JP2001157586A - Promoter gene - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a promoter which commands the transcription of Lentinula edodes tyrosinase, a terminator which commands the termination of the transcription of L. edodes tyrosinase, a recombination vector containing the promoter and/or the terminator, a transformant containing the recombination vector, and to provide a method for producing a polypeptide using the transformant. SOLUTION: The following DNA is provided which can function as a promoter: (a) DNA containing base sequence represented by formula 1 (the detailed structure; refer to the corresponding specification), or (b) DNA which contains a base sequence modified by deleting, substituting, or adding one base or more from, in, or to the base sequence represented by formula 1, both having a promoter activity.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a promoter for directing the initiation of transcription in the tyrosinase gene of Basidiomycete Shiitake, a terminator for directing the termination of transcription of the Shiitake tyrosinase gene, and a recombinant vector containing the promoter and / or the terminator. The present invention relates to a transformant containing the recombinant vector, and a method for producing a polypeptide using the transformant.

[0002]

2. Description of the Related Art Recent advances in recombinant DNA technology have
A host vector system for heterologous gene expression using various cells such as Escherichia coli, Bacillus subtilis, actinomycetes, yeast, filamentous fungi, animal cells, and plant cells as hosts has been developed. For example,
To date, various useful substances such as insulin, growth hormone, and interferon have been produced using an Escherichia coli host vector system. Moreover, in plant breeding, gene transfer from a heterologous organism beyond a species that was impossible with the conventional classical crossing method is performed by Agrobacterium tumefaciens .
Transgenic plants having desired properties have been produced by using a host vector system such as Ti plasmid.

[0003] Among the above host vector systems, the Escherichia coli host vector system which has been most practically used so far. However, when Escherichia coli is used as a host to produce a polypeptide derived from a higher animal such as a human, no sugar chain is added to the produced polypeptide or the polypeptide chain folds into its original higher-order structure.
g) It often does not show the original physiological activity, for example, because it is not done. Furthermore, Escherichia coli produces various toxic substances other than the polypeptide in the process of producing the target polypeptide, and thus has a problem that a multi-step purification process is required.

[0004] Therefore, in order to solve these problems, a host vector system using a eukaryotic cell such as a yeast cell or an animal cell as a host having a sugar chain addition function and a proper folding function has been developed. However, when a yeast cell is used to produce a polypeptide derived from a higher animal such as a human, a high-mannose-type sugar chain different from that derived from a human may be added, or production of the target polypeptide. Is low. On the other hand, even when animal cells are used, there are many problems such as the extremely low yield of the target product and the necessity of using an expensive medium. From such a viewpoint, there has been a demand for a host vector system satisfying such requirements that a sugar chain equivalent to that of a higher animal cell is added, culture can be performed at low cost, and safety is high. By the way, basidiomycetes are generally closer to animals than yeast [TL Smith: Proc. Natl. Acad.
i. USA, 86: 7063 (1989)], it seems to have an appropriate glycosylation function and an appropriate folding function. In particular, shiitake mushrooms ( Lentinula edodes ) have been used for food for many years and are excellent in safety.

[0005] Technological development of transformation of edible basidiomycetes belonging to Shiitake mushrooms by genetic engineering formulation has been reported by Mira.
nda D. et al. transformed mushrooms by electroporation [Miranda D. van de Rhee, et.
Mol. Gen. Genet., 250, 252-258, (1996)], Ming Peng
Transformed Pleurotus ostreatus by electroporation [Peng, M., et.al., Curr. Genet., 22, 53-59, (19
92)], and transformation of Oyster mushroom by the polyethylene glycol method [Yanai, K. et. Al., Biosc.
i. Biotech. Biochem., 60, 472-475 (1996)], and Noёl et al. reported the transformation of F. mushroom by the polyethylene glycol method [Noёl, T and Labarere, J.,
Curr. Genet., 25: 432-437 (1994), Noёl, T. et a
l., Theor. Appl. Genet., 90: 1019-1027 (1995)].

[0006] No effective mushroom host vector system has been established. One of the reasons is that there is no recombinant expression vector capable of efficiently expressing a heterologous gene in Shiitake mushroom. As a recombinant vector for expression of a shiitake mushroom host, shiitake ras
PLC vector using a gene promoter and a PriA gene terminator [Yanai et. Al., Biosci. Biot.
ech. Biochem., 60, 472-475, 1996, JP-A-6-319.
547, Yanai et al., Proceedings of the 1995 Annual Meeting of the Japanese Society of Agricultural Chemistry, p230]. However, when Lentinus edodes is transformed using this vector, the transformation efficiency is extremely low (all of them are 0.1 or less per microgram DNA), so that it has not been widely used.

In general, it is necessary to use a promoter having a high transcription efficiency for mRNA in order to construct an expression vector which can provide a higher expression level. In recent years, we have studied diligently and developed an effective shiitake mushroom transformation method and an expression vector (Sato et al., JP-A-11-155).
568, Hirano et al., Japanese Patent Application No. 10-247470).

[0008] On the other hand, a promoter that is specifically expressed at a specific growth stage is considered to be an important factor depending on the gene to be expressed. In particular, a promoter expressed after fruiting body formation is considered to be effective and important for expressing useful gene products such as functional proteins. We have already developed the tyrosinase gene (Japanese Unexamined Patent Publication No.
74586) were found to be expressed in large amounts later in fruiting body formation (Kanda. Et. Al.,
Biosci. Biotech. Biochem., 60, 479-480, 1996; Sato et al., Proceedings of the 1999 Annual Meeting of the Japanese Society of Agricultural Chemistry, p. 214).
Therefore, the promoter and terminator regions of the shiitake tyrosinase gene are considered to be useful as specific expression vectors. However, a promoter of a tyrosinase gene derived from shiitake mushroom and a recombinant vector containing the promoter have not been known so far.

[0009]

DISCLOSURE OF THE INVENTION The present invention relates to a promoter for directing the initiation of transcription of a shiitake tyrosinase gene, a terminator for directing the termination of transcription of a shiitake tyrosinase gene, and a recombinant vector containing the promoter and / or the terminator. It is an object of the present invention to provide a transformant containing the recombinant vector, and a method for producing a polypeptide using the transformant.

[0010]

Means for Solving the Problems The present inventors have conducted intensive studies in order to solve the above problems, and as a result, have isolated a tyrosinase gene from cDNA and genomic DNA libraries prepared from Shiitake mushroom hypha, and furthermore, their promoters. Successful isolation of the region and the terminator region led to the completion of the present invention.

[0011] That is, the present invention relates to the following (a) or (b):
Provide A. (A) DNA containing the nucleotide sequence represented by SEQ ID NO: 1. (B) a DNA comprising a base sequence in which at least one base is deleted, substituted or added in the base sequence represented by SEQ ID NO: 1 and having promoter activity. Further, the present invention relates to a DNA which hybridizes with the DNA under stringent conditions and has a promoter activity.
Provide NA.

Further, the present invention provides the following (c) or (d)
And DNA that can function as a terminator. (C) DNA containing the base sequence represented by SEQ ID NO: 2. (D) a DNA comprising a base sequence in which at least one base is deleted, substituted or added in the base sequence represented by SEQ ID NO: 2, and having a terminator activity. Further, the present invention provides a DNA that hybridizes with the above DNA under stringent conditions and has a terminator activity.

Further, the present invention provides a recombinant vector for expression containing the DNA capable of functioning as the above-mentioned promoter and / or the DNA capable of functioning as the above-mentioned terminator. Furthermore, the present invention provides a recombinant vector in which a gene encoding any polypeptide is incorporated into the above-mentioned recombinant vector for expression.

Further, the present invention provides a transformant containing the recombinant vector for expression. Further, the present invention provides
Provided are a transformant containing the recombinant vector, and a method for producing the polypeptide, which comprises culturing or cultivating the transformant and collecting the polypeptide from the resulting culture or cultivation.

[0015]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail. 1. Isolation of the promoter region and terminator region of Shiitake tyrosinase gene The promoter of the present invention was isolated from the 5 'upstream region of the Shiitake tyrosinase gene, and the terminator was isolated from the 3' downstream region of the Shiitake tyrosinase gene. It was done.

The promoter and terminator of the present invention are the shiitake tyrosinase gene (Japanese Patent Laid-Open No. 10-174).
586) Sequence determination of cDNA, preparation of shiitake mushroom genomic DNA library, isolation of shiitake tyrosinase gene genomic DNA from the library, sequencing of the genomic DNA, comparison of promoter region and terminator region by sequence comparison between cDNA and genomic DNA Identification and isolation of these regions. Hereinafter, each step will be described.

(1) Preparation of mRNA and Preparation of cDNA mRNA is extracted from Lentinula edodes . mRNA extraction can be performed by a known method, for example, oligo (d
T) Cellulose column method, magnetite oligo (dT) particle method, or Novagen's Straight A's ^TM
This can be performed using the mRNA Isolation Kit. mRN
The tissues used for the extraction of A include, for example, fruiting bodies, hyphae, and the like.

Next, these tissues are frozen, ground in the presence of liquid nitrogen, and an RNA extract is added to obtain a crude extract of total RNA. Furthermore, proteins, polysaccharides, and other impurities are removed, and further purified using magnetite oligo (dT) particles. The poly A (poly A +) chain fraction is eluted, the eluate is collected, and the mRNA is highly concentrated by repeating the same purification 2-3 times. On the other hand, two types of degenerate oligonucleotide primers synthesized from the partial amino acid sequence of Shiitake tyrosinase are designed.

Using the mRNA purified as described above as a template, RT-PCR is performed using degenerate oligonucleotide primers, a partial nucleotide sequence of the obtained Shiitake tyrosinase gene is cloned, and the nucleotide sequence is analyzed. For analysis of the nucleotide sequence, for example, ABI PRISM Dy
e Terminator Cycle Sequencing Ready Reaction kit,
It can be performed using FS (Perkin Elmer). RT-
Based on the base sequence of the PCR product, a primer specific to the shiitake tyrosinase gene is synthesized again.

Using the primers described above, the partial base sequences at the 5 ′ end and the 3 ′ end of the shiitake tyrosinase gene are amplified by the RACE method. The RACE method is, for example, 5 'RACE Syste
m for Rapid Amplification of cDNA Ends and 3 'RACE
System for Rapid Amplification of cDNA Ends (Gibc
oBRL).

The partial base sequence of the shiitake tyrosinase gene amplified by the RACE method is inserted into a plasmid vector, and then cloned by transformation. Cloning of the RACE product can be performed, for example, using the Original TA Cloning Kit (Invitrogen).

(2) Preparation of Probe DNA Two types of degenerate oligonucleotide primers (N primer and C primer) are synthesized from the partial amino acid sequence of tyrosinase isolated and purified from Shiitake mushroom.

N primer: 5'-T (C / T) CA (A / G) AT (A / C / T)
GG (A / C / G / T) GG (A / C / G / T) AT (A / C / T) CA (C / T) GG-3 '(SEQ ID NO: 6) C primer: 5'-( (A / G) (A / C / G / T) C (G / T) (A / G) TC (A / C / G /
T) AC (C / T) TG (A / C / G / T) GC (A / G) TG (A / G) TG-3 '(SEQ ID NO: 7)

RT-PCR is performed using these two kinds of oligonucleotide primers, and the obtained DNA fragment is purified, followed by cloning and sequencing. Two kinds of primers (N> GL.SQ01 primer and GL <C.SQ01 primer) are synthesized again based on the obtained base sequence.

N> GL.SQ01 primer: 5'-GCGCAGGAAATAAG
CCAGTAGACAC-3 '(SEQ ID NO: 8) GL <C.SQ01 Primer: 5'-GCGTGGTGCATAAAGAAAAT-3'
(SEQ ID NO: 9)

Obtained using the above two types of primers
After purifying the 650 bp RT-PCR product, it is cloned. For cloning, for example, Original TA Cloning ki
t (Invitrogen). After preparing a plasmid from the resulting clone, the insert (RT-PCR product) is recovered by Eco RI digestion and used as a probe.

(3) Screening from RACE product From the cloned RACE product, a clone having a partial base sequence of the tyrosinase gene is screened.
The screening is performed by, for example, a colony hybridization method using the above-mentioned probe or a PCR method using the above-mentioned two kinds of primers.

(4) Sequencing of RACE product For the nucleotide sequence of the RACE product, a plasmid was prepared from the clone obtained in the above (3), and a commercially available kit ABI P
RISM Dye Terminator Cycle Sequencing Ready Reacti
It can be determined using on Kit, FS (manufactured by Perkin Elmer).

The tyrosinase gene cDNA is shown in SEQ ID NO: 3.
However, as long as the sequence essentially expresses tyrosinase activity, it is not limited to this sequence, deletion,
The nucleotide sequence can be mutated by substitution, insertion, addition, or the like.

(5) Preparation of Shiitake Mushroom Genomic DNA and Genomic DNA Library The source of the genomic DNA is the same as in the above (1), such as shiitake umbrella, fungus fold, fungus ring, fungi, leg bract, hypha, etc. It may be a part of the fruiting body or the whole fruiting body. After spores or primary hyphae or secondary hyphae are cultured in a solid medium such as 0.25 × MYPG medium, SMY medium, or glucose / peptone medium, the mycelium is inoculated into a liquid medium, and the grown cells can be used.

Preparation of genomic DNA can be performed by a commonly used technique. For example, the cells of shiitake mushrooms cultured in liquid are collected by filtration or the like, and then the cells are frozen with liquid nitrogen, and the frozen cells are ground using a mortar. A buffer for DNA extraction is added to the ground cells, chloroform is added, and the mixture is vigorously stirred. After the chloroform is removed, ethanol is gradually added to the aqueous layer, and when the DNA precipitates, the genomic DNA is wound up and dissolved in a TE buffer to obtain a genomic DNA solution. Alternatively, genomic DNA can be obtained from the ground cells using a commercially available kit (for example, ISOPLANT (Nippon Gene)).

To prepare a genomic DNA library, genomic DNA is digested with a restriction enzyme such as Sau3AI, treated with phenol / chloroform, and then a DNA fragment is recovered by ethanol precipitation. Then, a commercially available kit (eg, Lambda Using EMBL3 / Bam HIVector Kit (Stratagene)), the fragment is ligated to, for example, λ EMBL3-Bam HI arm using T4 DNA ligase, and the resulting phage DNA is prepared by infecting Escherichia coli. Can be.

(6) Isolation of Genomic Tyrosinase Gene The genomic tyrosinase gene can be screened from a genomic DNA library by a conventional method (eg, PCR, plaque hybridization, etc.). That is, a method for screening from a shiitake mushroom genomic DNA library using the tyrosinase cDNA fragment as a probe and the like can be mentioned.

This fragment was directly labeled with an enzyme such as peroxidase or alkaline phosphatase or radioactively labeled with ³² P, ³⁵ S or the like, and then used as a probe. These were used as a nitrocellulose filter or a nylon membrane filter in which DNA of a phage library was denatured and fixed. Let it hybridize. Then, a phage clone is identified from the obtained positive signal, and a tyrosinase gene of Shiitake can be cloned.

The nucleotide sequence of the positive clone obtained as described above was determined by ABI PRISM Dye Terminator Cycle Seqeuen.
It can be determined using a commercially available kit such as cing Ready Reaction Kit, FS (manufactured by Perkin Elmer). PCR
The reaction was performed according to the manual attached to the kit,
The obtained PCR product is ABI PRISM 310 Genetic Analyzer
(Perkin Elmer) and the like. As the total base sequence determined in this way, for example, the one represented by SEQ ID NO: 5 can be mentioned.
This sequence is the base sequence of genomic DNA containing the tyrosinase gene. From the comparison of this sequence with the nucleotide sequence of cDNA containing the tyrosinase gene of SEQ ID NO: 3, the analyzed tyrosinase gene was divided into nine exons having eight introns (linear portions) as shown in FIG. It can be seen that it exists above.

(7) Isolation of the promoter region and the terminator region of the tyrosinase gene The isolation of the promoter region and the terminator region of the tyrosinase gene is carried out at a region of about 2.6 kbp upstream and about 1 kbp downstream of the tyrosinase gene containing the respective regions. By using a primer synthesized based on the nucleotide sequence determined in (6) above and amplifying by PCR using as a template a genomic tyrosinase gene, shiitake chromosomal DNA or the like cloned from a genomic library. Here, as a primer that can be used for PCR for isolating the promoter region, for example, 5′-ATTCCAAGCCTGTATTCCCTCCTATCG-3 ′
5 ′ sense primer (also referred to as TproU primer) and 5′-CTCTGTGAAA represented by the nucleotide sequence of (SEQ ID NO: 10)
ACAAATCGGTGTGTGGGG-3 '(SEQ ID NO: 11) 3' antisense primer (also referred to as TproL primer) represented by the nucleotide sequence. Further, as a primer that can be used for PCR for terminator region isolation, for example, 5'-GGAATTCGAATGAACTATCGCGATAAATAAATAAT
5 'sense primer (also referred to as TterU primer) represented by the nucleotide sequence of GT-3' (SEQ ID NO: 12) and 5'-AGCTTC
A 3 ′ antisense primer (also referred to as a TterL primer) represented by the nucleotide sequence of TGCCCTCTTCTGCCGTCCTTA-3 ′ (SEQ ID NO: 13) is included.

SEQ ID NO: 1 shows the nucleotide sequence of the DNA fragment having the promoter activity of the present invention, and SEQ ID NO: 2 shows the nucleotide sequence of the DNA fragment having the terminator activity of the present invention. In the latter case, a mutation such as deletion, substitution, or addition of at least one base may occur in the base sequence as long as the base sequence has terminator activity. Here, the deletion, substitution and addition means not only 1 to 10 short deletions, substitutions and additions but also 10
Long deletions, substitutions and additions of up to 50 bases, and even 50 to 100 bases are included.

[0038] The promoter gene or terminator gene of the present invention also includes a DNA that hybridizes with the above promoter gene or terminator gene under stringent conditions and has promoter activity. The stringent conditions are, for example, a sodium concentration of 10 mM to 300 mM, preferably 20 to 100 mM,
This refers to conditions at a temperature of 25 ° C to 70 ° C, preferably 42 ° C to 55 ° C.

To introduce a mutation into DNA, use Kunk
A known method such as an el method or a gapped duplex method or a method analogous thereto can be employed. For example, a mutagenesis kit using site-directed mutagenesis (for example, Mutant
-K or Mutant-G (TaKaRa)) or
Mutations can be introduced using the TaKaRa LA PCR in vitro Mutagenesis series kit.

Once the nucleotide sequence of the DNA fragment of the present invention has been determined, it is then subjected to chemical synthesis, PCR using a cDNA or genomic DNA containing the DNA fragment of the present invention as a template, or having the nucleotide sequence. D
The DNA fragment of the present invention can be obtained by hybridization using the NA fragment as a probe.

2. Construction of the recombinant vector for expression of the present invention The recombinant vector for expression of the present invention is different from the conventional shiitake mushroom expression vector in that An expression vector incorporating the tyrosinase gene promoter and / or the tyrosinase gene terminator obtained in (1). The recombinant vector for expression of the present invention comprises the above promoter and / or terminator in an appropriate plasmid vector (for example,
(pUC19 vector, etc.).

It is desirable that the recombinant vector for expression is used in combination with a marker gene which is effective for actually confirming the introduction of a foreign gene. Therefore, the recombinant vector for expression of the present invention includes, for example, a hygromycin B phosphotransferase (hph) gene [Griz and Davis, Gene, 2] which confers resistance to the antibiotic hygromycin B downstream of the promoter region of the tyrosinase gene.
5: 179-188 (1983)], a phosphinothricin acetyltransferase (bar) gene that confers resistance to the herbicide bialaphos [Murakami et al., Mol. Gen. Ge.
net., 205: 42-50 (1986)]. The thus produced recombinant vector for expression can be introduced into shiitake mushroom by various gene transfer methods such as PEG method, electroporation method and REMI method, and a transformant can be obtained by using the resistance to the drug as an index.

3. Production of Polypeptide Using the Recombinant Expression Vector of the Present Invention Using the recombinant vector for expression of the present invention, a desired polypeptide can be obtained by genetic engineering in Shiitake mushroom.

The above 2. Ligation (insertion) of a gene encoding a target polypeptide, for example, a useful protein such as insulin, growth hormone, tyrosinase, laccase, peroxidase, etc., into a recombinant vector for expression of
By doing so, a recombinant vector can be prepared. As a method for inserting a gene encoding a polypeptide of interest into the vector of the present invention, the purified DNA is cleaved with an appropriate restriction enzyme and inserted into a restriction enzyme site or a multiple cloning site of the vector of the present invention. And the like. The obtained recombinant vector was used for shiitake mushrooms by PEG method, electroporation method, R
A transformant can be obtained by introduction by a method such as the EMI (Restriction Enzyme-Mediated Integration) method.

Next, the target polypeptide can be obtained by culturing the obtained transformant and collecting it from the culture.

In the present invention, the method of culturing the mycelium of the transformant is carried out according to the usual method used for cultivating shiitake mushrooms. As a medium for culturing a transformant obtained using Shiitake mushroom as a host, a carbon source that can be utilized by Shiitake mushroom, a nitrogen source, a medium containing inorganic salts, etc., as long as the medium can efficiently culture the transformant, Either a natural medium or a synthetic medium may be used.

As the carbon source, carbohydrates such as glucose, fructose, sucrose, starch, maltose and dextrin are used. As the nitrogen source, ammonia, ammonium chloride, ammonium sulfate, ammonium nitrate, inorganic salts such as ammonium phosphate or ammonium salts of organic acids or other nitrogen-containing compounds,
Peptone, meat extract, corn steep liquor, casamino acid, NZ amine and the like are used.

As the inorganic substance, potassium (I) phosphate, potassium (II) phosphate, calcium chloride, magnesium sulfate, sodium carbonate, ferrous sulfate, zinc sulfate, manganese chloride, calcium carbonate and the like are used.

The cultivation of the hypha is preferably carried out at 25 ° C. for several days to about two months under aerobic to microaerobic conditions such as shaking culture in a liquid medium, aeration and stirring culture, and static culture in a solid medium. .
The subculture can be performed by inoculating a part of the grown hypha into a new medium. During the culture, an antibiotic such as hygromycin or bialaphos may be added to the medium as needed.

When the polypeptide of interest is produced in shiitake mushroom fruit bodies, shiitake mushroom strains can be used to establish fruit bodies. Examples of a method for setting up shiitake mushroom fruit bodies include bacterial bed culture.

In order to carry out bacterial bed culture, first, an inoculum is prepared. Here, the “seed fungus” is used as a seed in shiitake mushroom cultivation and refers to a cell or a culture that is purely cultured under appropriate conditions. Examples of such inoculum include a liquid inoculum prepared in a liquid medium, a liquid inoculum obtained by fragmenting hyphae, an inoculum prepared in an agar medium, and a sawdust spp.

The preparation of the inoculum can be performed using a known method, and the method is not particularly limited.
As an example, an example using a sawdust seed culture method will be described. The medium is prepared by mixing sawdust and rice bran at a ratio of 10: 1 to a water content of 63%. This is filled into a polypropylene incubator (800 ml) in an amount of 500 g, covered, and sterilized by autoclaving at 121 ° C. for 40 minutes. After cooling to room temperature, the shiitake mushroom strain is inoculated and cultured. Culture conditions are not particularly limited, since those skilled in the art can appropriately set the conditions. Such culture can be performed, for example, by culturing at 20 ° C. and a relative humidity of 65% for about 50 days.

Next, a bacterial bed culture is carried out using the inoculum obtained as described above. Here, the “bacterial bed” refers to a medium prepared for the purpose of cultivating shiitake mushrooms, inoculated with a seed bacterium, or a bacterium spread. This bacterial bed culture can be appropriately performed by those skilled in the art, and the method is not particularly limited, but the following method can be mentioned as an example.

Sawdust: The water content of the culture medium consisting of Hokuken Weidel (10: 1) is adjusted to 63%, and 2.5 kg of the culture medium is packed in a polypropylene bag with a filter to form a rectangular parallelepiped (density 0.7 g / cm). Drill a 2cm diameter hole in the center of the medium until it reaches the bottom, and in an autoclave,
Sterilize at 121 ° C for 40 minutes and allow to cool at room temperature overnight to use as the culture medium. About 17 g of the above sawdust seed bacteria is inoculated into this culture medium, and the bag is quickly closed with a heat sealer. This is cultured in the dark at 20 ° C. and a relative humidity of 65%. This culture is performed until the mycelium spreads over the entire surface of the microbial bed and is completely ripe.
2 to 116 days.

Finally, fruiting bodies are generated from the bacterial bed obtained by the above-described bacterial bed culture. Since this operation can be appropriately performed by those skilled in the art, the method is not particularly limited, but examples include the following methods.

The bag that has been completely mature-cultured is opened, the bacterial bed is taken out, and fruiting bodies are generated and harvested under the conditions of a temperature of 16 ° C., a humidity of 85%, and an illuminance of 300 lux (every 12 hours). The period from the emergence of the fruiting body to the harvest is particularly referred to as the “generation period”, but this generation period is not particularly limited since a person skilled in the art can appropriately set the period. After completion of the development, after a water immersion treatment (about 20 hours), culture for the development is performed again to perform the second generation. Further, after the harvest, the submergence treatment is performed again, and the fruiting body can be generated similarly to the second time.

After the culturing, if the desired polypeptide is produced in the cells or fruiting bodies, the cells or fruiting bodies are disrupted. On the other hand, when the target polypeptide is secreted out of the cells, the liquid culture solution is used as it is, or the cells are removed by centrifugation or the like to obtain a supernatant. Then, by using a general biochemical method used for isolation and purification of the polypeptide, for example, ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc., alone or in appropriate combination, the above culture The target polypeptide can be isolated and purified therefrom.

[0058]

The present invention will be described more specifically with reference to the following examples. However, these examples are for explanation, and do not limit the technical scope of the present invention.

[Example 1] Isolation of promoter region and terminator region of shiitake tyrosinase gene (1) Preparation of shiitake mycelium
× MYPG agar medium (0.25% malt extract, 0.1% yeast extract, 0.1% peptone, 0.5% glucose, 1.5% agar) was inoculated and cultured at 25 ° C for about 2 weeks. The grown mycelium was scraped off the agar medium and inoculated into a 200 ml Erlenmeyer flask containing 100 ml of 0.25 × MYPG liquid medium. 25 ° C after inoculation
For about 2 to 4 weeks with shaking to grow mycelia.

(2) Shiitake mushroom fruit body collection Fruit body formation was determined by T. Matsumoto et al., Rept. Tot.
Tori Mycol. Inst., 26, 46-54 (1988)), harvest the fruiting body in which the coating on the bottom of the fungus began to be cut off, and stored at 25 ° C for 3 days before browning. Total RNA was extracted from the fungal fold.

(3) Extraction of Total RNA Extraction of total RNA from a sample was performed according to the protocol of ISOGEN (Nippon Gene). As a result, 0.5 mg of purified total RNA was obtained from 1 g of the sample. (4) Preparation of mRNA Straight A's ^™ mRNA Isolation for 0.5 mg of RNA
Using the Kit (Novagen), Anneal Magnetight ^TM Oli
mRNA was purified by performing an affinity purification method using go (dT) Particles. Finally 27 μg mR
NA was purified.

(5) Preparation of cDNA For preparation of cDNA from mRNA, SuperScript II ^™ RNase H-Reverse Transcriptase was used as a reverse transcriptase.
(GibcoBRL) was used. The reaction is carried out at 42 ° C according to a standard method.
The reaction was carried out for 60 minutes, and the reaction was stopped by heating at 95 ° C. for 10 minutes.
CDNA was purified and isolated from the reaction solution by a conventional method.

(6) Preparation of partial sequence of Shiitake tyrosinase gene Partial amino acid sequence of Shiitake tyrosinase (K. Kanda e
t al., Biosci. Biotech. Biochem., 60, 1273-1278
(1996)), two types of degenerate oligonucleotide primers (N primer and C primer) were synthesized.

N primer: 5'-T (C / T) CA (A / G) AT (A / C / T)
GG (A / C / G / T) GG (A / C / G / T) AT (A / C / T) CA (C / T) GG-3 '(SEQ ID NO: 6) C primer: 5'-( (A / G) (A / C / G / T) C (G / T) (A / G) TC (A / C / G /
T) AC (C / T) TG (A / C / G / T) GC (A / G) TG (A / G) TG-3 ′ (SEQ ID NO: 7)

Using these degenerate oligonucleotide primers, PCR was performed using the above cDNA as a template. The reaction was performed for 30 minutes, with the reaction at 94 ° C. for 1 minute, 50 ° C. for 1 minute, and 72 ° C. for 2 minutes as one cycle. The obtained 700 bp RT-PCR product was purified according to a conventional method, and then cloned.

(7) Sequencing of RT-PCR product Regarding the nucleotide sequence of the RT-PCR product, a plasmid was prepared from the clone obtained in the above (6) using the RPM Kit (Bio101), and this plasmid was used as a template for ABI. PR
ISM ^TM Dye Terminator Cycle Sequencing Ready Reacti
Sequencing was performed by the Primer Walking method using on Kit, FS (Perkin Elmer), and the nucleotide sequence was determined. Two types of primers (N> GL.SQ01 primer and GL <C.SQ01 primer) specific to the shiitake tyrosinase gene were synthesized again from this nucleotide sequence.

N> GL.SQ01 primer: 5'-GCGCAGGAAATAAG
CCAGTAGACAC-3 '(SEQ ID NO: 8) GL <C.SQ01 Primer: 5'-GCGTGGTGCATAAAGAAAAT-3'
(SEQ ID NO: 9)

(8) Preparation of the base sequence at the 5 ′ end of the shiitake tyrosinase gene by the RACE method Using the GL <C.SQ01 primer, the 5 ′ RACE System for Rapid Amplificati
Using on of cDNA Ends (GibcoBRL), the nucleotide sequence at the 5 'end of the shiitake tyrosinase gene was amplified according to the protocol of the kit. The obtained 5'RACE product was purified according to a conventional method, and then cloned.

(9) Preparation of base sequence at 3 'end of shiitake tyrosinase gene by RACE method Using N> GL.SQ01 primer, 3' RACE System for Rapid Amplification
The base sequence of the shiitake tyrosinase gene on the 3 'end side was amplified using the cDNA of Ends (GibcoBRL) according to the protocol of the kit. The obtained 3'RACE product was purified according to a conventional method, and then cloned.

(10) Preparation of Probe DNA Using the cDNA prepared in the above (4) as a template, two kinds of primers synthesized in the above (7) (N> GL.SQ01 primer and GL <C.SQ01 primer) were used. PCR was performed. The reaction was performed for 30 cycles at 94 ° C. for 30 seconds, 60 ° C. for 30 seconds, and 72 ° C. for 1 minute. The obtained 650 bp PCR product was purified according to a conventional method, and then cloned. After preparing a plasmid from the resulting clone, the insert was recovered by digestion with Eco RI and used as probe DNA.

(11) Screening of RACE Product Having Partial Nucleotide Sequence of Shiitake Tyrosinase Gene From the clone having the RACE product prepared in (8) and (9) above, colony hybridization was performed using the probe prepared in (10) above. A clone having a partial base sequence of the shiitake tyrosinase gene was screened by a hybridization method.

(12) Sequencing of RACE Product Having Shiitake Tyrosinase Gene Partial Nucleotide Sequence The nucleotide sequence of the RACE product was analyzed according to the method described in (7) above. Since both the 5 ′ RACE product and the 3 ′ RACE product have a nucleotide sequence of 650 bp specific to the shiitake tyrosinase gene obtained in (10) above, the entire nucleotide sequence of the shiitake tyrosinase gene is determined based on this sequence. Were determined. The determined nucleotide sequence is shown in SEQ ID NO: 3.

CDN encoding shiitake tyrosinase
The nucleotide sequence of A comprises the nucleotide sequence of SEQ ID NO: 3, and a single open reading frame terminating at the 1875-1877th TAA from the methionine encoded by the 21-23rd nucleotide sequence. (618 amino acid residues)
Existed. The amino acid sequence encoded by this open reading frame is shown in SEQ ID NO: 4. In addition, an untranslated region of 20 bases (first to twentieth base sequences) was present upstream of this open reading frame.

Furthermore, since a poly (A) region exists downstream of the open reading frame, this cDN
A can be said to be full length. From these nucleotide sequences, it is estimated that the number of amino acid residues of tyrosinase obtained from Shiitake mushroom is 618 and its molecular weight is 68 kDa.

The amino acid sequence region of the shiitake tyrosinase thus obtained was obtained by combining Aspergillus oryzae , Neurospora crassa and mushroom ( A )
garicus bisporus ) has a homology of 36.3%, 30.8% and 54.0%, respectively, but differs in a considerable part, so that the bases represented by SEQ ID NOs: 3 and 4 are obtained. The sequence and amino acid sequence were shown to be unique to Shiitake.

(13) Preparation of Shiitake Mushroom Genome Library The mycelium grown by liquid culture was collected with a glass filter, and the hypha was squeezed as much as possible with a paper towel. About 1 g of the collected mycelium was placed in a mortar, and an appropriate amount of liquid nitrogen was added to grind. The ground mycelium was transferred to a 50 ml polypropylene tube, and 20 ml of TESS buffer (0.73 M sucrose, 10 mM Tris-HCl buffer (pH 8.0), 1 mM EDTA (pH
8.0), 1% SDS) and incubated at 65 ° C for 1 hour. To this was added 5M NaCl to a final concentration of 1M, and the mixture was centrifuged at 8,000 xg for 20 minutes to recover the supernatant. Add an equal volume of phenol / cresol reagent (100 g
The phenol was added with 4.7 ml of m-cresol and dissolved at 50 ° C., and 8-quinolinol was added thereto at 0.05%, and the mixture was equilibrated with an equal volume of 1M NaCl).
, And centrifuged at 1,300 xg for 5 minutes to collect a supernatant (aqueous layer). Further, the mixture was subjected to chloroform treatment and ethanol precipitation, and dissolved in 1 ml of TE buffer. RNase
The mixture was treated with A and proteinase K, subjected to phenol / chloroform treatment and ethanol precipitation, dissolved in an appropriate amount of TE buffer, and used as a chromosomal DNA sample.

The obtained DNA sample was digested with the restriction enzyme Sau 3AI, treated with phenol / chloroform, precipitated with ethanol, and dissolved in an appropriate amount of TE buffer. Using the obtained DNA fragment, Lambda EMBL3 / Bam HI Vector K
A genomic DNA library was prepared using it (Stratagene).

(14) Isolation of Tyrosinase Gene from Genomic Library From the genomic library prepared in (13), a tyrosinase gene was isolated in substantially the same procedure as in (7). Plaque formation and library amplification were performed using the E. coli XL1-blue MRA strain using Lambda EMBL3 /
Plaque hybridization and signal detection were carried out in the same procedure as in the isolation of tyrosinase from the cDNA library, based on the manual of the Bam HI vector kit (Stratagene). Then, the plaque near the obtained signal was scraped off, and it was removed using SM buffer (100m
M NaCl, 100 mM MgSO ₄ , 50 mM Tris-HCl, pH 7.5, 0.01%
(Including gelatin). This phage suspension was diluted appropriately, plated, and screened in the same manner as above to obtain a recombinant phage containing a genomic tyrosinase gene. Each cloned phage was plated and incubated at 37 ° C. for 6-8 hours to form plaques. The plaque-formed plate was overlaid with 10 ml of the SM buffer, and cultured with shaking at 4 ° C. for 12 hours or more to release the phage into the SM buffer. Collect the SM buffer containing the phage in a 15 ml propylene tube, add chloroform to a final concentration of 5%, leave at room temperature for 15 minutes, centrifuge it at 1,500 × g for 10 minutes, and collect the supernatant did. Next, Wizard Lambda Preps DNA Puri
The phage DNA was purified from the collected supernatant using a fication System (manufactured by Promega) and subjected to nucleotide sequence determination.

(15) Determination of Nucleotide Sequence The nucleotide sequence of the positive clone obtained in (14) above was determined by ABI PRISM Dye Terminator Cycle Sequencing Rea
It was determined using dy Reaction Kit, FS (manufactured by Perkin Elmer). The PCR reaction is performed based on the manual,
The obtained PCR product is ABI PRISM 310 Genetic Analyzer
(Perkin Elmer). The determined nucleotide sequence of the genomic DNA containing the tyrosinase gene is shown in SEQ ID NO: 5. From the comparison with SEQ ID NO: 3, which is the nucleotide sequence of the cDNA containing the tyrosinase gene, the analyzed tyrosinase gene is divided into nine exons having eight introns (linear portions) as shown in FIG. I found that.

[Example 2] Construction of pLT-hph vector (1) Isolation of tyrosinase gene promoter region Base sequence of isolated tyrosinase gene (SEQ ID NO: 5)
Of these, the translation initiation codon (positions 2656 to 2658 in SEQ ID NO: 5)
In the region of about 2.6 kb in the 5 'upstream region including bases, specific base sequences found in various promoters (TATA box, CAAT
box etc.) existed. Therefore, this region was regarded as a promoter region, and PCR was performed using the genome tyrosinase gene as a template to prepare a large amount of the tyrosinase gene promoter region.

As a 5 'sense primer (also referred to as a TproU primer), a sequence 5'-ATTCCAAGCCTGTATTCCCTCCTATCG-3' existing at a position between -2647 and -2621 bp from the translation initiation point.
(3) antisense primer (also referred to as TproL primer) having a sequence of -38 to -10 bp from the translation initiation site and having a sequence of 5'-CTCTG
The one having TGAAAACAAATCGGTGTGTGGGG-3 ′ (SEQ ID NO: 11) was used. The composition of the reaction solution for PCR is as follows.

[0082]

[Table 1]

PCR was performed by heat denaturation at 96 ° C. for 30 seconds,
The conditions of annealing for 2 seconds and extension reaction at 72 ° C. for 2 minutes were defined as 1 cycle, and 30 cycles were performed. After completion of the reaction, transfer the reaction solution to a new microtube, of which 5 μl
Was subjected to 1% agarose gel electrophoresis to confirm the amplified fragment. Then, add phenol
After performing chloroform treatment and ethanol precipitation, the pelleted PCR product was dissolved in 20 μl of TE buffer.

The obtained PCR product was subjected to 1% low melting point agarose gel electrophoresis to cut out a fragment of about 2,650 bp. The fragment was extracted from the gel using QIAEX II (manufactured by QIAGEN), and the tyrosinase gene promoter having the nucleotide sequence represented by SEQ ID NO: 1 was purified.

(2) Isolation of the terminator region of the tyrosinase gene 3 ′ containing the translation termination codon (bases 4972 to 4974 in SEQ ID NO: 5) of the isolated tyrosinase gene (SEQ ID NO: 5)
A region of about 1 kb in the side downstream region was regarded as a tyrosinase gene terminator region, and PCR was performed using the genomic tyrosinase gene as a template.

As a 5 'sense primer (also referred to as a TterU primer), a sequence 5'-GGAATTCGAATGAACTATCGCGATAAATAAATAATGT- which exists at a position 14 to 51 bp from a stop codon.
Using a 3 ′ (SEQ ID NO: 12), 3 ′ antisense primer (also referred to as TterL primer)
Sequence 5'-AGCT existing 96-988 bp from the stop codon
TCTGCCCTCTTCTGCCGTCCTTA-3 '(SEQ ID NO: 13) was used. The PCR reaction was performed under the same conditions as for the isolation of the promoter.

The obtained PCR product was subjected to 1% low melting point agarose gel electrophoresis to cut out a fragment of about 1,000 bp. The fragment was extracted from the gel using QIAEX II (manufactured by QIAGEN), the PCR product was purified, and a tyrosinase gene terminator having the base sequence represented by SEQ ID NO: 2 was prepared.

(3) Construction of Recombinant Vector Utilizing the tyrosinase promoter region and terminator region isolated in (1) and (2) above, as a gene derived from a heterologous organism, a hygromycin B resistance gene derived from Escherichia coli is used. (Hygromycin B phosphotransferase,
hph) [Gritzand Davies, Gene, 25, 179-188, 1983]
Was used to construct a recombinant vector using Shiitake mushroom as a host.

That is, a pCH vector having the hph gene as a marker gene [Matsuki et al., Mol. Gen. Ge.
net., 220, 12-16, 1989], and the hph gene fragment was excised by digestion with the restriction enzyme BamHI. That fragment, B
E. coli plasmid vector pUC19 [Ya
nisch-Perron et al., Gene, 33, 109-119, 1985] and competent cells Top 10 F '(Invitrogen)
To prepare a large amount of the pUC19 plasmid containing the hph gene. Restriction enzyme Xba
After digestion with I, blunting and dephosphorylation, pT7Bl
Using the ue PerfectlyBlunt Cloning Kit (Novagen), ligation was performed with the promoter of the isolated tyrosinase gene. Of the plasmids thus created,
Those inserted correctly in the transcription direction were selected and prepared in large quantities. This plasmid vector was digested with the restriction enzyme SmaI, dephosphorylated, and ligated to the tyrosinase gene terminator isolated by the above method. Of the plasmids thus produced, those that were correctly inserted in the transcription direction were selected and prepared in large quantities.
A schematic diagram of the obtained pLT-hph vector is shown in FIG.

Example 3 Transformation of Shiitake Mushroom by REMI Method (1) Preparation of Protoplast A binuclear hypha of wild-type Shiitake mushroom strain S-1 was transformed with a 0.25 × MYPG agar medium (0.25% malt extract, 0.1% yeast extract). , 0.1% peptone, 0.5% glucose, 1.5% agar) at 25 ° C for 2 weeks. Scrape the grown mycelium and add 50 ml of 0.25 x M
The cells were cultured in a YPG liquid medium for one week. The resulting hypha was collected with a glass filter, suspended in 50 ml of 0.25 × MYPG liquid medium, cut with a polytron homogenizer, and filtered with a 100 μm nylon mesh.The filtered hypha was further filtered at 0.25 × MYPG liquid medium at 25 ° C. Cultured for 5 days. The cultured mycelium was collected with a 100 μm nylon mesh, washed twice with a citrate buffer (50 mM citrate buffer containing 0.6 M mannitol, pH 5.6), and 10 ml of an enzyme solution (2.5% cellulase, The mycelium was suspended in (citrate buffer containing 0.1% chitinase) and incubated at 28 ° C for 3 to 4 hours. The enzyme-treated mycelium is filtered through a 40 μm nylon mesh, and the filtrate is filtered.
Protoplasts were precipitated by centrifugation at 1,500 × g for 10 minutes. Discard the supernatant and transfer the protoplasts to STC buffer (10m
10 mM Tris-H containing M calcium chloride, 1.2 M sorbitol
After washing with Cl, pH 7.5), the protoplasts were suspended again in 1 ml of STC buffer, and the number of protoplasts was counted with a microscope. Finally, it was adjusted to be 0.5 to 1.0 × 10 ⁷ protoplasts in 100 μl of STC buffer to obtain protoplasts for transformation.

(2) Introduction of pLT-hph vector Transformation was carried out using the restriction enzyme DraI that cuts the pLT-hph vector at three sites, or the restriction enzymes HindIII and S
Restriction E using al I or Sph I (see Fig. 1)
This was performed by the nzyme Mediasted Integration (REMI) method (Japanese Patent Application Laid-Open No. H11-155568). That is, 2.5 μg
pLT-hph and 50 units of Dra I, Hind III, Sal I or Sph
To 150 μl of STC buffer containing I, 100 μl of the above protoplast suspension was gently added and incubated on ice for 20 minutes. To this, 62.5 μl of a PEG solution (10 mM Tris-HCl containing 10 mM calcium chloride, 60% PEG4000, pH 7.5) was added, and incubated on ice for 20 minutes. 3.125ml
Was added and incubated at room temperature for 20 minutes. Next, 10 ml of STC buffer was added to sufficiently suspend the entire solution, followed by centrifugation at 1,500 × g for 10 minutes to precipitate protoplasts. The collected protoplasts were suspended in 4 ml of MS liquid medium (2% malt extract, 0.6 M sucrose),
The culture was allowed to stand for 4 days.

(3) Selection of hygromycin B-resistant hyphae Hyphae regenerated from protoplasts were collected by centrifugation at 1,500 × g for 10 minutes. The collected mycelium was resuspended in 1 ml of MS liquid medium, and a minimal agar medium containing 5 μg / ml hygromycin B (2% glucose, 0.2% ammonium tartrate,
0.05% magnesium sulfate, 0.1% potassium dihydrogen phosphate, 0.112% sodium carbonate, 0.132% fumaric acid, 10ppm
Iron sulfide, 8.8 ppm zinc sulfide, 7.2 ppm manganese chloride, pH 4.
5, 1.5% agar) and cultured at 25 ° C for 5 days. next,
20 μg / ml hygromycin B was added to a 0.25 × MYPG agar medium once dissolved and cooled to about 50 ° C., and was overlaid on hyphae grown on a minimal agar medium. After culturing at 25 ° C. for about 5 days, the growing hypha was separated and replaced with a fresh MYPG agar medium containing new 20 μg / ml hygromycin B. After further culturing for about one week, the growing mycelium was replaced with a fresh MYPG agar medium containing 20 μg / ml hygromycin B, followed by culturing, and the hypha having acquired hygromycin resistance was selected.

(4) Results The results are shown in Table 2. Values are the average of triplicate experiments. A shiitake mushroom transformant having acquired hygromycin resistance by introducing the pLT-hph vector was produced, and it was confirmed that the recombinant vector for expression of the present invention was effective as a vector for heterologous gene expression using shiitake as a host.

[0094]

[Table 2]

[0095]

According to the present invention, a promoter for directing transcription initiation of a shiitake tyrosinase gene, a terminator for directing termination of transcription of a shiitake tyrosinase gene,
A recombinant vector containing the promoter and / or the terminator, a transformant containing the recombinant vector, and a method for producing a polypeptide using the transformant are provided.

[0096]

[Sequence List] SEQUENCE LISTING <110> Iwate prefecture <120> Promoter Gene <130> P99-0629 <160> 13 <170> PatentIn Ver. 2.0 <210> 1 <211> 2639 <212> DNA <213> Lentinula edodes <400> 1 attccaagcc tgtattccct cctatcgcgg gaatcgttta cctatccacc cctttctctt 60 tcgatacgac gccggaagat aggcaaacag ctttaagagc gtatcatgaa acagaagacg 120 ctaaggagat atatgagcac tcaccggtcg gattgataga ggcgttatcc gcatcatctc 180 tagttttgga tccgagaaaa ttcccttgct tgattgtctt agcacagtac gacccgtacg 240 tcattaagtt cggattgctt tcaagagata acagtcgaga aatcgtcttc caggcaagaa 300 atccaagatt caaccttctc gtttatagag gaatatcgca gaaaaagtcc gcaaggaatc 360 ttaccagagt tcgtggtcgt ggctggacac aaccatattt cacatgtttg ttcaattgga 420 acagaggacg acgtgctggg gagattactg cgcgagtttg ttgggaaagt ctgttcaagg 480 tgagccagcg attcgtaaag atgtactgta actgaatgaa cgagtcgcgt catagattta 540 cttggaagta caaaggcaaa gatttggacg cttagacgaa gcagtggtac ttactgtaat 600 cttgatatgg atgtgtatga atggataccc gttcaagttg aagagaaagc gttgcctaac 660 ttcagaattg aacgcagtcg gaccaagggg cattcggctc cg gaatgcca gactcgacgc 720 accaccgagt tccccttcga caagcctttg cgcaaagtgt taaatgtagt cctggaattc 780 caaagagatt ttattcacga acgagaatat tatgtacatt cgattctccg tgaactaacc 840 aggtgcactg ttacatgtca cgtgtagggc gggtatctac tatctgccat tcggatgacc 900 gaggatgcca ctgggatatc gtgactaagc gattcagccg tcatcgatgg gacatgaata 960 tgcatgaata ttgaatcagc aaaatgaatc aacacccctt ggtcttctcg cttctcagag 1020 gcatcctgag gcaacctcta cggaattttt catgttcgtg ttaccaccgt ctccgcagct 1080 gtactacctc tgacataaaa cttttccccg ttcccaatga gacctccaca cctctcgagc 1140 ttggataagc cttcagcgtt atggattcga ttccagcttc cgcccccgtg gtcttctcgt 1200 ttcctaatga atttcctgga catgtcatgg ttgacaagag caatctctct gaaaaactat 1260 acctataatt ttgaccggcg gtgtaatcag gtagaatcag gttgtagtaa tgttcggaaa 1320 gttcaaccct aggtcttccc tccccttctc tcccatgctg ctgtcactgt cactcgtact 1380 tctctggaag taacagatat tggaactgtg tagcagaaaa caagtcgaac ggacatcaca 1440 tacctctcct ttgctgcgca ccaaattttc cccttctgtt gtatcccggt tgtctcaaat 1500 gtcggcatct tgttcctcga tttcgcggac acatagcgct agtgctaaat cc caatcctt 1560 tctaggagct ctcatcttca actctcatca aataacacgt tcaaatcaac caaagcctgg 1620 gtatatcaga cctttcgctt cgccatttca ttctgcattg atccacatcc tgactgggat 1680 acacggctga cgagataagg agccggatgg cacttaagaa gtccagatta tatcgactgc 1740 gatgtaataa gaatagaggt gagcagtgat gagctatgta tgtttccgga tcatcgtttc 1800 ttctcattta cacaatggtc ctacaaacga gcaaagtgta cttaccactg gattgttgaa 1860 cgaatatttt tcccaaaaca aatttttttt ccaatttata tgaccttagg tgacacaagt 1920 ggttggtggc tttagtcaag atgcttgcac ggcgttgaag ccatgttcgt gtataagtat 1980 gaacccatag acgcggctcg aattttcagt gccggtgtca atggagtaat cctcgctgtt 2040 cgggctacat agtttaggta gttggtgtta atagcgacat acaattcaag gaggcctaac 2100 aaaacactac ttcgggaacc aaggattatt accattgctc aggtgaaagt tagatccgta 2160 caaactcagc ccgaatcttg actaaaacac atactgaaga cagccgaaga agcaatggaa 2220 tgaatctagt cccgttggtg ttgaccctct ttttctatca ctcaatcgga cggcagattc 2280 cagaggccga ccaatactgc taagactgca gacagaggct gcttaaccga catgattcta 2340 tcaaacaaat ctcagccact ttctccgctt ctgtcgggac tgccctcttg ttcaattt gt 2400 tacttgatcg ctatgttggt ctcgtaagat ataatatgga cgtccccccc ctacggagtt 2460 cgatggaagt ataagcaaat gccaacttag ccaagcttcg aaggcaatgc ttagggggta 2520 gatcgtgtat ctgtcttggc tgttagtatt acagcactgg agtagctgtg ctcattcgga 2580 tccttaaaag ctcgaggtct aaatcttcta accccacaca ccgatttgtt ttcacagag 2639 <210> 2 <211> 971 <212> DNA <213> Lentinula edodes <400> 2 ggaattcgaa tgaactatcg cgataaataa ataatgtcct cgttgtgtgt atgtgtaatg 60 ttggtttttt agcggttgaa gacaggtagc gctgagcctg gccattaatg gagaatgatt 120 cggtactcaa attgacatac atacctctag accggtggta caccatgtga gcaaggcgat 180 atttctgccg gttctaattc actcagatgc tgcgcgcgca tccccaggca tgtgttcaat 240 acacagctca caccatccgc ggctctcctt ttcgctatca aggaatcagt tacggccatt 300 ttgaatcgga aagaaaatca cgcacgtagg gagtgcaact actgcagtgg ttgcaaaaag 360 caagctcatg caagcgaggg taaagacata agtccaacga gccattggag tgctgggata 420 tgataggata ggataggata gttaacttat actggctagc tccgattgct gggtaagtgg 480 gaagggagaa ctgacgggga cgagtgatgg agagaaagac gagtctccac agcagttttt 540 ataacctagt tgtgactaac tgtacatgtt gccaatctcc cgcataactg tatacataag 600 tattagcaaa tctttccatc aaagtgaaac cgtgacgggg ctactaatta tgctatggga 660 ccgcggtata atgtacgaac gcactgacca gtaaatcacc acagtatcga ggtgcaacct 720 ggtgcaacaa ggcgcagcac cgtcctgttc cattccatct ttgtaccata cccatttctc 780 ttgagataga tatcctgtgg ttcttgagtt tagagtacaa acagctcgga agttcattca 840 tggataaagt ctttcaatct ccgttcgacg caggagcggc gctccccggt gatcattgta 900 tcatcttgac taattcgtcg ggaaggtgta aaaggaggtg tatataagga cggcagaaga 960 gggcagaagc t 971 <210> 3 <211> 2050 <212> DNA <213> Lentinula edodes <220> <221> CDS <222> (21) .. (1874) <400> 3 ttttcacaga gttcatttag atg tct cat tat ctt gtc act ggc gca act gga 53 Met Ser His Tyr Leu Val Thr Gly Ala Thr Gly 1 5 10 gga tca acc tct ggg gca gca gca ccc aat cgt ctc gaa att aat gat 101 Gly Ser Thr Ser Gly Ala Ala Ala Pro Asn Arg Leu Glu Ile Asn Asp 15 20 25 ttc gtc aaa caa gaa gac cag ttt tct ctc tat att cag gct ttg caa 149 Phe Val Lys Gln Glu Asp Gln Phe Ser Leu Tyr Ile Gln Ala Leu Gln 30 35 40 tac att tat tca agt aaa agc caa gac gat att gac tcc ttc ttc caa 197 Tyr Ile Tyr Ser Ser Lys Ser Gln Asp Asp Ile Asp Ser Phe Phe Gln 45 50 55 atc gga ggg atc cat ggc ctt ccg tat gtc cct tgg gac ggc gca gga 245 Gly Gly Ile His Gly Leu Pro Tyr Val Pro Trp Asp Gly Ala Gly 60 65 70 75 aat aag cca gta gac act gac gcc tgg gag gga tat tgc act cat ggc 293 Asn Lys Pro Val Asp Thr Asp Ala Trp Glu Gly Tyr Cys Thr His Gly 80 85 90 agc gtg tta ttt cca acc ttc cac cgt ccg tat gtt cta ctc atc gag 341 Ser Val Leu Phe Pro Thr Phe His Arg Pro Tyr Val Leu Leu Ile Glu 95 100 105 caa gca atc cag gct gcg gcc gtc gat atc gcc gca aca tac atc gta 389 Gln Ala Ile Gln Ala Ala Ala Val Asp Ile Ala Ala Thr Tyr Ile Val 110 115 120 gat aga gct cgt tac cag gac gcc gcg ttg aat cta cgt cag cca tac 437 Asp Arg Ala Arg Tyr Gln Asp Ala Ala Leu Asn Leu Arg Gln Pro Tyr 125 130 135 tgg gat tgg gcc cga aac cca gtt cct ccg ccg gaa gta ata tct ctg 485 Trp Asp Trp Ala Arg Asn Pro Val Pro Pro Pro Glu Val Ile Ser Leu 140 145 150 155 155 gac gag gt t acc atc gtt aac cca agc gga gag aaa atc tct gtt ccc 533 Asp Glu Val Thr Ile Val Asn Pro Ser Gly Glu Lys Ile Ser Val Pro 160 165 170 aac cct ctc cga cgt tat aca ttc cac ccc ata gat ccg tcc ttc cct 581 Asn Pro Leu Arg Arg Tyr Thr Phe His Pro Ile Asp Pro Ser Phe Pro 175 180 185 gaa cca tat cag tct tgg tcg act act ctt cga cat cct ttg tcc gat 629 Glu Pro Tyr Gln Ser Trp Ser Thr Thr Leu Arg His Pro Leu Ser Asp 190 195 200 gat gcc aat gca tcg gac aat gtt cca gaa ttg aaa gcg acg ttg aga 677 Asp Ala Asn Ala Ser Asp Asn Val Pro Glu Leu Lys Ala Thr Leu Arg 205 210 215 agt gct ggt ccc caa ctc aag acc aag acg tac aac ctt ctg acg cga 725 Ser Ala Gly Pro Gln Leu Lys Thr Lys Thr Tyr Asn Leu Leu Thr Arg 220 225 230 235 gtt cat aca tgg ccg gcg ttc agt aac cat acg ccc gac gat gga ggg 773 Val His Thr Trp Pro Ala Phe Ser Asn His Thr Pro Asp Asp Gly Gly 240 245 250 agt acc agc aat agt ctt gaa ggt atc cac gac agt gtc cac gtc gat 821 Ser Thr Ser Asn Ser Leu Glu Gly Ile His Asp Ser Val His Val Asp 255 260 26 5 gtt ggt gga aac ggg caa atg tca gat cct tca gta gca gga ttc gat 869 Val Gly Gly Asn Gly Gln Met Ser Asp Pro Ser Val Ala Gly Phe Asp 270 275 275 280 ccc att ttc ttt atg cac cat gcc cag gtt gat cgt ctg ctt tca ttg 917 Pro Ile Phe Phe Met His His Ala Gln Val Asp Arg Leu Leu Ser Leu 285 290 295 tgg tct gca ttg aat ccg agg gtg tgg att acc gac gga cct tct ggc 965 Trp Ser Ala Leu Asn Pro Arg Val Trp Ile Thr Asp Gly Pro Ser Gly 300 305 310 315 gat ggg aca tgg act atc cct ccc gac act gta gtt gga aag gat act 1013 Asp Gly Thr Trp Thr Ile Pro Pro Asp Thr Val Val Gly Lys Asp Thr 320 325 330 gat ctt act ccg ttc tgg aac acc cag tca tcg tat tgg att tct gcc 1061 Asp Leu Thr Pro Phe Trp Asn Thr Gln Ser Ser Tyr Trp Ile Ser Ala 335 340 345 aat gtg acc gat acg tcc aag atg gga tat aca tat cca gaa ttt aac 1109 Asn Val Thr Asp Thr Ser Lys Met Gly Tyr Thr Tyr Pro Glu Phe Asn 350 355 360 aat ctc gat atg gga aat gaa gtt gca gtt cga tct gct ata gct gca 1157 Asn Leu Asp Met Gly Asn Glu Val Ala Val Arg Ser Ala Ile Al a Ala 365 370 375 caa gtt aac aag ctc tat ggt gga cca ttc acg aaa ttc gcg gca gca 1205 Gln Val Asn Lys Leu Tyr Gly Gly Pro Phe Thr Lys Phe Ala Ala Ala 380 385 390 395 att caa caa cct tct tct ca act act gca gac gct tcc acg att ggc 1253 Ile Gln Gln Pro Ser Ser Gln Thr Thr Ala Asp Ala Ser Thr Ile Gly 400 405 410 aat gtc aca agc gat gcc tct tcg cac ctg gta gac agc aaa atc aat 1301 Asn Val Thr Ser Asp Ala Ser Ser His Leu Val Asp Ser Lys Ile Asn 415 420 425 ccg acg cca aat aga agc att gat gat gcc cct caa gta aaa ata gct 1349 Pro Thr Pro Asn Arg Ser Ile Asp Asp Ala Pro Gln Val Lys Ile Ala 430 435 440 tcc act cta agg aac aac gaa caa aag gag ttt tgg gaa tgg act gcc 1397 Ser Thr Leu Arg Asn Asn Glu Gln Lys Glu Phe Trp Glu Trp Thr Ala 445 450 455 cgt gtg cag gtc aag aag tac gaa ata ggt ggaagc tt gtc tta 1445 Arg Val Gln Val Lys Lys Tyr Glu Ile Gly Gly Ser Phe Lys Val Leu 460 465 470 475 ttc ttc tta ggc agt gtg ccc agt gat ccc aag gaa tgg gct act gat 1493 Phe Phe Leu Gly Ser Val Pro Ser Asp Pro Lys Glu Trp Ala Thr Asp 480 485 490 ccc cat ttt gtc gga gca ttc cac ggg ttc gtg aat agc tct gcc gaa 1541 Pro His Phe Val Gly Ala Phe His Gly Phe Val Asn Ser Ser Ala Glu 495 500 505 cga tgc gca aac tgt cgg cgt caa cag gat gtc gtt ctc gaa gga ttc 1589 Arg Cys Ala Asn Cys Arg Arg Gln Gln Asp Val Val Leu Glu Gly Phe 510 515 520 gtg cat ctc aac gaa ggt att gcg aac att tcc aac ttg ac ttc His Leu Asn Glu Gly Ile Ala Asn Ile Ser Asn Leu Asn Ser Phe 525 530 535 gac cca atc gtt gtg gaa ccg tat ctt aaa gag aac ctc cac tgg cgt 1685 Asp Pro Ile Val Val Glu Pro Tyr Leu Lys Glu Asn Leu His Trp Arg 540 545 550 555 gtg caa aag gta tcg ggc gag gta gtc aat ttg gat gca gcg aca tcc 1733 Val Gln Lys Val Ser Gly Glu Val Val Asn Leu Asp Ala Ala Thr Ser 560 565 570 ctg gaa gtc gta gtt gc ttg gag ttg cct cct gga gag 1781 Leu Glu Val Val Val Val Ala Thr Arg Leu Glu Leu Pro Pro Gly Glu 575 580 585 atc ttc cca gta cct gca gag aca cac cac cat cac cat atc aca cat 1829 Ile Phe Pro Val Pro Ala Glu Thr His His His His His Ile Thr His 590 595 600 ggt cgt cct ggt ggt tct cgc cac agc gtc gca tct tca agc tcc 1874 Gly Arg Pro Gly Gly Ser Arg His Ser Val Ala Ser Ser Ser Ser 605 610 615 taatcagaca aagagtggaa ttcgaatgaa ctatcgcgat aaataaataa tgtcctcgtt 1934 gtgcgtatgt gtaatgttgg tttttttagc ggttgaagac aggtagcgct gagcctggcc 1994 attaatggag aatgattcgg tactcaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaa 2050 <210> 4 <211> 618 <212> PRT <213> Lentinula edodes <400> 4 Met Ser His Tyr Leu Val Thr Gly Ala Thr Gly Gly Ser Thr Ser Gly 1 5 10 15 Ala Ala Ala Pro Asn Arg Leu Glu Ile Asn Asp Phe Val Lys Gln Glu 20 25 30 Asp Gln Phe Ser Leu Tyr Ile Gln Ala Leu Gln Tyr Ile Tyr Ser Ser 35 40 45 Lys Ser Gln Asp Asp Ile Asp Ser Phe Phe Gln Ile Gly Gly Ile His 50 55 60 Gly Leu Pro Tyr Val Pro Trp Asp Gly Ala Gly Asn Lys Pro Val Asp 65 70 75 80 Thr Asp Ala Trp Glu Gly Tyr Cys Thr His Gly Ser Val Leu Phe Pro 85 90 95 Thr Phe His Arg Pro Tyr Val Leu Leu Ile Glu Gln Ala Ile Gln Ala 100 105 110 Ala Ala Val Asp Ile Ala Ala Thr Tyr Ile Val Asp Arg Ala Arg Tyr 115 120 125 Gln Asp Ala Ala Leu Asn Leu Arg Gln Pro Tyr Trp Asp Trp Ala Arg 130 135 140 Asn Pro Val Pro Pro Pro Glu Val Ile Ser Leu Asp Glu Val Thr Ile 145 150 155 160 Val Asn Pro Ser Gly Glu Lys Ile Ser Val Pro Asn Pro Leu Arg Arg 165 170 175 Tyr Thr Phe His Pro Ile Asp Pro Ser Phe Pro Glu Pro Tyr Gln Ser 180 185 190 Trp Ser Thr Thr Leu Arg His Pro Leu Ser Asp Asp Ala Asn Ala Ser 195 200 205 Asp Asn Val Pro Glu Leu Lys Ala Thr Leu Arg Ser Ala Gly Pro Gln 210 215 220 Leu Lys Thr Lys Thr Tyr Asn Leu Leu Thr Arg Val His Thr Trp Pro 225 230 235 240 Ala Phe Ser Asn His Thr Pro Asp Asp Gly Gly Ser Thr Ser Asn Ser 245 250 255 Leu Glu Gly Ile His Asp Ser Val His Val Asp Val Gly Gly Asn Gly 260 265 270 Gln Met Ser Asp Pro Ser Val Ala Gly Phe Asp Pro Ile Phe Phe Met 275 280 285 His His Ala Gln Val Asp Arg Leu Leu Ser Leu Trp Ser Ala Leu Asn 290 295 300 Pro Arg Val Trp Ile Thr Asp Gly Pro Ser Gly Asp Gly Thr Trp Thr 305 310 315 320 Ile Pro Pro Asp Thr Val Val Gly Lys Asp Thr Asp Leu Thr Pro Phe 325 330 335 Trp Asn Thr Gln Ser Ser Tyr Trp Ile Ser Ala Asn Val Thr Asp Thr 340 345 350 Ser Lys Met Gly Tyr Thr Tyr Pro Glu Phe Asn Asn Leu Asp Met Gly 355 360 365 Asn Glu Val Ala Val Arg Ser Ala Ile Ala Ala Gln Val Asn Lys Leu 370 375 380 Tyr Gly Gly Pro Phe Thr Lys Phe Ala Ala Ala Ile Gln Gln Pro Ser 385 390 395 400 Ser Gln Thr Thr Ala Asp Ala Ser Thr Ile Gly Asn Val Thr Ser Asp 405 410 415 Ala Ser Ser His Leu Val Asp Ser Lys Ile Asn Pro Thr Pro Asn Arg 420 425 430 Ser Ile Asp Asp Ala Pro Gln Val Lys Ile Ala Ser Thr Leu Arg Asn 435 440 445 Asn Glu Gln Lys Glu Phe Trp Glu Trp Thr Ala Arg Val Gln Val Lys 450 455 460 Lys Tyr Glu Ile Gly Gly Ser Phe Lys Val Leu Phe Phe Leu Gly Ser 465 470 475 475 480 Val Pro Ser Asp Pro Lys Glu Trp Ala Thr Asp Pro His Phe Val Gly 485 490 495 Ala Phe His Gly Phe Val Asn Ser Ser Ala Glu Arg Cys Ala Asn Cys 500 505 510 Arg Arg Gln Gln Asp Val Val Leu Glu Gly Phe Val His Leu Asn Glu 515 520 525 Gly Ile Ala Asn Il e Ser Asn Leu Asn Ser Phe Asp Pro Ile Val Val 530 535 540 Glu Pro Tyr Leu Lys Glu Asn Leu His Trp Arg Val Gln Lys Val Ser 545 550 555 555 Gly Glu Val Val Val Asn Leu Asp Ala Ala Thr Ser Leu Glu Val Val Val 565 570 575 Val Ala Thr Arg Leu Glu Leu Pro Pro Gly Glu Ile Phe Pro Val Pro 580 585 590 Ala Glu Thr His His His His His Ile Thr His Gly Arg Pro Gly Gly 595 600 605 Ser Arg His Ser Val Ala Ser Ser Ser Ser 610 615 <210> 5 <211> 6290 <212> DNA <213> Lentinula edodes <400> 5 aatgtgaatt ccaagcctgt attccctcct atcgcgggaa tcgtttacct atccacccct 60 ttctctttcg atacgacgcc ggaagatagg caaacagctt taagagcgta tcatgaaaca 120 gaagacgcta aggagatata tgagcactca ccggtcggat tgatagaggc gttatccgca 180 tcatctctag ttttggatcc gagaaaattc ccttgcttga ttgtcttagc acagtacgac 240 ccgtacgtca ttaagttcgg attgctttca agagataaca gtcgagaaat cgtcttccag 300 gcaagaaatc caagattcaa ccttctcgtt tatagaggaa tatcgcagaa aaagtccgatcaggtcgtacgatcgtacgtcgtcgacgtcgtcgacgtcgtcgtcgacgtcgtcgtcgcagcgtcgtcgcgtcgcgtcgcgtcgtcgagtc actgcgc gagtttgttg ggaaagtctg 480 ttcaaggtga gccagcgatt cgtaaagatg tactgtaact gaatgaacga gtcgcgtcat 540 agatttactt ggaagtacaa aggcaaagat ttggacgctt agacgaagca gtggtactta 600 ctgtaatctt gatatggatg tgtatgaatg gatacccgtt caagttgaag agaaagcgtt 660 gcctaacttc agaattgaac gcagtcggac caaggggcat tcggctccgg aatgccagac 720 tcgacgcacc accgagttcc ccttcgacaa gcctttgcgc aaagtgttaa atgtagtcct 780 ggaattccaa agagatttta ttcacgaacg agaatattat gtacattcga ttctccgtga 840 actaaccagg tgcactgtta catgtcacgt gtagggcggg tatctactat ctgccattcg 900 gatgaccgag gatgccactg ggatatcgtg actaagcgat tcagccgtca tcgatgggac 960 atgaatatgc atgaatattg aatcagcaaa atgaatcaac accccttggt cttctcgctt 1020 ctcagaggca tcctgaggca acctctacgg aatttttcat gttcgtgtta ccaccgtctc 1080 cgcagctgta ctacctctga cataaaactt ttccccgttc ccaatgagac ctccacacct 1140 ctcgagcttg gataagcctt cagcgttatg gattcgattc cagcttccgc ccccgtggtc 1200 ttctcgtttc ctaatgaatt tcctggacat gtcatggttg acaagagcaa tctctctgaa 1260 aaactatacc tataattttg accggcggtg taatcaggta gaatca ggtt gtagtaatgt 1320 tcggaaagtt caaccctagg tcttccctcc ccttctctcc catgctgctg tcactgtcac 1380 tcgtacttct ctggaagtaa cagatattgg aactgtgtag cagaaaacaa gtcgaacgga 1440 catcacatac ctctcctttg ctgcgcacca aattttcccc ttctgttgta tcccggttgt 1500 ctcaaatgtc ggcatcttgt tcctcgattt cgcggacaca tagcgctagt gctaaatccc 1560 aatcctttct aggagctctc atcttcaact ctcatcaaat aacacgttca aatcaaccaa 1620 agcctgggta tatcagacct ttcgcttcgc catttcattc tgcattgatc cacatcctga 1680 ctgggataca cggctgacga gataaggagc cggatggcac ttaagaagtc cagattatat 1740 cgactgcgat gtaataagaa tagaggtgag cagtgatgag ctatgtatgt ttccggatca 1800 tcgtttcttc tcatttacac aatggtccta caaacgagca aagtgtactt accactggat 1860 tgttgaacga atatttttcc caaaacaaat tttttttcca atttatatga ccttaggtga 1920 cacaagtggt tggtggcttt agtcaagatg cttgcacggc gttgaagcca tgttcgtgta 1980 taagtatgaa cccatagacg cggctcgaat tttcagtgcc ggtgtcaatg gagtaatcct 2040 cgctgttcgg gctacatagt ttaggtagtt ggtgttaata gcgacataca attcaaggag 2100 gcctaacaaa acactacttc gggaaccaag gattattacc attgctcagg t gaaagttag 2160 atccgtacaa actcagcccg aatcttgact aaaacacata ctgaagacag ccgaagaagc 2220 aatggaatga atctagtccc gttggtgttg accctctttt tctatcactc aatcggacgg 2280 cagattccag aggccgacca atactgctaa gactgcagac agaggctgct taaccgacat 2340 gattctatca aacaaatctc agccactttc tccgcttctg tcgggactgc cctcttgttc 2400 aatttgttac ttgatcgcta tgttggtctc gtaagatata atatggacgt ccccccccta 2460 cggagttcga tggaagtata agcaaatgcc aacttagcca agcttcgaag gcaatgctta 2520 gggggtagat cgtgtatctg tcttggctgt tagtattaca gcactggagt agctgtgctc 2580 attcggatcc ttaaaagctc gaggtctaaa tcttctaacc ccacacaccg atttgttttc 2640 acagagttca tttagatgtc tcattatctt gtcactggcg caactggagg atcaacctct 2700 ggggcagcag cacccaatcg tctcgaaatt aatgatttcg tcaaacaaga agaccagttt 2760 tctctctata ttcaggcttt gcgtaagtcg aaatcaggct gaatatcgcg gaactcgttc 2820 attaattggc acatcatgaa tcagaataca tttattcaag taaaagccaa gacgatattg 2880 actccttctt ccaaatcgga gggatccatg gccttccgta tgtcccttgg gacggcgcag 2940 gaaataagcc agtagacact gacgcctggg agggatattg cactcatggc agcgtg ttat 3000 ttccaacctt ccaccgtccg tatgttctac tcatcgaggt aatcagattt ttttgctcaa 3060 aactgtcgac actgactcat atttgttttg cttcgttagc aagcaatcca ggctgcggcc 3120 gtcgatatcg ccgcaacata catcgtagat agagctcgtt accaggacgc cgcgttgaat 3180 ctacgtcagc catactggga ttgggcccga aacccagttc ctccgccgga agtaatatct 3240 ctggacgagg ttaccatcgt taacccaagc ggagagaaaa tctctgttcc caaccctctc 3300 cgacgttata cattccaccc catagatccg tccttccctg aaccatatca gtcttggtcg 3360 actactcttc gacatccttt gtccgatgat gccaatgcat cggacaatgt tccagaattg 3420 aaagcgttag tttcactgca tactcaaatg aatagcatga attcttacgt tcattgcagg 3480 acgttgagaa gtgctggtcc ccaactcaag accaagacgt acaaccttct gacgcgagtt 3540 catacatggc cggcgttcag taaccatacg cccgacgatg gagggagtac cagcaatagt 3600 cttgaaggta ttcacattgg tgttcactgc aaacacgagg cttatggtct ccacaaggta 3660 tccacgacag tgtccacgtc gatgttggtg gaaacgggca aatgtcagat ccttcagtag 3720 caggtaggtc atttttgtta ctctttcgcg ctgaataatc gacatacctt cggcaggatt 3780 cgatcccatt ttctttatgc accatgccca ggttgatcgt ctgctttcat tgtggtctgc 3 840 attgaatccg agggtgtgga ttaccgacgg accttctggc gatgggacat ggactatccc 3900 tcccgacact gtagttggaa aggatactgg tactttcacg ctcgattcgt acggatggac 3960 ccgaagtcaa ctaatcatct tataatatcc agatcttact ccgttctgga acacccagtc 4020 atcgtattgg atttctgcca atgtgaccga tacgtccaag atgggatata catatccaga 4080 atttaacaat ctcgatatgg gaaatgaagt tgcagttcga tctgctatag ctgcacaagt 4140 taacaagctc tatggtggac cattcacgaa attcgcggca gcaattcaac aaccttcttc 4200 tcaaactact gcagacgctt ccacgattgg caatgtcaca agcgatgcct cttcgcacct 4260 ggtagacagc aaaatcaatc cgacgccaaa tagaagcatt gatgatgccc ctcaagtaaa 4320 aatagcttcc actctaagga acaacgaaca aaaggagttt tgggaatgga ctgcccgtgt 4380 gcaggtcaag aagtacgaaa taggtggaag cttcaaggtc ttattcttct taggcagtgt 4440 gcccagtgat cccaaggaat gggctactga tccccatttt gtcggagcat tccacgggtt 4500 cgtgaatagg ttagctgcaa tctcattatc gcaatacttc aatttataat ttggctctgt 4560 ttatgtatca cagctctgcc gaacgatgcg caaactgtcg gcgtcaacag gatgtcgttc 4620 tcgaaggatt cgtgcatctc aacgaaggta ttgcgaacat ttccaacttg aactcattcg 4680 a cccaatcgt tgtggaaccg tatcttaaag agaacctcca ctggcgtgtg caaaaggcaa 4740 gatttgattg tttctctgct tcacaatgcc atggatcaac ataactttca ggtatcgggc 4800 gaggtagtca atttggatgc agcgacatcc ctggaagtcg tagttgtcgc tacgcgtttg 4860 gagttgcctc ctggagagat cttcccagta cctgcagaga cacaccacca tcaccatatc 4920 acacatggtc gtcctggtgg ttctcgccac agcgtcgcat cttcaagctc ctaatcagac 4980 aaagagtgga attcgaatga actatcgcga taaataaata atgtcctcgt tgtgtgtatg 5040 tgtaatgttg gttttttagc ggttgaagac aggtagcgct gagcctggcc attaatggag 5100 aatgattcgg tactcaaatt gacatacata cctctagacc ggtggtacac catgtgagca 5160 aggcgatatt tctgccggtt ctaattcact cagatgctgc gcgcgcatcc ccaggcatgt 5220 gttcaataca cagctcacac catccgcggc tctccttttc gctatcaagg aatcagttac 5280 ggccattttg aatcggaaag aaaatcacgc acgtagggag tgcaactact gcagtggttg 5340 caaaaagcaa gctcatgcaa gcgagggtaa agacataagt ccaacgagcc attggagtgc 5400 tgggatatga taggatagga taggatagtt aacttatact ggctagctcc gattgctggg 5460 taagtgggaa gggagaactg acggggacga gtgatggaga gaaagacgag tctccacagc 5520 agttttt ata acctagttgt gactaactgt acatgttgcc aatctcccgc ataactgtat 5580 acataagtat tagcaaatct ttccatcaaa gtgaaaccgt gacggggcta ctaattatgc 5640 tatgggaccg cggtataatg tacgaacgca ctgaccagta aatcaccaca gtatcgaggt 5700 gcaacctggt gcaacaaggc gcagcaccgt cctgttccat tccatctttg taccataccc 5760 atttctcttg agatagatat cctgtggttc ttgagtttag agtacaaaca gctcggaagt 5820 tcattcatgg ataaagtctt tcaatctccg ttcgacgcag gagcggcgct ccccggtgat 5880 cattgtatca tcttgactaa ttcgtcggga aggtgtaaaa ggaggtgtat ataaggacgg 5940 cagaagaggg cagaagctgg gcagaagtga catagaaaat ggcgctccaa atgggcgaaa 6000 tcaggaatta atctgtgtac attggaagat aagataagat catatgccat aagatcaaca 6060 tttattgact ccgatctgat tgattgaaaa acctcagaac tgcaaaagag cctctttttt 6120 ccagcactct tatcttcata tacagtgctg cctccccccc ctcttacagc gaagttcccc 6180 accatgaacg acaaaatttt ggaggatacg agcgatcctg gcttaccgac cactattgtt 6240 ccccatactg cagattttga tggctcttcc tttggtgatc ggagttagta 6290 <210> 6 <211> 22 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Seq uence: Primer <220> <221> Degenerate <222> (11) <223> "n" is a, t, c or g <220> <221> Degenerate <222> (14) <223> "n" is a, t, c or g <400> 6 tycarathgg nggnathcay gg 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <220> <221> Degenerate <222> (2) <223> "n" is a, t, c or g <220> <221> Degenerate <222> (8) <223> "n" is a, t, c or g <220 > <221> Degenerate <222> (14) <223> "n" is a, t, c or g <400> 7 rnckrtcnac ytgngcrtgr tg 22 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 8 gcgcaggaaa taagccagta gacac 25 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer < 400> 9 gcgtggtgca taaagaaaat 20 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 10 attccaagcc tgtattccct cctatcg 27 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Descri ption of Artificial Sequence: Primer <400> 11 ctctgtgaaa acaaatcggt gtgtgggg 28 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 12 ggaattcgaa tgaactatcg cgataaataa ataatgt 37 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 13 agcttctgcc ctcttctgcc gtcctta 27

[0097]

[Sequence List Free Text]

[SEQ ID NO: 6] Primer. N of the 11th and 14th bases is a, t, c or g.

[SEQ ID NO: 7] Primer. N of the second base, the eighth base and the fourteenth base is a, t, c or g.

[SEQ ID NOS: 8 to 13] Primers.

[0098]

[Brief description of the drawings]

FIG. 1 is a schematic diagram showing the structure of a shiitake tyrosinase gene.

FIG. 2 is a schematic diagram showing the structure of the gene expression vector pLT-hph of the present invention.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 5/10 C12N 5/00 A (72) Inventor Kumiko Okawa 1-24-1, Kitakami Ichimachi, Iwate Prefecture Preste Gage II 205 (72) Katsuhiro Kanda 1-7 Nishi-Aoyama, Morioka-shi, Iwate Prefecture Aoyama Apartment 1-201 (72) Kaoru Yaegashi 3-6-16 Miyamachi, Miyako-shi, Iwate Prefecture Diaz Miyamachi A-201 (72) Inventor Hitoshi Ei 1-6-6 Shinshin-cho, Kitakami-shi, Iwate Prefecture F-term (reference) 2B030 AA05 AD08 CA17 CA19 CB03 4B024 AA20 BA02 BA03 BA08 CA04 DA11 EA04 FA02 FA07 GA14 GA19 HA01 HA14 4B065 AA26Y AA71X AB01 AC03 BA01 CA24 CA28

Claims (9)

[Claims] 1. A DNA capable of functioning as a promoter, represented by the following (a) or (b): (A) DNA containing the nucleotide sequence represented by SEQ ID NO: 1. (B) a DNA comprising a base sequence in which at least one base is deleted, substituted or added in the base sequence represented by SEQ ID NO: 1 and having promoter activity. 2. A DNA that hybridizes with the gene according to claim 1 under stringent conditions and has a promoter activity. 3. A DNA capable of functioning as a terminator, represented by the following (c) or (d): (C) DNA containing the base sequence represented by SEQ ID NO: 2. (D) a DNA comprising a base sequence in which at least one base is deleted, substituted or added in the base sequence represented by SEQ ID NO: 2, and having a terminator activity. 4. A DNA which hybridizes with the gene according to claim 3 under stringent conditions and has a terminator activity. 5. The DNA according to claim 1 or 2 and / or
Or a recombinant vector for expression containing the DNA according to claim 3 or 4. 6. A recombinant vector in which a gene encoding an arbitrary polypeptide has been incorporated into the recombinant vector for expression according to claim 5. A transformant comprising the recombinant vector for expression according to claim 5. 8. A transformant comprising the recombinant vector according to claim 6. 9. A method for producing a polypeptide, comprising culturing or cultivating the transformant according to claim 8, and collecting the polypeptide from the obtained culture or cultivated product.