EP1709180A2 - Method for overproducing a specific recombinant protein with p. cinnabarinus monokaryotic strains - Google Patents

Method for overproducing a specific recombinant protein with p. cinnabarinus monokaryotic strains

Info

Publication number
EP1709180A2
EP1709180A2 EP05717425A EP05717425A EP1709180A2 EP 1709180 A2 EP1709180 A2 EP 1709180A2 EP 05717425 A EP05717425 A EP 05717425A EP 05717425 A EP05717425 A EP 05717425A EP 1709180 A2 EP1709180 A2 EP 1709180A2
Authority
EP
European Patent Office
Prior art keywords
pycnoporus
laccase
promoter
seq
endogenous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP05717425A
Other languages
German (de)
French (fr)
Inventor
Alexandra M.C.R. Alves
Eric Record
Anne Lomascolo
Jean-Claude Sigoillot
Marcel Asther
Han A.B. WÖSTEN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aix Marseille Universite
Institut National de la Recherche Agronomique INRA
Original Assignee
Universite de Provence Aix Marseille I
Institut National de la Recherche Agronomique INRA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite de Provence Aix Marseille I, Institut National de la Recherche Agronomique INRA filed Critical Universite de Provence Aix Marseille I
Publication of EP1709180A2 publication Critical patent/EP1709180A2/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
    • C12N9/0057—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10) with oxygen as acceptor (1.10.3)
    • C12N9/0059—Catechol oxidase (1.10.3.1), i.e. tyrosinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
    • C12N9/0057—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10) with oxygen as acceptor (1.10.3)
    • C12N9/0061—Laccase (1.10.3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione

Definitions

  • the present invention relates to the use of monocaryotic strains of filamentous fungi of the species Pycnoporus of the basidiomycete group, for the implementation of a process for the preparation of a specific recombinant protein, said process being carried out by overexpression of the gene coding for this protein in the aforementioned monocaryotic strain of Pycnoporus.
  • two fungal models are preferably used by large industrial groups in the context of the production of enzymes involved in plant biotransformations, such as metalloenzymes. These are ⁇ HAspergillus, and Trichoderma, which belong to the group of deuteromycetes.
  • the present invention stems from the demonstration by the inventors that the transformation of monocaryotic strains of P. cinnabarinus deficient for laccase activity using vectors containing the gene coding for this laccase and whose expression is under the control of a promoter identical to the endogenous pLac promoter of P. cinnabarinus laccase, leads to an equivalent production of laccase only when implementing a process of overproduction of laccase by induction of the endogenous promoter of this laccase by action ethanol on monocaryotic strains of P. cinnabarinus not deficient in laccase activity, and which equals g / 1.
  • the subject of the present invention is a process for preparing a specific recombinant protein, said process being carried out by overexpression of the gene coding for this determined protein in a monocaryotic strain of filamentous fungi of the species Pycnoporus of the basidiomycete group, and comprises: - a step of culturing the aforementioned monocaryotic strain of Pycnoporus, said strain being transformed using an expression vector containing the gene coding for the determined recombinant protein, the expression of which is placed under the control of a promoter corresponding to an endogenous promoter of the above-mentioned fungi, or of a different promoter (also called exogenous promoter), said promoter constituting or inducible, - where appropriate a step of inducing the above-mentioned
  • a more particular subject of the invention is a method as described above, characterized in that the monocaryotic strain of Pycnoporus used for the overexpression of the gene coding for the determined recombinant protein is as obtained by culturing the original dicaryotic strain at 30 ° C in the dark for 15 days, followed by an exposure step on day 2 to 3 weeks at room temperature until the formation of fruiting bodies corresponding to differentiated hyphae called basides , within which karyogamy then takes place (fusion of the nuclei), followed by meiosis which leads to the formation of four sexual spores, or genetically different haploid basidiospores, which, after germination, generates a monocaryotic mycelium.
  • the monocaryotic strain of Pycnoporus used in the above-mentioned method of the invention is a strain of Pycnoporus cinnabarinus.
  • the recombinant proteins determined to be overexpressed within the framework of the implementation of the method according to the invention correspond either to endogenous proteins of Pycnoporus, or to exogenous proteins different from the endogenous proteins of the strain of Pycnoporus used for the production of said proteins.
  • these exogenous proteins correspond to endogenous proteins of basidiomycetes other than Pycnoporus, such as the enzymes basidiomycetes involved in plant biotransformations, or correspond to endogenous proteins of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins.
  • the invention more particularly relates to a process as described above, characterized in that the determined recombinant proteins correspond: - to the following endogenous Pycnoporus proteins: * the metalloenzymes, such as laccase, or tyrosinase, * or cellobiose dehydrogenase, xylanase, ⁇ -glycosidase, invertase, or ⁇ -amylase, - with exogenous proteins chosen from the following: * tyrosinases from strains of Pycnoporus different from the strain of Pycnoporus used for production of said proteins, such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * laccases of basidiomycetes other than Pycnoporus, such as laccase of haloc
  • the monocaryotic strain of Pycnoporus used is deficient for the gene coding for the endogenous protein to which the determined recombinant protein corresponds, so as not to have to separating the determined recombinant protein from the endogenous protein to which it corresponds during the purification of said recombinant protein.
  • the monocaryotic strain of Pycnoporus used may not be deficient for the gene coding for the endogenous protein to which the determined recombinant protein corresponds, said strain. then being transformed using an expression vector containing the gene coding for the determined recombinant protein marked in order to distinguish it from the endogenous protein during the purification step.
  • the determined recombinant protein can be labeled with a histidine tag (His-tag).
  • the invention more particularly relates to a process for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus, the if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus, transformed using an expression vector containing the gene coding for a laccase for Pycnoporus, if necessary marked, and whose expression is placed under the control of a promoter corresponding to the endogenous promoter of this laccase, a step of inducing the above-mentioned promoter, in particular by adding ethanol, or agricultural by-products containing lignocellulose such as wheat straw, corn bran and beet pulp, or compounds with an aromatic cycle such as 2,5-xylidine, veratrylic acid, gua ⁇ col, veratrylic alcohol, syringaldazin
  • the invention relates more particularly to a process as defined above, for the preparation of the recombinant laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a stage of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus cinnabarinus, transformed using a vector of expression containing the nucleotide sequence (or nucleic acid) SEQ LD NO: 1 coding for the recombinant laccase represented by SEQ JO NO: 2, where appropriate marked, in particular by a His-tag label, and the expression of
  • a more particular subject of the invention is a process for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus, transformed using an expression vector containing the gene coding for a laccase of Pycnoporus, the expression of which is placed under the control of an exogenous promoter chosen from: * the gpd promoter for the expression of the gene coding for glyceraldehyde 3-phosphate dehydrogenase from the common Schizophyllum, the nucleotide sequence of which is represented by SEQ ID NO: 4, * or the sc3 promoter of the expression of the gene coding for the common Schizophyllum hydrophobin, the nucleotide sequence of which is represented by SEQ ID NO: 4,
  • the invention relates more particularly to a process as defined above, for preparing the laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a step of setting in culture of a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 1 coding for the recombinant laccase represented by SEQ ID NO: 2, where appropriate marked, in particular by a His-tag label, the expression of which is placed under the control of the exogenous promoter gpd or sc3, - the recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ ID NO: 2 produced in the culture medium
  • the invention more particularly relates to a process as defined above, for the preparation of recombinant tyrosinase corresponding to the tyrosinase of Pycnoporus sanguineus represented by SEQ JD NO: 16, characterized in that it comprises: - a step of setting in culture of a monocaryotic strain of Pycnoporus cinnabarinus transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 15 coding for the recombinant tyrosinase represented by SEQ JD NO: 16, where appropriate labeled sequence SEQ JD NO: 15 being advantageously preceded by the nucleotide sequence delimited by the nucleotides located at positions 128 and 190 of SEQ ID NO: 1 coding for the signal peptide of Pycnoporus cinnabarinus delimited by the first 21 amino acids of SEQ ID NO: .2 , and the expression of which is placed
  • the invention relates more particularly to a process as defined above, for the preparation of recombinant laccase corresponding to the laccase of halocyphina villosa shown in FIG. 12 (SEQ JD NO: 18), characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous lcase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence represented on the FIG.
  • SEQ JD NO: 17 coding for the recombinant laccase represented by SEQ ID NO: 18, where appropriate marked, and the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the laccase of Pycnoporus cinnabarinus , the sequence of said pLac promoter being represented by SEQ JD NO: 3, - a step of induction with ethanol of the aforementioned pLac promoter, - recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ ID NO: 18 produced in the culture medium.
  • the subject of the invention is also the nucleotide sequence coding for the promoter pLac of the endogenous laccase of Pycnoporus cinnabarinus, and corresponding to the sequence SEQ ID NO: 3, or any sequence derived from this promoter by substitution, addition or deletion of a or several nucleotides and retaining the property of being a promoter of the expression of sequences.
  • the invention also relates to any expression vector, such as the plasmid pELP, characterized in that it comprises the sequence SEQ ID NO: 3 of the aforementioned pLac promoter, or a derived sequence as defined above.
  • the subject of the invention is more particularly any expression vector as defined above, characterized in that it comprises a gene coding for a specific recombinant protein, and the expression of which is placed under the control of the aforementioned pLac promoter , or a derived sequence as defined above.
  • the invention relates more particularly to any expression vector as defined above, characterized in that the determined recombinant protein is a protein corresponding: - to the following endogenous Pycnoporus proteins: * the metalloenzymes, such as laccase, or the tyrosinase, * or cellobiose dehydrogenase, xylanase, ⁇ -glycosidase, invertase, or ⁇ -amylase, - with exogenous proteins chosen from the following: * tyrosinases of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins, such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * the laccases of basidiomycetes other than Pycnoporus
  • the invention also relates to any host cell transformed using an expression vector as defined above.
  • the subject of the invention is more particularly any host cell mentioned above, corresponding to monocaryotic cells of Pycnoporus strains, such as the Pycnoporus cinnabarinus strains.
  • the subject of the invention is also the use of expression vectors as defined above, or of host cells mentioned above, for the implementation of a method of overproduction of a determined recombinant protein as defined above. above.
  • Pycnoporus cinnabarinus Expression System namely the development of an efficient fungal expression model making it possible to overcome the industrial models currently used by major European groups (Aspergillus and Trichoderma).
  • Pycnoporus cinnabarinus Expression System namely the development of an efficient fungal expression model making it possible to overcome the industrial models currently used by major European groups (Aspergillus and Trichoderma).
  • it is a eukaryotic expression system and more specifically a filamentous fungus of the basidiomycete group, Pycnoporus cinnabarinus, which has been developed by the inventors for the overexpression of proteins of industrial interest.
  • the purpose of this step is to isolate and then select haploid cell lines from the sexual spores of a filamentous fungus, Pycnoporus cinnabarinus, which will be used as a host for the expression of the genes of interest.
  • P. cinnabarinus is a heterothallic fungus which is found in the wild in the dicaryotic form (two unpaired nuclei per cell) from which monocaryotic lines are selected (one nucleus per cell), potentially more stable and therefore usable for transformation genetic.
  • lac " laccase
  • the fungus can multiply vegetatively (Fig. 1).
  • basides Within differentiated hyphae called basides, then takes place karyogamy (fusion of nuclei), followed by meiosis which leads to the formation of four sexual spores, or genetically different haploid basidiospores. After germination, each basidiospore generates a monocaryotic mycelium. A simple colorimetric test then makes it possible to select only the strains lacking laccase activity.
  • the fruiting medium is composed of 2% malt extract (PN) and agar (1.6% P / N).
  • the cultures are sown in Petri dishes and kept at 30 ° C in the dark for 15 days before exposing them to the day 2 to 3 weeks at room temperature.
  • the f uctification body appears orange-red.
  • the monospores are then harvested with sterile water on the lid of the Petri dish.
  • the suspension is diluted and cultured in Petri dishes containing MA2 medium (2% P / N malt and 2% P / N agar) in order to isolate colonies. Isolated pure cultures are pricked and kept in MA2 medium at 30 ° C for 5 days and stored at 4 ° C.
  • reaction mixture 100 ng of genomic DNA; 0.2 mM dATP, dCTP, dTTP, and dGTP; 25 pmol of each nucleotide primer; 0.1 volume of 10X Pfu polymerase buffer (100 mM Tris-HCl, 15mM MgCl, 500 mM KCl, pH 8.3) and 1 U of Pfu polymerase.
  • 10X Pfu polymerase buffer 100 mM Tris-HCl, 15mM MgCl, 500 mM KCl, pH 8.3
  • the reaction conditions are as follows: 5 cycles of 94 ° C, 5 min; 55 ° C, 30 s; and 72 ° C, 4 min; then 25 cycles of 94 ° C, 30 s; 55 ° C, 30 s, and 72 ° C, 3 min.
  • a step of 10 min at 72 ° C. is carried out in order to finish the reaction.
  • a band of 1.64 kbp was obtained corresponding to the central part of the laccase gene.
  • the DNA sequence was cloned into pGEM-T in order to sequence this part of the gene.
  • the PCR reaction is carried out with 150 ng of DNA cut by PstI and recircularized on itself by ligation and the nucleotide primers Fex (SEQ ID NO: 8; GGATAACTACTGGATCCGCG) and Rex (SEQ ID NO: 9; CGCAGTATTGCGTGGAGAG).
  • the reaction conditions are as follows: 5 cycles of 94 ° C, 5 min; 55 ° C, 30 s; and 72 ° C, 5 min; then 25 cycles of 94 ° C, 30 s; 55 ° C, 30 s, and 72 ° C, 4 min with a final step of 10 min at 72 ° C.
  • the amplified DNA fragment corresponds to a 2.7 kbp band which has been cloned into pGEM-T and sequenced.
  • the entire gene coding for laccase was then defined by combining the central part and the amplified 5 'and 3' parts.
  • the entire gene was amplified (3.331 kbp, FIG. 4) with the nucleotide primers Fin (SEQ JD NO: 10; GACATCTGGAGCGCCTGTC) and Rin (SEQ ID NO: 11; ATCGAAGGTTCCGATGACTGACATGAC) from genomic DNA of P. cinnabarinus.
  • This gene was also cloned from the genomic DNA of P. cinnabarinus ss3 and was found to be identical to that isolated in P. cinnabarinus I-937.
  • a terminator of the gene coding for hydrophobin sc3 from Schizophyllum commune was placed downstream in order to complete the transcription step.
  • This vector called pELP will be used for the homologous expression of laccase (Fig. 6).
  • Two other heterologous promoters were used in this study. They are the promoters of the genes coding for glyceraldehyde 3- phosphate dehydrogenase (gpd) and hydrophobin (sc3) from Schizophyllum commune (Fig. 6), constituting respectively the pEGT and pESC expression vectors.
  • the fungus culture is centrifuged for 10 min at 2000 rpm in an oscillating rotor (50 ml tube). Sixteen g (wet weight) are washed in 40 ml of a 0.5 M MgSO 4 solution or 0.5 M sucrose. In the case of the use of sucrose, the lyric enzyme used to digest the walls is diluted in sucrose. The mycelium is then centrifuged 10 min at 2000 rpm and the supernatant removed.
  • the supernatant containing the protoplasts is carefully transferred to a new 50 ml.
  • the remaining pellet may be re-incubated with 25 ml of a 0.5 M MgSO 4 solution to recover the maximum of protoplasts (the centrifugation step is then repeated).
  • a volume of sorbitol 1 M equal to that of the preparation of the protoplasts, is added to it.
  • the protoplasts are allowed to release the water.
  • This preparation is then centrifuged 10 min at 2000 rpm.
  • the supernatant is removed, while leaving a little sorbitol.
  • the protoplasts are transferred to a new tube.
  • the previous tube is rinsed with the 1M sorbitol solution and the protoplasts recovered, added to the new tube.
  • the protoplasts are counted and centrifuged for 10 min at 2000 rpm. They are then diluted to a concentration of
  • Two and a half ml of regeneration medium (per 100 ml: glucose 2 g, MgSO 4 , 7H 2 0 12.5 g, K ⁇ 2 PO 4 0.046 g, K 2 HPO 4 0.1 g, bacto peptone 0.2 g , yeast extract 0.2 g) are added to the protoplasts which are incubated overnight at 30 ° C.
  • Selection boxes (YM medium containing phleomycin at 7 ⁇ g / ml, square boxes) are preheated to 37 ° C.
  • top agar Low Melting Point agarose 1% diluted in YM medium containing phleomycin 7 to 10 ⁇ g / ml
  • the regeneration medium containing the protoplasts are poured onto the dishes. preheated selection.
  • the dishes are incubated at 30 ° C for 4 days. The transformants are then transferred to new selection boxes.
  • the activity over time was followed for the transformants GPD14 and 1.2.7 (Fig. 11).
  • the activity is detectable from 3-4 days and increases up to 12 days to reach approximately 1200 nkatal / ml or 72000 U / l with addition of ethanol in the culture medium.
  • Figure 1 Isolation of monocaryotic strain deficient for laccase activity.
  • Figure 2 Isolation of the gene coding for the laccase of Pycnoporus cinnabarinus laccase.
  • Figure 3 Southern blot study of the gene coding for the laccase of Pycnoporus cinnabarinus.
  • Figure 4 Sequence of the gene coding for the laccase of Pycnoporus cinnabarinus.
  • Figure 5 Sequence of the pLac promoter sequence of the gene coding for the laccase of Pycnoporus cinnabarinus (up to the ATG coding for the methionine of laccase).
  • Figure 6 Physical map of the three expression vectors pEGT, pESC, pELP, used for the production of laccase in Pycnoporus cinnabarinus.
  • Figure 7 Nucleotide sequence of the pEGT vector, containing the promoter of the gpd gene (4480-5112), a marker of resistance to phleomycin (507-1822) and the terminator of the sc3 gene (71-507).
  • Figure 8 Nucleotide sequence of the vector pESC, containing the promoter of the sc3 gene (1-1033), a marker for resistance to phleomycin (1540-2855) and the terminator of the sc3 gene (1104-1540). - ,, --- ,, PCT / FR2005 / 000093 15
  • Figure 9 Nucleotide sequence of the pELP vector, containing the promoter of the laccase gene (4457-6983), a marker of resistance to phleomycin (507-1822) and the terminator of the sc3 gene (71-507)
  • Figure 10 Production results of transformants with the most important activities. The culture was carried out with or without (control) ethanol.
  • Figure 11 Monitoring of the laccase activities of transformants GPD 14 and 12.7 as a function of time with or (control) without ethanol.
  • Figure 12 Sequence of the gene coding for halocyphina villosa laccase.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention concerns the use of monokaryotic strains of filamentous fungi of the Pycnoporus species of the basidiomycete group, for implementing a method for preparing a specific recombinant protein, said method being carried out by overexpressing the gene encoding said protein in said Pycnoporus monokaryotic strain.

Description

PROCEDE DE SURPRODUCTION D'UNE PROTEINE RECOMBINANTE DETERMINEE PAR DES SOUCHES MONOCARYOTIQUES DE P. CINNABARINUSPROCESS FOR OVERPRODUCTION OF A RECOMBINANT PROTEIN DETERMINED BY MONOCARYOTIC STRAINS OF P. CINNABARINUS
La présente invention concerne l'utilisation de souches monocaryotiques de champignons filamenteux de l'espèce Pycnoporus du groupe basidiomycète, pour la mise en oeuvre d'un procédé de préparation d'une protéine recombinante déterminée, ledit procédé étant effectué par surexpression du gène codant pour cette protéine dans la souche monocaryotique susmentionnée de Pycnoporus. . A l'heure actuelle, deux modèles fongiques sont utilisés préférentiellement par les grands groupes industriels dans le cadre de la production d'enzymes intervenant dans les biotransformations végétales, telles que les métalloenzymes. Il s'agit ôHAspergillus, et de Trichoderma, qui appartiennent au groupe des deutéromycètes. Toutefois, les rendements de production à l'aide de ces modèles, notamment en production de laccases, n'excèdent pas les 150 mg/1. La présente invention découle de la mise en évidence par les Inventeurs du fait que la transformation de souches monocaryotiques de P. cinnabarinus déficientes pour F activité laccase à l'aide de vecteurs contenant le gène codant pour cette laccase et dont l'expression est sous le contrôle d'un promoteur identique au promoteur pLac endogène de la laccase de P. cinnabarinus, conduit à une production équivalente de laccase que lors de la mise en œuvre d'un procédé de surproduction de laccase par induction du promoteur endogène de cette laccase par action de l'éthanol sur des souches monocaryotiques de P. cinnabarinus non déficientes pour l'activité laccase, et qui égale le g/1. Des résultats similaires ont été obtenus par les Inventeurs en utilisant le promoteur gpd, et le promoteur sc3 de Schizophyllum commune, en lieu et place du promoteur pLac susmentionné. La présente invention a pour objet un procédé de préparation d'une protéine recombinante déterminée, ledit procédé étant effectué par surexpression du gène codant pour cette protéine déterminée dans une souche monocaryotique de champignons filamenteux de l'espèce Pycnoporus du groupe basidiomycète, et comprend : - une étape de mise en culture de la souche monocaryotique de Pycnoporus susmentionnée, ladite souche étant transformée à l'aide d'un vecteur d'expression contenant le gène codant pour la protéine recombinante déterminée, dont l'expression est placée sous le contrôle d'un promoteur correspondant à un promoteur endogène des champignons susmentionnés, ou d'un promoteur différent (encore désigné promoteur exogène), ledit promoteur étant constitutif ou inductible, - le cas échéant une étape d'induction du promoteur susmentionné, lorsque celui-ci est inductible, - la récupération, et, le cas échéant, la purification de la protéine recombinante déterminée, produite dans le milieu de culture. L'invention a plus particulièrement pour objet un procédé tel que décrit ci-dessus, caractérisé en ce que la souche monocaryotique de Pycnoporus utilisée pour la surexpression du gène codant pour la protéine recombinante déterminée, est telle qu'obtenue par mise en culture de la souche dicaryotique d'origine à 30°C dans le noir pendant 15 jours, suivie d'une étape d'exposition au jour 2 à 3 semaines à température ambiante jusqu'à la formation d'organes de fructification correspondant à des hyphes différenciées appelées basides, au sein desquels a alors lieu la caryogamie (fusion des noyaux), suivie de la méiose qui conduit à la formation de quatre spores sexuées, ou basidiospores haploïdes génétiquement différentes, qui, après germination, engendre un mycélium monocaryotique. Avantageusement, la souche monocaryotique de Pycnoporus utilisée dans le procédé susmentionné de l'invention, est une souche de Pycnoporus cinnabarinus. Les protéines recombinantes déterminées surexprimées dans le cadre de la mise en oeuvre du procédé selon l'invention, correspondent soit à des protéines endogènes de Pycnoporus, soit à des protéines exogènes différentes des protéines endogènes de la souche de Pycnoporus utilisée pour la production desdites protéines. Notamment ces protéines exogènes correspondent à des protéines endogènes de basidiomycètes autres que Pycnoporus, telles que les enzymes basidiomycètes intervenant dans les biotransformations végétales, ou correspondent à des protéines endogènes de souches de Pycnoporus différentes de la souche de Pycnoporus utilisée pour la production desdites protéines. L'invention a plus particulièrement pour objet un procédé tel que décrit ci-dessus, caractérisé en ce que les protéines recombinantes déterminées correspondent : - aux protéines endogènes de Pycnoporus suivantes : * les métalloenzymes, telles que la laccase, ou la tyrosinase, * ou la cellobiose déshydrogénase, la xylanase, la β-glycosidase, l'invertase, ou l'α-amylase, - aux protéines exogènes choisies parmi les suivantes : * les tyrosinases de souches de Pycnoporus différentes de la souche de Pycnoporus utilisée pour la production desdites protéines, telle que la tyrosinase de Pycnoporus sanguineus lorsque la souche de Pycnoporus utilisée pour la production de cette tyrosinase est différente de Pycnoporus sanguineus, * les laccases de basidiomycètes autres que Pycnoporus, telle que la laccase d'halocyphina villosa (basidiomycète halophile), * les cinnamoyl estérases A (numéro EMBL Y09330) et B (numéro EMBL ANI309807) dAspergillus niger. Avantageusement, notamment dans le cas de la préparation de protéines recombinantes déterminées correspondant aux protéines endogènes de Pycnoporus, la souche monocaryotique de Pycnoporus utilisée est déficiente pour le gène codant pour la protéine endogène à laquelle correspond la protéine recombinante déterminée, afin de ne pas avoir à séparer la protéine recombinante déterminée de la protéine endogène à laquelle elle correspond lors de la purification de ladite protéine recombinante. En variante, notamment dans le cas de la préparation de protéines recombinantes déterminées correspondant aux protéines endogènes de Pycnoporus, la souche monocaryotique de Pycnoporus utilisée peut ne pas être déficiente pour le gène codant pour la protéine endogène à laquelle correspond la protéine recombinante déterminée, ladite souche étant alors transformée à l'aide d'un vecteur d'expression contenant le gène codant pour la protéine recombinante déterminée marqμée afin de la distinguer de la protéine endogène lors de l'étape de purification. A titre d'illustration, la protéine recombinante déterminée peut être marquée par une étiquette histidine (His-tag). A ce titre, l'invention a plus particulièrement pour objet un procédé de préparation de laccases recombinantes correspondant aux laccases endogènes de Pycnoporus, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus, transformée à l'aide d'un vecteur d'expression contenant le gène codant pour une laccase de Pycnoporus, le cas échéant marquée, et dont l'expression est placée sous le contrôle d'un promoteur correspondant au promoteur endogène de cette laccase, - une étape d'induction du promoteur susmentionné, notamment par addition d'éthanol, ou de sous-produits agricoles contenant de la lignocellulose comme la paille de blé, les sons de maïs et la pulpe de betterave, ou des composés à cycle aromatique comme la 2,5-xylidine, l'acide vératrylique, le guaïcol, l'alcool vératrylique, la syringaldazine, l'acide férulique, l'acide caféique et les lignosulfonates, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, correspondant à la laccase endogène de Pycnoporus susmentionnée produite dans le milieu de culture, notamment selon la méthode décrite dans Sigoillot J.C., Herpoel L, Frasse P., Moukha S., Lesage-Meessen L., Asther M. 1999 ; Laccase production by a monokaryotic strain Pycnoporus cinnabarinus derived from a dikaryotic strain ; World Journal of Microbiology and Biotechnology 15, 481- 484. L'invention concerne plus particulièrement un procédé tel que défini ci-dessus, de préparation de la laccase recombinante correspondant à la laccase endogène de Pycnoporus cinnabarinus représentée par SEQ ID NO : 2, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus cinnabarinus, transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique (ou acide nucléique) SEQ LD NO : 1 codant pour la laccase recombinante représentée par SEQ JO NO : 2, le cas échéant marquée, notamment par une étiquette His-tag, et dont l'expression est placée sous le contrôle du promoteur pLac correspondant au promoteur endogène de la laccase susmentionnée, la séquence dudit promoteur pLac étant représentée par SEQ ID NO : 3, - une étape d'induction par l'éthanol du promoteur pLac susmentionné, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, représentée par SEQ ID NO : 2 produite dans le milieu de culture, notamment selon la méthode décrite dans Sigoillot J.C., et al. (1999) susmentionné. L'invention a plus particulièrement pour objet un procédé de préparation de laccases recombinantes correspondant aux laccases endogènes de Pycnoporus, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus, transformée à l'aide d'un vecteur d'expression contenant le gène codant pour une laccase de Pycnoporus dont l'expression est placée sous le contrôle d'un promoteur exogène choisi parmi : * le promoteur gpd de l'expression du gène codant pour la glycéraldéhyde 3-phosphate déhydrogénase de Schizophyllum commune, dont la séquence nucléotidique est représentée par SEQ ID NO : 4, * ou le promoteur sc3 de l'expression du gène codant pour l'hydrophobine de Schizophyllum commune, dont la séquence nucléotidique est représentée par SEQ ID NO : 5, - la récupération, et, le cas échéant, la purification de la laccase recombinante correspondant à la laccase endogène de Pycnoporus susmentionnée produite dans le milieu de culture, notamment selon la méthode, décrite dans Sigoillot J.C., et al. (1999) susmentionné. • L'invention concerne plus particulièrement un procédé tel que défini ci-dessus, de préparation de la laccase correspondant à la laccase endogène de Pycnoporus cinnabarinus représentée par SEQ ID NO : 2, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus cinnabarinus, transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique SEQ ID NO : 1 codant pour la laccase recombinante représentée par SEQ ID NO : 2, le cas échéant marquée, notamment par une étiquette His-tag, dont l'expression est placée sous le contrôle du promoteur exogène gpd ou sc3, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, représentée par SEQ ID NO : 2 produite dans le milieu de culture, notamment selon la méthode décrite dans Sigoillot J.C., et al. (1999) susmentionné. L'invention a plus particulièrement pour objet un procédé tel que défini ci-dessus, de préparation de tyrosinase recombmante correspondant à la tyrosinase de Pycnoporus sanguineus représentée par SEQ JD NO : 16, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique SEQ ID NO : 15 codant pour la tyrosinase recombinante représentée par SEQ JD NO : 16, le cas échéant marquée, la séquence SEQ JD NO : 15 étant avantageusement précédée par la séquence nucléotidique délimitée par les nucléotides situés aux positions 128 et 190 de SEQ ID NO : 1 codant pour le peptide signal de Pycnoporus cinnabarinus délimité par les 21 premiers aminoacides de SEQ ID NO :.2, et dont l'expression est placée sous le contrôle du promoteur pLac correspondant au promoteur endogène de la laccase de Pycnoporus cinnabarinus, la séquence dudit promoteur pLac étant représentée par SEQ JD NO : 3, - une étape d'induction par l'éthanol du promoteur pLac susmentionné, - la récupération, et, le cas échéant, la purification de la tyrosinase recombinante, le cas échéant marquée, représentée par SEQ JD NO : 16 produite dans le milieu de culture. L'invention concerne plus particulièrement un procédé tel que défini ci-dessus, de préparation de laccase recombinante correspondant à la laccase d'halocyphina villosa représentée sur la figure 12 (SEQ JD NO : 18), caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus cinnabarinus, transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique représentée sur la figure 12 (SEQ JD NO : 17) codant pour la laccase recombinante représentée par SEQ ID NO : 18, le cas échéant marquée, et dont l'expression est placée sous le contrôle du promoteur pLac correspondant au promoteur endogène de la laccase de Pycnoporus cinnabarinus, la séquence dudit promoteur pLac étant représentée par SEQ JD NO : 3, - une étape d'induction par l'éthanol du promoteur pLac susmentionné, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, représentée par SEQ ID NO : 18 produite dans le milieu de culture. L'invention a également pour objet la séquence nucléotidique codant pour le promoteur pLac de la laccase endogène de Pycnoporus cinnabarinus, et correspondant à la séquence SEQ ID NO : 3, ou toute séquence dérivée de ce promoteur par substitution, addition ou suppression d'un ou plusieurs nucléotides et conservant la propriété d'être un promoteur de l'expression de séquences. L'invention concerne également tout vecteur d'expression, tel que le plasmide pELP, caractérisé en ce qu'il comprend la séquence SEQ ID NO : 3 du promoteur pLac susmentionné, ou une séquence dérivée telle que définie ci-dessus. L'invention a plus particulièrement pour objet tout vecteur d'expression tel que défini ci-dessus, caractérisé en ce qu'il comprend un gène codant pour une protéine recombinante déterminée, et dont l'expression est placée sous le contrôle du promoteur pLac susmentionné, ou d'une séquence dérivée telle que définie ci-dessus. L'invention concerne plus particulièrement tout vecteur d'expression tel que défini ci-dessus, caractérisé en ce que la protéine recombinante déterminée est une protéine correspondant : - aux protéines endogènes de Pycnoporus suivantes : * les métalloenzymes, telles que la laccase, ou la tyrosinase, * ou la cellobiose déshydrogénase, la xylanase, la β-glycosidase, l'invertase, ou l'α-amylase, - aux protéines exogènes choisies parmi les suivantes : * les tyrosinases de souches de Pycnoporus différentes de la souche de Pycnoporus utilisée pour la production desdites protéines, telle que la tyrosinase de Pycnoporus sanguineus lorsque la souche de Pycnoporus utilisée pour la production de cette tyrosinase est différente de Pycnoporus sanguineus, * les laccases de basidiomycètes autres que Pycnoporus, telle que la laccase d'halocyphina villosa (basidiomycète halophile), * les cinnamoyl estérases A et B d'Aspergillus niger. L'invention concerne également toute cellule hôte transformée à l'aide d'un vecteur d'expression tel que défini ci-dessus. L'invention a plus particulièrement pour objet toute cellule hôte susmentionnée, correspondant à des cellules monocaryotiques de souches de Pycnoporus, telles que les souches de Pycnoporus cinnabarinus. L'invention a également pour objet l'utilisation de vecteurs d'expression tels que définis ci-dessus, ou de cellules hôtes susmentionnées, pour la mise en oeuvre d'un procédé de surproduction d'une protéine recombinante déterminée telle que définie ci- dessus. L'invention sera davantage illustrée à l'aide de la description détaillée qui suit du SEPC : Système d'Expression Pycnoporus cinnabarinus, à savoir du développement d'un modèle d'expression fongique performant permettant de s'affranchir des modèles industriels utilisés actuellement par les grands groupes européens (Aspergillus et Trichoderma). En résumé, il s'agit d'un système d'expression eucaryote et plus spécifiquement de champignon filamenteux du groupe basidiomycète, Pycnoporus cinnabarinus, qui a' été développé par les Inventeurs pour la surexpression de protéines d'intérêt industriel. Ce travail a été fait dans le cadre de l'étude de métalloenzymes, telles que les laccases, et en particulier a permis de cloner les gènes impliqués pour leur surexpression, et de surproduction des laccases en grande quantité à l'aide de fermenteurs, ceci afin de les utiliser dans des applications industrielles à usage alimentaire (panification, préparation de boissons afin de moduler la couleur du thé, aider à la clarification des jus de fruits et des boissons alcoolisées, formation d' agropolymères) et non alimentaire (traitement des «jeans », dégradation de polluants aromatiques dans les sols, bioblanchiment des fibres lignocellulosiques dans le domaine des pâtes à papier).The present invention relates to the use of monocaryotic strains of filamentous fungi of the species Pycnoporus of the basidiomycete group, for the implementation of a process for the preparation of a specific recombinant protein, said process being carried out by overexpression of the gene coding for this protein in the aforementioned monocaryotic strain of Pycnoporus. . At the present time, two fungal models are preferably used by large industrial groups in the context of the production of enzymes involved in plant biotransformations, such as metalloenzymes. These are ÔHAspergillus, and Trichoderma, which belong to the group of deuteromycetes. However, the production yields using these models, especially in the production of laccases, do not exceed 150 mg / 1. The present invention stems from the demonstration by the inventors that the transformation of monocaryotic strains of P. cinnabarinus deficient for laccase activity using vectors containing the gene coding for this laccase and whose expression is under the control of a promoter identical to the endogenous pLac promoter of P. cinnabarinus laccase, leads to an equivalent production of laccase only when implementing a process of overproduction of laccase by induction of the endogenous promoter of this laccase by action ethanol on monocaryotic strains of P. cinnabarinus not deficient in laccase activity, and which equals g / 1. Similar results have been obtained by the inventors using the gpd promoter, and the sc3 promoter from Schizophyllum commune, in place of the aforementioned pLac promoter. The subject of the present invention is a process for preparing a specific recombinant protein, said process being carried out by overexpression of the gene coding for this determined protein in a monocaryotic strain of filamentous fungi of the species Pycnoporus of the basidiomycete group, and comprises: - a step of culturing the aforementioned monocaryotic strain of Pycnoporus, said strain being transformed using an expression vector containing the gene coding for the determined recombinant protein, the expression of which is placed under the control of a promoter corresponding to an endogenous promoter of the above-mentioned fungi, or of a different promoter (also called exogenous promoter), said promoter constituting or inducible, - where appropriate a step of inducing the above-mentioned promoter, when the latter is inducible, - the recovery and, where appropriate, the purification of the determined recombinant protein produced in the culture medium. A more particular subject of the invention is a method as described above, characterized in that the monocaryotic strain of Pycnoporus used for the overexpression of the gene coding for the determined recombinant protein is as obtained by culturing the original dicaryotic strain at 30 ° C in the dark for 15 days, followed by an exposure step on day 2 to 3 weeks at room temperature until the formation of fruiting bodies corresponding to differentiated hyphae called basides , within which karyogamy then takes place (fusion of the nuclei), followed by meiosis which leads to the formation of four sexual spores, or genetically different haploid basidiospores, which, after germination, generates a monocaryotic mycelium. Advantageously, the monocaryotic strain of Pycnoporus used in the above-mentioned method of the invention is a strain of Pycnoporus cinnabarinus. The recombinant proteins determined to be overexpressed within the framework of the implementation of the method according to the invention correspond either to endogenous proteins of Pycnoporus, or to exogenous proteins different from the endogenous proteins of the strain of Pycnoporus used for the production of said proteins. In particular, these exogenous proteins correspond to endogenous proteins of basidiomycetes other than Pycnoporus, such as the enzymes basidiomycetes involved in plant biotransformations, or correspond to endogenous proteins of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins. The invention more particularly relates to a process as described above, characterized in that the determined recombinant proteins correspond: - to the following endogenous Pycnoporus proteins: * the metalloenzymes, such as laccase, or tyrosinase, * or cellobiose dehydrogenase, xylanase, β-glycosidase, invertase, or α-amylase, - with exogenous proteins chosen from the following: * tyrosinases from strains of Pycnoporus different from the strain of Pycnoporus used for production of said proteins, such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * laccases of basidiomycetes other than Pycnoporus, such as laccase of halocyphina villosa (basidiomycete halophile) , * cinnamoyl esterases A (EMBL number Y09330) and B (EMBL number ANI309807) of Aspergillus niger. Advantageously, in particular in the case of the preparation of specific recombinant proteins corresponding to the endogenous proteins of Pycnoporus, the monocaryotic strain of Pycnoporus used is deficient for the gene coding for the endogenous protein to which the determined recombinant protein corresponds, so as not to have to separating the determined recombinant protein from the endogenous protein to which it corresponds during the purification of said recombinant protein. As a variant, in particular in the case of the preparation of specific recombinant proteins corresponding to the endogenous proteins of Pycnoporus, the monocaryotic strain of Pycnoporus used may not be deficient for the gene coding for the endogenous protein to which the determined recombinant protein corresponds, said strain. then being transformed using an expression vector containing the gene coding for the determined recombinant protein marked in order to distinguish it from the endogenous protein during the purification step. By way of illustration, the determined recombinant protein can be labeled with a histidine tag (His-tag). As such, the invention more particularly relates to a process for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus, the if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus, transformed using an expression vector containing the gene coding for a laccase for Pycnoporus, if necessary marked, and whose expression is placed under the control of a promoter corresponding to the endogenous promoter of this laccase, a step of inducing the above-mentioned promoter, in particular by adding ethanol, or agricultural by-products containing lignocellulose such as wheat straw, corn bran and beet pulp, or compounds with an aromatic cycle such as 2,5-xylidine, veratrylic acid, guaïcol, veratrylic alcohol, syringaldazine, ferulic acid, caffeic acid and lignosulfonates, - recovery and, if necessary, purification of recombinant laccase, where appropriate labeled, corresponding to the above-mentioned endogenous Pycnoporus laccase produced in the culture medium, in particular according to the method described in Sigoillot JC, Herpoel L, Frasse P., Moukha S., Lesage-Meessen L., Asther M. 1999; Laccase production by a monokaryotic strain Pycnoporus cinnabarinus derived from a dikaryotic strain; World Journal of Microbiology and Biotechnology 15, 481-484. The invention relates more particularly to a process as defined above, for the preparation of the recombinant laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a stage of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus cinnabarinus, transformed using a vector of expression containing the nucleotide sequence (or nucleic acid) SEQ LD NO: 1 coding for the recombinant laccase represented by SEQ JO NO: 2, where appropriate marked, in particular by a His-tag label, and the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the aforementioned laccase, the sequence of said pLac promoter being represented by SEQ ID NO: 3, - an in step duction with ethanol of the aforementioned pLac promoter, - the recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ ID NO: 2 produced in the culture medium, in particular according to the method described in Sigoillot JC, et al. (1999) mentioned above. A more particular subject of the invention is a process for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus, transformed using an expression vector containing the gene coding for a laccase of Pycnoporus, the expression of which is placed under the control of an exogenous promoter chosen from: * the gpd promoter for the expression of the gene coding for glyceraldehyde 3-phosphate dehydrogenase from the common Schizophyllum, the nucleotide sequence of which is represented by SEQ ID NO: 4, * or the sc3 promoter of the expression of the gene coding for the common Schizophyllum hydrophobin, the nucleotide sequence of which is represented by SEQ ID NO: 5, - the recovery, and, where appropriate, the purification of the recombinant laccase corresponding to the endogenous laccase of Pycnoporus mentioned above produced in the culture medium, in particular according to the method, described in Sigoillot JC, et al. (1999) mentioned above. • The invention relates more particularly to a process as defined above, for preparing the laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a step of setting in culture of a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 1 coding for the recombinant laccase represented by SEQ ID NO: 2, where appropriate marked, in particular by a His-tag label, the expression of which is placed under the control of the exogenous promoter gpd or sc3, - the recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ ID NO: 2 produced in the culture medium, in particular according to the method described in Sigoillot JC, et al. (1999) mentioned above. The invention more particularly relates to a process as defined above, for the preparation of recombinant tyrosinase corresponding to the tyrosinase of Pycnoporus sanguineus represented by SEQ JD NO: 16, characterized in that it comprises: - a step of setting in culture of a monocaryotic strain of Pycnoporus cinnabarinus transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 15 coding for the recombinant tyrosinase represented by SEQ JD NO: 16, where appropriate labeled sequence SEQ JD NO: 15 being advantageously preceded by the nucleotide sequence delimited by the nucleotides located at positions 128 and 190 of SEQ ID NO: 1 coding for the signal peptide of Pycnoporus cinnabarinus delimited by the first 21 amino acids of SEQ ID NO: .2 , and the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the Pycnoporus cinnabarinus laccase, the sequence of said pLac promoter being represented by SEQ JD NO: 3, - a step of induction of the promoter with ethanol pLac mentioned above, - recovery and, where appropriate, purification of the recombinant tyrosinase, where appropriate labeled, represented by SEQ JD NO: 16 produced in the culture medium. The invention relates more particularly to a process as defined above, for the preparation of recombinant laccase corresponding to the laccase of halocyphina villosa shown in FIG. 12 (SEQ JD NO: 18), characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous lcase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence represented on the FIG. 12 (SEQ JD NO: 17) coding for the recombinant laccase represented by SEQ ID NO: 18, where appropriate marked, and the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the laccase of Pycnoporus cinnabarinus , the sequence of said pLac promoter being represented by SEQ JD NO: 3, - a step of induction with ethanol of the aforementioned pLac promoter, - recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ ID NO: 18 produced in the culture medium. The subject of the invention is also the nucleotide sequence coding for the promoter pLac of the endogenous laccase of Pycnoporus cinnabarinus, and corresponding to the sequence SEQ ID NO: 3, or any sequence derived from this promoter by substitution, addition or deletion of a or several nucleotides and retaining the property of being a promoter of the expression of sequences. The invention also relates to any expression vector, such as the plasmid pELP, characterized in that it comprises the sequence SEQ ID NO: 3 of the aforementioned pLac promoter, or a derived sequence as defined above. The subject of the invention is more particularly any expression vector as defined above, characterized in that it comprises a gene coding for a specific recombinant protein, and the expression of which is placed under the control of the aforementioned pLac promoter , or a derived sequence as defined above. The invention relates more particularly to any expression vector as defined above, characterized in that the determined recombinant protein is a protein corresponding: - to the following endogenous Pycnoporus proteins: * the metalloenzymes, such as laccase, or the tyrosinase, * or cellobiose dehydrogenase, xylanase, β-glycosidase, invertase, or α-amylase, - with exogenous proteins chosen from the following: * tyrosinases of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins, such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * the laccases of basidiomycetes other than Pycnoporus, such as the laccase of halocyphina villosa (basidiomycete halophile), * the cinnamoyl esterases A and B of Aspergillus niger. The invention also relates to any host cell transformed using an expression vector as defined above. The subject of the invention is more particularly any host cell mentioned above, corresponding to monocaryotic cells of Pycnoporus strains, such as the Pycnoporus cinnabarinus strains. The subject of the invention is also the use of expression vectors as defined above, or of host cells mentioned above, for the implementation of a method of overproduction of a determined recombinant protein as defined above. above. The invention will be further illustrated with the aid of the following detailed description of the UPCE: Pycnoporus cinnabarinus Expression System, namely the development of an efficient fungal expression model making it possible to overcome the industrial models currently used by major European groups (Aspergillus and Trichoderma). In summary, it is a eukaryotic expression system and more specifically a filamentous fungus of the basidiomycete group, Pycnoporus cinnabarinus, which has been developed by the inventors for the overexpression of proteins of industrial interest. This work was done within the framework of the study of metalloenzymes, such as laccases, and in particular made it possible to clone the genes involved for their overexpression, and to overproduction of laccases in large quantities using fermenters, this in order to use them in industrial applications for food use (bread-making, preparation of drinks in order to modulate the color of tea, help in the clarification of fruit juices and drinks alcoholic, formation of agropolymers) and non - food (treatment of "jeans", degradation of aromatic pollutants in soils, biobleaching of lignocellulosic fibers in the field of paper pulp).
I) Obtention de lignées monocaryotiques de Pycnoporus cinnabarinus pour la transformation du champignon et la surproduction de gènes d'intérêt.I) Obtaining monocaryotic lines of Pycnoporus cinnabarinus for the transformation of the fungus and the overproduction of genes of interest.
Cette étape a pour but d'isoler puis de sélectionner des lignées cellulaires haploïdes issues des spores sexuées d'un champignon filamenteux, Pycnoporus cinnabarinus, qui seront utilisées en temps qu'hôte pour l'expression des gènes d'intérêt. P. cinnabarinus est un champignon hétérothallique qui se trouve à l'état sauvage sous forme dicaryotique (deux noyaux non appariés par cellule) à partir duquel des lignées monocaryotiques sont sélectionnées (un noyau par cellule), potentiellement plus stable et donc utilisable pour la transformation génétique. Dans le cadre de cette étude les Inventeurs se sont attachés à sélectionner de lignées monocaryotiques déficientes pour l'activité laccase (lac"). A l'état dicaryotique, le champignon peut se multiplier par voie végétative (Fig. 1). Mais, sous l'influence de conditions environnementales particulières, on peut induire, en laboratoire, la formation d'organes de fructification. Au sein d'hyphes différenciées appelées basides, a alors lieu la caryogamie (fusion des noyaux), suivie de la méiose qui conduit à la formation de quatre spores sexuées, ou basidiospores haploïdes génétiquement différentes. Après germination, chaque basidiospore engendre un mycélium monocaryotique. Un simple test colorimétrique permet ensuite de ne sélectionner que les souches dépourvues d'activité laccase.The purpose of this step is to isolate and then select haploid cell lines from the sexual spores of a filamentous fungus, Pycnoporus cinnabarinus, which will be used as a host for the expression of the genes of interest. P. cinnabarinus is a heterothallic fungus which is found in the wild in the dicaryotic form (two unpaired nuclei per cell) from which monocaryotic lines are selected (one nucleus per cell), potentially more stable and therefore usable for transformation genetic. In the context of this study, the inventors set out to select monocaryotic lines deficient for laccase (lac " ) activity. In the dicaryotic state, the fungus can multiply vegetatively (Fig. 1). the influence of particular environmental conditions, we can induce, in the laboratory, the formation of fruiting bodies. Within differentiated hyphae called basides, then takes place karyogamy (fusion of nuclei), followed by meiosis which leads to the formation of four sexual spores, or genetically different haploid basidiospores. After germination, each basidiospore generates a monocaryotic mycelium. A simple colorimetric test then makes it possible to select only the strains lacking laccase activity.
1) Isolement des souches monocaryotiques Le milieu de fructification est composé d'extrait de malt 2% (PN) et de l'agar (1,6% P/N). Les cultures sont ensemencées dans des boites de Pétri et gardées à 30°C dans le noir pendant 15 jours avant de les exposer au jour 2 à 3 semaines à température ambiante. Le corps de f uctification apparaît orange-rouge. Les monospores sont alors récoltées avec de l'eau stérile sur le couvercle de la boite de Pétri. La suspension est diluée et mise en culture dans des boites de Pétri contenant un milieu MA2 (malt 2% P/N et agar 2% P/N) dans le but d'isoler des colonies. Des cultures pures isolées sont piquées et gardées dans du milieu MA2 à 30°C pendant 5 jours et stockées à 4°C. Dans ces conditions, une souche monocaryotique déficiente pour l'activité laccase a été sélectionnée pour la transformation avec le vecteur d'expression dans le but de surexprimer le gène de la laccase. Une étude en Southern blot a été effectuée et a permis de démontrer que cette souche est déficiente pour le gène codant pour la laccase chez P . cinnabarinus.1) Isolation of monocaryotic strains The fruiting medium is composed of 2% malt extract (PN) and agar (1.6% P / N). The cultures are sown in Petri dishes and kept at 30 ° C in the dark for 15 days before exposing them to the day 2 to 3 weeks at room temperature. The f uctification body appears orange-red. The monospores are then harvested with sterile water on the lid of the Petri dish. The suspension is diluted and cultured in Petri dishes containing MA2 medium (2% P / N malt and 2% P / N agar) in order to isolate colonies. Isolated pure cultures are pricked and kept in MA2 medium at 30 ° C for 5 days and stored at 4 ° C. Under these conditions, a monocaryotic strain deficient for laccase activity was selected for transformation with the expression vector with the aim of overexpressing the laccase gene. A Southern blot study was carried out and made it possible to demonstrate that this strain is deficient for the gene coding for laccase in P. cinnabarinus.
2) Test rapide de détection de l'activité laccase des colonies monospores Un morceau de mycélium est déposé dans une boite de Pétri et recouvert d'une goutte de syringaldazine 0,1% (P/N) en solution éthanolique ; Après 15 minutes, un changement de couleur est observé. Le 2,2-azino-bis-[3-ethylthiazoline-6-sulfonate] (ABTS) peut-être utilisé également comme substrat pour révéler une activité laccase.2) Rapid test for the detection of laccase activity in monospore colonies A piece of mycelium is placed in a petri dish and covered with a drop of 0.1% syringaldazine (P / N) in ethanolic solution; After 15 minutes, a color change is observed. 2,2-azino-bis- [3-ethylthiazoline-6-sulfonate] (ABTS) can also be used as a substrate to reveal laccase activity.
3) Conditions de cultures pour produire la laccase Un inoculum est prélevé des précultures qui ont poussé 10 jours à 30°C dans des fioles de Roux contenant 200 mL d'un milieu synthétique avec la composition suivante pour IL : maltose (20 g), tartrate de diammoriium (1,84 g), tartrate de disodium (2,3 g), KH2PO4 (1,33 g), CaCl2, H2O (0,1 g), MgSO4, 7H2O (0,5 g), FeSO4,7H2O (0,07 g), ZnSO4,7H2O (0,046 g), MnSO4,H2O (0,035 g), CuSO4,5H2O (0,1 g), extrait de levure (1 g), solution de vitamines (1 mL/L) selon Tatum et al. (Biochemical mutant strams of Neurospora produced by physical and chemical treatment. American Journal of Botany, 37 : 38-46, 1950). Le mycélium de deux fioles est collecté, mélangé à 100 mL d'eau stérile et broyés au mixeur Ultraturax 60 sec. Pour produire de la laccase, le milieu synthétique est inoculé par 1 mL de la suspension de mycélium. Le milieu (100 mL) est ensuite incubé à 30°C dans des fioles erlenmeyer bafflées de 250 mL sous agitation (120 rpm).°3) Culture conditions for producing laccase An inoculum is taken from the precultures which have grown for 10 days at 30 ° C. in Roux vials containing 200 ml of a synthetic medium with the following composition for IL: maltose (20 g), diammoriium tartrate (1.84 g), disodium tartrate (2.3 g), KH 2 PO 4 (1.33 g), CaCl 2 , H 2 O (0.1 g), MgSO 4 , 7H 2 O (0.5 g), FeSO 4 , 7H 2 O (0.07 g), ZnSO 4 , 7H 2 O (0.046 g), MnSO4, H 2 O (0.035 g), CuSO 4 , 5H 2 O (0, 1 g), yeast extract (1 g), vitamin solution (1 mL / L) according to Tatum et al. (Biochemical mutant strams of Neurospora produced by physical and chemical treatment. American Journal of Botany, 37: 38-46, 1950). The mycelium from two vials is collected, mixed with 100 mL of sterile water and ground in a 60 sec Ultraturax mixer. To produce laccase, the synthetic medium is inoculated with 1 ml of the mycelium suspension. The medium (100 ml) is then incubated at 30 ° C. in baffled 250 ml Erlenmeyer flasks with shaking (120 rpm).
II) Clonage du gène codant pour la laccase de Pycnoporus cinnabarinus et de son promoteur en vue de la construction d'un vecteur d'expressionII) Cloning of the gene coding for the laccase of Pycnoporus cinnabarinus and of its promoter with a view to the construction of an expression vector
Il s'agit d'un système d'expression eucaryote et plus particulièrement de champignon filamenteux, Pycnoporus cinnabarinus, du groupe basidiomycète pour la surproduction de protéines recombinantes déterminées. Le modèle d'étude sélectionné est celui de la laccase de P. cinnabarinus. A l'heure actuelle, deux modèles fongiques sont utilisés préférentiellement par les grands groupes industriels. Il s'agit d'Aspergillus et de Trichoderma qui appartiennent au groupe des Deutéromycètes. Ce système d'expression est donc tout à fait original et devrait combler la lacune concernant le développement de système d'expression basidiomycète compatible avec les exigences des industriels (possibilité de production à grande échelle de protéines sécrétées dans le milieu extra-cellulaire et culture du champignon producteur en fermenteur).It is a eukaryotic expression system and more particularly a filamentous fungus, Pycnoporus cinnabarinus, from the basidiomycete group for overproduction of specific recombinant proteins. The study model selected is that of P. cinnabarinus laccase. Currently, two fungal models are used preferentially by large industrial groups. These are Aspergillus and Trichoderma which belong to the group of Deuteromycetes. This expression system is therefore completely original and should fill the gap concerning the development of a basidiomycete expression system compatible with the requirements of manufacturers (possibility of large-scale production of proteins secreted in the extracellular medium and culture of mushroom producer in fermenter).
1) Clonage de gène de la laccase de Pycnoporus cinnabarinus et de son promoteur Dans une première étape, les Inventeurs ont amplifié un fragment du gène codant pour la laccase à l'aide d'amorces nucléotidiques dégénérées (Fig. 2). Les amorces dégénérées amont F2 (SEQ JD NO : 6 ; CAYTGGCAYGGRTTCTTCC) et aval R8 (SEQ ID NO : 7 ; GAGRTGGAAGTCRATGTGRC) ont été déduites, respectivement , des régions de liaison au cuivre I et IN des laccases d'organismes voisins et utilisées dans une réaction de PCR (Polymerase Chain Reaction) en utilisant l'ADΝ génomique de P. cinnabarinus 1-937. A 10 μl de mélange réactionnel sont ajoutés : 100 ng d'ADN génomique; 0.2 mM de dATP, dCTP, dTTP, and dGTP; 25 pmol de chaque amorce nucléotidique; 0.1 volume de tampon 10X Pfu polymerase (100 mM Tris-HCl, 15mM MgCl , 500 mM KCl, pH 8,3) and 1 U de polymerase Pfu. Le mélange est chauffé à 94°C pendant 5 min avant d'ajouter la polymerase. Les conditions de la réaction sont les suivantes : 5 cycles de 94 °C, 5 min; 55 °C, 30 s; et 72 °C, 4 min; puis 25 cycles of 94 °C, 30 s; 55 °C, 30 s, et 72 °C, 3 min. Une étape de 10 min à 72°C est effectuée afin de finir la réaction. Une bande de 1,64 kpb a été obtenue correspondant à la partie centrale du gène de la laccase. La séquence ADN a été clonée dans pGEM-T afin de séquencer cette partie du gène. Par une technique de Southern blot (Fig. 3), nous avons défini les sites de restriction appropriés afin d'obtenir un fragment d'ADN minimum, pouvant contenir l'intégralité de gène de la laccase, et qui sont susceptibles de servir à amplifier les extrémités 5' et 3' manquantes. Un Southern blot a été effectué avec F ADN génomique de P. cinnabarinus avec les enzymes, BamΗI, Eco I, PstI, PvuII, Sacï, Smal and Xba I et a permis de sélectionner PstI qui donne une bande de 3.5 kpb par digestion de l' ADN génomique. Afin d'amplifier les parties manquantes du gène, une technique de PCR inverse a été utilisée avec un mélange de PCR contenant des amorces nucléotidiques spécifiques de la partie centrale précédemment isolée et de TADN génomique de P. cinnabarinus. La réaction de PCR est effectuée avec 150 ng d'ADN coupé par PstI et recircularisé sur lui-même par ligation et les amorces nucléotidiques Fex (SEQ ID NO : 8 ; GGATAACTACTGGATCCGCG) et Rex (SEQ ID NO : 9 ; CGCAGTATTGCGTGGAGAG). Les conditions de la réaction sont les suivantes : 5 cycles de 94 °C, 5 min; 55 °C, 30 s; et 72 °C, 5 min; puis 25 cycles of 94 °C, 30 s; 55 °C, 30 s, et 72 °C, 4 min avec une étape finale de 10 min à 72 °C. Le fragment d'ADN amplifié correspond à une bande de 2,7 kpb qui a été clone dans pGEM-T et séquence. L'intégralité du gène codant pour la laccase a été ensuite définie en combinant la partie centrale et les parties 5' et 3' amplifiées. Afin de vérifier cette séquence, l'intégralité du gène a été amplifié (3,331 kpb, Fig. 4) avec les amorces nucléotidiques Fin (SEQ JD NO : 10 ; GACATCTGGAGCGCCTGTC) et Rin (SEQ ID NO : 11 ; ATCGAAGGTTCCGATGACTGACATGAC) à partir de l'ADN génomique de P. cinnabarinus. Ce gène a été également clone à partir de l'ADN génomique de P. cinnabarinus ss3 et s'est avéré être identique à celui isolé chez P. cinnabarinus I- 937.1) Cloning of the Pycnoporus cinnabarinus Laccase Gene and Its Promoter In a first step, the inventors amplified a fragment of the gene coding for laccase using degenerate nucleotide primers (FIG. 2). The degenerate primers upstream F2 (SEQ JD NO: 6; CAYTGGCAYGGRTTCTTCC) and downstream R8 (SEQ ID NO: 7; GAGRTGGAAGTCRATGTGRC) were deduced, respectively, from the copper binding regions I and IN from the laccases of neighboring organisms and used in a PCR reaction (Polymerase Chain Reaction) using the genomic ADΝ of P. cinnabarinus 1-937. To 10 μl of reaction mixture are added: 100 ng of genomic DNA; 0.2 mM dATP, dCTP, dTTP, and dGTP; 25 pmol of each nucleotide primer; 0.1 volume of 10X Pfu polymerase buffer (100 mM Tris-HCl, 15mM MgCl, 500 mM KCl, pH 8.3) and 1 U of Pfu polymerase. The mixture is heated at 94 ° C for 5 min before adding the polymerase. The reaction conditions are as follows: 5 cycles of 94 ° C, 5 min; 55 ° C, 30 s; and 72 ° C, 4 min; then 25 cycles of 94 ° C, 30 s; 55 ° C, 30 s, and 72 ° C, 3 min. A step of 10 min at 72 ° C. is carried out in order to finish the reaction. A band of 1.64 kbp was obtained corresponding to the central part of the laccase gene. The DNA sequence was cloned into pGEM-T in order to sequence this part of the gene. By a Southern blot technique (Fig. 3), we have defined the appropriate restriction sites in order to obtain a minimum DNA fragment, which may contain the entire laccase gene, and which may be used to amplify the 5 'and 3' ends missing. A Southern blot was carried out with F genomic DNA of P. cinnabarinus with the enzymes, BamΗI, Eco I, PstI, PvuII, Sacï, Smal and Xba I and made it possible to select PstI which gives a band of 3.5 kbp by digestion of l 'Genomic DNA. In order to amplify the missing parts of the gene, a PCR technique reverse was used with a mixture of PCR containing nucleotide primers specific for the central part previously isolated and genomic DNA from P. cinnabarinus. The PCR reaction is carried out with 150 ng of DNA cut by PstI and recircularized on itself by ligation and the nucleotide primers Fex (SEQ ID NO: 8; GGATAACTACTGGATCCGCG) and Rex (SEQ ID NO: 9; CGCAGTATTGCGTGGAGAG). The reaction conditions are as follows: 5 cycles of 94 ° C, 5 min; 55 ° C, 30 s; and 72 ° C, 5 min; then 25 cycles of 94 ° C, 30 s; 55 ° C, 30 s, and 72 ° C, 4 min with a final step of 10 min at 72 ° C. The amplified DNA fragment corresponds to a 2.7 kbp band which has been cloned into pGEM-T and sequenced. The entire gene coding for laccase was then defined by combining the central part and the amplified 5 'and 3' parts. In order to verify this sequence, the entire gene was amplified (3.331 kbp, FIG. 4) with the nucleotide primers Fin (SEQ JD NO: 10; GACATCTGGAGCGCCTGTC) and Rin (SEQ ID NO: 11; ATCGAAGGTTCCGATGACTGACATGAC) from genomic DNA of P. cinnabarinus. This gene was also cloned from the genomic DNA of P. cinnabarinus ss3 and was found to be identical to that isolated in P. cinnabarinus I-937.
2) Construction du vecteur d'expression utilisant le promoteur du gène de la laccase A partir de la séquence du gène de la laccase, les Inventeurs ont clone le promoteur de ce gène en utilisant la même stratégie employée précédemment pour l'isolement du gène, c'est-à-dire avec une technique de PCR inverse sur un fragment d'ADN génomique (3,5 kpb) coupé cette fois-ci par l'enzyme de restriction BgïïL (Fig. 5). Deux mille cinq cent vingt sept kpb en avant du gène de la laccase ont été ainsi clone par PCR inverse et séquence. Ce promoteur a été placé dans un vecteur une résistance à l'ampicilline pour son sous-clonage dans la bactérie et une résistance à la phléomycine utilisé comme marqueur de sélection dans le champignon. Un terminateur du gène codant pour Thydrophobine sc3 de Schizophyllum commune a été placé en aval afin de terminer l'étape de transcription. Ce vecteur appelé pELP sera utilisé pour l'expression homologue de la laccase (Fig. 6). Deux autres promoteurs hétérologues ont été utilisés dans cette étude. Ce sont les promoteurs des gènes codant pour la glycéraldéhyde 3- phosphate déshydrogénase (gpd) et l'hydrophobine (sc3) de Schizophyllum commune (Fig. 6), constituant respectivement les vecteurs d'expression pEGT et pESC. L'intégralité des séquences nucléotidiques de vecteurs pEGT (SEQ JD NO : 12), pESC (SEQ ID NO : 13), et pELP (SEQ ID NO : 14), se trouvent dans les figures 7, 8 et 9 avec les positions du promoteur, du marqueur de sélection et du terminateur.2) Construction of the expression vector using the promoter of the laccase gene From the sequence of the laccase gene, the inventors cloned the promoter of this gene using the same strategy used previously for the isolation of the gene, that is to say with a reverse PCR technique on a fragment of genomic DNA (3.5 kbp) cut this time by the restriction enzyme BgïïL (FIG. 5). Two thousand five hundred and twenty seven kbp in front of the laccase gene were thus cloned by reverse PCR and sequence. This promoter was placed in a vector: resistance to ampicillin for its subcloning in the bacterium and resistance to phleomycin used as a selection marker in the fungus. A terminator of the gene coding for hydrophobin sc3 from Schizophyllum commune was placed downstream in order to complete the transcription step. This vector called pELP will be used for the homologous expression of laccase (Fig. 6). Two other heterologous promoters were used in this study. They are the promoters of the genes coding for glyceraldehyde 3- phosphate dehydrogenase (gpd) and hydrophobin (sc3) from Schizophyllum commune (Fig. 6), constituting respectively the pEGT and pESC expression vectors. The complete nucleotide sequences of pEGT (SEQ JD NO: 12), pESC (SEQ ID NO: 13), and pELP (SEQ ID NO: 14) vectors are found in Figures 7, 8 and 9 with the positions of promoter, selection marker and terminator.
III) Transformation de la souche monocaryotique avec les vecteurs d'expression (modèle d'étude : la laccase de Pycnoporus cinnabarinus)III) Transformation of the monocaryotic strain with the expression vectors (study model: the laccase of Pycnoporus cinnabarinus)
1) Préparation du mycélium pour l'obtention de protoplastes Un quart d'une colonie cultivée en milieu solide (10 jours) est homogénéisé avec un mixeur (type Ultraturax, vitesse lente) pendant une minute dans 50 ml de milieu YM (par litre : glucose 10 g, peptone 5 g, extrait de levure 3 g, extrait de malt 3 g). Le broyât est transféré dans un erlenmeyer de 250 ml stérile où l'on rajoute50 ml de milieu YM, puis incubé à 30°C et sous agitation (225 rpm) pendant 20 heures. La culture est une nouvelle fois homogénéisée pendant 1 min (vitesse lente) et on rajoute 100 ml de milieu YM. Le broyât est transféré dans un erlenmeyer de 500 ml et mis en culture pendant une nuit à 30°C.1) Preparation of the mycelium for obtaining protoplasts A quarter of a colony cultivated in solid medium (10 days) is homogenized with a mixer (type Ultraturax, slow speed) for one minute in 50 ml of YM medium (per liter: glucose 10 g, peptone 5 g, yeast extract 3 g, malt extract 3 g). The ground material is transferred into a sterile 250 ml Erlenmeyer flask to which 50 ml of YM medium is added, then incubated at 30 ° C. and with shaking (225 rpm) for 20 hours. The culture is again homogenized for 1 min (slow speed) and 100 ml of YM medium are added. The ground material is transferred to a 500 ml Erlenmeyer flask and cultured overnight at 30 ° C.
2) Préparation des protoplastes La culture de champignon est centrifugée pendant 10 min à 2000 rpm dans un rotor oscillant (tube de 50 ml). Seize g (poids humide) sont lavés dans 40 ml d'une solution de MgSO4 0,5 M ou de saccharose 0,5 M. Dans le cas de l'utilisation du saccharose, l'enzyme lyrique utilisée pour digérer les parois est diluée dans le saccharose. Le mycélium est ensuite centrifugé 10 min à 2000 rpm et le surnageant éliminé. Concernant la lyse des parois fongiques, on ajoute au mycélium provenant de 50 ml de culture, 10 ml d'enzyme lyrique (Glucanex, Sigma) dilué à 1 mg/ml dans une solution de MgSO4 0,5 M . La digestion se fait dans un erlenmeyer de 500 ml à 30°C sous faible agitation pendant 3 à 4 heures. Pendant cette incubation, l'apparition des protoplastes est contrôlée au microscope. Dix ml d'eau stérile sont rajoutés, puis mélangés délicatement. Les protoplastes sont laissés 10 min, le temps que l'équilibre avec l'eau se fasse (les protoplastes vont flotter à la surface). Ils sont ensuite centrifugés 10 min à 2000 rpm dans un rotor oscillant. Le surnageant contenant les protoplastes est transféré délicatement dans un nouveau de 50 ml. Le culot restant peut-être re-incubé avec 25 ml d'une solution de MgSO4 0,5M pour récupérer le maximum de protoplastes (on répète alors l'étape de centrifugation). Un volume de sorbitol 1 M, égal à celui de la préparation des protoplastes, lui est rajouté. Pendant 10 min, on laisse les protoplastes relarguer l'eau. Cette préparation est ensuite centrifugée 10 min à 2000 rpm. Le surnageant est éliminé, tout en laissant un peu de sorbitol. Les protoplastes sont transférés dans un nouveau tube. Le précédent tube est rincé avec la solution de sorbitol 1M et les protoplastes récupérés, ajoutés dans le nouveau tube. Les protoplastes sont comptés et centrifugés 10 min à 2000 rpm. Ils sont ensuite dilués à une concentration de2) Preparation of the protoplasts The fungus culture is centrifuged for 10 min at 2000 rpm in an oscillating rotor (50 ml tube). Sixteen g (wet weight) are washed in 40 ml of a 0.5 M MgSO 4 solution or 0.5 M sucrose. In the case of the use of sucrose, the lyric enzyme used to digest the walls is diluted in sucrose. The mycelium is then centrifuged 10 min at 2000 rpm and the supernatant removed. Concerning the lysis of the fungal walls, 10 ml of lyric enzyme (Glucanex, Sigma) diluted to 1 mg / ml in a 0.5 M MgSO 4 solution are added to the mycelium originating from 50 ml of culture. Digestion takes place in a 500 ml Erlenmeyer flask at 30 ° C with gentle stirring for 3 to 4 hours. During this incubation, the appearance of the protoplasts is monitored under a microscope. Ten ml of sterile water are added, then gently mixed. The protoplasts are left for 10 min, while the equilibrium with water takes place (the protoplasts will float on the surface). They are then centrifuged for 10 min at 2000 rpm in an oscillating rotor. The supernatant containing the protoplasts is carefully transferred to a new 50 ml. The remaining pellet may be re-incubated with 25 ml of a 0.5 M MgSO 4 solution to recover the maximum of protoplasts (the centrifugation step is then repeated). A volume of sorbitol 1 M, equal to that of the preparation of the protoplasts, is added to it. For 10 min, the protoplasts are allowed to release the water. This preparation is then centrifuged 10 min at 2000 rpm. The supernatant is removed, while leaving a little sorbitol. The protoplasts are transferred to a new tube. The previous tube is rinsed with the 1M sorbitol solution and the protoplasts recovered, added to the new tube. The protoplasts are counted and centrifuged for 10 min at 2000 rpm. They are then diluted to a concentration of
2. 10 protoplastes par ml dans la solution de sorbitol 1M. Une solution de CaC12 à 0,5 M (1/10) est rajoutée aux protoplastes.2. 10 protoplasts per ml in the 1M sorbitol solution. A 0.5 M (1/10) CaCl2 solution is added to the protoplasts.
3) Transformation des protoplastes Pour la transformation, 100 μl de protoplastes sont transformés avec 5 à 10 μg de vecteur (volume maximum de 10 μl) dans un tube stérile de 10 ml. Ils sont alors incubés 10 à 15 min dans la glace. Un volume d'une solution de PEG 4000 à 40% est ajouté, puis mélangé et les protoplastes sont incubés 5 min à température ambiante. Deux et demi ml de milieu de régénération (pour 100 ml : glucose 2 g, MgSO4,7H20 12,5 g, KΗ2PO4 0,046 g, K2HPO4 0,1 g, bacto peptone 0,2 g, extrait de levure 0,2 g) sont rajoutés aux protoplastes qui sont incubés une nuit à 30°C. Des boites de sélection (milieu YM contenant de la phléomycine à 7 μg/ml , boites carrées) sont préchauffées à 37°C. Sept et demi ml d'un mélange de top agar (Low Melting Point agarose 1% dilué dans un milieu YM contenant de la phléomycine 7 à 10 μg/ml) sont ajoutés au milieu de régénération contenant les protoplastes et sont versés sur les boites de sélection préchauffées. Quand la solution de top agar s'est solidifiée, les boites sont incubées à 30°C pendant 4 jours. Les transformants sont alors transférés sur de nouvelles boites de sélection.3) Transformation of the protoplasts For the transformation, 100 μl of protoplasts are transformed with 5 to 10 μg of vector (maximum volume of 10 μl) in a sterile 10 ml tube. They are then incubated 10 to 15 min in ice. A volume of a 40% PEG 4000 solution is added, then mixed and the protoplasts are incubated for 5 min at room temperature. Two and a half ml of regeneration medium (per 100 ml: glucose 2 g, MgSO 4 , 7H 2 0 12.5 g, KΗ 2 PO 4 0.046 g, K 2 HPO 4 0.1 g, bacto peptone 0.2 g , yeast extract 0.2 g) are added to the protoplasts which are incubated overnight at 30 ° C. Selection boxes (YM medium containing phleomycin at 7 μg / ml, square boxes) are preheated to 37 ° C. Seven and a half ml of a mixture of top agar (Low Melting Point agarose 1% diluted in YM medium containing phleomycin 7 to 10 μg / ml) are added to the regeneration medium containing the protoplasts and are poured onto the dishes. preheated selection. When the top agar solution has solidified, the dishes are incubated at 30 ° C for 4 days. The transformants are then transferred to new selection boxes.
4) Ciblage des transformants A partir de 16 g de mycélium, on obtient généralement de l'ordre de 1 à 2.107 protoplastes. Le pourcentage de régénération est de 10 %. Concernant le vecteur pESC, les monokaryons ont été transformés avec le vecteur contenant le cDNA (BRFM 472, 473 et 474) ou le gène codant pour la laccase de P. cinnabarinus (BRFM 470 et 471) (Fig. 10). En parallèle, d'autres monokaryons ont été transformés avec les promoteurs pEGT (GPDll, 12 et 13) ou avec le vecteur pELP (12.3, 12.7 et 12.8) contenant le gène codant pour la laccase (Fig. 10). Au vu des résultats deux transformants se dégagent du lot avec des activités équivalentes, les transformants 12.7 et GPD14. L'activité au cours du temps a été suivie pour les transformants GPD14 etl2.7 (Fig. 11). L'activité est détectable à partir de 3-4 jours et augmentent jusqu'à 12 jours pour atteindre approximativement 1200 nkatal/ml soit 72000 U/l avec ajout d'éthanol dans le milieu de culture.4) Targeting of the transformants From 16 g of mycelium, the order of 1 to 2.10 7 protoplasts is generally obtained. The percentage of regeneration is 10%. Concerning the vector pESC, the monokaryons were transformed with the vector containing cDNA (BRFM 472, 473 and 474) or the gene coding for the laccase of P. cinnabarinus (BRFM 470 and 471) (FIG. 10). In parallel, other monokaryons were transformed with the pEGT promoters (GPDll, 12 and 13) or with the vector pELP (12.3, 12.7 and 12.8) containing the gene coding for laccase (Fig. 10). In view of the results, two transformants emerge from the lot with equivalent activities, transformants 12.7 and GPD14. The activity over time was followed for the transformants GPD14 and 1.2.7 (Fig. 11). The activity is detectable from 3-4 days and increases up to 12 days to reach approximately 1200 nkatal / ml or 72000 U / l with addition of ethanol in the culture medium.
Légende des figuresLegend of figures
Figure 1 : Isolement de souche monocaryotique déficiente pour l'activité laccase.Figure 1: Isolation of monocaryotic strain deficient for laccase activity.
Figure 2 : Isolement du gène codant pour la laccase de Pycnoporus cinnabarinus laccase.Figure 2: Isolation of the gene coding for the laccase of Pycnoporus cinnabarinus laccase.
Figure 3 : Etude en Southern blot du gène codant pour la laccase de Pycnoporus cinnabarinus.Figure 3: Southern blot study of the gene coding for the laccase of Pycnoporus cinnabarinus.
Figure 4 : Séquence du gène codant pour la laccase de Pycnoporus cinnabarinus.Figure 4: Sequence of the gene coding for the laccase of Pycnoporus cinnabarinus.
Figure 5 : Séquence de la séquence promotrice pLac du gène codant pour la laccase de Pycnoporus cinnabarinus (jusqu'à l'ATG codant pour la méthionine de la laccase).Figure 5: Sequence of the pLac promoter sequence of the gene coding for the laccase of Pycnoporus cinnabarinus (up to the ATG coding for the methionine of laccase).
Figure 6 : Carte physique des trois vecteurs d'expression pEGT, pESC, pELP, utilisés pour la production de la laccase chez Pycnoporus cinnabarinus.Figure 6: Physical map of the three expression vectors pEGT, pESC, pELP, used for the production of laccase in Pycnoporus cinnabarinus.
Figure 7 : Séquence nucléotidique du vecteur pEGT, contenant le promoteur du gène gpd (4480-5112), un marqueur de résistance à la phléomycine (507-1822) et le terminateur du gène sc3 (71-507).Figure 7: Nucleotide sequence of the pEGT vector, containing the promoter of the gpd gene (4480-5112), a marker of resistance to phleomycin (507-1822) and the terminator of the sc3 gene (71-507).
Figure 8 : Séquence nucléotidique du vecteur pESC, contenant le promoteur du gène sc3 (1-1033), un marqueur de résistance à la phléomycine (1540-2855) et le terminateur du gène sc3 (1104-1540). -,,---,, PCT/FR2005/000093 15Figure 8: Nucleotide sequence of the vector pESC, containing the promoter of the sc3 gene (1-1033), a marker for resistance to phleomycin (1540-2855) and the terminator of the sc3 gene (1104-1540). - ,, --- ,, PCT / FR2005 / 000093 15
Figure 9 : Séquence nucléotidique du vecteur pELP, contenant le promoteur du gène laccase (4457-6983), un marqueur de résistance à la phléomycine (507-1822) et le terminateur du gène sc3 (71-507)Figure 9: Nucleotide sequence of the pELP vector, containing the promoter of the laccase gene (4457-6983), a marker of resistance to phleomycin (507-1822) and the terminator of the sc3 gene (71-507)
Figure 10 : Résultats de production des transformants présentant les activités les plus importantes. La culture a été effectuée avec ou sans (témoin) éthanol.Figure 10: Production results of transformants with the most important activities. The culture was carried out with or without (control) ethanol.
Figure 11 : Suivi des activités laccase des transformants GPD 14 et 12.7 en fonction du temps avec ou (témoin) sans éthanol.Figure 11: Monitoring of the laccase activities of transformants GPD 14 and 12.7 as a function of time with or (control) without ethanol.
Figure 12 : Séquence du gène codant pour la laccase àϋhalocyphina villosa. Figure 12: Sequence of the gene coding for halocyphina villosa laccase.

Claims

REVENDICATIONS
1. Procédé de préparation d'une protéine recombinante déterminée, ledit procédé étant effectué par surexpression du gène codant pour cette protéine déterminée dans une souche monocaryotique de champignons filamenteux de l'espèce Pycnoporus du groupe basidiomycète, et comprend : - une étape de mise en culture de la souche monocaryotique de Pycnoporus susmentionnée, ladite souche étant transformée à l'aide d'un vecteur d'expression contenant le gène codant pour la protéine recombinante déterminée, dont l'expression est placée sous le contrôle d'un promoteur correspondant à un promoteur endogène des champignons susmentionnés, ou d'un promoteur différent (encore désigné promoteur exogène), ledit promoteur étant constitutif ou inductible, - le cas échéant une étape d'induction du promoteur susmentionné, lorsque celui-ci est inductible, - la récupération, et, le cas échéant, la purification de la protéine recombinante déterminée, produite dans le milieu de culture.1. Process for the preparation of a specific recombinant protein, said process being carried out by overexpression of the gene coding for this specific protein in a monocaryotic strain of filamentous fungi of the species Pycnoporus of the basidiomycete group, and comprises: - a step of setting culture of the above-mentioned monocaryotic strain of Pycnoporus, said strain being transformed using an expression vector containing the gene coding for the determined recombinant protein, the expression of which is placed under the control of a promoter corresponding to a endogenous promoter of the above-mentioned fungi, or of a different promoter (also known as an exogenous promoter), said promoter being constitutive or inducible, - where appropriate a stage of induction of the above-mentioned promoter, when the latter is inducible, - recovery, and, where appropriate, the purification of the determined recombinant protein produced in the culture centre.
2. Procédé selon la revendication 1, caractérisé en ce que la souche monocaryotique de Pycnoporus utilisée pour la surexpression du gène codant pour la protéine recombinante déterminée est telle qu'obtenue par mise en culture de la souche dicaryotique d'origine à 30°C dans le noir pendant 15 jours, suivie d'une étape d'exposition au jour 2 à 3 semaines à température ambiante jusqu'à la formation d'organes de fructification correspondant à des hyphes différenciées appelées basides, au sein desquels a alors lieu la caryogamie, suivie de la méiose qui conduit à la formation de quatre spores sexuées, ou basidiospores haploïdes génétiquement différentes, qui, après germination, engendre un mycélium monocaryotique.2. Method according to claim 1, characterized in that the monocaryotic strain of Pycnoporus used for the overexpression of the gene coding for the determined recombinant protein is such as obtained by culturing the original dicaryotic strain at 30 ° C in black for 15 days, followed by an exposure step on day 2 to 3 weeks at room temperature until the formation of fruiting bodies corresponding to differentiated hyphae called basides, within which karyogamy then takes place, followed by meiosis which leads to the formation of four sexual spores, or genetically different haploid basidiospores, which, after germination, generates a monocaryotic mycelium.
3. Procédé selon la revendication 1 ou , 2, caractérisé en ce que la souche monocaryotique de Pycnoporus utilisée est une souche de Pycnoporus cinnabarinus.3. Method according to claim 1 or, 2, characterized in that the monocaryotic strain of Pycnoporus used is a strain of Pycnoporus cinnabarinus.
4. Procédé selon l'une des revendications 1 à 3, caractérisé en ce que les protéines recombinantes déterminées surexprimées correspondent à des protéines endogènes de Pycnoporus, ou à des protéines exogènes, notamment à des protéines exogènes correspondant à des protéines endogènes de basidiomycètes autres que Pycnoporus, telles que les enzymes basidiomycètes intervenant dans les biotransformations végétales, ou correspondant à des protéines endogènes de souches de Pycnoporus différentes de la souche de Pycnoporus utilisée pour la production desdites protéines.4. Method according to one of claims 1 to 3, characterized in that the determined overexpressed recombinant proteins correspond to endogenous proteins of Pycnoporus, or to exogenous proteins, in particular to exogenous proteins corresponding to endogenous proteins of basidiomycetes other than Pycnoporus, such as the enzymes basidiomycetes involved in plant biotransformations, or corresponding to endogenous proteins of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins.
5. Procédé selon l'une des revendications 1 à 4, caractérisé en ce que les protéines recombinantes déterminées correspondent : - aux protéines endogènes de Pycnoporus suivantes : * les métalloenzymes, telles que la laccase, ou la tyrosinase, * ou la cellobiose déshydrogénase, la xylanase, la β-glycosidase, l'invertase, ou l'α-amylase, - aux protéines exogènes choisies parmi les suivantes : * les tyrosinases de souches de Pycnoporus différentes de la souche de Pycnoporus utilisée pour la production desdites protéines, telle que la tyrosinase de Pycnoporus sanguineus lorsque la souche de Pycnoporus utilisée pour la production de cette tyrosinase est différente de Pycnoporus sanguineus, * les laccases de basidiomycètes autres que Pycnoporus, telle que la laccase d'halocyphina villosa (basidiomycète halophile), * les cinnamoyl estérases A et B d'Aspergillus niger.5. Method according to one of claims 1 to 4, characterized in that the determined recombinant proteins correspond: - to the following endogenous proteins of Pycnoporus: * metalloenzymes, such as laccase, or tyrosinase, * or cellobiose dehydrogenase, xylanase, β-glycosidase, invertase, or α-amylase, - with exogenous proteins chosen from the following: * tyrosinases from strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins, such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * basidiomycetes laccases other than Pycnoporus, such as halocyphina villosa laccase (halophilic basidiomycetes), * cinnamoyl esters and B of Aspergillus niger.
6. Procédé selon l'une des revendications 1 à 5, de préparation de protéines recombinantes déterminées correspondant aux protéines endogènes de Pycnoporus, caractérisé en ce que la souche monocaryotique de Pycnoporus utilisée est déficiente pour le gène codant pour la protéine endogène à laquelle correspond la protéine recombinante déterminée.6. Method according to one of claims 1 to 5, for the preparation of specific recombinant proteins corresponding to the endogenous proteins of Pycnoporus, characterized in that the monocaryotic strain of Pycnoporus used is deficient for the gene coding for the endogenous protein to which the specific recombinant protein.
7. Procédé selon l'une des revendications 1 à 6, de préparation de protéines recombinantes déterminées correspondant aux protéines endogènes de Pycnoporus, caractérisé en ce que la souche monocaryotique de Pycnoporus utilisée est transformée a l'aide d'un vecteur d'expression contenant le gène codant pour la protéine recombinante déterminée marquée, notamment par un marqueur histidine. 7. Method according to one of claims 1 to 6, for the preparation of specific recombinant proteins corresponding to the endogenous proteins of Pycnoporus, characterized in that the monocaryotic strain of Pycnoporus used is transformed using an expression vector containing the gene coding for the determined recombinant protein marked, in particular with a histidine tag.
8. Procédé selon l'une des revendications 1 à 7, de préparation de laccases recombinantes correspondant aux laccases endogènes de Pycnoporus, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus, transformée à l'aide d'un vecteur d'expression contenant le gène codant pour une laccase de Pycnoporus, le cas échéant marquée, et dont l'expression est placée sous le contrôle d'un promoteur correspondant au promoteur endogène de cette laccase, - une étape d'induction du promoteur susmentionné, notamment par addition d'éthanol, ou de sous-produits agricoles contenant de la lignocellulose comme la paille de blé, les sons de maïs et la pulpe de betterave, ou des composés à cycle aromatique comme la 2,5-xylidine, l'acide vératrylique, le guaïcol, l'alcool vératrylique, la syringaldazine, l'acide férulique, l'acide caféique et les lignosulfonates, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, correspondant à la laccase endogène de Pycnoporus susmentionnée produite dans le milieu de culture.8. Method according to one of claims 1 to 7, for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus, the case possibly deficient for the gene coding for the endogenous Pycnoporus laccase, transformed using an expression vector containing the gene coding for a Pycnoporus laccase, if appropriate labeled, and the expression of which is placed under control a promoter corresponding to the endogenous promoter of this laccase, a step of inducing the above-mentioned promoter, in particular by adding ethanol, or agricultural by-products containing lignocellulose such as wheat straw, corn bran and beet pulp, or compounds with an aromatic cycle such as 2,5-xylidine, veratrylic acid, guaïcol, veratrylic alcohol, syringaldazine, ferulic acid, caffeic acid and lignosulfonates, - the recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, corresponding to the endogenous laccase of Pycnoporus mentioned above produced in the culture medium.
9. Procédé selon la revendication 8, de préparation de la laccase recombinante correspondant à la laccase endogène de Pycnoporus cinnabarinus représentée par SEQ ID NO : 2, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus cinnabarinus, transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique SEQ ID NO : 1 codant pour la laccase recombinante représentée par SEQ ID NO : 2, le cas échéant marquée, et dont l'expression est placée sous le contrôle du promoteur pLac correspondant au promoteur endogène de la laccase susmentionnée, la séquence dudit promoteur pLac étant représentée par SEQ JD NO : 3, - une étape d'induction par l'éthanol du promoteur pLac susmentionné, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, représentée par SEQ JD NO : 2 produite dans le milieu de culture.9. Method according to claim 8, for preparing the recombinant laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 1 coding for the recombinant laccase represented by SEQ ID NO: 2, where appropriate labeled, the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the aforementioned laccase, the sequence of said pLac promoter being represented by SEQ JD NO: 3, - a step of induction with ethanol of the aforementioned pLac promoter, - recovery, and, where appropriate, purification of the recombinant laccase, where appropriate labeled e, represented by SEQ JD NO: 2 produced in the culture medium.
10. Procédé de préparation de laccases recombinantes correspondant aux laccases endogènes de Pycnoporus selon l'une des revendications 1 à 7, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus, transformée à l'aide d'un vecteur d'expression contenant le gène codant pour une laccase de Pycnoporus, le cas échéant marquée, et dont l'expression est placée sous le contrôle d'un promoteur exogène choisi parmi : * le promoteur gpd de l'expression du gène codant pour la glycéraldéhyde 3-phosphate déhydrogénase de Schizophyllum commune, dont la séquence nucléotidique est représentée par SEQ ID NO : 4, * ou le promoteur sc3 de l'expression du gène codant pour l'hydrophobine de Schizophyllum commune, dont la séquence nucléotidique est représentée par SEQ ID NO : 5, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, correspondant à la laccase endogène de Pycnoporus susmentionnée produite dans le milieu de culture.10. Process for the preparation of recombinant laccases corresponding to the endogenous laccases of Pycnoporus according to one of claims 1 to 7, characterized in that it comprises: a step of culturing a monocaryotic strain of Pycnoporus, if necessary deficient for the gene coding for the endogenous laccase of Pycnoporus, transformed using an expression vector containing the gene coding for a laccase of Pycnoporus, where appropriate labeled, the expression of which is placed under the control of an exogenous promoter chosen from: * the gpd promoter of the expression of the gene coding for glyceraldehyde 3-phosphate dehydrogenase from Schizophyllum common, the sequence of which nucleotide is represented by SEQ ID NO: 4, * or the promoter sc3 of the expression of the gene coding for the common Schizophyllum hydrophobin, the nucleotide sequence of which is represented by SEQ ID NO: 5, - recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, corresponding to the endogenous laccase of Pycnoporus mentioned above produced in the culture medium.
11. Procédé selon la revendication 10, de préparation de la laccase recombinante correspondant à la laccase endogène de Pycnoporus cinnabarinus représentée par SEQ ID NO : 2, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus, transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique SEQ ID NO : 1 codant pour la laccase recombinante représentée par SEQ ID NO : 2 le cas échéant marquée, et dont l'expression est placée sous le contrôle du promoteur exogène gpd ou sc3, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, représentée par SEQ JD NO : 2 produite dans le milieu de culture.11. The method as claimed in claim 10, for preparing the recombinant laccase corresponding to the endogenous laccase of Pycnoporus cinnabarinus represented by SEQ ID NO: 2, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous lcase of Pycnoporus, transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 1 coding for the recombinant laccase represented by SEQ ID NO : 2 where appropriate labeled, and the expression of which is placed under the control of the exogenous promoter gpd or sc3, - the recovery, and, where appropriate, the purification of the recombinant laccase, where appropriate labeled, represented by SEQ JD NO: 2 produced in the culture medium.
12. Procédé selon l'une des revendications 1 à 5, de préparation de tyrosinase recombinante correspondant à la tyrosinase de Pycnoporus sanguineus représentée par SEQ TD NO : 16, caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique SEQ ID NO : 15 codant pour la tyrosinase recombinante représentée par SEQ ID NO : 16, le cas échéant marquée, la séquence SEQ TD NO : 15 étant avantageusement précédée par la séquence nucléotidique délimitée par les nucléotides situés aux positions 128 et 190 de SEQ JD NO : 1 codant pour le peptide signal de Pycnoporus cinnabarinus délimité par les 21 premiers aminoacides de SEQ TD NO : 2, et dont l'expression est placée sous le contrôle du promoteur pLac correspondant au promoteur endogène de la laccase de Pycnoporus cinnabarinus, la séquence dudit promoteur pLac étant représentée par SEQ TD NO : 3, - une étape d'induction par l'éthanol du promoteur pLac susmentionné, - la récupération, et, le cas échéant, la purification de la tyrosinase recombinante, le cas échéant marquée, représentée par SEQ TD NO : 16 produite dans le milieu de culture.12. Method according to one of claims 1 to 5, of preparation of recombinant tyrosinase corresponding to the tyrosinase of Pycnoporus sanguineus represented by SEQ TD NO: 16, characterized in that it comprises: - a step of culturing a monocaryotic strain of Pycnoporus cinnabarinus transformed using an expression vector containing the nucleotide sequence SEQ ID NO: 15 coding for the recombinant tyrosinase represented by SEQ ID NO: 16, if appropriate labeled, the sequence SEQ TD NO : 15 being advantageously preceded by the nucleotide sequence delimited by the nucleotides located at positions 128 and 190 of SEQ JD NO: 1 coding for the signal peptide of Pycnoporus cinnabarinus delimited by the first 21 amino acids of SEQ TD NO: 2, and the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the Pycnoporus cinnabarinus laccase, the sequence of said pLac promoter being represented by SEQ TD NO: 3, - an ethanol induction step of the aforementioned pLac promoter, - recovery, and, where appropriate, the purification of the recombinant tyrosinase, where appropriate labeled, represented by SEQ TD NO: 16 produced in the culture medium.
13. Procédé selon l'une des revendications 1 à 5, de préparation de laccase recombinante correspondant à la laccase d'halocyphina villosa représentée sur la figure 12 (SEQ TD NO : 18), caractérisé en ce qu'il comprend : - une étape de mise en culture d'une souche monocaryotique de Pycnoporus cinnabarinus, le cas échéant déficiente pour le gène codant pour la laccase endogène de Pycnoporus cinnabarinus, transformée à l'aide d'un vecteur d'expression contenant la séquence nucléotidique représentée sur la figure 12 (SEQ TD NO : 17) codant pour la laccase recombinante représentée par SEQ TD NO : 18, le cas échéant marquée, et dont l'expression est placée sous le contrôle du promoteur pLac correspondant au promoteur endogène de la laccase de Pycnoporus cinnabarinus, la séquence dudit promoteur pLac étant représentée par SEQ TD NO : 3, - une étape d'induction par l'éthanol du promoteur pLac susmentionné, - la récupération, et, le cas échéant, la purification de la laccase recombinante, le cas échéant marquée, représentée par SEQ ID NO : 18 produite dans le milieu de culture.13. Method according to one of claims 1 to 5, for the preparation of recombinant laccase corresponding to the laccase of halocyphina villosa shown in FIG. 12 (SEQ TD NO: 18), characterized in that it comprises: - a step for culturing a monocaryotic strain of Pycnoporus cinnabarinus, if necessary deficient for the gene coding for the endogenous lcase of Pycnoporus cinnabarinus, transformed using an expression vector containing the nucleotide sequence represented in FIG. 12 (SEQ TD NO: 17) coding for the recombinant laccase represented by SEQ TD NO: 18, where appropriate labeled, and the expression of which is placed under the control of the pLac promoter corresponding to the endogenous promoter of the laccase of Pycnoporus cinnabarinus, the sequence of said pLac promoter being represented by SEQ TD NO: 3, - a step of induction with ethanol of the aforementioned pLac promoter, - recovery, and, if necessary, purification cation of the recombinant laccase, optionally labeled, represented by SEQ ID NO: 18 produced in the culture medium.
14. Séquence nucléotidique codant pour le promoteur pLac de la laccase endogène de Pycnoporus cinnabarinus, et correspondant à la séquence SEQ TD NO : 3, ou toute séquence dérivée de ce promoteur par substitution, addition ou suppression d'un ou plusieurs nucléotides et conservant la propriété d'être un promoteur de l'expression de séquences. 14. Nucleotide sequence coding for the pLac promoter of the endogenous laccase of Pycnoporus cinnabarinus, and corresponding to the sequence SEQ TD NO: 3, or any sequence derived from this promoter by substitution, addition or deletion of one or more nucleotides and retaining the property of being a promoter of the expression of sequences.
15. Vecteur d'expression caractérisé en ce qu'il comprend la séquence SEQ TD NO: 3 du promoteur pLac selon la revendication 14.15. Expression vector characterized in that it comprises the sequence SEQ TD NO: 3 of the pLac promoter according to claim 14.
16. Vecteur d'expression selon la revendication 15, caractérisé en ce qu'il comprend un gène codant pour une protéine recombinante déterminée, et dont l'expression est placée sous le contrôle du promoteur pLac selon la revendication 14.16. Expression vector according to claim 15, characterized in that it comprises a gene coding for a specific recombinant protein, and the expression of which is placed under the control of the pLac promoter according to claim 14.
17. Vecteur d'expression selon la revendication 15 ou 16, caractérisé en ce que la protéine recombinante déterminée est une protéine correspondant : - aux protéines endogènes de Pycnoporus suivantes : * les métalloenzymes, telles que la laccase, ou la tyrosinase, * ou la cellobiose déshydrogénase, la xylanase, la β-glycosidase, l'invertase, ou l'α-amylase, - aux protéines exogènes choisies parmi les suivantes : * les tyrosinases de souches de Pycnoporus différentes de la souche de Pycnoporus utilisée pour la production desdites protéines, telle que la tyrosinase de Pycnoporus sanguineus lorsque la souche de Pycnoporus utilisée pour la production de cette tyrosinase est différente de Pycnoporus sanguineus, * les laccases de basidiomycètes autres que Pycnoporus, telle que la laccase Shalocyphina villosa (basidiomycète halophile), * les cinnamoyl estérases A et B dAspergillus niger.17. Expression vector according to claim 15 or 16, characterized in that the determined recombinant protein is a protein corresponding: - to the following endogenous Pycnoporus proteins: * metalloenzymes, such as laccase, or tyrosinase, * or cellobiose dehydrogenase, xylanase, β-glycosidase, invertase, or α-amylase, - with exogenous proteins chosen from the following: * tyrosinases of strains of Pycnoporus different from the strain of Pycnoporus used for the production of said proteins , such as the tyrosinase of Pycnoporus sanguineus when the strain of Pycnoporus used for the production of this tyrosinase is different from Pycnoporus sanguineus, * laccases of basidiomycetes other than Pycnoporus, such as laccase Shalocyphina villosa (basidiomycete halophile), * cinnam A and B of Aspergillus niger.
18. Cellule hôte transformée à l'aide d'un vecteur d'expression selon l'une des revendications 15 à 17.18. Host cell transformed using an expression vector according to one of claims 15 to 17.
19. Cellule hôte selon la revendication 18, correspondant à des cellules monocaryotiques de souches de Pycnoporus, telles que les souches de Pycnoporus cinnabarinus.19. Host cell according to claim 18, corresponding to monocaryotic cells of strains of Pycnoporus, such as strains of Pycnoporus cinnabarinus.
20. Utilisation de vecteurs d'expression selon l'une des revendications 15 à 17, ou de cellules hôtes selon la revendication 18 ou 19, pour la mise en oeuvre d'un procédé de surproduction d'une protéine recombinante déterminée selon l'une des revendications l à 13. 20. Use of expression vectors according to one of claims 15 to 17, or of host cells according to claim 18 or 19, for the implementation of a method of overproduction of a recombinant protein determined according to one of claims l to 13.
EP05717425A 2004-01-15 2005-01-14 Method for overproducing a specific recombinant protein with p. cinnabarinus monokaryotic strains Ceased EP1709180A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0400366A FR2865216B1 (en) 2004-01-15 2004-01-15 PROCESS FOR THE OVERPRODUCTION OF A RECOMBINANT PROTEIN DETERMINED BY MONOCARYOTIC STRAINS OF P. CINNABARINUS
PCT/FR2005/000093 WO2005073381A2 (en) 2004-01-15 2005-01-14 Method for overproducing a specific recombinant protein with p. cinnabarinus monokaryotic strains

Publications (1)

Publication Number Publication Date
EP1709180A2 true EP1709180A2 (en) 2006-10-11

Family

ID=34707878

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05717425A Ceased EP1709180A2 (en) 2004-01-15 2005-01-14 Method for overproducing a specific recombinant protein with p. cinnabarinus monokaryotic strains

Country Status (7)

Country Link
US (1) US8481706B2 (en)
EP (1) EP1709180A2 (en)
JP (1) JP4719690B2 (en)
AU (1) AU2005209453A1 (en)
CA (1) CA2553435A1 (en)
FR (1) FR2865216B1 (en)
WO (1) WO2005073381A2 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2231863B1 (en) 2007-12-14 2011-05-04 Novozymes A/S Process for degrading zearalenone in a feed product employing laccase
WO2009109607A2 (en) * 2008-03-05 2009-09-11 Novozymes A/S Detoxification of feed products
KR20120011025A (en) * 2009-04-24 2012-02-06 삿뽀로 비루 가부시키가이샤 Sparkling alcoholic drink and method for producing same
WO2014100742A2 (en) * 2012-12-21 2014-06-26 The Regents Of The University Of California Modulation of expression of acyltransferases to modify hydroxycinnamic acid content
WO2016097270A1 (en) * 2014-12-19 2016-06-23 Dsm Ip Assets B.V. Process for bleaching a food product

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1295566C (en) * 1987-07-21 1992-02-11 Robert T. Garvin Characterization and structure of genes for protease a and protease b from streptomyces griseus
DE19814853A1 (en) * 1998-04-02 1999-10-21 Consortium Elektrochem Ind Expression system for the production of proteins
JP2001157586A (en) * 1999-12-01 2001-06-12 Iwate Prefecture Promoter gene
AU2003211681A1 (en) * 2002-02-25 2003-09-09 Oji Paper Co., Ltd. Dna fragment having promoter activity

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005073381A2 *

Also Published As

Publication number Publication date
CA2553435A1 (en) 2005-08-11
FR2865216B1 (en) 2006-05-19
FR2865216A1 (en) 2005-07-22
US8481706B2 (en) 2013-07-09
WO2005073381A2 (en) 2005-08-11
AU2005209453A1 (en) 2005-08-11
WO2005073381A3 (en) 2005-11-10
US20080305521A1 (en) 2008-12-11
JP2007518407A (en) 2007-07-12
JP4719690B2 (en) 2011-07-06

Similar Documents

Publication Publication Date Title
EP1828392B1 (en) Production of dicarboxylic acids by improved mutant strains of yarrowia lipolytica
Cai et al. Identifying pathogenicity genes in the rubber tree anthracnose fungus Colletotrichum gloeosporioides through random insertional mutagenesis
JP2001518786A (en) Agrobacterium-mediated transformation of filamentous fungi, especially those belonging to the genus Aspergillus
JPH09503126A (en) Purification ▲ pH ▼ Neutral Rhizoctonia laccase and nucleic acid encoding the same
EP1989310B1 (en) System for producing aromatic molecules by bioconversion
JPH08500733A (en) Fungal promoter active in the presence of glucose
EP1709180A2 (en) Method for overproducing a specific recombinant protein with p. cinnabarinus monokaryotic strains
JP2001025393A (en) Expression system comprising aspergillus
BE1008737A3 (en) Expression system, integration and vector cell transformed by the vector integration.
Alic et al. Genetics and molecular biology of the lignin-degrading basidiomycete Phanerochaete chrysosporium
JP3330941B2 (en) Method for producing heme protein
CN1321196A (en) Fatty acid hydroperoxide lyase nucleic acid sequences
CN107815459A (en) A kind of oyster cap fungus manganese peroxidase enzyme gene and its application
EP1196592B1 (en) Expression system for the production of proteins in fungi
EP1066393B1 (en) Expression system for producing proteins
BE1008738A3 (en) Expression system, integration and vector cell transformed by the vector integration.
US7998721B2 (en) Diglycosidase and gene encoding the same
JP7105815B2 (en) Methods for restoring sexual reproduction in the fungus Trichoderma reesei
DE10046932B4 (en) Expression system for the overexpression of copper-dependent secreted proteins in eukaryotic cells
BE1008267A3 (en) Expression system, integration vector and cell transformed by saidintegration vector
BE1009488A4 (en) Expression system, integration vector and cell converted by said integration vector
CN117286148A (en) Arabidopsis thaliana gene and application thereof in ultra-long chain primary alcohol synthesis
JP4189317B2 (en) Process for producing alcohol from starch
BE1008435A3 (en) Expression system, integration vector and cell transformed by saidintegration vector
CA3182330A1 (en) Method of producing proteins using a trichoderma fungus strain in which the cel1a gene is invalidated

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060711

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20070403

REG Reference to a national code

Ref country code: DE

Ref legal event code: R003

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20140530