Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/0004—Oxidoreductases (1.)
  • C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
  • C12N9/0057—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10) with oxygen as acceptor (1.10.3)
  • C12N9/0059—Catechol oxidase (1.10.3.1), i.e. tyrosinase
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/0004—Oxidoreductases (1.)
  • C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
  • C12N9/0057—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10) with oxygen as acceptor (1.10.3)
  • C12N9/0061—Laccase (1.10.3.2)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P21/00—Preparation of peptides or proteins
  • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione

Definitions

• the present invention relates to the use of monocaryotic strains of filamentous fungi of the species Pycnoporus of the basidiomycete group, for the implementation of a process for the preparation of a specific recombinant protein, said process being carried out by overexpression of the gene coding for this protein in the aforementioned monocaryotic strain of Pycnoporus.
• two fungal models are preferably used by large industrial groups in the context of the production of enzymes involved in plant biotransformations, such as metalloenzymes. These are ⁇ HAspergillus, and Trichoderma, which belong to the group of deuteromycetes.
• the present invention stems from the demonstration by the inventors that the transformation of monocaryotic strains of P. cinnabarinus deficient for laccase activity using vectors containing the gene coding for this laccase and whose expression is under the control of a promoter identical to the endogenous pLac promoter of P. cinnabarinus laccase, leads to an equivalent production of laccase only when implementing a process of overproduction of laccase by induction of the endogenous promoter of this laccase by action ethanol on monocaryotic strains of P. cinnabarinus not deficient in laccase activity, and which equals g / 1.
• the subject of the present invention is a process for preparing a specific recombinant protein, said process being carried out by overexpression of the gene coding for this determined protein in a monocaryotic strain of filamentous fungi of the species Pycnoporus of the basidiomycete group, and comprises: - a step of culturing the aforementioned monocaryotic strain of Pycnoporus, said strain being transformed using an expression vector containing the gene coding for the determined recombinant protein, the expression of which is placed under the control of a promoter corresponding to an endogenous promoter of the above-mentioned fungi, or of a different promoter (also called exogenous promoter), said promoter constituting or inducible, - where appropriate a step of inducing the above-mentioned
• a more particular subject of the invention is a method as described above, characterized in that the monocaryotic strain of Pycnoporus used for the overexpression of the gene coding for the determined recombinant protein is as obtained by culturing the original dicaryotic strain at 30 ° C in the dark for 15 days, followed by an exposure step on day 2 to 3 weeks at room temperature until the formation of fruiting bodies corresponding to differentiated hyphae called basides , within which karyogamy then takes place (fusion of the nuclei), followed by meiosis which leads to the formation of four sexual spores, or genetically different haploid basidiospores, which, after germination, generates a monocaryotic mycelium.
• the monocaryotic strain of Pycnoporus used in the above-mentioned method of the invention is a strain of Pycnoporus cinnabarinus.
• the recombinant proteins determined to be overexpressed within the framework of the implementation of the method according to the invention correspond either to endogenous proteins of Pycnoporus, or to exogenous proteins different from the endogenous proteins of the strain of Pycnoporus used for the production of said proteins.
• these exogenous proteins correspond to endogenous proteins of basidiomycetes other than Pycnoporus, such as the enzymes basidiomycetes involved in plant biotransformations, or correspond to endogenous proteins of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins.
• the invention more particularly relates to a process as described above, characterized in that the determined recombinant proteins correspond: - to the following endogenous Pycnoporus proteins: * the metalloenzymes, such as laccase, or tyrosinase, * or cellobiose dehydrogenase, xylanase, ⁇ -glycosidase, invertase, or ⁇ -amylase, - with exogenous proteins chosen from the following: * tyrosinases from strains of Pycnoporus different from the strain of Pycnoporus used for production of said proteins, such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * laccases of basidiomycetes other than Pycnoporus, such as laccase of haloc
• the monocaryotic strain of Pycnoporus used is deficient for the gene coding for the endogenous protein to which the determined recombinant protein corresponds, so as not to have to separating the determined recombinant protein from the endogenous protein to which it corresponds during the purification of said recombinant protein.
• the monocaryotic strain of Pycnoporus used may not be deficient for the gene coding for the endogenous protein to which the determined recombinant protein corresponds, said strain. then being transformed using an expression vector containing the gene coding for the determined recombinant protein marked in order to distinguish it from the endogenous protein during the purification step.
• the determined recombinant protein can be labeled with a histidine tag (His-tag).
• the invention more particularly relates to a process for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus, the if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus, transformed using an expression vector containing the gene coding for a laccase for Pycnoporus, if necessary marked, and whose expression is placed under the control of a promoter corresponding to the endogenous promoter of this laccase, a step of inducing the above-mentioned promoter, in particular by adding ethanol, or agricultural by-products containing lignocellulose such as wheat straw, corn bran and beet pulp, or compounds with an aromatic cycle such as 2,5-xylidine, veratrylic acid, gua ⁇ col, veratrylic alcohol, syringaldazin
• the invention relates more particularly to a process as defined above, for the preparation of the recombinant laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a stage of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus cinnabarinus, transformed using a vector of expression containing the nucleotide sequence (or nucleic acid) SEQ LD NO: 1 coding for the recombinant laccase represented by SEQ JO NO: 2, where appropriate marked, in particular by a His-tag label, and the expression of
• a more particular subject of the invention is a process for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus, transformed using an expression vector containing the gene coding for a laccase of Pycnoporus, the expression of which is placed under the control of an exogenous promoter chosen from: * the gpd promoter for the expression of the gene coding for glyceraldehyde 3-phosphate dehydrogenase from the common Schizophyllum, the nucleotide sequence of which is represented by SEQ ID NO: 4, * or the sc3 promoter of the expression of the gene coding for the common Schizophyllum hydrophobin, the nucleotide sequence of which is represented by SEQ ID NO: 4,
• the invention relates more particularly to a process as defined above, for preparing the laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a step of setting in culture of a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 1 coding for the recombinant laccase represented by SEQ ID NO: 2, where appropriate marked, in particular by a His-tag label, the expression of which is placed under the control of the exogenous promoter gpd or sc3, - the recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ ID NO: 2 produced in the culture medium
• the invention more particularly relates to a process as defined above, for the preparation of recombinant tyrosinase corresponding to the tyrosinase of Pycnoporus sanguineus represented by SEQ JD NO: 16, characterized in that it comprises: - a step of setting in culture of a monocaryotic strain of Pycnoporus cinnabarinus transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 15 coding for the recombinant tyrosinase represented by SEQ JD NO: 16, where appropriate labeled sequence SEQ JD NO: 15 being advantageously preceded by the nucleotide sequence delimited by the nucleotides located at positions 128 and 190 of SEQ ID NO: 1 coding for the signal peptide of Pycnoporus cinnabarinus delimited by the first 21 amino acids of SEQ ID NO: .2 , and the expression of which is placed
• the invention relates more particularly to a process as defined above, for the preparation of recombinant laccase corresponding to the laccase of halocyphina villosa shown in FIG. 12 (SEQ JD NO: 18), characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous lcase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence represented on the FIG.
• SEQ JD NO: 17 coding for the recombinant laccase represented by SEQ ID NO: 18, where appropriate marked, and the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the laccase of Pycnoporus cinnabarinus , the sequence of said pLac promoter being represented by SEQ JD NO: 3, - a step of induction with ethanol of the aforementioned pLac promoter, - recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ ID NO: 18 produced in the culture medium.
• the subject of the invention is also the nucleotide sequence coding for the promoter pLac of the endogenous laccase of Pycnoporus cinnabarinus, and corresponding to the sequence SEQ ID NO: 3, or any sequence derived from this promoter by substitution, addition or deletion of a or several nucleotides and retaining the property of being a promoter of the expression of sequences.
• the invention also relates to any expression vector, such as the plasmid pELP, characterized in that it comprises the sequence SEQ ID NO: 3 of the aforementioned pLac promoter, or a derived sequence as defined above.
• the subject of the invention is more particularly any expression vector as defined above, characterized in that it comprises a gene coding for a specific recombinant protein, and the expression of which is placed under the control of the aforementioned pLac promoter , or a derived sequence as defined above.
• the invention relates more particularly to any expression vector as defined above, characterized in that the determined recombinant protein is a protein corresponding: - to the following endogenous Pycnoporus proteins: * the metalloenzymes, such as laccase, or the tyrosinase, * or cellobiose dehydrogenase, xylanase, ⁇ -glycosidase, invertase, or ⁇ -amylase, - with exogenous proteins chosen from the following: * tyrosinases of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins, such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * the laccases of basidiomycetes other than Pycnoporus
• the invention also relates to any host cell transformed using an expression vector as defined above.
• the subject of the invention is more particularly any host cell mentioned above, corresponding to monocaryotic cells of Pycnoporus strains, such as the Pycnoporus cinnabarinus strains.
• the subject of the invention is also the use of expression vectors as defined above, or of host cells mentioned above, for the implementation of a method of overproduction of a determined recombinant protein as defined above. above.
• Pycnoporus cinnabarinus Expression System namely the development of an efficient fungal expression model making it possible to overcome the industrial models currently used by major European groups (Aspergillus and Trichoderma).
• Pycnoporus cinnabarinus Expression System namely the development of an efficient fungal expression model making it possible to overcome the industrial models currently used by major European groups (Aspergillus and Trichoderma).
• it is a eukaryotic expression system and more specifically a filamentous fungus of the basidiomycete group, Pycnoporus cinnabarinus, which has been developed by the inventors for the overexpression of proteins of industrial interest.
• the purpose of this step is to isolate and then select haploid cell lines from the sexual spores of a filamentous fungus, Pycnoporus cinnabarinus, which will be used as a host for the expression of the genes of interest.
• P. cinnabarinus is a heterothallic fungus which is found in the wild in the dicaryotic form (two unpaired nuclei per cell) from which monocaryotic lines are selected (one nucleus per cell), potentially more stable and therefore usable for transformation genetic.
• lac " laccase
• the fungus can multiply vegetatively (Fig. 1).
• basides Within differentiated hyphae called basides, then takes place karyogamy (fusion of nuclei), followed by meiosis which leads to the formation of four sexual spores, or genetically different haploid basidiospores. After germination, each basidiospore generates a monocaryotic mycelium. A simple colorimetric test then makes it possible to select only the strains lacking laccase activity.
• the fruiting medium is composed of 2% malt extract (PN) and agar (1.6% P / N).
• the cultures are sown in Petri dishes and kept at 30 ° C in the dark for 15 days before exposing them to the day 2 to 3 weeks at room temperature.
• the f uctification body appears orange-red.
• the monospores are then harvested with sterile water on the lid of the Petri dish.
• the suspension is diluted and cultured in Petri dishes containing MA2 medium (2% P / N malt and 2% P / N agar) in order to isolate colonies. Isolated pure cultures are pricked and kept in MA2 medium at 30 ° C for 5 days and stored at 4 ° C.
• reaction mixture 100 ng of genomic DNA; 0.2 mM dATP, dCTP, dTTP, and dGTP; 25 pmol of each nucleotide primer; 0.1 volume of 10X Pfu polymerase buffer (100 mM Tris-HCl, 15mM MgCl, 500 mM KCl, pH 8.3) and 1 U of Pfu polymerase.
• 10X Pfu polymerase buffer 100 mM Tris-HCl, 15mM MgCl, 500 mM KCl, pH 8.3
• the reaction conditions are as follows: 5 cycles of 94 ° C, 5 min; 55 ° C, 30 s; and 72 ° C, 4 min; then 25 cycles of 94 ° C, 30 s; 55 ° C, 30 s, and 72 ° C, 3 min.
• a step of 10 min at 72 ° C. is carried out in order to finish the reaction.
• a band of 1.64 kbp was obtained corresponding to the central part of the laccase gene.
• the DNA sequence was cloned into pGEM-T in order to sequence this part of the gene.
• the PCR reaction is carried out with 150 ng of DNA cut by PstI and recircularized on itself by ligation and the nucleotide primers Fex (SEQ ID NO: 8; GGATAACTACTGGATCCGCG) and Rex (SEQ ID NO: 9; CGCAGTATTGCGTGGAGAG).
• the reaction conditions are as follows: 5 cycles of 94 ° C, 5 min; 55 ° C, 30 s; and 72 ° C, 5 min; then 25 cycles of 94 ° C, 30 s; 55 ° C, 30 s, and 72 ° C, 4 min with a final step of 10 min at 72 ° C.
• the amplified DNA fragment corresponds to a 2.7 kbp band which has been cloned into pGEM-T and sequenced.
• the entire gene coding for laccase was then defined by combining the central part and the amplified 5 'and 3' parts.
• the entire gene was amplified (3.331 kbp, FIG. 4) with the nucleotide primers Fin (SEQ JD NO: 10; GACATCTGGAGCGCCTGTC) and Rin (SEQ ID NO: 11; ATCGAAGGTTCCGATGACTGACATGAC) from genomic DNA of P. cinnabarinus.
• This gene was also cloned from the genomic DNA of P. cinnabarinus ss3 and was found to be identical to that isolated in P. cinnabarinus I-937.
• a terminator of the gene coding for hydrophobin sc3 from Schizophyllum commune was placed downstream in order to complete the transcription step.
• This vector called pELP will be used for the homologous expression of laccase (Fig. 6).
• Two other heterologous promoters were used in this study. They are the promoters of the genes coding for glyceraldehyde 3- phosphate dehydrogenase (gpd) and hydrophobin (sc3) from Schizophyllum commune (Fig. 6), constituting respectively the pEGT and pESC expression vectors.
• the fungus culture is centrifuged for 10 min at 2000 rpm in an oscillating rotor (50 ml tube). Sixteen g (wet weight) are washed in 40 ml of a 0.5 M MgSO 4 solution or 0.5 M sucrose. In the case of the use of sucrose, the lyric enzyme used to digest the walls is diluted in sucrose. The mycelium is then centrifuged 10 min at 2000 rpm and the supernatant removed.
• the supernatant containing the protoplasts is carefully transferred to a new 50 ml.
• the remaining pellet may be re-incubated with 25 ml of a 0.5 M MgSO 4 solution to recover the maximum of protoplasts (the centrifugation step is then repeated).
• a volume of sorbitol 1 M equal to that of the preparation of the protoplasts, is added to it.
• the protoplasts are allowed to release the water.
• This preparation is then centrifuged 10 min at 2000 rpm.
• the supernatant is removed, while leaving a little sorbitol.
• the protoplasts are transferred to a new tube.
• the previous tube is rinsed with the 1M sorbitol solution and the protoplasts recovered, added to the new tube.
• the protoplasts are counted and centrifuged for 10 min at 2000 rpm. They are then diluted to a concentration of
• Two and a half ml of regeneration medium (per 100 ml: glucose 2 g, MgSO 4 , 7H 2 0 12.5 g, K ⁇ 2 PO 4 0.046 g, K 2 HPO 4 0.1 g, bacto peptone 0.2 g , yeast extract 0.2 g) are added to the protoplasts which are incubated overnight at 30 ° C.
• Selection boxes (YM medium containing phleomycin at 7 ⁇ g / ml, square boxes) are preheated to 37 ° C.
• top agar Low Melting Point agarose 1% diluted in YM medium containing phleomycin 7 to 10 ⁇ g / ml
• the regeneration medium containing the protoplasts are poured onto the dishes. preheated selection.
• the dishes are incubated at 30 ° C for 4 days. The transformants are then transferred to new selection boxes.
• the activity over time was followed for the transformants GPD14 and 1.2.7 (Fig. 11).
• the activity is detectable from 3-4 days and increases up to 12 days to reach approximately 1200 nkatal / ml or 72000 U / l with addition of ethanol in the culture medium.
• Figure 1 Isolation of monocaryotic strain deficient for laccase activity.
• Figure 2 Isolation of the gene coding for the laccase of Pycnoporus cinnabarinus laccase.
• Figure 3 Southern blot study of the gene coding for the laccase of Pycnoporus cinnabarinus.
• Figure 4 Sequence of the gene coding for the laccase of Pycnoporus cinnabarinus.
• Figure 5 Sequence of the pLac promoter sequence of the gene coding for the laccase of Pycnoporus cinnabarinus (up to the ATG coding for the methionine of laccase).
• Figure 6 Physical map of the three expression vectors pEGT, pESC, pELP, used for the production of laccase in Pycnoporus cinnabarinus.
• Figure 7 Nucleotide sequence of the pEGT vector, containing the promoter of the gpd gene (4480-5112), a marker of resistance to phleomycin (507-1822) and the terminator of the sc3 gene (71-507).
• Figure 8 Nucleotide sequence of the vector pESC, containing the promoter of the sc3 gene (1-1033), a marker for resistance to phleomycin (1540-2855) and the terminator of the sc3 gene (1104-1540). - ,, --- ,, PCT / FR2005 / 000093 15
• Figure 9 Nucleotide sequence of the pELP vector, containing the promoter of the laccase gene (4457-6983), a marker of resistance to phleomycin (507-1822) and the terminator of the sc3 gene (71-507)
• Figure 10 Production results of transformants with the most important activities. The culture was carried out with or without (control) ethanol.
• Figure 11 Monitoring of the laccase activities of transformants GPD 14 and 12.7 as a function of time with or (control) without ethanol.
• Figure 12 Sequence of the gene coding for halocyphina villosa laccase.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Mycology (AREA)
• Plant Pathology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=34707878

Family Applications (1)

Country Status (7)

Families Citing this family (5)

Family Cites Families (4)

• 2004
  • 2004-01-15 FR FR0400366A patent/FR2865216B1/fr not_active Expired - Fee Related
• 2005
  • 2005-01-14 WO PCT/FR2005/000093 patent/WO2005073381A2/fr active Application Filing
  • 2005-01-14 US US10/586,348 patent/US8481706B2/en not_active Expired - Fee Related
  • 2005-01-14 JP JP2006548355A patent/JP4719690B2/ja not_active Expired - Fee Related
  • 2005-01-14 AU AU2005209453A patent/AU2005209453A1/en not_active Abandoned
  • 2005-01-14 EP EP05717425A patent/EP1709180A2/de not_active Ceased
  • 2005-01-14 CA CA002553435A patent/CA2553435A1/fr not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events