 65W/25) y un cambio de luz/oscuridad de 16/8 horas. El musgo fue modificado ya sea en cultivo líquido utilizando medio de Knop de acuerdo con Reski y Abel (1985, Planta 165: 354 - 358) o cultivado sobre medio sólido de Knop utilizando agar oxoid al 1% (Unipath, Basingstoke, Inglaterra). Los protonemas utilizados para el aislamiento del ARN y del ADN se cultivaron en cultivos líquidos aireados. Los protonemas se trituraron cada 9 días y transferidos a un medio de cultivo fresco.

Ejemplo 2

Aislamiento del ADN total de las plantas

Los detalles para el aislamiento del ADN total se relacionan con el tratamiento de un gramo de peso fresco de material de la planta. Los materiales utilizados incluyen las siguientes amortiguadores: amortiguador CTAB: 2% (p/v) de bromuro de N-cetil-N,N,N-trimetilamonio (CTAB); Tris-HCl 100 mM, pH 8,0; NaCl 1,4 M; EDTA 20 mM; amortiguador de N-Laurilsarcosina: 10% (p/v) N-laurilsarcosina; Tris HCl 100 mM pH 8,0; EDTA 20 mM.

Se trituró el material de la planta bajo nitrógeno líquido en un mortero para producir un polvo fino y se lo transfirió a recipientes Eppendorf de 2 ml. Se cubrió luego el material congelado de la planta con una capa de 1 ml de amortiguador de descomposición (1 ml de amortiguador CTAB, 100 \mul de amortiguador N-laurilsarcosina, 20 \mul de \beta-mercaptoetanol y 10 \mul de solución de proteinasa K, 10 mg/ml) y se incubó a 60ºC durante una hora con agitación continua. El homogeneizado obtenido se repartió en dos recipientes de Eppendorf (2 ml) y se extrajo dos veces por medio de agitación con el mismo volumen de cloroformo/alcohol isoamílico (24:1). Para la separación de fases, se llevó a cabo una centrifugación a 8000 x g y a temperatura ambiente durante 15 minutos en cada caso. Se precipitó luego el ADN a -70ºC durante 30 minutos utilizando isopropanol enfriado sobre hielo. Se sedimentó el ADN precipitado a 4ºC y 10.000 g durante 30 minutos y se resuspendió en 180 \mul de amortiguador TE (Sambrook y colaboradores, 1989, Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6). Para una purificación adicional, se trató el ADN con NaCl (concentración final 1,2 M) y se precipitó otra vez a -70ºC durante 30 minutos utilizando dos veces el volumen de etanol absoluto. Después de una etapa de lavado con etanol al 70%, se secó el ADN y posteriormente se lo recogió en 50 \mul de H_{2}O + ARNasa (concentración final 50 mg/ml). Se disolvió el ADN durante la noche a 4ºC y se llevó a cabo posteriormente la digestión con ARNasa a 37ºC por 1 hora. El almacenamiento del ADN se hizo a 4ºC.

Ejemplo 3

Aislamiento de ARN total y construcción de la biblioteca de poli-(A)^{+} ARN y ADNc de Physcomitrella patens

Para la investigación de transcripciones, se aislaron tanto ARN total como poli-(A)^{+}ARN. El ARN total se obtuvo de protonemata de tipo silvestre de 9 días de edad siguiendo el método GTC (Reski y colaboradores. 1994, Mol. Gen. Genet., 244: 352 - 359). Se aisló el Poli(A)+ARN utilizando Dyna Beads^{R} (Dynal, Oslo, Noruega) siguiendo las instrucciones del protocolo del fabricante. Después de la determinación de la concentración del ARN o del poli(A)+ ARN, se precipitó el ARN mediante la adición de 1/10 de volumen de acetato de sodio 3 M, pH 4,6 y 2 volúmenes de etanol y se almacenó a -70ºC.

Para la construcción de la genoteca de ADNc, se logró primero la síntesis de la cadena utilizando la transcriptasa inversa del Virus de Leucemia de Múrido (Roche, Mannheim, Alemania) y los iniciadores oligo-d(T), la síntesis de la segunda cadena por incubación con ADN polimerasa I, enzima Klenow y digestión con ARNseH a 12ºC (2 horas), 16ºC (1 hora) y 22ºC (1 hora). Se detuvo la reacción por incubación a 65ºC (10 minutos) y posteriormente se transfirió a hielo. Las moléculas de ADN bicatenario se volvieron romas por medio de T4-ADN-polimerasa (Roche, Mannheim) a 37ºC (30 minutos). Se removieron los nucleótidos por extracción con fenol/cloroformo y columnas de giro de Sefadex G50. Se ligaron los adaptadores de EcoRI (Pharmacia, Freiburg, Alemania) a los extremos del ADNc por medio de la T4-ADN-ligasa (Roche, 12ºC, durante la noche) y se fosforiló por incubación con polinucleótido quinasa (Roche, 37ºC, 30 minutos). Se sometió esta mezcla a separación sobre moléculas de ADN en gel de agarosa de bajo punto de fusión, se eluyeron las mayores a 300 pares de bases del gel, se extrajo con fenol, se concentró sobre columnas de Elutip-D (Schleicher y Schuell, Dassel, Alemania) y se ligaron a los brazos del vector y se empacó en fagos ZAPII lambda o fagos ZAP-Express lambda utilizando el Kit Gigapack Gold (Stratagene, Ámsterdam, Países Bajos) utilizando el material y siguiendo las instrucciones del fabricante.

Ejemplo 4

Secuenciación y función de anotación de los EST de Physcomitrella patens

Se utilizaron las bibliotecas de ADNc como se describe en el Ejemplo 3 para la secuenciación del ADN de acuerdo con métodos estándar, y en particular, por medio del método de terminación de la cadena utilizando el Big Dye Terminator Cycle Sequencing Ready Reaction Kit de ABI PRISM (Perkin-Elmer, Weiterstadt, Alemania). Se llevó a cabo una secuenciación aleatoria después de la recuperación preparativa del plásmido a partir de bibliotecas de ADNc a través de escisión de masa in vivo, retransformación, y posterior siembra en placa de DH10B sobre placas de agar (detalles del material y el protocolo de Stratagene, Ámsterdam, Países Bajos). Se preparó ADN del plásmido a partir de cultivos de E. coli que se desarrollaron durante la noche, cultivados en medio de Caldo Luria que contiene ampicilina (ver Sambrook y colaboradores. 1989, Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6) sobre un robot para preparación de ADN de Qiagene (Qiagen, Hilden) de acuerdo con el protocolo del fabricante. Se utilizaron los iniciadores de secuenciación con las siguientes secuencias de nucleótidos:

5'-CAGGAAACAGCTATGACC-3'
SEQ ID NO: 16

5'-CTAAAGGGAACAAAAGCTG-3'
SEQ ID NO: 17

5'-TGTAAAACGACGGCCAGT-3'
SEQ ID NO: 18

\newpage

\global\parskip1.000000\baselineskip

Se procesaron las secuencias y se anotaron utilizando el paquete de programa EST-MAX comercialmente suministrado por Bio-Max (Múnich, Alemania). El programa incorpora prácticamente todos los métodos bioinformáticos importantes para la caracterización funcional y estructural de las secuencias de proteína. Para referencia remítase al sitio web en pedant.mips.biochem.mpg.de. Los algoritmos más importantes incorporados en EST-MAX son: FASTA: Very sensitive sequence database searches with estimates of statistical significance; Pearson W. R. (1990) Rapid and sensitive sequence comparison with FASTP and FASTA. Methods Enzymol. 183: 63 - 98; BLAST: Very sensitive sequence database searches with estimates of statistical significance. Altschul S. F., Gish W., Miller W., Myers E.W., y Lipman D. J. Basic local alignment search tool. Journal of Molecular Biology 215: 403 - 10; PREDATOR: High-accuracy secondary structure prediction from single and multiple sequences. Frishman, D. y Argos, P. (1997) 75% accuracy in protein secondary structure prediction. Proteins, 27: 329 - 335; CLUSTALW: Multiple sequence alignment. Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673 - 4680; TMAP: Transmembrane region prediction from multiply aligned sequences. Persson, B. y Argos, P. (1994) Prediction of transmembrane segments in proteins utilizing multiple sequence alignments. J. Mol. Biol. 237: 182 - 192; ALOM2: Transmembrane region prediction from single sequences. Klein, P., Kanehisa, M., y DeLisi, C. Prediction of protein function from sequence properties: A discriminate analysis of a database. Biochim. Biophys. Acta 787: 221 - 226 (1984). Version 2 por el Dr. K. Nakai; PROSEARCH: Detection of PROSITE protein sequence patterns. Kolakowski L. F. Jr., Leunissen J. A. M., Smith J. E. (1992) ProSearch: fast searching of protein sequences with regular expression patterns related to protein structure and function. Biotechniques 13, 919 - 921; BLIMPS: Similarity searches against a database of ungapped blocks. J. C.Wallace y Henikoff S., (1992); PATMAT: A searching and extraction program for sequence, pattern and block queries and databases, CABIOS 8: 249 - 254. Written by Bill Alford.

\vskip1.000000\baselineskip

Ejemplo 5

Identificación de los ORF de Physcomitrella patens correspondientes a PP2A-2

Los ADNc parciales de Physcomitrella patens (EST) mostrados en la Tabla 1 abajo, se identificaron en el programa de secuenciación EST de Physcomitrella patens utilizando el programa BST-MAX a través de un análisis BLAST. Los Números de Identificación de Secuencia correspondientes a este EST son los siguientes: PP2A-2 (SEQ ID NO: 1) PP2A-2 es homóloga a la subunidad reguladora de la proteína fosfatasa 2A de humano.

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip
TABLA 1

1

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip
TABLA 2 Grado de identidad y de similitud de aminoácidos de PpPP2A-2 y otras proteínas homólogas (se utilizó el programa GCG Gap: penalización por hueco: 10; penalización por extensión del hueco: 0,1; matriz de la puntuación: blosum62)

2

3

\vskip1.000000\baselineskip

Ejemplo 6

Clonación de la longitud completa del ADNc de Physcomitrella patens que codifica para PP2A-2

Para aislar la PP2A-2 de longitud completa (SEQ ID NO: 6) de Physcomitrella patens, se crearon bibliotecas de ADNc con el kit de Amplificación de ADNc SMART RACE (Clontech Laboratories) siguiendo las instrucciones del fabricante. Se utilizó el ARN total aislado como se describe en el Ejemplo 2 como el molde. Se trataron los cultivos antes del aislamiento del ARN de la siguiente manera: Estrés por Sal: 2, 6, 12, 24, 48 horas con medio suplementado con NaCl 1M; Estrés por Frío: 4ºC durante los mismos períodos de tiempo que para la sal; Estrés por Sequía: se incubaron los cultivos sobre papel de filtro seco durante los mismos períodos de tiempo que para la
sal.

\vskip1.000000\baselineskip
Protocolo 5' RACE

Se utilizó la secuencia EST PP2A-2 (SEQ ID NO: 1) identificada a partir de la búsqueda en la base de datos como se describe en el Ejemplo 4, para diseñar los oligos para RACE. Se obtuvieron las secuencias extendidas para estos genes llevando a cabo una Amplificación Rápida de reacción en cadena de la polimerasa de los extremos del ADNc (RACE PCR) utilizando el kit de PCR Advantage 2 (Clontech Laboratories) y el kit de amplificación de ADNc SMART RACE (Clontech Laboratories) utilizando un Termociclador Biometra T3 siguiendo las instrucciones del fabricante. Las secuencias obtenidas de las reacciones RACE corresponden a las regiones de codificación de longitud completa de PP2A-2 y fueron utilizadas para diseñar los oligos para la clonación de longitud completa de los genes respectivos (ver más abajo la amplificación de longitud completa).

\vskip1.000000\baselineskip
Amplificación de longitud completa

Se obtuvieron los clones de longitud completa correspondientes a PP2A-2 (SEQ ID NO: 1) llevando a cabo la reacción en cadena de la polimerasa (PCR) con iniciadores específicos para el gen (ver Tabla 3) y el EST original como molde. Las condiciones para la reacción fueron condiciones estándar con ADN polimerasa PWO (Roche). Se llevó a cabo la PCR de acuerdo con condiciones estándar y con los protocolos del fabricante (Sambrook y colaboradores, 1989, Molecular Cloning, A Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., Biometra T3 Thermocycler). Los parámetros para la reacción fueron: cinco minutos a 94ºC seguido por cinco ciclos de un minuto a 94ºC, un minuto a 50ºC y 1,5 minutos a 72ºC. Esto fue seguido por veinticinco ciclos de un minuto a 94ºC, un minuto a 65ºC y 1,5 minutos a 72ºC.

Se extrajeron los fragmentos amplificados del gel agarosa con un Kit de Extracción del Gel QIAquick (Qiagen) y se ligaron dentro del vector TOPO pCR 2.1 (Invitrogen) siguiendo las instrucciones del fabricante. Se transformaron los vectores recombinantes en células Top10 (Invitrogen) utilizando condiciones estándar (Sambrook y colaboradores. 1989. Molecular Cloning, A Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY). Se seleccionaron las células transformadas sobre agar LB que contiene 100 \mug/ml de carbenicilina, 0,8 mg de X-gal (5-bromo-3-cloro-3-\beta-D-galactosido) y 0,8 mg de IPTG (isopropiltio-\beta-D-galactósido) cultivadas durante la noche a 37ºC. Se seleccionaron las colonias blancas y se las utilizó para inocular 3 ml de LB líquido que contiene 100 \mug/ml de ampicilina y se cultivaron durante la noche a 37ºC. Se extrajo el ADN del plásmido utilizando el Kit QIAprep Spin Miniprep (Qiagen) siguiendo las instrucciones del fabricante. Se llevó a cabo el análisis de los clones posteriores y se llevó a cabo el mapeo de restricción de acuerdo con técnicas estándar de biología molecular (Sambrook y colaboradores, 1989, Molecular Cloning, A Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.).

TABLA 3

4

Ejemplo 7

Modificación por Ingeniería Genética de plantas de Arabidopsis tolerantes al estrés por sobreexpresión del gen PP2A-2 Construcción del vector binario: kanamicina

El vector pACGH101 (BPS-Cynmid) fue digerido con PstI (Roche) y FseI (NEB) de acuerdo con las instrucciones del fabricante. Se purificó el fragmento por gel de agarosa y se extrajo a través del kit de Extracción de ADN Qiaex II (Qiagen). Esto dio como resultado un fragmento de vector con el promotor Actin2 de Arabidopsis con un intrón interno y el terminador OCS3. Se diseñaron los iniciadores para la amplificación por PCR del gen NPTII de la siguiente manera:

5'NPT-Pst:

GCG-CTG-CAG-ATT-TCA-TTT-GGA-GAG-GAC-ACG
(SEQ ID NO: 34)

\vskip1.000000\baselineskip

3'NPT-Fse:

CGC-GGC-CGG-CCT-CAG-AAG-AAC-TCG-TCA-AGA-AGG-CG
(SEQ ID NO: 35)

El gen NPTII de 0,9 kilobases fue amplificado a través de PCR a partir del ADN del plásmido pCambia 2301 [94ºC 60 s, {94ºC 60 s, 61ºC (-0,1ºC por ciclo) 60 s, 72ºC 2 min} x 25 ciclos, 72ºC 10 min en un equipo T-Gradient de Biometra], y purificado con el kit de Extracción Qiaquick PCR (Qiagen) siguiendo las instrucciones del fabricante. Se subclonó luego el ADN de la PCR en el vector pCR-BluntII TOPO (Invitrogen) conforme a las instrucciones del fabricante (construcción NPT-Topo). Estas uniones fueron transformadas en las células Top10 (Invitrogen) y se cultivaron sobre placas LB con 50 \mug/ml de sulfato de kanamicina durante la noche a 37ºC. Se utilizaron luego las colonias para inocular 2 ml de medio LB con 50 \mug/ml de sulfato de kanamicina y se desarrollaron durante la noche a 37ºC. Se recuperó el ADN del plásmido utilizando el kit Qiaprep Spin Miniprep (Qiagen) y se lo secuenció tanto en la dirección 5' como 3' utilizando condiciones estándar. El análisis posterior de los datos de la secuencia utilizando el software VectorNTI no reveló errores de PCR presentes en la secuencia de gen NPTII.

La construcción NPT-Topo fue luego digerida con PstI (Roche) y FseI (NEB) de acuerdo con las instrucciones del fabricante. Se purificó el fragmento de 0,9 kilobases sobre gel de agarosa y se extrajo mediante el kit de Extracción de ADN Qiaex II (Qiagen). Luego, se ligaron juntos el fragmento del inserto Pst/Fse de NPT-Topo y el fragmento del vector Pst/Fse de pACGH101 utilizando T4 ADN Ligasa (Roche) siguiendo las instrucciones del fabricante. Se transformó luego la ligación en células Top10 (Invitrogen) bajo condiciones estándar, creando la construcción pBPSsc019. Se seleccionaron las colonias sobre placas LB con 50 \mug/ml de sulfato de kanamicina y se desarrollaron durante la noche a 37ºC. Se utilizaron luego estas colonias para inocular 2 ml de medio LB con 50 \mug/ml de sulfato de kanamicina y se desarrollaron durante la noche a 37ºC. Se recuperó el ADN del plásmido utilizando el kit Qiaprep Spin Miniprep (Qiagen) siguiendo las instrucciones del fabricante.

Se digirió la construcción pBPSSC019 con KpnI y BsaI (Roche) de acuerdo con las instrucciones del fabricante. Se purificó el fragmento a través de gel de agarosa y luego se extrajo a través del kit de Extracción de ADN Qiaex II (Qiagen) siguiendo sus instrucciones, resultando en un casete Act-NPT de 3 kilobases, que incluye el promotor Actin2 de Arabidopsis con intrón interno, el gen NPTII y el terminador OCS3.

Se digirió el vector pBPSJH001 con SpeI y ApaI (Roche) y se rellenó en el extremo romo con enzima Klenow y dNTPs 0,1 mM (Roche) de acuerdo con las instrucciones del fabricante. Esto produjo un fragmento del vector de 10,1 kilobases menos el casete de Gentamicina, que se recirculó nuevamente por auto-ligación con T4 ADN Ligasa (Roche), y se transformó dentro de células Top10 (Invitrogen) a través de condiciones estándar. Se seleccionaron las células transformadas sobre agar LB que contiene 50 \mug/ml de sulfato de kanamicina y se desarrollaron durante la noche a 37ºC. Se utilizaron luego las colonias para inocular 2 ml de LB líquido que contiene 50 \mug/ml de sulfato de kanamicina y se desarrollaron durante la noche a 37ºC. Se extrajo el ADN del plásmido utilizando el Kit QIAprep Spin Miniprep (Qiagen) siguiendo las instrucciones del fabricante. Se digirió luego el plásmido recircularizado con KpnI (Roche) y se extrajo del gel agarosa a través del kit de Extracción de ADN Qiaex II (Qiagen) siguiendo las instrucciones del fabricante.

Se ligaron luego juntos el inserto Act-NPT Kpn-cut y el vector recircularizado Kpn-cut pBPSJH001 utilizando T4 ADN Ligasa (Roche) y se transformaron dentro de células Top10 (Invitrogen) siguiendo las instrucciones del fabricante. La construcción resultante, pBPSsc022, contenía ahora al Súper Promotor, al gen GUS, al terminador NOS, y al casete Act-NPT. Se seleccionaron las células transformadas sobre agar LB que contiene 50 \mug/ml de sulfato de kanamicina y se desarrollaron durante la noche a 37ºC. Se utilizaron luego las colonias para inocular 2 ml de LB líquido que contiene 50 \mug/ml de sulfato de kanamicina y se desarrollaron durante la noche a 37ºC. Se extrajo el ADN del plásmido utilizando el Kit QIAprep Spin Miniprep (Qiagen) siguiendo las instrucciones del fabricante. Después de la confirmación del éxito de la unión a través de las digestiones de restricción, se propagó y recuperó adicionalmente el ADN del plásmido pBPSsc022 utilizando el Kit Plasmid Midiprep (Qiagen) siguiendo las instrucciones del fabricante.

Subclonación de PP2A-2 en el vector binario

Se cortó el fragmento que contiene la proteína fosfatasas de Physcomitrella patens de los vectores recombinantes PCR2.1 TOPO por medio de doble digestión con enzimas de restricción (ver Tabla 4) de acuerdo con las instrucciones del fabricante. Se cortó el fragmento de la subsecuencia del gel de agarosa con un Kit de Extracción del Gel QIAquick (QIAgen) de acuerdo con las instrucciones del fabricante y se lo ligó en el vector binario pBPSsc022, escindido con las enzimas apropiadas (ver la Tabla 4) y se lo sometió a desfosforilación previamente a la ligación. El vector recombinante pBPSsc022 resultante contenía la Fosfatasa correspondiente en la orientación sentido bajo el control del súper promotor constitutivo.

TABLA 4 Se enlista el nombre de la construcción de la fosfatasa de Physcomitrella patens utilizada para la transformación de la planta

5

Transformación del Agrobacterium

Se transformó el vector recombinante en Agrobacterium tumefaciens C58C1 y PMP90 de acuerdo con condiciones estándar (Hoefgen y Willmitzer, 1990).

Transformación de la Planta

Se cultivó y transformó el ecotipo C24 de Arabidopsis thaliana de acuerdo con condiciones estándar (Bechtold 1993, Acad. Sci. Paris. 316: 1194 - 1199; Bent y colaboradores, 1994, Science 265: 1856 - 1860).

Selección de Plantas Transformadas

Se esterilizaron las semillas T1 de acuerdo con protocolos estándar (Xiong y colaboradores, 1999, Plant Molecular Biology Reporter 17: 159 - 170). Se sembraron las semillas en placa en los medios ½ Murashige y Skoog (MS) (Sigma - Aldrich) pH 5,7 con KOH, agar al 0,6% y suplementado con sacarosa al 1%, 0,5 g/L de ácido 2-[N-Morfolino]etanosulfónico (MES) (Sigma - Aldrich), 50 \mug/ml de kanamicina (Sigma - Aldrich), 500 \mug/ml de carbenicilina (Sigma - Aldrich) y 2 \mug/ml de benomilo (Sigma - Aldrich). Se vernalizaron las semillas sobre placas durante cuatro días a 4ºC. Se germinaron las semillas en una cámara climática a temperatura ambiente de 22ºC y una intensidad de luz de 40 micromoles^{-1m2} (luz blanca; tubo fluorescente Philips TL 65W/25) y un ciclo de 16 horas de luz y 8 horas de oscuridad diarias. Se seleccionaron las plantas de semillero transformados después de 14 días y se los transfectó al medio ½ MS pH 5,7 con KOH y placas de agar al 0,6% suplementado con agar al 0,6%, sacarosa al 1%, 0,5 g/L de MES (Sigma - Aldrich),

\hbox{y 2  \mu g/ml de
benomilo (Sigma - Aldrich) y se  les permitió recuperarse durante
cinco - siete días.}
Selección de Tolerancia a la Sequía

Se transfirieron las plantas de semillero T1 a un papel filtro estéril seco en una caja de Petri y se dejaron desecar por dos horas con una RH del 80% (humedad relativa) en una Cámara e Crecimiento Percieval MLR-350H, micromoles^{-1m2} (luz blanca; tubo fluorescente Philips TL 65W/25). Se disminuyó luego la RH a 60% y se desecaron las plantas de semillero durante ocho horas adicionales. Se removieron luego las plantas de semillero y se los colocó en placas de agar al 0,6% con ½ MS suplementadas con 2 \mug/ml de benomilo (Sigma - Aldrich) y 0,5 g/L de MES (Sigma - Aldrich) y se almacenaron después de cinco días.

Bajo condiciones de estrés por sequía, las plantas de Arabidopsis thaliana que sobreexpresan PpPP2A-2 mostraron un índice de supervivencia del 82% (9 supervivientes de 11 plantas estresadas) a la selección por estrés mientras que el control no transformado solamente mostró un índice de supervivencia del 28%. Cabe destacar que los análisis de estas líneas transgénicas se realizaron con plantas T1, y por consiguiente, los resultados serán mejores cuando se encuentre un expresador homocigoto fuerte.

TABLA 5

6

Selección de Tolerancia a la Congelación

Los semilleros fueron movidos a cajas de Petri que contienen ½ MS al 0,6%, agar suplementado con sacarosa al 2% y 2 \mug/ml de benomilo. Después de cuatro días, se incubaron las plantas de semillero a 4ºC durante 1 hora y luego se cubrieron con hielo raspado. Se colocaron luego las plantas de semillero en una Cámara Ambiental Environmental Specialist ES2000 y se incubó durante 3,5 horas iniciando en -1,0ºC disminuyendo -1ºC por hora. Los semilleros luego se incubaron a -5,0ºC durante 24 horas y luego se dejaron descongelar a 5ºC durante 12 horas. Se retiró el agua completamente y se almacenaron las plantas de semillero después de 5 días.

Bajo condiciones de estrés por congelación las plantas de Arabidopsis thaliana que sobreexpresan PpPP2A-2 mostraron un índice de supervivencia del 58% (7 supervivientes de 12 plantas estresadas); mientras que el control no transformado solamente mostró un índice de supervivencia del 2% (1 superviviente de 48 plantas probadas). Cabe destacar que los análisis de estas líneas transgénicas se realizaron con plantas T1, y por consiguiente, los resultados serán mejores cuando se encuentre un expresador homocigoto fuerte.

TABLA 6

7

Selección de Tolerancia al Estrés

Se transfirieron las plantas de semillero a un papel filtro remojado en ½ MS y se colocaron en ½ MS de agar al 0,6% suplementado con 2 \mug/ml de benomilo, la noche antes de la selección de la tolerancia a la sal. Para la selección de tolerancia a la sal, se removió el papel filtro con las plantas de semillero a arrumes de papel filtro estéril, remojado en NaCl 50 mM, en una caja de Petri. Después de dos horas, se removió el papel filtro con las plántulas a las pilas de filtro de papel estéril, remojado con NaCl 200 mM, en una caja de Petri. Después de dos horas, el filtro de papel con la planta de semillero se trasladó a las pilas de filtro de papel estéril, remojado en NaCl 600 mM, en una caja de Petri. Después de 10 horas, se movieron las plantas de semillero a las cajas de Petri que contienen ½ MS de agar al 0,6% suplementado con 2 \mug/ml de benomilo. Se hizo recuento de las plantas de semillero después de 5 días. Se seleccionaron luego las plantas transgénicas por su mejor tolerancia a la sal, demostrando que la expresión del transgén confiere tolerancia a la sal.

Ejemplo 8

Detección del transgén de PP2A-2 en las líneas transgénicas de Arabidopsis

Para comprobar la presencia del transgén PpPP2A-2 en las líneas transgénicas de Arabidopsis, se realizó una PCR sobre ADN genómico que contamina las muestras de ARN tomadas como se describe en el Ejemplo 9 más abajo. Se utilizaron 2,5 \mul de la muestra de ARN en una reacción PCR de 50 \mul utilizando Taq ADN polimerasa (Roche Molecular Biochemicals) de acuerdo con las instrucciones del fabricante. Para la PCR se utilizaron, el iniciador para la región del vector binario (5'GCTCGACACGCCAAGCCTCCCTAGTC3') (SEQ ID NO: 36) y el iniciador 3' del gen específico para cada transgén que se utilizó para la RT-PCR de longitud completa (ver Tabla 3). El programa de PCR fue el siguiente: 30 ciclos de 1 minuto a 94ºC, 1 minuto a 62ºC y 4 minutos a 70ºC, seguido por 10 minutos a 72ºC. El plásmido del vector binario con los transgenes clonados fue utilizado como control positivo, y el ADN genómico C24 de tipo silvestre fue utilizado como control negativo en las reacciones de PCR. Se analizaron 10 \mul de la reacción de PCR sobre gel de agarosa al 0,8% - bromuro de etidio.

Se amplificó exitosamente el transgén con el tamaño esperado (para PpPP2A-2: fragmento de 2,5 kb) a partir de las líneas transgénicas T1, pero no del C24 de tipo silvestre. Este resultado indica que las plantas transgénicas T1 contienen al menos una copia de los transgenes. No hubo indicios de la existencia ya sea de idénticos o muy similares en Arabidopsis thaliana sin transformar que pueda ser amplificado en este método en las plantas de tipo silvestre.

Ejemplo 9

Detección del ARNm del transgén de PP2A-2 en líneas transgénicas de Arabidopsis

Se detectó la expresión del transgén utilizando RT-PCR. Se aisló el ARN total de plantas tratadas por estrés utilizando un procedimiento adaptado de (Verwoerd y colaboradores, 1989, NAR 17: 2362). Se recolectaron muestras de hojas (50 - 100 mg) y se las molió hasta un polvo fino en nitrógeno líquido. Se resuspendió el tejido molido en 500 \mul de una mezcla 1:1 a 80ºC de fenol en amortiguador para extracción (LiCl 100 mM, Tris 100 mM pH 8, EDTA 10 mM, SDS al 1%), seguido de un breve período de agitación tipo vórtice para efectuar la mezcla. Después de la adición de 250 \mul de cloroformo, cada muestra fue sometida brevemente a agitación tipo vórtice. Se centrifugaron luego las muestras durante 5 minutos a 12.000 x g. Se removió la fase acuosa superior a un tubo Eppendorf nuevo. Se precipitó el ARN por medio de la adición de 1/10 de volumen de acetato de sodio 3 M y 2 volúmenes de etanol al 95%. Se mezclaron las muestras por medio de inversión de los tubos y se colocaron sobre hielo durante 30 minutos. Se precipitó el ARN por centrifugación a 12.000 x g durante 10 minutos. Se removió el sobrenadante y se secó brevemente el precipitado al aire. Se resuspendió el precipitado de la muestra de ARN en 10 \mul de agua tratada con DEPC.

Para remover el ADN contaminante de las muestras, cada una fue tratada con ADNasa libre de ARNasa (Roche) de acuerdo con las recomendaciones del fabricante. Se sintetizó ADNc a partir del ARN total utilizando el Superscript First-Strand Synthesis System para RT-PCR (Gibco-BRL) siguiendo las recomendaciones del fabricante. La amplificación por PCR de un fragmento específico de gen a partir del ADNc sintetizado, se realizó utilizando Taq ADN polimerasa (Roche) e iniciadores específicos para el gen como se muestra abajo en la siguiente reacción: amortiguador para PCR 1X, MgCl_{2} 1,5 mM, 0,2 \muM de cada iniciador, 0,2 \muM de dNTPs, 1 unidad de polimerasa, 5 \mul de ADNc de la reacción de síntesis. Se llevó a cabo la amplificación bajo las siguientes condiciones: Desnaturalización previa, 94ºC, 3 minutos; desnaturalización, 94ºC, 30 segundos; hibridación, 62ºC, 30 segundos; extensión, 72ºC, 2 minutos, 30, ciclos; extensión, 72ºC, 5 minutos; mantener a 4ºC, siempre. Se corrieron los productos de la PCR en un gel de agarosa al 1%, se tiñeron con bromuro de etidio, y se visualizaron bajo luz UV utilizando el sistema de documentación en gel Quantity-One (Bio-Rad).

Se detectó la expresión de los transgenes en la línea transgénica T1. Estos resultados indicaron que los transgenes se expresan en las líneas transgénicas y sugieren fuertemente que su producto génico mejora la tolerancia de la planta al estrés en las líneas transgénicas. De acuerdo con la afirmación previa, no se podría detectar por este método ninguna expresión de

\hbox{genes endógenos idénticos o muy similares. Estos
resultados están de  acuerdo con los datos del Ejemplo 7.}
TABLA 7

8

Ejemplo 10

Modificación por medio de ingeniería genética de plantas de soja tolerantes al estrés por sobreexpresión del gen PP2A-2

Se utilizó la construcción pBPSJYW023 se utilizó para transformar la soja como se describe a continuación.

Se esterilizó la superficie de semillas de soja con etanol al 70% durante 4 minutos a temperatura ambiente con agitación continua, seguido por 20% (v/v) de Clorox suplementado con Tween al 0,05% (v/v) durante 20 minutos con agitación continua. Luego, se enjuagaron las semillas 4 veces con agua destilada y se las colocó en un papel filtro estéril humedecido en una caja de Petri a temperatura ambiente durante 6 a 39 horas. Se pelaron completamente los recubrimientos de la semilla, y se desprendieron los cotiledones del eje del embrión. Se examinó el eje del embrión para garantizar que no se dañara la región meristemática. Se recolectaron los ejes embrionarios cortados en una caja de Petri estéril medio abierta y se secó al aire hasta un contenido de humedad menor del 20% (peso fresco) en una caja de Petri sellada hasta un próximo uso.

Se preparó el cultivo de Agrobacterium tumefaciens a partir de una colonia única en medio sólido LB más antibióticos apropiados (por ejemplo 100 mg/l de estreptomicina, 50 mg/l de kanamicina) seguido por el crecimiento de la única colonia en medio LB líquido hasta una densidad óptica a 600 nm de 0,8. Luego, se precipitó el cultivo de bacterias a 7000 rpm durante 7 minutos a temperatura ambiente, y se resuspendió en medio MS (Murashige y Skoog, 1962) suplementado con 100 \mum de acetosiringona. Se incubaron los cultivos de bacterias en este medio de inducción previa durante 2 horas a temperatura ambiente antes de utilizarlos. Se embebieron los ejes de los embriones de la semilla cigótica de soja en un contenido de humedad aproximadamente del 15% durante 2 horas a temperatura ambiente con el cultivo previamente inducido en suspensión de Agrobacterium. Se removieron los embriones del cultivo embebido y se los transfirió a las cajas de Petri que contienen medio MS sólido suplementado con sacarosa al 2% y se incubó durante 2 días, en la oscuridad a temperatura ambiente. Alternativamente, se colocaron los embriones encima de papel filtro estéril humedecido (medio MS líquido) en una caja de Petri y se incubó bajo las mismas condiciones descritas anteriormente. Después de este período, se transfirieron los embriones ya sea a medio MS sólido o líquido suplementado con 500 mg/L de carbenicilina ó 300 mg/L de cefotaxima para matar la Agrobacteria. Se utilizó el medio líquido para humedecer el papel filtro estéril. Se incubaron los embriones durante 4 semanas a 25ºC, bajo 150 \mumol m^{-2} s^{-1} y períodos de luz de 12 horas. Una vez produjeron raíces las plantas de semillero, fueron transferidas a suelo estéril Metromix. Se lavó completamente el medio de las plantas in vitro antes de transferir las plantas al suelo. Se mantuvieron las plantas bajo una cubierta plástica durante 1 semana para favorecer el proceso de aclimatación. Luego se transfirieron las plantas a un cuarto de crecimiento donde fueron incubadas a 25ºC, bajo una intensidad de luz de 150 \mumol m^{-2}s^{-1} y un período de luz de 12 horas aproximadamente durante 80
días.

Se seleccionaron luego las plantas transgénicas por su tolerancia mejorada a la sequía, la sal y/o el frío de acuerdo con el método de selección descrito en el Ejemplo 7 demostrando que la expresión transgénica confiere tolerancia al estrés.

\vskip1.000000\baselineskip

Ejemplo 11

Modificación por medio de ingeniería genética de plantas de Semilla de colza/Canola tolerantes al estrés por sobreexpresión del gen PP2A-2

Se utilizó la construcción pBPSJYW023 para transformar semilla de colza/canola como se describe abajo.

El método de transformación de la planta descrito aquí también es aplicable a Brassica y a otros cultivos. Se esteriliza la superficie de las semillas de canola con etanol al 70% durante 4 minutos a temperatura ambiente con agitación continua, seguido por Clorox al 20% (v/v) suplementado con Tween al 0,05% (v/v) durante 20 minutos, a temperatura ambiente con agitación continua. Luego, se enjuagan las semillas 4 veces con agua destilada y se colocan sobre papel filtro estéril humedecido en una caja de Petri a temperatura ambiente durante 18 horas. Luego se remueven los recubrimientos de la semilla y se secan las semillas al aire durante la noche en una caja de Petri estéril medio abierta. Durante este periodo, las semillas pierden aprox. 85% de su contenido de agua. Se almacenan luego las semillas a temperatura ambiente en una caja de Petri sellada hasta una utilización adicional. Las construcciones de ADN y la imbibición de los embriones son como se describen en el Ejemplo 10. Se analizan las muestras de las plantas transgénicas primarias (T0) se analizaron por medio de PCR para confirmar la presencia del T-ADN. Estos resultados se confirman por medio de hibridación tipo Southern en la cual se somete a electroforesis el ADN sobre un gel de agarosa al 1% y se lo transfiere a una membrana de nylon cargada positivamente (Roche Diagnostics). Se utiliza el PCR DIG Probe Synthesis Kit (Roche Diagnostics) para preparar una sonda marcada con digoxigenina por medio de PCR, y se utiliza según las recomendaciones del fabricante.

Se seleccionan luego las plantas transgénicas por su tolerancia mejorada al estrés de acuerdo con el método de selección descrito en el Ejemplo 7 demostrando que la expresión transgénica confiere tolerancia a la sequía.

\newpage

\global\parskip0.950000\baselineskip

Ejemplo 12

Modificación por medio de ingeniería genética de plantas de maíz tolerantes al estrés por sobreexpresión del gen PP2A-2

La construcción pBPSJYW023 fue utilizada para transformar maíz como se describe abajo.

La transformación del maíz (Zea Mayz L.) se realiza con el método descrito por Ishida y colaboradores. 1996. Nature Biotch 14745 - 50. Se cultivan conjuntamente embriones inmaduros con Agrobacterium tumefaciens que trasportan los vectores "súper binarios", y se recuperan las plantas transgénicas a través de organogénesis. Este procedimiento proporciona una eficiencia de transformación entre el 2,5% y el 20%. Se seleccionan luego las plantas transgénicas por su tolerancia mejorada a la sequía, la sal y/o el frío de acuerdo con el método de selección descrito en el Ejemplo 7, demostrando que la expresión transgénica confiere tolerancia al estrés.

Ejemplo 13

Modificación por medio de ingeniería genética de plantas de trigo tolerantes al estrés por sobreexpresión de los genes PP2A-2

Se utilizó la construcción pBPSJYW023 para transformar trigo como se describe abajo.

La transformación del trigo se realiza con el método descrito por Ishida y colaboradores. 1996, Nature Biotch. 14745-50. Se cultivaron conjuntamente embriones inmaduros con Agrobacterium tumefaciens que transportan vectores "súper binarios", y se recuperan las plantas transgénicas a través de organogénesis. Este procedimiento proporciona una eficiencia de transformación entre el 2,5% y el 20%.

Se seleccionan luego las plantas transgénicas por su tolerancia mejorada al estrés de acuerdo con el método de selección descrito en el Ejemplo 7, demostrando que la expresión transgénica confiere tolerancia a la sequía.

Ejemplo 14

Identificación de Genes Homólogos y Heterólogos

Se pueden utilizar secuencias génicas para identificar genes homólogos o heterólogos a partir de bibliotecas de ADNc o genómicas. Se pueden aislar genes homólogos (por ejemplo, clones de ADNc de longitud completa) a través de hibridación de ácido nucleico utilizando por ejemplo bibliotecas de ADNc. Dependiendo de la abundancia del gen de interés, se siembran en placa 100.000 hasta 1.000.000 de bacteriófagos recombinantes y se transfieren a las membranas de nylon. Después de la desnaturalización con álcali, se inmoviliza el ADN sobre la membrana, por ejemplo, por enlace entrecruzado por UV. La hibridación se realiza bajo condiciones altamente estrictas. En solución acuosa, la hibridación y el lavado se llevan a cabo con una fuerza iónica de NaCl 1 M y una temperatura de 68ºC. Se generan sondas de hibridación, por ejemplo, por medio de marcación de la transcripción por mella radioactiva (^{32}P) (High Prime, Roche, Mannheim, Alemania). Se detectan las señales por autorradiografía.

Los genes parcialmente homólogos o heterólogos que están relacionados pero no son idénticos se pueden identificar de una manera análoga al procedimiento descrito arriba utilizando condiciones de hibridación y lavado poco rigurosas. Para hibridación acuosa, se mantiene normalmente la fuerza iónica en NaCl 1 M mientras se disminuye progresivamente la temperatura de 68 a 42ºC.

El aislamiento de secuencias de genes se puede llevar a cabo únicamente con homologías (o identidad/similitud de la secuencia) en un dominio distinto (por ejemplo 10-20 aminoácidos) utilizando sondas sintéticas de oligonucleótido marcado en forma radioactiva. Los oligonucleótidos marcados en forma radioactiva se preparan por medio de fosforilación del extremo 5 prima de dos oligonucleótidos complementarios con polinucleótido quinasa T4. Los oligonucleótidos complementarios se aparean y se unen para formar los concatémeros. Los concatémeros bicatenarios se marcan luego en forma radioactiva, por ejemplo, por medio de transcripción con mella. La hibridación normalmente se realiza en condiciones de baja rigurosidad utilizando concentraciones altas de oligonucleótido.

Solución de hibridación del oligonucleótidos

6 x SSC

Fosfato de sodio 0,01 M

EDTA 1 mM (pH 8)

SDS al 0,5%

100 \mul/ml de ADN desnaturalizado de esperma de salmón

Leche deshidratada sin grasa al 0,1%.

\newpage

\global\parskip1.000000\baselineskip

Durante la hibridación, se disminuye la temperatura lentamente hasta 5 - 10ºC por debajo de la Tm estimada del oligonucleótido o hasta temperatura ambiente seguido por las etapas de lavado y autorradiografía. El lavado se realiza con baja rigurosidad tal como 3 etapas de lavado utilizando 4 x SSC. Los detalles adicionales son descritos por Sambrook, J. y colaboradores. (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press o Ausubel, F. M. y colaboradores, (1994), "Current Protocols in Molecular Biology", John Wiley &
Sons.

\vskip1.000000\baselineskip

Ejemplo 15

Identificación de Genes Homólogos por medio de Selección de Bibliotecas de Expresión con Anticuerpos

Se pueden utilizar clones de ADNc para producir proteína recombinante por ejemplo en E. coli (por ejemplo, el sistema QIAexpress pQE de Qiagen). Se purifican luego normalmente las proteínas recombinantes por medio de cromatografía de afinidad Ni-NTA (Qiagen). Se utilizan luego las proteínas recombinantes para producir anticuerpos específicos por ejemplo por medio del uso de técnicas estándar para inmunización de conejos. Los anticuerpos se purifican por afinidad utilizando una columna de Ni-NTA saturada con el antígeno recombinante como lo describen Gu y colaboradores, 1994, BioTechniques 17: 257 - 262. Se puede utilizar luego el anticuerpo para seleccionar bibliotecas de expresión de ADNc para identificar genes homólogos o heterólogos a través de una selección inmunológica (Sambrook, J. y colaboradores, (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press or Ausubel, F. M. y colaboradores, (1994), "Current Protocols in Molecular Biology", John Wiley &
Sons).

\vskip1.000000\baselineskip

Ejemplo 16

Mutagénesis in vivo

Se puede llevar a cabo mutagénesis in vivo de microorganismos por paso del ADN del plásmido (u otro vector) a través de E. coli o de otros microorganismos (por ejemplo, Bacillus spp. o levaduras tal como Saccharomyces cerevisiae) que se deterioran en sus capacidades para mantener la integridad de su información genética. Las cepas de mutación típicas tienen mutaciones en los genes para el sistema de reparación del ADN (por ejemplo, mutHLS, mutD, mutT, etc.; para referencia, ver Rupp, W. D. (1996) DNA repair mechanisms, en: Escherichia coli and Salmonella, páginas 2277 - 2294, ASM: Washington). Tales cepas son bien conocidas por aquellos capacitados en el arte. El uso de tales cepas se ilustra, por ejemplo, en Greener, A. y Callahan, M. (1994) Strategies 7: 32 - 34. La transferencia de moléculas mutadas de ADN en plantas se hace preferiblemente después de la selección y prueba en microorganismos. Las plantas transgénicas se generan de acuerdo con varios ejemplos presentados en este documento.

\vskip1.000000\baselineskip

Ejemplo 17

Análisis In vitro de la Función de Genes de Physcomitrella en Organismos Transgénicos

La determinación de actividades y parámetros cinéticos de enzimas está bien establecida en el arte. Los experimentos para determinar la actividad de cualquier enzima alterada dada se deben adaptar a la actividad específica de la enzima de tipo silvestre, que hace parte también de los conocimientos de una persona capacitada en el arte. La visión general acerca de las enzimas en general, así como los detalles específicos concernientes a la estructura, cinética, principios, métodos, aplicaciones y ejemplos para la determinación de la actividad de muchas enzimas se puede encontrar, por ejemplo, en las siguientes referencias: Dixon, M., y Webb, E. C., (1979) Enzymes. Longmans: London; Fersht, (1985) Enzyme Structure and Mechanism. Freeman: New York; Walsh, (1979) Enzymatic Reaction Mechanisms. Freeman: San Francisco; Price, N. C., Stevens, L. (1982) Fundamentals of Enzymology. Oxford Univ. Press: Oxford; Boyer, P. D., ed. (1983) The Enzymes, 3rd ed. Academic Press: New York; Bisswanger, H., (1994) Enzymkinetik, 2^{nd} ed. VCH: Weinheim (ISBN 3527300325); Bergmeyer, H. U., Bergmeyer, J., Graßl;1, M., eds. (1983 - 1986) Methods of Enzymatic Analysis, 3rd ed., vol. I-XII, Verlag Chemie: Weinheim; y Ullmann's Encyclopedia of Industrial Chemistry (1987) vol. A9, Enzymes. VCH: Weinheim, páginas 352 - 363.

La actividad de las proteínas que se unen al ADN se puede medir por medio de diferentes métodos bien establecidos, tales como ensayos de desplazamiento de la banda de ADN (también llamados ensayos de retardo en gel). El efecto de tales proteínas sobre la expresión de otras moléculas se puede medir utilizando ensayos con gen reportero (tal como aquel descrito en Kolmar, H. y colaboradores. (1995) EMBO J. 14: 3895 - 3904 y las referencias citadas allí). Los sistemas de prueba del gen reportero son bien conocidos y establecidos para aplicaciones tanto en células procariotas como eucariotas, utilizando enzimas tal como \beta-galactosidasa, proteína fluorescente verde, y muchas
otras.

La determinación de la actividad de proteínas de transporte por membranas se puede llevar a cabo de acuerdo con técnicas como aquellas descritas en Gennis, R. B. Pores, Channels and Transporters, in Biomembranes, Molecular Structure and Función, páginas 85 - 137, 199 - 234 y 270 - 322, Springer: Heidelberg (1989).

\vskip1.000000\baselineskip

Ejemplo 18

Purificación del Producto Deseado a partir de Organismos Transformados

La recuperación del producto deseado del material de la planta (es decir, Physcomitrella patens o Arabidopsis thaliana), hongos, algas, ciliados, células de C. glutamicum, u otras células bacterianas transformadas con las secuencias de ácido nucleico descritas aquí, o el sobrenadante de los cultivos descritos anteriormente, se puede realizar por medio de diferentes métodos bien conocidos en el arte. Sí el producto deseado no es secretado por las células, puede ser cosechado a partir del cultivo por centrifugación a baja velocidad, se pueden lisar las células por medio de técnicas estándar, tal como fuerza mecánica o sonicación. Los órganos de las plantas se pueden separar mecánicamente de otros tejidos u órganos. Después de homogenización, se remueven los residuos por centrifugación, y se retiene la fracción sobrenadante que contiene las proteínas solubles para una purificación adicional del compuesto deseado. Sí el producto es secretado a partir de las células deseadas, entonces se remueven las células del cultivo por centrifugación a baja velocidad, y se retiene la fracción del sobrenadante para una purificación adicional.

La fracción sobrenadante de cualquier método de purificación es sometida a cromatografía con una resina apropiada, en la cual es o bien retenida molécula deseada sobre una resina cromatográfica mientras que muchas de las impurezas en la muestra no son retenidas, o donde las impurezas son retenidas por la resina mientras que la muestra no. Tales etapas de cromatografía se pueden repetir según sea necesario, utilizando la misma o diferentes resinas de cromatografía. Alguien capacitado en el arte estaría capacitado para la selección de resinas cromatográficas apropiadas y en su aplicación más eficaz para una molécula particular que va a ser purificada. El producto purificado se puede concentrar por filtración o ultrafiltración, y almacenarse a una temperatura a la cual se maximiza la estabilidad del producto.

Existe una gran variedad de métodos de purificación conocidos en el arte y el método precedente de purificación no pretende constituirse en limitante. Tales técnicas de purificación se describen, por ejemplo, en Bailey, J. E. & Ollis, D. F. Biochemical Ingeniería Fundamentals, McGraw-Hill: NewYork (1986). Adicionalmente, la identidad y pureza de los compuestos aislados pueden ser evaluadas por medio de técnicas estándar en el arte. Estas incluyen cromatografía líquida de alto rendimiento (HPLC), métodos espectroscópicos, métodos de coloración, cromatografía de capa fina, NIRS, ensayos enzimáticos, o en forma microbiológica. Tales métodos de análisis son revisados en: Patek y colaboradores, 1994, Appl. Environ. Microbiol. 60: 133 - 140; Malakhova y colaboradores, 1996, Biotekhnologiya 11: 27 - 32; y Schmidt y colaboradores, 1998, Bioprocess Engineer. 19: 67 - 70. Ulmann's Encyclopedia of Industrial Chemistry, (1996) vol. A27, VCH: Weinheim, páginas 89 - 90, páginas 521 - 540, páginas 540 - 547, páginas 559 - 566, 575 - 581 y páginas 581 - 587; Michal, G. (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. y colaboradores. (1987) Applications of HPLC in Biochemistry en: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17.

\vskip1.000000\baselineskip
Referencias citadas en la descripción

Este listado de referencias citado por el solicitante es únicamente para conveniencia del lector. No forma parte del documento europeo de la patente. Aunque se ha tenido gran cuidado en la recopilación, no se pueden excluir los errores o las omisiones y la OEP rechaza toda responsabilidad en este sentido.

Documentos de patente citados en la descripción

\bullet US 4987071 A, Cech [0067]
\bullet WO 9113980 A [0089]

\bullet US 5116742 A, Cech [0067]
\bullet WO 9515389 A [0089]

\bullet WO 9801572 A [0073]
\bullet WO 9523230 A [0089]

\bullet US 4873316 A [0081]
\bullet WO 9916890 A [0089]

\bullet EP 264166 A [0081]
\bullet WO 9516783 A [0090]

\bullet US 5352605 A [0085]
\bullet WO 9706250 A [0090]

\bullet WO 8402913 A [0085]
\bullet WO 9946394 A [0090]

\bullet US 4962028 A [0085]
\bullet EP 0424047 A [0097]

\bullet WO 9519443 A [0087]
\bullet US 5322783 A [0097]

\bullet WO 9321334 A [0087]
\bullet EP 0397687 A [0097]

\bullet US 5187267 A [0088]
\bullet US 5376543 A [0097]

\bullet WO 9612814 A [0088]
\bullet US 5169770 A [0097]

\bullet EP 375091 A [0088]
\bullet US 5990387 A [0097]

\bullet US 5608152 A [0089]
\bullet WO 9307256 A [0097]

\bullet WO 9845461 A [0089]
\bullet US 6004804 A [0120]

\bullet US 5504200 A [0089]

Literatura citada en la descripción que no es de patente

\bulletSmith, R. D.; Walker, J. C. Annu. Rev. Plant Physiol Plant Mol. Biol., 1996, vol. 47, 101 - 125 [0005]

\bulletMacKintosh C.; Cohen P. Biochem. J., 1989, vol. 262, 335 - 339 [0006]

\bulletSmith, R. D.; Walker, J. C. Annu. Rev. Plant Physiol Plant Mol. Biol., 1996, vol. 47, 101 - 125 [0006]

\bulletSheen, J. Proc. Natl Acad. Sci. USA, 1998, vol. 95, 975 - 980 [0007]

\bulletCunningham, K. W.; Fink, G. R. Mol. Cell. Biol., 1996, vol. 16, 2226 - 2237 [0007]

\bulletPardo, J. M. y colaboradores. Proc. Natl. Acad. Sci. USA, 1998, vol. 95, 9681 - 9686 [0007]

\bulletAndreeva A y colaboradores. Journal of Plant Physiology, August 1999, vol. 155 (2), 153 - 158 [0008]

\bulletHendershot J. D. y colaboradores. Protein Phosphatase 2A 62 kDa B, 01 November 1999 [0008]

\bulletHendrix. P. y colaboradores. Serine/Threonine-protein phosphatase2A72/130kDaregulatory subunit B, 01 June 1994 [0008]

\bulletBevan M. Nucleic Acids Res., 1984, vol. 26, 8711 - 21 [0021]

\bulletAn YQ y colaboradores. Plant J, 1996, vol. 10, 107 - 121 [0021]

\bulletDuring K. Transgenic Res., 1994, vol. 3, 138 - 140 [0021]

\bulletJefferson y colaboradores. EMBO J, vol. 6, 3901 - 71987 [0021]

\bulletChirgwin y colaboradores. Biochemistry, 1979, vol. 18, 5294 - 5299 [0034]

\bullet Current Protocols in Molecular Biology. John Wiley & Sons, 1992 [0040]

\bulletNarang, S. A. Tetrahedron, 1983, vol. 39, 3 [0044]

\bulletItakura y colaboradores. Annu. Rev. Biochem., 1984, vol. 53, 323 [0044]

\bulletItakura y colaboradores. Science, 1984, vol. 198, 1056 [0044]

\bulletIka y colaboradores. Nucleic Acid Res., 1983, vol. 11, 477 [0044]

\bulletArkin; Yourvan. PNAS, 1992, vol. 89, 7811 - 7815 [0046]

\bulletDelgrave y colaboradores. Protein Engineering, 1993, vol. 6 (3), 327 - 331 [0046]

\bulletKarlin; Altschul. Proc. Natl. Acad. Sci. USA, 1990, vol. 90, 5873 - 5877 [0051]

\bulletAltschul y colaboradores. J. Mol. Biol, 1990, vol. 215, 403 - 410 [0051]

\bulletAltschul y colaboradores. Nucleic Acids Res., 1997, vol. 25, 3389 - 3402 [0052]

\bulletMyers; Miller. CABIOS, 1989 [0052]

\bullet Current Protocols in Molecular Biology. John Wiley & Sons, 1989, vol. 6.3, 1 - 6.3.6 [0054]

\bulletTatusov, R. L. Science, 1997, vol. 278 (5338), 631 - 637 [0056]

\bulletGaultier y colaboradores. Nucleic Acids. Res., 1987, vol. 15, 6625 - 6641 [0066]

\bulletInoue y colaboradores. Nucleic Acids Res., 1987, vol. 15, 6131 - 6148 [0066]

\bulletInoue y colaboradores. FEBS Lett., 1987, vol. 215, 327 - 330 [0066]

\bulletHaselhoff; Gerlach. Nature, 1988, vol. 334, 585 - 591 [0067]

\bulletSzostak, J. W. Science, 1993, vol. 261, 1411 - 1418 [0067]

\bulletHelene, C. Anticancer Drug Des., 1991, vol. 6 (6), 569 - 84 [0068]

\bulletHellene, C. y colaboradores. Ann. N.Y. Acad. Sci, 1992, 66027 - 36 [0068]

\bulletMaher, L. J. Bioassays, 1992, vol. 14 (12), 807 - 15 [0068]

\bulletAusubel y colaboradores. Current Protocols in Molecular Biology. Wiley, 1988 [0070]

\bulletBormann, E. R. y colaboradores. Mol. Microbiol., 1992, vol. 6, 317 - 326 [0070]

\bulletGoeddel. Gene Expression Technology: Methods in Enzymology. Academic Press, 1990, vol. 185 [0072] [0073]

\bulletGruber; Crosby. Methods in Plant Molecular Biology and Biotechnology. CRC Press, 89 - 108 [0072]

\bulletRomanos, M. A. y colaboradores. Foreign gene expression in yeast: a review. Yeast, 1992, vol. 8, 423 - 488 [0073]

\bullet Heterologous gene expression in filamentous fungi. van den Hondel, C. A. M. J. J. y colaboradores. More Gene Manipulations in Fungi. Academic Press, 1991, 396 - 428 [0073]

\bullet Gene transfer systems and vector development for filamentous fungi. van den Hondel, C. A. M. J. J.; Punt, P. J. y colaboradores. Applied Molecular Genetics of Fungi. Cambridge University Press, 1991, 1 - 28 [0073]

\bulletFalciatore y colaboradores. Marine Biotechnology, 1999, vol. 1 (3), 239 - 251 [0073] [0082]

\bulletSchmidt, R.; Wiltmitzer, L. High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants. Plant Cell Rep., 1988, 583 - 586 [0073]

\bullet Plant Molecular Biology and Biotechnology. C Press, 1993, 71 - 119 [0073]

\bullet Techniques for Gene Transfer. F. F. White; B. Jenes y colaboradores. Transgenic Plants. Academic Press, 1993, vol. 1, 128 - 43 [0073]

\bulletPotrykus. Annu. Rev. Plant Physiol. Plant Molec. Biol, 1991, vol. 42, 205 - 225 [0073]

\bulletSmith, D. B.; Johnson, K. S. Gene, 1988, vol. 67, 31 - 40 [0075]

\bulletAmann y colaboradores. Gene, 1988, vol. 69, 301 - 315 [0076]

\bulletStudier y colaboradores. Gene Expression Technology: Methods in Enzymology. Academic Press, 1990, vol. 185, 60 - 89 [0076]

\bulletGottesman, S. Gene Expression Technology: Methods in Enzymology. Academic Press, 1990, vol. 185, 119 - 128 [0077]

\bulletWada y colaboradores. Nucleic Acids Res., 1992, vol. 20, 2111 - 2118 [0077]

\bulletBaldari y colaboradores. Embo J., 1987, vol. 6, 229 - 234 [0078]

\bulletKurjan; Herskowitz. Cell, 1982, vol. 30, 933 - 943 [0078]

\bulletSchultz y colaboradores. Gene, 1987, vol. 54, 113 - 123 [0078]

\bullet Gene transfer systems and vector development for filamentous fungi. van den Handel C. A. M. J. J.; Punt, P. J. y colaboradores. Applied Molecular Genetics of Fungi. Cambridge University Press, 1991, 1 - 28 [0078]

\bulletSmith y colaboradores. Mol Cell Biol, 1983, vol. 3, 2156 - 2165 [0079]

\bulletLucklow; Summers. Virology, 1989, vol. 170, 31 - 39 [0079]

\bulletSeed, B. Nature, 1987, vol. 329, 840 [0080]

\bulletKaufman y colaboradores. BMBO J., 1987, vol. 6, 187 - 195 [0080]

\bulletSambrook, J.; Fritsh, E. F.; Maniatis, T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1989 [0080]

\bulletPinkert y colaboradores. Genes Dev., 1987, vol. 1, 268 - 277 [0081]

\bulletCalame; Eaton. Adv. Immunol, 1988, vol. 43, 235 - 275 [0081]

\bulletWinoto; Baltimore. EMBO J., 1989, vol. 8, 729 - 733 [0081]

\bulletBanerji y colaboradores. Cell, 1983, vol. 33, 729 - 740 [0081]

\bulletQueen; Baltimore. Cell, 1983, vol. 33, 741 - 748 [0081]

\bulletByrne; Ruddle. PNAS, 1989, vol. 86, 5473 - 5477 [0081]

\bulletEdlund y colaboradores. Science, 1985, vol. 230, 912 - 916 [0081]

\bulletKessel; Gruss. Science, 1990, vol. 249, 374 - 379 [0081]

\bulletCampes; Tilghman. Genes Dev., 1989, vol. 3, 537 - 546 [0081]

\bulletBecker, D.; Kemper, E.; Schell, J.; Masterson, R. New plant binary vectors with selectable markers located proximal to the left border. Plant Mol. Biol, 1992, vol. 20, 1195 - 11197 [0082]

\bulletBevan, M. W. Binary Agrobacterium vectors for plant transformation. Nucl. Acid. Res., 1984, vol. 12, 8711 - 8721 [0082]

\bullet Vectors for Gene Transfer in Higher Plants. Transgenic Plants, Vol. 1, Engineering and Utilization. Academic Press, 1993, vol. 1, 15 - 38 [0082]

\bulletGielen y colaboradores. EMBO J., 1984, vol. 3, 835 [0083]

\bulletGallie y colaboradores. Nucl. Acids Research, 1987, vol. 15, 8693 - 8711 [0084]

\bulletBenfy y colaboradores. EMBOJ., 1989, vol. 8, 2195 - 2202 [0085]

\bulletFranck y colaboradores. Cell, 1980, vol. 21, 285 - 294 [0085]

\bulletKermode. Crit. Rev. Plant Sci., 1996, vol. 15 (4), 285 - 423 [0086]

\bulletGatz. Annu. Rev. Plant Physiol Plant Mol. Biol, 1997, vol. 48, 89 - 108 [0087]

\bulletGatz y colaboradores. Plant J., 1992, vol. 2, 397 - 404 [0087]

\bulletWard y colaboradores. Plant. Mol. Biol, 1993, vol. 22, 361 - 366 [0088]

\bulletYamaguchi-Shinozalei y colaboradores. Mol. Gen. Genet, 1993, vol. 236, 331 - 340 [0088]

\bulletBaeumlein y colaboradores. Mol Gen Genet, 1991, vol. 225 (3), 459 - 67 [0089]

\bulletBaeumlein y colaboradores. Plant Journal, 1992, vol. 2 (2), 233 - 9 [0089]

\bulletWeintraub, H. y colaboradores. Antisense RNA as a molecular tool for genetic analysis. Reviews - Trends in Genetics, 1986, vol. 1 (1 [0091]

\bulletMol y colaboradores. FEBS Letters, 1990, vol. 268, 427 - 430 [0091]

\bulletSambrook y colaboradores. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1989 [0094]

\bullet Agrobacterium protocols. Methods in Molecular Biology. Humana Press, 1995, vol. 44 [0094]

\bulletHöfgen; Willmitzer. Plant Science, 1990, vol. 66, 221 - 230 [0096]

\bulletKermode. Crit. Rev. Plant Sci., 1996, vol. 4 (15), 285 - 423 [0096]

\bulletKoncz; Schell. Mol. Gen. Genet, 1986, vol. 204, 383 - 396 [0097]

\bulletDeblaere y colaboradores. Nucl. Acids. Res., 1994, vol. 13, 4777 - 4788 [0097]

\bulletGelvin, Stanton B.; Schilperoort, Robert A. Plant Molecular Biology Manual. Kluwer Academic Publ, 1995 [0097]

\bulletGlick, Bernard R.; Thompson, John B. Methods in Plant Molecular Biology and Biotechnology. CRC Press, 1993, 360 S [0097]

\bulletMoloney y colaboradores. Plant cell Report, 1989, vol. 8, 238 - 242 [0097]

\bullet De Block y colaboradores. Plant Physiol., 1989, vol. 91, 694 - 701 [0097]

\bulletMlynarova y colaboradores. Plant Cell Report, 1994, vol. 13, 282 - 285 [0097]

\bulletFeeling; Walbot. The maize handbook. Springer Verlag, 1993 [0097]

\bulletCole-Strauss y colaboradores. Nucleic Acids Research, 1999, vol. 27 (5), 1323 - 1330 [0099]

\bulletKmiec. Gene therapy American Scientist., 1999, vol. 87 (3), 240 - 247 [0099]

\bulletThomas, K. R.; Capecchi, M. R. Cell, 1987, vol. 51, 503 [0100]

\bulletStrepp y colaboradores. PNAS, 1998, vol. 95 (8), 4368 - 4373 [0100]

\bulletGreisman; Pabo. Science, 1997, vol. 275, 657 [0111]

\bullet Applications of HPLC in Biochemistry. Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17 [0117]

\bullet Product recovery and purification. Rehm y colaboradores. Biotechnology. VCH, 1993, vol. 3, 469 - 714 [0117]

\bulletBelter, P. A. y colaboradores. Bioseparations: downstream processing for biotechnology. John Wiley and Sons, 1988 [0117]

\bulletKennedy, J. F.; Cabral, J. M. S. Recovery processes for biological materials. John Wiley and Sons, 1992 [0117]

\bullet Biochemical separations. Shaeiwitz, J. A.; Henry, J. D. Ulmann's Encyclopedia of Industrial Chemistry. VCH, 1988, vol. B3, 1 - 27 [0117]

\bulletDechow, F. J. Separation and purification techniques in biotechnology. Noyes Publications, 1989 [0117]

\bulletGroves, J. T. Curr. Opin. Chem. Biol., 1999, vol. 3 (2), 226 - 235 [0119]

\bulletGirke, T. The Plant Journal, 1998, vol. 15, 39 - 48 [0120]

\bulletPuttaraju y colaboradores. Spliceosome-mediated RNA trans-splicing as a tool for gene therapy. Nature Biotechnology, 1999, vol. 17, 246 - 252 [0120]

\bulletHarlow; Lane. Antibodies; A Laboratory Manual. Cold Spring Harbor Laboratory, 1988 [0122]

\bulletKelly y colaboradores. Bio/Technology, 1992, vol. 10, 163 - 167 [0122]

\bulletBebbington y colaboradores. Bio/Technology, 1992, vol. 10, 169 - 175 [0122]

\bulletHarlow; Lane. Antibodies, A Laboratory Manual. Cold Spring Harbor Publications, 1988 [0123] [0124]

\bullet Basic and Clinical Immunology. Lange Medical Publications [0124]

\bullet H. L. K. Whitehouse. Gransden Wood. Huntingdonshire (England). Am. J. Bot., 1968, vol. 55, 438 - 446 [0126]

\bulletReski; Abel. Plants, 1985, vol. 165, 354 - 358 [0127]

\bulletReski y colaboradores. Mol. Gen. Genet., 1994, vol. 24 (4), 352 - 359 [0130]

\bulletFASTP; PASTA. Methods Enzymol., vol. 183, 63 - 98 [0133]

\bulletAltschul S. F.; Gish W.; Miller W.; Myers E. W.; Lipman D. J. Basic local alignment search tool. Journal of Molecular Biology, vol. 215, 403 - 10 [0133]

\bulletFrishman, D.; Argos, P. 75% accuracy in protein secondary structure prediction Proteins, 1997, vol. 27, 329 - 335 [0133]

\bulletThompson, J. D.; Higgins, D. G.; Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 1994, vol. 22, 4673 - 4680 [0133]

\bulletPersson, B.; Argos, P. Prediction of transmembrana segments in proteins utilizing multiple sequence alignments. J. Mol. Biol., 1994, vol. 237, 182 - 192 [0133]

\bulletKlein, P.; Kanehisa, M.; DeLasi, C. Prediction of protein function from sequence properties: A discriminate analysis of a database. Biochim. Biophys. Acta, 1984, vol. 787, 221 - 226 [0133]

\bulletKolakowski L. F. Jr.; Leunissen J. A. M.; Smith J. E. ProSearch: fast searching of protein sequences with regular expression patterns related to protein structure and function. Biotechniques, 1992, vol. 13, 919 - 921 [0133]

\bullet J. C. Wallace; Henikoff S. PATMAT: A searching and extraction program for sequence, pattern and block queries and databases. CABIOS, 1992, vol. 8, 249 - 254 [0133]

\bulletSambrook y colaboradores. Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1989 [0138] [0139]

\bulletBechtold. Acad. Sci. Paris., 1993, vol. 316, 1194 - 1199 [0149]

\bulletBent y colaboradores. Science, 1994, vol. 265, 1856 - 1860 [0149]

\bulletXiong y colaboradores. Plant Molecular Biology Reporter, 1999, vol. 17, 159 - 170 [0150]

\bulletIshida y colaboradores. Nature Biotch, 1996, 14745 - 50 [0169]

\bulletIshida y colaboradores. Nature Biotch., 1996, 14745 - 50 [0171]

\bulletSambrook, J. y colaboradores. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 1989 [0175] [0176]

\bulletAusubel, F. M. y colaboradores. Current Protocols in Molecular Biology. John Wiley & Sons, 1994 [0175] [0176]

\bulletGu y colaboradores. BioTechniques, 1994, vol. 17, 257 - 262 [0176]

\bullet DNA repair mechanisms. Rupp, W. D. Escherichia coli and Salmonella. ASM, 1996, 2277 - 2294 [0177]

\bulletGreener, A.; Callahan, M. Strategies, 1994, vol. 7, 32 - 34 [0177]

\bulletDixon, M.; Webb, E. C. Enzymes. Longmans, 1979 [0178]

\bulletFersht. Enzyme Structure and Mechanism. Freeman, 1985 [0178]

\bulletWalsh. Enzymatic Reaction Mechanisms. Freeman, 1979 [0178]

\bulletPrice, N. C.; Stevens, L. Fundamentals of Enzymology. Oxford Univ. Press, 1982 [0178]

\bullet The Enzyme. Academic Press, 1983 [0178]

\bulletBisswanger, H. Enzymkinetik. VCH, 1994 [0178]

\bullet Methods of Enzymatic Analysis. Verlag Chemie, 1983, vol. 1-XII [0178]

\bullet Enzymes. Ullmann's Encyclopedia of Industrial Chemistry. VCH, 1987, vol. A9, 352 - 363 [0178]

\bulletKolmar, H. y colaboradores. EMBO J., 1995, vol. 14, 3895 - 3904 [0179]

\bullet Channels and Transporters. Gennis, R. B. Pores. Biomembranes, Molecular Structure and Function. Springer, 1989, 85 - 137199 - 234270 - 322 [0180]

\bulletBailey, J. E.; Ollis, D. F. Biochemical Engineering Fundamentals. McGraw-Hill, 1986 [0183]

\bulletPatek y colaboradores. Appl. Environ. Microbiol., 1994, vol. 60, 133 - 140 [0183]

\bulletMalakhova y colaboradores. Biotekhnologiya, 1996, vol. 11, 27 - 32 [0183]

\bulletSchmidt y colaboradores. Bioprocess Engineer., 1998, vol. 19, 67 - 70 [0183]

\bullet Ulmann's Encyclopedia of Industrial Chemistry. VCH, 1996, vol. A27, 89 - 90521 - 540540 - 547559 - 566575 - 581581 - 587 [0183]

\bulletMichal, G. Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology. John Wiley and Sons, 1999 [0183]

\bullet Applications of HPLC in Biochemistry. Fallon, A. y colaboradores. Laboratory Techniques in Biochemistry and Molecular Biology. 1987, vol. 17 [0183]

\global\parskip0.000000\baselineskip

<110> BASF Plant Science GmbH

\vskip0.400000\baselineskip

<120> Proteínas fosfatasas relacionadas con el estrés y métodos de utilización en plantas

\vskip0.400000\baselineskip

<130> 07017995.7-1521

\vskip0.400000\baselineskip

<140> 29083PEP-WO-1

\vskip0.400000\baselineskip

<141> 2007-10-16

\vskip0.400000\baselineskip

<160> 46

\vskip0.400000\baselineskip

<170> PatentIn versión 3.3

\vskip0.400000\baselineskip

<210> 1

\vskip0.400000\baselineskip

<211> 656

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 1

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
9

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 2

\vskip0.400000\baselineskip

<211> 807

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 2

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
10

\hskip0,8cm
11

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 3

\vskip0.400000\baselineskip

<211> 447

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 3

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
12

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 4

\vskip0.400000\baselineskip

<211> 591

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\newpage

\vskip0.400000\baselineskip

<400> 4

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
13

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 5

\vskip0.400000\baselineskip

<211> 587

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<221> características diversas

\vskip0.400000\baselineskip

<222> (9)..(9)

\vskip0.400000\baselineskip

<223> n es a, c, g, o t

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<221> características diversas

\vskip0.400000\baselineskip

<222> (283)..(283)

\vskip0.400000\baselineskip

<223> n es a, c, g, o t

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 5

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
14

\vskip0.400000\baselineskip

<210> 6

\vskip0.400000\baselineskip

<211> 2559

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 6

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
15

\hskip0,8cm
16

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 7

\vskip0.400000\baselineskip

<211> 2005

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 7

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
17

\hskip0,8cm
18

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 8

\vskip0.400000\baselineskip

<211> 1365

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 8

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
19

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 9

\vskip0.400000\baselineskip

<211> 1346

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\newpage

\vskip0.400000\baselineskip

<400> 9

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
20

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 10

\vskip0.400000\baselineskip

<211> 1410

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\newpage

\vskip0.400000\baselineskip

<400> 10

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
21

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 11

\vskip0.400000\baselineskip

<211> 572

\vskip0.400000\baselineskip

<212> PRT

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\newpage

\vskip0.400000\baselineskip

<400> 11

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
22

\hskip0,8cm
23

\hskip0,8cm
24

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 12

\vskip0.400000\baselineskip

<211> 532

\vskip0.400000\baselineskip

<212> PRT

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\newpage

\vskip0.400000\baselineskip

<400> 12

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
25

\hskip0,8cm
26

\hskip0,8cm
27

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 13

\vskip0.400000\baselineskip

<211> 306

\vskip0.400000\baselineskip

<212> PRT

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 13

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
28

\hskip0,8cm
29

\hskip0,8cm
30

\newpage

\vskip0.400000\baselineskip

<210> 14

\vskip0.400000\baselineskip

<211> 353

\vskip0.400000\baselineskip

<212> PRT

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 14

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
31

\hskip0,8cm
32

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 15

\vskip0.400000\baselineskip

<211> 371

\vskip0.400000\baselineskip

<212> PRT

\vskip0.400000\baselineskip

<213> Physcomitrella patens

\newpage

\vskip0.400000\baselineskip

<400> 15

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\hskip0,8cm
33

\hskip0,8cm
34

\vskip1.000000\baselineskip

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 16

\vskip0.400000\baselineskip

<211> 18

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 16

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
caggaaacag ctatgacc
\hfill
18

\newpage

\vskip0.400000\baselineskip

<210> 17

\vskip0.400000\baselineskip

<211> 19

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 17

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
ctaaagggaa caaaagctg
\hfill
19

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 18

\vskip0.400000\baselineskip

<211> 18

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 18

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
tgtaaaacga cggccagt
\hfill
18

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 19

\vskip0.400000\baselineskip

<211> 26

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 19

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
ctgccgttgg aggcatcctc gccatc
\hfill
26

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 20

\vskip0.400000\baselineskip

<211> 34

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 20

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
atcccgggca tcgggaagac ggtgtgtgtg tgtg
\hfill
34

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 21

\vskip0.400000\baselineskip

<211> 34

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\newpage

\vskip0.400000\baselineskip

<400> 21

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgttaacgc taccagcctc gggctgaacc agtc
\hfill
34

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 22

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 22

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
ggagcccttg ctgctactgt atgct
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 23

\vskip0.400000\baselineskip

<211> 32

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 23

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
atcccgggtg gtggtggcgg tgaagttatt ac
\hfill
32

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 24

\vskip0.400000\baselineskip

<211> 31

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 24

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgttaacat gtacaagctg ttggatgcag c
\hfill
31

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 25

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
acatcgggcc ctcgtgcggc acttc
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 26

\vskip0.400000\baselineskip

<211> 33

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 26

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgttaacgc gcggaggaga gcggatcggt tag
\hfill
33

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 27

\vskip0.400000\baselineskip

<211> 33

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 27

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgagctcga gcatgccata tacagtaggt gtg
\hfill
33

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 28

\vskip0.400000\baselineskip

<211> 34

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 28

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgatatcga tttgcaaggg cgaagtgcac aaga
\hfill
34

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 29

\vskip0.400000\baselineskip

<211> 32

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 29

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgatatcga aggcagaagg caactcccag tt
\hfill
32

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 30

\vskip0.400000\baselineskip

<211> 26

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 30

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
cactcccaca ccacacctac caggca
\hfill
26

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 31

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 31

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gggcttcgtg agccatgaat ccctt
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 32

\vskip0.400000\baselineskip

<211> 34

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 32

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
atcccgggcg tggaaggaga ggcgaatgtg gagg
\hfill
34

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 33

\vskip0.400000\baselineskip

<211> 32

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 33

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgagctcct gtgggtgtct agcttcaggt tc
\hfill
32

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 34

\vskip0.400000\baselineskip

<211> 30

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 34

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgctgcaga tttcatttgg agaggacacg
\hfill
30

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 35

\vskip0.400000\baselineskip

<211> 35

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 35

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
cgcggccggc ctcagaagaa ctcgtcaaga aggcg
\hfill
35

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 36

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 36

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gctgacacgc caagcctcgc tagtc
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 37

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 37

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcagacgtat gggaactagc cacct
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 38

\vskip0.400000\baselineskip

<211> 26

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 38

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
cgctctacga ttcggtaggt gagagc
\hfill
26

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 39

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 39

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
ctggcgacag aggaggacgc gttgt
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 40

\vskip0.400000\baselineskip

<211> 26

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\newpage

\vskip0.400000\baselineskip

<400> 40

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gcgtaggctc ttctacatct cgcaac
\hfill
26

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 41

\vskip0.400000\baselineskip

<211> 27

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 41

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
cggacgatct tggtggagga gtggaac
\hfill
27

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 42

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 42

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
gtgtcgagcg atggagacag accac
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 43

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 43

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
cggatggatg agatgatgaa gggag
\hfill
25

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 44

\vskip0.400000\baselineskip

<211> 26

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 44

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
cacgaccacc atggacgaag cctcca
\hfill
26

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 45

\vskip0.400000\baselineskip

<211> 26

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 45

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
ggctgtgctc ggtagattct ctcgca
\hfill
26

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<210> 46

\vskip0.400000\baselineskip

<211> 25

\vskip0.400000\baselineskip

<212> ADN

\vskip0.400000\baselineskip

<213> Artificial

\vskip0.400000\baselineskip

<220>

\vskip0.400000\baselineskip

<223> Iniciador

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

<400> 46

\vskip1.000000\baselineskip

\vskip0.400000\baselineskip

\hskip-.1em\dddseqskip
cagcctcttg gttggacaag tgctc
\hfill
25

Claims (31)

1. Una célula de una planta transgénica transformada por ácido nucleico que codifica una Proteína Fosfatasa Relacionada con el Estrés (PHSRP) el cual es Proteína Fosfatasa 2A-2, en donde la expresión del ácido nucleico en la célula de la planta resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de la célula de la planta de tipo silvestre, en donde la PHSRP es una PP2A-2 como se define en la SEQ ID NO: 11 o secuencias que son al menos aproximadamente 50 - 60% idénticas a la secuencia entera de aminoácidos mostrada en la SEQ ID NO:11.
2. La célula de la planta transgénica de la reivindicación 1, en donde la PHSRP es una PP2A-2 como se define en la SEQ ID NO: 11.
3. La célula de la planta transgénica de la reivindicación 1, en donde el ácido nucleico que codifica una PHSRP es PP2A-2 como se define en la SEQ ID NO: 6.
4. La célula de la planta transgénica de la Reivindicación 1, en donde el ácido nucleico que codifica una PHSRP es aproximadamente al menos 50 - 60% idéntico a la secuencia de la SEQ ID NO: 6 sobre la región entera de codificación.
5. La célula de la planta transgénica de la Reivindicación 1, en donde la planta es una monocotiledónea.
6. La célula de la planta transgénica de la Reivindicación 1, en donde la planta es una dicotiledónea.
7. La célula de la planta transgénica de la Reivindicación 1, en donde la planta se selecciona del grupo que consiste de maíz, trigo, centeno, avena, triticale, arroz, cebada, soja, maní, algodón, semilla de colza, canola, yuca, pimienta, girasol, tagetes, plantas solanáceas, patata, tabaco, berenjena, tomate, especie Vicia, guisante, alfalfa, café, cacao, té, especie Salix, palma aceitera, coco, hierba perenne y cultivos de forraje.
8. Una planta transgénica que comprende una célula de una planta de acuerdo con cualquiera de las Reivindicaciones 1 a 7.
9. Una semilla producida por una planta transgénica que comprende una célula de una planta de acuerdo con cualquiera de las Reivindicaciones 1 a 8, en donde la semilla es una línea genéticamente pura para mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la célula de la planta.
10. El uso de una planta o semilla de cualquiera de las Reivindicaciones 1 a 9 para la producción de un producto agrícola.
11. Una Proteína Fosfatasa aislada Relacionada con el Estrés (PHSRP), en donde la PHSRP es la Proteína Fosfatasa 2A-2 (PP2A-2) como se define en la SEQ ID NO:11 o secuencias que son al menos 70 - 80% idénticas a la secuencia entera de aminoácidos mostrada en la SEQ ID NO: 11.
12. La PHSRP de la Reivindicación 11, en donde la PHSRP es PP2A-2 como se define en la SEQ ID NO: 11.
13. Un ácido nucleico que codifica una Proteína Fosfatasa aislada Relacionada con el Estrés (PHSRP), en donde el ácido nucleico que codifica la PHSRP codifica para Proteína Fosfatasa 2A-2 (PP2A-2) como se define en la SEQ ID NO:11 o secuencias que son al menos 70 - 80% idénticas a la secuencia entera de aminoácidos mostrada en la SEQ ID NO: 11.
14. El ácido nucleico que codifica la PHSRP de la Reivindicación 13, en donde el ácido nucleico que codifica la PHSRP es PP2A-2 como se define en la SEQ ID NO: 6.
15. El ácido nucleico que codifica la PHSRP de la Reivindicación 13, en donde el ácido nucleico que codifica la PHSRP es al menos 70 - 80% idéntico a la secuencia de la SEQ ID NO: 6 sobre la región entera de codificación.
16. Un vector aislado de expresión recombinante que comprende el ácido nucleico de las Reivindicaciones 14 ó 15, en donde la expresión del vector en una célula huésped resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la célula huésped.
17. Un método para producir una planta transgénica que contiene un ácido nucleico que codifica una Proteína Fosfatasa Relacionada con el Estrés (PHSRP) que es una Proteína Fosfatasa 2A-2 (PP2A-2), en donde la expresión del ácido nucleico en la planta resulta en una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta, que comprende la transformación de una célula de una planta con un vector de expresión que comprende al ácido nucleico, la generación a partir de la célula de la planta de una planta transgénica con una mayor tolerancia al estrés por sequía y/o temperatura en comparación con una variedad de tipo silvestre de la planta, en donde la PHSRP es una PP2A-2 como se define en la SEQ ID NO: 11 o secuencias que son al menos aproximadamente 50 - 60% idénticas a la secuencia completa de aminoácidos mostrada en la SEQ ID NO: 11.
18. El método de la reivindicación 17, en donde la PHSRP es PP2A-2 como se define en la SEQ ID NO: 11.
19. El método de la Reivindicación 17, en donde el ácido nucleico que codifica la PHSRP es PP2A-2 como se define en la SEQ ID NO: 6.
20. El método de la Reivindicación 19, en donde el ácido nucleico que codifica la PHSRP es al menos 50 - 60% idéntico a la secuencia de la SEQ ID NO: 6 sobre la región entera de codificación.
21. Un método para modificación de la tolerancia al estrés por sequía y/o temperatura de una planta que comprende modificar la expresión de una Proteína Fosfatasa Relacionada con el Estrés (PHSRP) la cual es la Proteína Fosfatasa 2A-2 en la planta, en donde la PHSRP es una PP2A-2 como se define en la SEQ ID NO: 11 o secuencias que son aproximadamente al menos 50 - 60% idénticas a la secuencia completa de aminoácidos mostrada en la SEQ ID NO: 11.
22. El método de la Reivindicación 21, en donde la PHSRP es PP2A-2 como se define en la SEQ ID NO: 11.
23. El método de la Reivindicación 21, en donde el ácido nucleico que codifica la PHSRP es PP2A-2 como se define en la SEQ ID NO: 6.
24. El método de la Reivindicación 21, en donde el ácido nucleico que codifica la PHSRP es al menos 50 - 60% idéntico a la secuencia de la SEQ ID NO: 6 sobre la región entera de codificación.
25. El método de la Reivindicación 21, en donde la tolerancia al estrés se incrementa.
26. El método de la Reivindicación 21, en donde la tolerancia al estrés se disminuye.
27. El método de la Reivindicación 21, en donde la planta no es transgénica.
28. El método de la Reivindicación 21, en donde la planta es transgénica.
29. El método de la Reivindicación 28, en donde la planta es transformada con un promotor que dirige la expresión de la PHSRP.
30. El método de la Reivindicación 29, en donde el promotor es específico del tejido.
31. El método de la Reivindicación 29, en donde el promotor es regulado en función del desarrollo.
ES07017995T 2000-04-07 2001-04-06 Proteinas fosfatasas realacionadas con el estres y metodos de utilizacion en plantas. Active ES2340879T3 (es)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US19600100P true 2000-04-07 2000-04-07
US196001P 2000-04-07

Publications (1)

Publication Number Publication Date
ES2340879T3 true ES2340879T3 (es) 2010-06-10

Family

ID=22723712

Family Applications (7)

Application Number Title Priority Date Filing Date
ES06023948T Active ES2345833T3 (es) 2000-04-07 2001-04-06 Proteinas proteina-quinasa relacionadas con el estres y metodos de utilizacion en las plantas.
ES01923229T Active ES2272461T3 (es) 2000-04-07 2001-04-06 Proteinas proteina-quinasa relacionadas con el estres y metodos de utilizacion en las plantas.
ES01926730T Active ES2272466T3 (es) 2000-04-07 2001-04-06 Proteinas de transduccion de señales relacionadas con el estres y metodos de utilizacion en las plantas.
ES01928388T Active ES2277922T3 (es) 2000-04-07 2001-04-06 Proteinas fijadoras de gtp relacionadas con el estres, y metodos de utilizacion en plantas.
ES01989068T Active ES2295230T3 (es) 2000-04-07 2001-04-06 Proteina fosfatasa relacionada con el estres y metodos de uso en las plantas.
ES07017995T Active ES2340879T3 (es) 2000-04-07 2001-04-06 Proteinas fosfatasas realacionadas con el estres y metodos de utilizacion en plantas.
ES01928389T Active ES2279810T3 (es) 2000-04-07 2001-04-06 Proteinas relacionadas con el estres del ciclo celular y metodos de utilizacion en plantas.

Family Applications Before (5)

Application Number Title Priority Date Filing Date
ES06023948T Active ES2345833T3 (es) 2000-04-07 2001-04-06 Proteinas proteina-quinasa relacionadas con el estres y metodos de utilizacion en las plantas.
ES01923229T Active ES2272461T3 (es) 2000-04-07 2001-04-06 Proteinas proteina-quinasa relacionadas con el estres y metodos de utilizacion en las plantas.
ES01926730T Active ES2272466T3 (es) 2000-04-07 2001-04-06 Proteinas de transduccion de señales relacionadas con el estres y metodos de utilizacion en las plantas.
ES01928388T Active ES2277922T3 (es) 2000-04-07 2001-04-06 Proteinas fijadoras de gtp relacionadas con el estres, y metodos de utilizacion en plantas.
ES01989068T Active ES2295230T3 (es) 2000-04-07 2001-04-06 Proteina fosfatasa relacionada con el estres y metodos de uso en las plantas.

Family Applications After (1)

Application Number Title Priority Date Filing Date
ES01928389T Active ES2279810T3 (es) 2000-04-07 2001-04-06 Proteinas relacionadas con el estres del ciclo celular y metodos de utilizacion en plantas.

Country Status (8)

Country Link
US (37) US6689939B2 (es)
EP (18) EP1335986B1 (es)
AT (8) AT355383T (es)
AU (6) AU5525001A (es)
CA (11) CA2785943A1 (es)
DE (8) DE60124880T2 (es)
ES (7) ES2345833T3 (es)
WO (6) WO2001077311A2 (es)

Families Citing this family (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7868229B2 (en) 1999-03-23 2011-01-11 Mendel Biotechnology, Inc. Early flowering in genetically modified plants
US8633353B2 (en) * 1999-03-23 2014-01-21 Mendel Biotechnology, Inc. Plants with improved water deficit and cold tolerance
US20050086718A1 (en) * 1999-03-23 2005-04-21 Mendel Biotechnology, Inc. Plant transcriptional regulators of abiotic stress
US7345217B2 (en) * 1998-09-22 2008-03-18 Mendel Biotechnology, Inc. Polynucleotides and polypeptides in plants
US7939715B2 (en) * 2000-11-16 2011-05-10 Mendel Biotechnology, Inc. Plants with improved yield and stress tolerance
US9322031B2 (en) 1999-05-06 2016-04-26 Monsanto Technology Llc Transgenic plants with enhanced agronomic traits
US20090241217A9 (en) * 2001-05-22 2009-09-24 Jingrui Wu Yield-improved transgenic plants
US20090044297A1 (en) * 1999-05-06 2009-02-12 Andersen Scott E Transgenic plants with enhanced agronomic traits
US7442853B2 (en) * 2000-04-07 2008-10-28 Basf Plant Science Gmbh Protein kinase stress-related proteins and methods of use in plants
US20050066396A1 (en) * 2000-04-07 2005-03-24 Amber Shirley Casein kinase stress-related polypeptides and methods of use in plants
AT540575T (de) 2001-03-16 2012-01-15 Basf Plant Science Gmbh Regulatoren des zucker- und lipidstoffwechsels in pflanzen
US7778711B2 (en) * 2001-08-31 2010-08-17 Bio Control Medical (B.C.M.) Ltd. Reduction of heart rate variability by parasympathetic stimulation
US7763777B2 (en) * 2001-09-05 2010-07-27 Basf Plant Science Gmbh Protein phosphatase stress-related polypeptides and methods of use in plants
ES2335089T3 (es) * 2001-11-09 2010-03-22 Basf Plant Science Gmbh Polipeptidos de proteina quinasa relacionados con el estres y metodos de uso en las plantas.
AU2008212062B2 (en) * 2001-11-09 2011-04-07 Basf Plant Science Gmbh Protein kinase stress-related polypeptides and methods of use in plants
CA2465951A1 (en) * 2001-11-09 2003-05-15 Basf Plant Science Gmbh Transcription factor stress-related polypeptides and methods of use in plants
AU2003202392A1 (en) * 2002-02-05 2003-09-02 National Research Council Of Canada Methods for modifying plant responses to stress and correspondingly derived plants
US20030188330A1 (en) * 2002-03-18 2003-10-02 Jacqueline Heard Genes for modifying plant traits xi
US20030196214A1 (en) * 2002-03-27 2003-10-16 Priti Sharma Novel genes from drought stress tolerant tea plant and a method of introducing water-stress tolerance
CN100434524C (zh) 2002-06-21 2008-11-19 武汉大学 烟草钙调素依赖型蛋白激酶基因、蛋白和制备方法及其应用
US7446241B2 (en) * 2002-07-30 2008-11-04 Texas Tech University Transcription factors, DNA and methods for introduction of value-added seed traits and stress tolerance
WO2004013304A2 (en) 2002-08-02 2004-02-12 Basf Plant Science Gmbh Sugar and lipid metabolism regulators in plants iv
US20090183270A1 (en) 2002-10-02 2009-07-16 Adams Thomas R Transgenic plants with enhanced agronomic traits
US20090049573A1 (en) * 2002-10-02 2009-02-19 Dotson Stanton B Transgenic plants with enhanced agronomic traits
US20050022266A1 (en) * 2002-10-02 2005-01-27 Jingrui Wu Yield-improved transgenic plants
AU2003286916B2 (en) * 2002-11-06 2007-06-14 Pioneer Hi-Bred International, Inc. Auxin-repressed, dormancy-associated promoter and uses thereof
CN100343279C (zh) * 2002-12-31 2007-10-17 德里大学 稻新基因osisap1赋予对应激的耐受性及其方法
KR100586084B1 (ko) 2003-03-31 2006-06-01 한국생명공학연구원 스트레스 저항성 전사인자 유전자, 단백질 및 이에 의해형질전환된 스트레스 저항성 식물체
EP1616014A2 (en) 2003-04-11 2006-01-18 CropDesign N.V. Method to increase stress tolerance in plants
CN103131673A (zh) * 2003-04-15 2013-06-05 巴斯福植物科学有限公司 编码非生物胁迫反应相关蛋白质的核酸序列,以及提高对环境胁迫耐性的植物和植物细胞
BR122014032137B1 (pt) 2003-05-02 2016-02-16 Carlos Alberto Dezar construção de ácido nucleico; célula hospedeira de fungo ou bactéria; método para expressar pelo menos uma proteína de interesse em uma célula hospedeira; e método para obter uma planta transgênica que expressa pelo menos uma proteína de interesse
KR100577142B1 (ko) * 2003-05-07 2006-05-08 한국생명공학연구원 스트레스 저항성 전사인자 유전자, 단백질 및 이에 의해형질전환된 스트레스 저항성 식물체
US7554007B2 (en) 2003-05-22 2009-06-30 Evogene Ltd. Methods of increasing abiotic stress tolerance and/or biomass in plants
BR122016024209B1 (pt) 2003-05-22 2019-08-20 Evogene Ltd. Método para aumentar a biomassa e/ou tolerância de uma planta ao estresse salino e construto de ácido nucleico
AU2005234725B2 (en) * 2003-05-22 2012-02-23 Evogene Ltd. Methods of Increasing Abiotic Stress Tolerance and/or Biomass in Plants and Plants Generated Thereby
EP2186899A3 (en) * 2004-06-14 2010-09-08 Evogene Ltd. Polynucleotides and polypeptides involved in plant fiber development and methods of using same
US8962915B2 (en) * 2004-06-14 2015-02-24 Evogene Ltd. Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same
US7317098B2 (en) * 2004-07-01 2008-01-08 The Board Of Trustees Of Michigan State University Ryegrass CBF3 gene: identification and isolation
US7186622B2 (en) * 2004-07-15 2007-03-06 Infineon Technologies Ag Formation of active area using semiconductor growth process without STI integration
CA2582304A1 (en) * 2004-10-20 2006-04-27 Basf Plant Science Gmbh Scarecrow-like stress-related polypeptides and methods of use in plants
AU2005302590B2 (en) * 2004-10-29 2010-10-14 Basf Plant Science Gmbh Vesicle Trafficking Stress-Related Polypeptides and methods of use in plants
CA2606220A1 (en) * 2005-04-19 2006-12-21 Basf Plant Science Gmbh Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants
CA2619411A1 (en) * 2005-08-12 2007-02-22 Basf Plant Science Gmbh Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress
BRPI0615347A2 (pt) * 2005-08-31 2009-07-14 Mendel Biotechnology Inc toleráncia ao estresse em plantas
US20070214521A1 (en) * 2006-03-08 2007-09-13 The Regents Of The University Of California Role of microRNA in plant salt tolerance
US20080229442A1 (en) 2007-03-14 2008-09-18 Ceres, Inc. Nucleotide sequences and corresponding polypeptides conferring modulated growth rate and biomass in plants grown in saline and oxidative conditions
WO2007124312A2 (en) * 2006-04-19 2007-11-01 Pioneer Hi-Bred International, Inc. Isolated polynucleotide molecules corresponding to mutant and wild-type alleles of the maize d9 gene and methods of use
US7632982B2 (en) * 2006-06-23 2009-12-15 Monsanto Technology Llc Drought responsive promoters HVA22e and PLDδ identified from Arabidopsis thaliana
US7977535B2 (en) 2006-07-12 2011-07-12 Board Of Trustees Of Michigan State University DNA encoding ring zinc-finger protein and the use of the DNA in vectors and bacteria and in plants
CA2672756C (en) * 2006-12-20 2018-11-20 Evogene Ltd. Polynucleotides and polypeptides involved in plant fiber development and methods of using same
AU2008214568B2 (en) 2007-02-16 2013-04-18 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
CN101854798B (zh) 2007-04-09 2013-04-03 伊沃基因有限公司 用于增加植物的油含量、生长速率和/或产量的多核苷酸、多肽和方法
US20100093715A1 (en) * 2007-04-23 2010-04-15 Basf Se Plant productivity enhancement by combining chemical agents with transgenic modifications
CN102770542A (zh) * 2007-05-22 2012-11-07 巴斯夫植物科学有限公司 对环境胁迫具有提高的耐性和/或抗性以及增加的生物量产生的植物
AU2008277735A1 (en) * 2007-07-13 2009-01-22 Basf Plant Science Gmbh Transgenic plants with increased stress tolerance and yield
CA3019282A1 (en) * 2007-07-24 2009-01-29 Evogene Ltd. Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same
CN101889089B (zh) 2007-11-27 2013-10-23 巴斯夫植物科学有限公司 具有增加的胁迫耐受性和产率的转基因植物
US20110119791A1 (en) 2007-12-27 2011-05-19 Evogene Ltd. Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants
US8847008B2 (en) * 2008-05-22 2014-09-30 Evogene Ltd. Isolated polynucleotides and polypeptides and methods of using same for increasing plant utility
EP2331685A1 (en) * 2008-08-15 2011-06-15 E. I. du Pont de Nemours and Company Plants with altered root architecture, related constructs and methods involving genes encoding protein phophatase 2c (pp2c) polypeptides and homologs thereof
EP2326163B1 (en) * 2008-08-18 2016-05-04 Evogene Ltd. Isolated polypeptides and polynucleotides useful for increasing nitrogen use efficiency, abiotic stress tolerance, yield and biomass in plants
US20110145948A1 (en) * 2008-08-20 2011-06-16 BASG Plant Science GmbH Transgenic Plants Comprising as Transgene a Phosphatidate Cytidylyltransferase
US8688258B2 (en) 2008-09-11 2014-04-01 Rockwell Automation Technologies, Inc. Method of controlling a machine tool
WO2010049897A2 (en) 2008-10-30 2010-05-06 Evogene Ltd. Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficieny
MX350550B (es) 2008-12-29 2017-09-08 Evogene Ltd Polinucleotidos, polipeptidos codificados, y metodos para utilizarlos para aumentar la tolerancia al estres, abiotico, biomasa y/o rendimiento en plantas que los expresan.
CN102300992A (zh) 2009-01-28 2011-12-28 巴斯夫植物科学有限公司 为增强转基因植物的干旱抗性和提高其产量而工程化nf-yb转录因子
AU2010220157C1 (en) 2009-03-02 2015-08-06 Evogene Ltd. Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics
BRPI1010843A2 (pt) * 2009-06-08 2015-09-08 Nunhems Bv plantas tolerantes à seca
EP3238534A3 (en) 2009-06-10 2017-11-22 Evogene Ltd. Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance
US9175301B2 (en) * 2009-07-24 2015-11-03 Pioneer Hi Bred International Inc Use of dimerization domain component stacks to modulate plant architecture
CN102041248A (zh) * 2009-10-20 2011-05-04 中国科学院遗传与发育生物学研究所 植物耐逆性相关蛋白GmSIK1及其编码基因与应用
AU2010337936B2 (en) 2009-12-28 2016-06-23 Evogene Ltd. Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency
WO2011135527A2 (en) 2010-04-28 2011-11-03 Evogene Ltd. Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics
CN102311490B (zh) 2010-07-08 2014-10-22 中国科学院上海生命科学研究院 一种植物抗热基因JAZ5a及其应用
MX354193B (es) 2010-12-22 2018-02-16 Evogene Ltd Polinucleótidos y polipéptidos aislados, y métodos para utilizarlos para aumentar la tolerancia al estrés abiótico, rendimiento, tasa de crecimiento, vigor, biomasa, contenido de aceite y/o eficacia en el uso de nitrógeno de las plantas.
US20140223604A1 (en) * 2011-05-13 2014-08-07 Andy Pereira Crop plants with improved water use efficiency and grain yield and methods of making them
ES2627330T3 (es) * 2011-07-07 2017-07-27 Keygene N.V. Uso de JAZ5a para mejorar la resistencia a la sequía en una planta
WO2013023243A1 (en) * 2011-08-12 2013-02-21 Commonwealth Scientific And Industrial Research Organisation Methods of controlling fructan synthesis in plants
US9035132B2 (en) 2012-02-21 2015-05-19 Lia Raquel Chan Modified Helianthus annuus transcription factor improves yield
CN104136634A (zh) * 2012-03-02 2014-11-05 出光兴产株式会社 水系冷却剂
CN103305486B (zh) * 2012-03-09 2014-11-12 中国农业科学院作物科学研究所 小麦TaCPK2蛋白在植物抗病育种中的应用
CA2869567A1 (en) * 2012-04-05 2013-10-10 Howard University Methods for modulating plant response to environmentally-induced stress
ITAN20120129A1 (it) 2012-10-16 2014-04-17 Ariston Thermo Spa Deflettore per l'ingresso di acqua fredda in uno scaldacqua ad accumulo
WO2014160152A1 (en) 2013-03-13 2014-10-02 The Board Of Trustees Of The University Of Arkansas Methods of increasing resistance of crop plants to heat stress and selecting crop plants with increased resistance to heat stress
CA2918452A1 (en) * 2013-07-15 2015-01-22 Donald Danforth Plant Science Center Enhanced oil production and stress tolerance in plants
US9101100B1 (en) 2014-04-30 2015-08-11 Ceres, Inc. Methods and materials for high throughput testing of transgene combinations
CN104450743A (zh) * 2014-12-19 2015-03-25 重庆大学 茄子花青素合成相关基因SmMYB1在培育紫色非洲红茄品种中的应用
CN105505946B (zh) * 2015-11-25 2019-04-23 广东省农业科学院水稻研究所 一种提高水稻穗瘟抗性的基因GF14e、蛋白及其应用
EP3351107B1 (en) 2017-01-20 2019-07-10 Agrotecnologias Naturales, S.L. Method for reducing plant water stress
CN107746851A (zh) * 2017-10-30 2018-03-02 齐齐哈尔大学 砂藓蛋白磷酸酶2C基因RcPP2C及其编码蛋白和应用

Family Cites Families (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0714349B2 (ja) 1983-01-17 1995-02-22 モンサント カンパニ− 植物細胞での発現に適したキメラ遺伝子
US5352605A (en) 1983-01-17 1994-10-04 Monsanto Company Chimeric genes for transforming plant cells using viral promoters
US5504200A (en) 1983-04-15 1996-04-02 Mycogen Plant Science, Inc. Plant gene expression
AT141646T (de) 1986-04-09 1996-09-15 Genzyme Corp Genetisch transformierte tiere, die ein gewünschtes protein in milch absondern
US4962028A (en) 1986-07-09 1990-10-09 Dna Plant Technology Corporation Plant promotors
US5420034A (en) 1986-07-31 1995-05-30 Calgene, Inc. Seed-specific transcriptional regulation
US4987071A (en) 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5116742A (en) 1986-12-03 1992-05-26 University Patents, Inc. RNA ribozyme restriction endoribonucleases and methods
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
WO1989005859A1 (en) 1987-12-21 1989-06-29 The Upjohn Company Agrobacterium mediated transformation of germinating plant seeds
US5614395A (en) 1988-03-08 1997-03-25 Ciba-Geigy Corporation Chemically regulatable and anti-pathogenic DNA sequences and uses thereof
US5990387A (en) 1988-06-10 1999-11-23 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
DE3843628A1 (de) 1988-12-21 1990-07-05 Inst Genbiologische Forschung Wundinduzierbare und kartoffelknollenspezifische transkriptionale regulation
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
DK0472712T3 (da) 1990-03-16 2002-01-14 Calgene Llc Sekvenser, der præferentielt eksprimeres i tidlig frøudvikling og dertil relaterede fremgangsmåder
US5187267A (en) 1990-06-19 1993-02-16 Calgene, Inc. Plant proteins, promoters, coding sequences and use
AU2781892A (en) 1991-10-07 1993-05-03 Ciba-Geigy Ag Particle gun for introducing dna into intact cells
WO1993021334A1 (en) 1992-04-13 1993-10-28 Zeneca Limited Dna constructs and plants incorporating them
GB9324707D0 (en) 1993-12-02 1994-01-19 Olsen Odd Arne Promoter
US5576198A (en) 1993-12-14 1996-11-19 Calgene, Inc. Controlled expression of transgenic constructs in plant plastids
GB9403512D0 (en) 1994-02-24 1994-04-13 Olsen Odd Arne Promoter
GB9421286D0 (en) 1994-10-21 1994-12-07 Danisco Promoter
US6177614B1 (en) * 1995-03-16 2001-01-23 Cold Spring Harbor Laboratory Control of floral induction in plants and uses therefor
WO1997006250A1 (en) 1995-08-10 1997-02-20 Rutgers University Nuclear-encoded transcription system in plastids of higher plants
MX205414B (es) * 1996-05-08 2001-12-07 Univ Mexico Nacional Autonoma Metodo para incrementar de trehalosa de los organismos por medio de su transformacion con el adnc de la trehalosa-6-fosfato sintasa/fosfatasa de selaginella lepidophylla.
AU3351997A (en) * 1996-06-28 1998-01-21 University Of Bristol, The G protein signal transduction in plants
DE19626564A1 (de) 1996-07-03 1998-01-08 Hoechst Ag Genetische Transformation von Ciliatenzellen durch Microcarrier-Bombardement mit DNA beladenen Goldpartikeln
US6171864B1 (en) * 1996-07-05 2001-01-09 Pioneer Hi-Bred International, Inc. Calreticulin genes and promoter regions and uses thereof
US6417428B1 (en) 1996-09-04 2002-07-09 Michael F. Thomashow Plant having altered environmental stress tolerance
US5892009A (en) 1996-09-04 1999-04-06 Michigan State University DNA and encoded protein which regulates cold and dehydration regulated genes
US5939601A (en) * 1996-09-27 1999-08-17 Rutgers, The State University Of New Jersey Genes associates with enhanced disease resistance in plants
US7084323B1 (en) * 1996-12-13 2006-08-01 The General Hospital Corporation Stress-protected transgenic plants
WO1998026045A1 (en) 1996-12-13 1998-06-18 The General Hospital Corporation Stress-protected transgenic plants
WO1998037184A1 (en) * 1997-02-21 1998-08-27 The Regents Of The University Of California Leafy cotyledon1 genes and their uses
US5977436A (en) 1997-04-09 1999-11-02 Rhone Poulenc Agrochimie Oleosin 5' regulatory region for the modification of plant seed lipid composition
AUPO947997A0 (en) 1997-09-26 1997-10-23 Commonwealth Scientific And Industrial Research Organisation Method of regulating gene expression
WO1999016890A2 (en) 1997-09-30 1999-04-08 The Regents Of The University Of California Production of proteins in plant seeds
US5929305A (en) * 1997-10-14 1999-07-27 Michigan State University Plant material containing non-naturally introduced binding protein for regulating cold and dehydration regulatory genes
CN1222621C (zh) 1998-03-11 2005-10-12 辛根塔参与股份公司 新的植物质体启动子序列
JP3586706B2 (ja) * 1998-03-11 2004-11-10 独立行政法人農業生物資源研究所 細胞死を調節する方法
JP2004527201A (ja) * 1998-04-09 2004-09-09 アリゾナ ボード オブ リーゼンツ アルフィン1の発現、ならびに根の生長および根の特定の遺伝子活性化の増大したトランスジェニック植物を生産する方法
JP2002512040A (ja) * 1998-04-21 2002-04-23 クロップデザイン エヌ.ブイ. ストレス耐性植物
US6004804A (en) 1998-05-12 1999-12-21 Kimeragen, Inc. Non-chimeric mutational vectors
US20100293663A2 (en) * 1998-06-16 2010-11-18 Thomas La Rosa Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement
US6265636B1 (en) * 1998-06-19 2001-07-24 Pioneer Hi-Bred International, Inc. Pyruvate dehydrogenase kinase polynucleotides, polypeptides and uses thereof
AU4838199A (en) * 1998-06-29 2000-01-17 Cornell Research Foundation Inc. Production of low-temperature, salt-and drought-tolerant transgenic cereal plants
US6727407B1 (en) * 1998-07-24 2004-04-27 Regents Of The University Of California NUCLEIC ACIDS ENCODING THE ARABIDOPSIS PROTEIN KINASE β-SUBUNIT CKB3 AND A METHOD OF ALTERING CIRCADIAN RHYTHMS AND FLOWERING IN A PLANT BY TRANFORMING WITH A NUCLEIC ACID ENCODING A PROTEIN KINASE β-SUBUNIT
GB9816639D0 (en) * 1998-07-30 1998-09-30 Novartis Ag Organic compounds
US6613959B1 (en) 1998-08-10 2003-09-02 The General Hospital Corporation Transgenic plants expressing a MAPKKK protein kinase domain
AU5475399A (en) * 1998-08-10 2000-03-06 General Hospital Corporation, The Transgenic plants expressing a dual-specificity mapk phosphatase and uses thereof
US5981729A (en) 1998-08-27 1999-11-09 Korea Kumho Petrochemical Co., Ltd. Transcription factor gene induced by water deficit and abscisic acid isolated from Arabidopsis thaliana
WO2000036121A2 (en) * 1998-12-16 2000-06-22 E.I. Du Pont De Nemours And Company Plant protein phosphatases
EP1141353A2 (en) 1998-12-17 2001-10-10 CropDesign N.V. Plant cell cycle genes and uses thereof
EP1033405A3 (en) * 1999-02-25 2001-08-01 Ceres Incorporated Sequence-determined DNA fragments and corresponding polypeptides encoded thereby
US6137031A (en) 1999-03-11 2000-10-24 Duke University DNA binding proteins that interact with NPR1
AU4810700A (en) 1999-05-14 2000-12-05 Pioneer Hi-Bred International, Inc. Signal transduction genes and methods of use
WO2001002541A2 (en) 1999-07-01 2001-01-11 The Penn State Research Foundation Compositions and methods for regulating abscisic acid-induced closure of plant stomata
US7151202B1 (en) * 1999-07-19 2006-12-19 Japan Science And Technology Agency Environmental stress resistance gene
US6603061B1 (en) * 1999-07-29 2003-08-05 Monsanto Company Agrobacterium-mediated plant transformation method
US6376747B1 (en) 1999-08-27 2002-04-23 Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Agriculture And Agri-Food Canada Plant-derived map kinase kinase
AU7117400A (en) * 1999-09-07 2001-04-10 Pioneer Hi-Bred International, Inc. Maize casein kinase 1 orthologue and uses thereof
AU2912301A (en) 1999-12-22 2001-07-03 Basf Plant Science Gmbh Pyrophosphatase stress-related proteins and methods of use in plants
ES2380422T3 (es) * 2000-12-22 2012-05-11 Cropdesign N.V. Genes de la remolacha azucarera involucrados en la tolerancia al estrés

Also Published As

Publication number Publication date
US20080072347A1 (en) 2008-03-20
US7161063B2 (en) 2007-01-09
CA2405721A1 (en) 2001-10-18
AT460491T (de) 2010-03-15
US7495151B2 (en) 2009-02-24
US7504559B2 (en) 2009-03-17
US20090100541A1 (en) 2009-04-16
US7179962B2 (en) 2007-02-20
CA2405697A1 (en) 2002-06-13
US6689939B2 (en) 2004-02-10
EP2357242A1 (en) 2011-08-17
EP1268828A2 (en) 2003-01-02
US7521598B2 (en) 2009-04-21
AU5526101A (en) 2001-10-23
US20040148658A1 (en) 2004-07-29
US20090100540A1 (en) 2009-04-16
US20090031451A1 (en) 2009-01-29
US20080168585A1 (en) 2008-07-10
US7456337B2 (en) 2008-11-25
ES2295230T3 (es) 2008-04-16
CA2405703A1 (en) 2001-10-18
US20080189806A1 (en) 2008-08-07
US7482511B2 (en) 2009-01-27
WO2001077356A3 (en) 2003-10-16
DE60124880D1 (de) 2007-01-11
EP2175028A3 (en) 2010-07-14
WO2001077354A2 (en) 2001-10-18
US20090165170A1 (en) 2009-06-25
AT348181T (de) 2007-01-15
DE60126920D1 (de) 2007-04-12
US7803987B2 (en) 2010-09-28
CA2405750A1 (en) 2001-10-18
US7271316B2 (en) 2007-09-18
CA2405708A1 (en) 2001-10-18
AU5524901A (en) 2001-10-23
EP1760146A2 (en) 2007-03-07
DE60141547D1 (de) 2010-04-22
US20080168578A1 (en) 2008-07-10
CA2404857C (en) 2012-11-27
US7709698B2 (en) 2010-05-04
US20110055979A1 (en) 2011-03-03
US20080168577A1 (en) 2008-07-10
EP1311693B1 (en) 2006-09-13
US20090320158A1 (en) 2009-12-24
DE60142715D1 (de) 2010-09-09
WO2001077355A3 (en) 2002-08-29
WO2001077356A2 (en) 2001-10-18
US6818805B2 (en) 2004-11-16
EP2172555A1 (en) 2010-04-07
US20070157334A1 (en) 2007-07-05
CA2789254A1 (en) 2001-10-18
EP1760146B1 (en) 2010-07-28
WO2001077354A3 (en) 2002-09-12
US6677504B2 (en) 2004-01-13
EP1795600A2 (en) 2007-06-13
EP1335986B1 (en) 2007-12-05
AT380248T (de) 2007-12-15
CA2405703C (en) 2012-06-19
US7915484B2 (en) 2011-03-29
ES2272461T3 (es) 2007-05-01
EP2169069A2 (en) 2010-03-31
WO2001077311A3 (en) 2003-01-23
ES2277922T3 (es) 2007-08-01
EP1760145A2 (en) 2007-03-07
US7482510B2 (en) 2009-01-27
US20090188004A1 (en) 2009-07-23
US20100325759A1 (en) 2010-12-23
CA2785943A1 (en) 2001-10-18
AT339509T (de) 2006-10-15
CA2405721C (en) 2012-06-19
US7838731B2 (en) 2010-11-23
US7714190B2 (en) 2010-05-11
US7855324B2 (en) 2010-12-21
DE60124880T2 (de) 2007-09-06
US6867351B2 (en) 2005-03-15
EP1881073A3 (en) 2008-02-13
DE60126771D1 (de) 2007-04-05
DE60123079D1 (de) 2006-10-26
EP2281894A3 (en) 2011-03-23
AU4319002A (en) 2002-06-18
WO2002046442A2 (en) 2002-06-13
CA2405750C (en) 2013-06-11
US7435875B2 (en) 2008-10-14
US20040199946A1 (en) 2004-10-07
US20080141388A1 (en) 2008-06-12
US20020059662A1 (en) 2002-05-16
US20040194163A1 (en) 2004-09-30
CA2404857A1 (en) 2001-10-18
EP1335986A2 (en) 2003-08-20
AT346945T (de) 2006-12-15
WO2001077161A2 (en) 2001-10-18
US20080263725A1 (en) 2008-10-23
EP1760146A3 (en) 2007-05-02
EP1881073A2 (en) 2008-01-23
EP1268830A2 (en) 2003-01-02
WO2001077161A3 (en) 2003-01-30
US7847155B2 (en) 2010-12-07
EP1268830B1 (en) 2007-02-28
EP1881073B1 (en) 2010-03-10
EP1728870A3 (en) 2007-01-10
US7888559B2 (en) 2011-02-15
US6720477B2 (en) 2004-04-13
DE60123079T2 (de) 2007-04-05
EP2281894A2 (en) 2011-02-09
WO2001077355A2 (en) 2001-10-18
EP1373530B1 (en) 2006-12-13
DE60131772T2 (de) 2008-11-20
US7608757B2 (en) 2009-10-27
US20080172759A1 (en) 2008-07-17
EP1311693A2 (en) 2003-05-21
US7514599B2 (en) 2009-04-07
US7919684B2 (en) 2011-04-05
US6710229B2 (en) 2004-03-23
US20040216183A1 (en) 2004-10-28
EP1373530A2 (en) 2004-01-02
DE60125245T2 (de) 2007-04-19
US7880056B2 (en) 2011-02-01
EP1760145A3 (en) 2007-05-02
DE60126920T2 (de) 2007-06-21
US7166767B2 (en) 2007-01-23
US20040107463A1 (en) 2004-06-03
US7425666B2 (en) 2008-09-16
WO2001077311A2 (en) 2001-10-18
US20070157344A1 (en) 2007-07-05
CA2405697C (en) 2012-06-19
CA2767239C (en) 2016-08-23
US7259294B2 (en) 2007-08-21
EP1783229A2 (en) 2007-05-09
US20020069432A1 (en) 2002-06-06
EP2175028A2 (en) 2010-04-14
US20030097675A1 (en) 2003-05-22
US7427696B2 (en) 2008-09-23
AU4994101A (en) 2001-10-23
EP1728870A2 (en) 2006-12-06
CA2767275A1 (en) 2001-10-18
EP1294912A2 (en) 2003-03-26
US20090320157A1 (en) 2009-12-24
US20080201799A1 (en) 2008-08-21
US20070192908A1 (en) 2007-08-16
CA2767270A1 (en) 2002-06-13
AU5324701A (en) 2001-10-23
CA2767239A1 (en) 2001-10-18
US20040128721A1 (en) 2004-07-01
DE60125245D1 (de) 2007-01-25
ES2279810T3 (es) 2007-09-01
AT354666T (de) 2007-03-15
US20090138987A1 (en) 2009-05-28
DE60131772D1 (de) 2008-01-17
DE60126771T2 (de) 2007-11-15
US7189893B2 (en) 2007-03-13
US7763776B2 (en) 2010-07-27
WO2002046442A3 (en) 2003-06-12
EP1294912B1 (en) 2007-02-21
US20020066124A1 (en) 2002-05-30
US20020102695A1 (en) 2002-08-01
US20100011466A1 (en) 2010-01-14
ES2345833T3 (es) 2010-10-04
US7795500B2 (en) 2010-09-14
US20080307543A1 (en) 2008-12-11
EP1795600A3 (en) 2007-06-20
EP2169069A3 (en) 2010-07-14
US20020152502A1 (en) 2002-10-17
EP2264056A1 (en) 2010-12-22
EP1268828B1 (en) 2006-11-29
AT475715T (de) 2010-08-15
AT355383T (de) 2006-03-15
EP1783229A3 (en) 2007-07-18
ES2272466T3 (es) 2007-05-01
AU5525001A (en) 2001-10-23
US20090144859A1 (en) 2009-06-04
US7498482B2 (en) 2009-03-03
US7858847B2 (en) 2010-12-28

Similar Documents

Publication Publication Date Title
US20070199103A1 (en) Nucleic acid molecules encoding wrinkled1-like polypeptides and methods of use in plants
EP1395108B1 (en) Sugar and lipid metabolism regulators in plants
US20080141388A1 (en) Cell-Cycle Stress-Related Proteins and Methods of Use in Plants
US7622570B2 (en) Plants expressing putative palmitoyl protein thioesterase
US8212111B2 (en) Sugar and lipid metabolism regulators in plants III
CN101228277B (zh) 过表达accdp基因的植物中的产量增加
DE60034069T2 (de) Stress-gekoppelte transkriptionsfaktor proteine sowie methoden zu ihrer verwendung in pflanzen
US7446241B2 (en) Transcription factors, DNA and methods for introduction of value-added seed traits and stress tolerance
AU2009801A (en) Moss genes from physcomitrella patens encoding proteins involved in the synthesis of tocopherols carotenoids and aromatic amino acids
CN101296613B (zh) 显性失活突变体krp蛋白保护活性细胞周期蛋白-cdk复合物不受野生型krp抑制
WO2001038541A1 (en) Moss genes from physcomitrella patents encoding proteins involved in the synthesis of polyunsaturated fatty acids and lipids
Yang et al. GsAPK, an ABA-activated and calcium-independent SnRK2-type kinase from G. soja, mediates the regulation of plant tolerance to salinity and ABA stress
Ohba et al. Diverse response of rice and maize genes encoding homologs of WPK4, an SNF1-related protein kinase from wheat, to light, nutrients, low temperature and cytokinins
US20110010803A1 (en) Polypeptides, Such As Lipases, Capable Of Altering The Seed Storage Content In Transgenic Plants
US9328354B2 (en) Transgenic plant with increased stress tolerance and yield
ES2550364T3 (es) Plantas que tienen incrementada la tolerancia al estrés térmico
US8916748B2 (en) Nucleic acid molecules encoding polypeptides involved in regulation of sugar and lipid metabolism and methods of use VIII
US20110035841A1 (en) Lipid Metabolism Proteins, Combinations of Lipid Metabolism Proteins and Uses Thereof
US8188339B2 (en) Sugar and lipid metabolism regulators in plants IV
US8835714B2 (en) Sugar and lipid metabolism regulators in plants II
EP2163638A1 (en) Nucleic acid molecules encoding fatty acid desaturase genes from plants and methods of use
US7795415B2 (en) Casein kinase stress-related polypeptides and methods of use in plants
CN103717732A (zh) 增加植物产量和胁迫耐性的方法
EP1572901B1 (en) Transposable elements in rice and methods of use
AU2005295398B2 (en) Scarecrow-like stress-related polypeptides and methods of use in plants