Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
  • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
  • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
  • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
  • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

• the present invention relates to new means of combating insect pests, and in particular against aphids.
• insect pests In addition to the damage produced by the insects themselves, attack by these insects very often promotes the transmission and infection of plants by bacterial, viral or fungal diseases.
• aphids also known as aphids
• aphids are the most common.
• There are more than 4000 species of which the most widespread are Myzus persicae and Aphis gossypii.
• Aphids are extremely dynamic organisms, which adapt quickly to environmental conditions. This rapid adaptation is mainly due to the various reproductive strategies developed by aphids. Depending on climatic conditions, aphids reproduce sexually or asexually and are oviparous or viviparous. They may or may not be winged, thus facilitating their passage from one plant to another. Thanks to this great ability to adapt and reproduce, the total infestation of a crop in the field and a fortiori in the greenhouse is extremely fast. A single individual gives birth to a number of larvae between 40 and 100. The cotton aphid or melon Aphis gossypii is present in most regions of the world except the most northern.
• the melon aphid has a wide spectrum of hosts (around 700 cultivated or wild plants, including around fifty in France). Among these, the most sensitive are cucurbits including, for example, melon, zucchini, cucumber, malvaceae like cotton or hibiscus and to a lesser extent solanaceae and rutaceae like citrus.
• the melon aphid mainly colonizes the underside of the leaves, buds and young shoots.
• the aphid By drawing nutrients from the phloem, the aphid diverts the resources of the plant and weakens it.
• the colonized tissues become chlorotic, the leaves roll up on themselves and the yield of photosynthesis decreases.
• the aphid secretes a honeydew very rich in sugars serving as a substrate for saprophytic fungi such as fùmagine which deposits a black veil on the leaf further reducing the photosynthesis capacities of the plant and causing a strong commercial depreciation of the affected vegetables and fruits.
• saprophytic fungi such as fùmagine which deposits a black veil on the leaf further reducing the photosynthesis capacities of the plant and causing a strong commercial depreciation of the affected vegetables and fruits.
• the aphid is a vector of many viruses which it introduces directly into the phloem of the plant when it bites the vessels.
• Biological control consists in using natural predators and parasites with Aphis gossypii such as for example ladybugs, certain heminoptera or pathogenic fungi. However, it can only be used for greenhouse crops.
• Vat locus favorable to resistance was introduced by crossing into different varieties of melon on the market; however, the creation of aphid-resistant varieties of melon by the usual varietal improvement techniques remains long and costly. It therefore appears desirable to precisely identify and clone the gene
• Vat in particular to allow: - to transfer the Vat allele favorable to resistance, by transgenesis, to varieties of melon sensitive to Aphis gossypii, and also to other species sensitive to this aphid and for which no natural resistance has been detected, such as for example zucchini, cucumber or cotton; the allele of the V ⁇ t gene favorable to resistance can also be transferred into plant species sensitive to viral transmission by aphids, such as for example solanaceae, in particular tomatoes;
• the V ⁇ t gene has been located on the V melon chromosome in the sub-telomeric position (PERIN et al., Theor Appl Genêt, 104, 1017-1034, 2002).
• Several sequences homologous to resistance genes have been mapped in this region (KLINGER et al., J. Amer. Soc. Hort. Sci., 126, 56-63, 2001; BROTMAN et al., Theor. Api. Genêt. , 104, 1055-1063, 2002), which suggests that the V ⁇ t gene belongs to the NBS-LRR superfamily, of which a large number of resistance genes are currently cloned.
• NBS-LRR nucleotide binding site
• LRR leucine-rich repeat sequences
• NBS-LRR homologous sequences have been observed to be linked to the V ⁇ t locus (KLLNGLER et al., J. Amer. Soc. Hort. Sci., 126, 56-63, 2001).
• NBS-2, NBS46-7, NBS5a and NBS5b were located respectively at 4.75, 7.5, 10 and 11 cM of V ⁇ t; however, none of them co-aggregates with the V ⁇ t locus (BROTMAN et al., Theor. Appl. Genêt, 104, 1055-1063, 2002).
• the inventors have constructed a BAC (bacterial artificial chromosome) bank from genomic melon DNA homozygous for the V ⁇ t allele favorable to resistance to Aphis gossypii and to resistance to viral transmission by this vector. At the same time, they defined markers more precisely framing the V ⁇ t locus than the markers known in the prior art. Screening of the BAC library using these markers made it possible to identify clones carrying the entire V ⁇ t locus.
• Vat-like gene The sequence of this Vat-like gene is represented in the sequence list in the annex under the number SEQ ID NO: 4.
• the cDNA sequence and the deduced polypeptide sequence are respectively represented in the annex under the numbers SEQ ID NO: 5 and SEQ ID NO: 6.
• Figure 2 shows the sequence alignment between the Vat cDNA and the Vat-like cDNA.
• Vat cDNA comprises 4,422 bp
• Vat-like cDNA only comprises 4,233 bp due to a 195 bp deletion located between positions 3014 and 3210 of the Vat sequence and an addition of 6 bp located between positions 3649 and 3656 of the Vat-like sequence.
• the Vat and Vat-like sequences have 92.4% identity between them.
• FIG. 3 shows the alignment of the sequences of the deduced VAT and VAT-like proteins which consist respectively of 1473 amino acids and 1410 amino acids.
• the VAT and VAT-like sequences show approximately 90% identity between them.
• the Vat gene and Vat-like are genetically and physically linked (17 kb apart). Recombinant plants between Vat and Vat-like have been identified by genetic analysis. Plants carrying only the Vat-like gene are susceptible to colonization and transmission of viruses by A. gossypii. On the contrary, plants carrying only the Vat gene are resistant to colonization and transmission of viruses by A. gossypii. Therefore, the Vat gene is necessary and sufficient to confer the double phenotype described above.
• the subject of the present invention is an isolated polynucleotide chosen from: a) a polynucleotide coding for a polypeptide involved in resistance to the aphid Aphis gossypii and / or to viral transmission by said aphid, which polypeptide has at least 80%, preferably at least at least 90% and most preferably at least 95% identity with the polypeptide SEQ ID NO: 3; b) a polynucleotide complementary to polynucleotide a); c) a polynucleotide capable of hybridizing selectively, under stringent conditions, with the polynucleotide a); or polynucleotide b).
• the percentages of sequence identity indicated here for the nucleotide or peptide sequences refer to the value obtained, on a comparison window constituted by the entire reference sequence, with the BLAST software suite (ALTSCHUL et al. ., Nucleic Acids Res., 25, 3389-3402, 1997) in using the default settings, on a comparison window consisting of the entire reference sequence
• a polynucleotide "coding for" a given polypeptide is defined as any polynucleotide containing the genetic information allowing the synthesis of said polypeptide.
• polynucleotides in accordance with the invention coding for a polypeptide involved in the resistance to the aphid Aphis gossypii and / or to viral transmission by said aphid in particular include the polynucleotide of sequence SEQ ID NO: 1 and the polynucleotide of sequence SEQ ID NO: 2.
• the present invention also includes any fragment of at least 10 bp, preferably at least 20 bp, and most preferably at least 50 bp of a polynucleotide a) or b) above, or capable of selectively hybridizing, under stringent conditions, with a polynucleotide a) or b) above.
• Preferred fragments are those of any of the polynucleotides of sequence SEQ ID NO: 1, SEQ ED NO: 2, SEQ ID NO: 4 or SEQ ID NO: 5 or those capable of hybridizing selectively under stringent conditions with one of these polynucleotides or its complement.
• Other preferred fragments are those of any of the polynucleotides SEQ ID NO: 1 or SEQ ID NO: 2, which are not present in the polynucleotides SEQ ID NO: 4 or SEQ ID NO: 5, or fragments which are capable of hybridizing selectively with one of the polynucleotides SEQ ID NO: 1 or SEQ ID NO: 2, without hybridizing with the polynucleotides SEQ ID NO: 4 or SEQ ID NO: 5.
• Stringent hybridization conditions for a given polynucleotide, can be identified by a person skilled in the art according to the size and the base composition of the polynucleotide concerned, as well as the composition of the hybridization mixture (in particular pH and ionic strength). Generally, stringent conditions, for a polynucleotide of given size and sequence, are obtained by operating at a temperature which is approximately 5 ° C. to 10 ° C. below the melting point (Tm) of the hybrid formed, in the same reaction mixture, by this polynucleotide and its complement.
• Tm melting point
• a polynucleotide capable of hybridizing selectively with a polynucleotide a) or b) according to the invention any polynucleotide which when hybridized under stringent conditions with a melon nucleic acid library (in particular a library of Genomic or cDNA) produces a detectable hybridization signal (i.e. at least 2 times higher, preferably at least 5 times higher than the background noise) with said polynucleotide, but produces no detectable signal with other sequences of said library, and in particular with sequences coding for other proteins of the NBS-LRR family.
• the present invention also relates to polynucleotide probes or amplification primers obtained from polynucleotides a) or b) according to the invention or fragments thereof.
• the present invention also encompasses any polynucleotide encoding a polypeptide involved in resistance to the aphid Aphis gossypii and / or to viral transmission by said aphid, and which can be obtained from a genomic DNA or plant cDNA library by screening said bank using probes or primers according to the invention.
• the present invention also includes genetic markers enabling the detection of the presence or absence in a plant, and in particular in melons, of an allele of the Vat gene favorable to resistance to colonization by the aphid Aphis gossypii and / or resistance to viral transmission by said aphid.
• Genetic markers in accordance with the invention include in particular the following markers: L273, L246, V681, V 1684, V432, GRP805, M8, marker E, marker D.
• the markers E and D are more particularly usable for differentiating the Vat and Vat-like genes in PI161375.
• markers in accordance with the invention are respectively defined by the following primers: L273: F2-B2: GGAGAGAGAATCCGGGACTAAGTGACT (SEQ ID NO: 7)
• F2-Br TAACCACCTTTTCCGATCAAATTTCGTAC (SEQ ID NO: 8)
• L246 F2-B2 Eco: ATTGATTCATCTACT SEQ ID NO: 9)
• V681 GGAATCTTGTTGAGGCCGAGAGGG (SEQ ID NO: 11)
• V681R GTTGTATATGGCTTCCCTGTAGCC (SEQ ID NO: 12)
• V588 CAACAGGCTCAACAGTGTATTCGG (SEQ ID NO: 13)
• V551R GAAGAAGGTGACGAGAGATGCC (SEQ ID NO: 14)
• V432 AACTTCTCCAACTCCCTCCACTGC (SEQ ID NO: 15)
• V432R TTAGAGTGGCAAAGGGAAGATGGG (SEQ ID NO: 16)
• GRP805 GRP805: ATCCCCTGTTTCCTTCAACAACCC (SEQ ID NO: 17)
• GRP805R AACCCCCAAGAAGAAGAACAACCC (SEQ ID NO: 18)
• LRR842R CTCCACTCAGAATTGGTAGGTGCC (SEQ H> NO: 22)
• LRR915 AACAACTTAGAACCATCTCCCAGC (SEQ ID NO: 23)
• LRR1R GTTGTTGAGAGCAATAGTGTACCC (SEQ ID NO: 24)
• Other genetic markers of resistance to aphid A gossypii and / or to viral transmission by said aphid can also be defined from the sequences SEQ ID NO: 1 and SEQ ID NO: 2, by comparing these sequences with their homologs obtained from from plants sensitive to A. gossypii and / or to viral transmission by this aphid, in order to detect the polymorphisms existing between these sequences, and to determine the form associated with resistance and the form associated with sensitivity.
• polymorphisms can be located in the coding regions of the Vat gene, and can result in modifications to the peptide sequence of the protein.
• VAT can also be polymorphisms located in the non-coding 5 ′ region or in the introns of the Vat gene, or polymorphisms located in the coding regions but which do not result in a sequence modification of the VAT protein.
• polymorphism When a polymorphism has been thus identified, it is possible to use it as a genetic marker of resistance or sensitivity, and to define tools (nucleic acid probes, amplification primers, restriction enzymes) making it possible to distinguish its different forms.
• the present invention also encompasses the use of at least one polynucleotide or at least one genetic marker according to the invention for the detection of the presence, in a plant, of an allele of the Vat gene favorable to resistance to the aphid Aphis gossypii and / or to resistance to viral transmission by said aphid.
• the subject of the present invention is in particular a process for evaluating the resistance or the sensitivity of a plant to the aphid Aphis gossypii, and or to viral transmission by said aphid, characterized in that it comprises the determination of the allelic form of the Vat gene present in said plant.
• the present invention also relates to oligonucleotide primers which can be used for the implementation of the detection methods defined above.
• the subject of the present invention is:
• any pair of primers allowing the amplification of a region of the Vat gene comprising at least one polymorphism associated with resistance or sensitivity to Aphis gossypii and / or viral transmission by said aphid;
• kits for implementing a method according to the invention comprise at least one pair of primers in accordance with the invention, optionally associated with reagents allowing the implementation of an amplification reaction, with means for detecting the amplification product, with one or more enzymes. restriction, and / or positive controls and / or negative amplification controls.
• the subject of the present invention is also:
• an expression cassette comprising a polynucleotide in accordance with the invention, and in particular a polynucleotide coding for a polypeptide involved in the resistance to the aphid Aphis gossypii and / or to viral transmission by said aphid, placed under the transcriptional control of a promoter appropriate;
• the present invention also encompasses a method for producing a recombinant polypeptide, characterized in that it comprises the transformation of a host cell, prokaryotic or eukaryotic, with a polynucleotide in accordance with the invention coding for a polypeptide involved in resistance to the aphid Aphis gossypii and / or to viral transmission by said aphid, and the recovery of said polypeptide produced by said cell.
• the subject of the present invention is also a polypeptide involved in resistance to the aphid Aphis gossypii and / or to viral transmission by said aphid, which polypeptide has at least 80%, preferably at least 90% and most preferably at least 95% identity with the polypeptide SEQ ID NO: 3, as well as fragments of at least 5, preferably at minus 10, and most preferably at least 15 consecutive amino acids of said polypeptide.
• the present invention also encompasses host cells genetically transformed with a polynucleotide or an expression cassette in accordance with the invention.
• Host cells can be eukaryotic or prokaryotic cells.
• bacteria in particular E. coli or Agrobacterium, yeasts, for example Saccharomyces, animal cells or, preferably, plant cells.
• the present invention also encompasses transgenic plants genetically transformed with a polynucleotide according to the invention.
• the genetic transformation of plants with a polynucleotide in accordance with the invention makes it possible to obtain transgenic plants resistant to the aphid Aphis gossypii and / or to viral transmission by said aphid.
• the present invention thus relates to the use of a polynucleotide in accordance with the invention, for increasing the resistance of a plant to the aphid Aphis gossypii.
• a more particular subject of the present invention is therefore a process for the production of a transgenic plant resistant to the aphid Aphis gossypii and / or to viral transmission by said aphid, characterized in that it comprises the genetic transformation of said plant by a polynucleotide according to the invention.
• Said plant is advantageously chosen from species sensitive to Aphis gossypii, in particular from cucurbits such as melon, cucumber or zucchini, or malvaceae such as cotton or hibiscus, or from species sensitive to viruses transmitted by A gossypii, especially among nightshades such as tomatoes or peppers.
• overexpression of the Vat gene at a high level can lead to constitutive resistance of the plant against more varied pathogens in melons or in other plant species (cucurbits, solanaceae or malvaceae).
• this over-expression can allow the plant to recognize aphids phylogenetically distant from Aphis gossypii or confer low constitutive resistance which will delay the infectious cycle of pathogens in general.
• a strong promoter 35S
• the genetic transformation of plants can be carried out by conventional methods known in themselves to those skilled in the art.
• GUIS et al. Biotechnology and Genetic Engineering Reviews, 15, 289-311, 1998; Scientia horticulturae, 84, 91-99, 2000.
• PANNETIER et al. Euphytica, 96, 163-166, 1997.
• HAMZA and CHUPEAU J. Exp. Bot., 44, 1837-1845, 1993).
• plants having increased resistance to the aphid Aphis gossypii and / or to viral transmission by said aphid can be obtained by site-directed mutagenesis, in order to introduce into the allele of the Vat gene present in said plants the modifications necessary to confer this resistance.
• the invention also relates to the transformed plants obtained by a process of transgenesis or of directed mutagenesis according to the invention, as well as the descendants of these plants.
• the invention also encompasses the products obtained from these plants, such as plant organs or tissues, cells, seeds, etc.
• BAC bank of melon genomic DNA (variety PI 161375 resistant to Aphis gossypii and to viral transmission by this aphid) representing approximately 29 genome equivalents were constructed.
• the first part of the BAC library comprises 66,048 clones (DNA digested with BamHI, HindIII), the second 56,448 clones (DNA digested with EcoR).
• the marker L273 is defined by the primers: F2-B2: GGAGAGAGAATCCGGGACTAAGTGACT (SEQ ID NO: 7) and F2-Br: TAACCACCTTTTCCGATCAAATTTCGTAC (SEQ ID NO: 8)
• the amplification product obtained from genomic DNA from the Védrantais variety (Vilmorin) (sensitive to Aphis gossypii) or from the PI 161375 variety (accession of Korean origin multiplied by INRA) (resistant to A. gossypii) has a length of 210 bp.
• the amplification product has a BsiWl restriction site in the PI 161375 variety, leading to the production of two fragments of 181 bp and 29 bp.
• digestion by the enzyme BsrGl restricts the amplification of Védrantais into three fragments: 153 bp, 28 bp and 29 bp and that of PI 161375 into two fragments of 182 bp and 28 bp.
• the L246 marker is defined by the primers:
• F2-B2 Eco ATTGATGAATCTACACTCCTCGATCTCTTC (SEQ ID NO: 9) and
• the amplification product obtained from the genomic DNA of the Védrantais variety or of the PI 161375 variety is 173 bp long.
• the amplification product of the variety PI 161375 has a restriction site for the enzyme EcoRV leading to the production of two fragments of 144 bp and 29 bp respectively.
• oligonucleotides (Table 1) were designated in the region between these two markers in order to reduce the interval and precisely delimit the gene Vat.
• the V432 marker is defined by the primers:
• V432 AACTTCTCCAACTCCCTCCACTGC (SEQ ID NO: 15) and
• V432R TTAGAGTGGCAAAGGGAAGATGGG (SEQ ID NO: 16)
• the amplification product obtained from the genomic DNA of the Védrantais variety or of the PI 161375 variety has a length of 432bp.
• the amplification product of the variety PI 161375 has a restriction site for the Haell enzyme leading to the production of two fragments of 223 bp and 209 bp respectively. This restriction site is absent in the Védrantais variety.
• the marker V681 is defined by the primers:
• V681 GGAATCTTGTTGAGGCCGAGAGGG (SEQ ID NO: 11) and
• V681R GTTGTATATGGCTTCCCTGTAGCC (SEQ ID NO: 12)
• the amplification product obtained from the genomic DNA of the Védrantais variety or of the PI 161375 variety has a length of 681 bp.
• the amplification product of the variety PI 161375 has two restriction sites for the enzyme
• the marker VI 684 is defined by the primers: V588: CAACAGGCTCAACAGTGTATTCGG (SEQ ID NO: 13) and
• V551R GAAGAAGGTGACGAGAGATGCC (SEQ ID NO: 14)
• the amplified fragment in the Védrantais variety measures approximately 1300 bp while in the PI161375 variety, the amplifier measures 1684 bp. In this case, it is a large polymorphism.
• markers as well as markers D, E, and M8 (cf. example 4 below) and the oligonucleotides defining them are indicated in Table 1 below:
• the plant P26 64 presents a recombination event between the marker V432 and the Vat gene.
• the plant P49 40 exhibits a recombination event between the marker L246 and the Vat gene.
• Plant P10 35 exhibits a recombination event between marker VI 684 and the Vat gene.
• marker VI 684 includes the ATG of the Vat gene, this plant exhibits an intragenic recombination destroying the function of the gene.
• V681 marker co-segregates with the Vat gene. These data therefore make it possible to genetically identify the Vat gene.
• a subcloning Vat gene was performed in the vector pGEM ® 3Zff (Promega). To do this, digestion of the clone BAC 3-18-9 with the restriction enzyme Mscl was carried out. Each fragment thus generated was ligated into the vector pGEM 3Zf + (Promega) and then screened with the markers flanking the Vat gene or internal to this gene.
• the cDNA was obtained using the Marathon TM cDNA clone kit, (Clontech). This cDNA is represented on the annexed sequence list under the number SEQ ID NO: 2.
• the Vat gene has 4 exons and 3 introns:
• the first exon has 2367bp and extends from base 1 of the ATG initiation codon (corresponding to position 2344 according to SEQ ID NO: 1) to base 2367 (corresponding to position 4710 according to SEQ ID NO: 1).
• the first intron extends from base 2368 to base 2921 (4711 to 5264 according to SEQ ID NO: 1).
• the second exon extends from base 2922 to base 4055 (5265 to 6398 according to SEQ ID NO: 1).
• the second intron extends from base 4056 to base 4876 (6399 to 7219 according to SEQ ID NO: 1).
• the third exon extends from base 4877 to base 5734 (7220 to 8077 according to SEQ ID NO: 1).
• the third intron extends from base 5735 to base 5833 (8078 to 8176 according to SEQ ID NO: 1).
• the fourth exon extends from base 5834 to base 5896 (8177 to 8239 according to SEQ ID NO: 1).
• F ⁇ t-like a clone carrying a homolog of the Vat gene (F ⁇ t-like) was identified (93.8% identity at the nucleic level and 89.9% at the protein level).
• the F ⁇ t-like sequence is represented in the sequence list in the appendix under the number SEQ ID NO: 4.
• Vat and Vat-like genes are genetically and physically linked since they are 17 kb apart.
• Marker D is defined by the primers: LRR1: CCTTAGAAGAAGATGAAGTCTCCC (SEQ ID NO: 21) and
• LRR842R CTCCACTCAGAATTGGTAGGTGCC (SEQ ID NO: 22) This marker makes it possible to amplify in PI 161375 a fragment of 1722 bp corresponding to the Vat gene, and a fragment of 1527 bp corresponding to the Vat-like gene.
• the amplification product obtained from the genomic DNA of the Védrantais variety has an agarose gel length of approximately 1.3 kb.
• Marker D is defined by the primers: LRR915: AACAACTTAGAACCATCTCCCAGC (SEQ ID NO: 23) and LRR1R: GTTGTTGAGAGCAATAGTGTACCC (SEQ ID NO: 24)
• This marker makes it possible to amplify in PI161375 a fragment of 1549 bp corresponding to the Vat gene and a fragment of 1372 bp corresponding to the Vat-like gene.
• the marker makes it possible to amplify 4 DNA fragments of approximately 750 bp, 900 bp, 1100 bp, 1300 bp.
• the markers L246 and M8 make it possible to characterize recombinants between the Vat gene and the Vat-like gene and to genetically distinguish these two genes.
• the M8 marker is defined by the primers: M8: CCGACGCATCTCCCGACGCGTTGTTG (SEQ ID NO: 19) and
• the amplification product obtained from genomic DNA of the Védrantais variety and PI 161375 has a length of 228 bp.
• the amplification product of the variety PI 161375 has a restriction site for the enzyme Aatll leading to the production of two fragments of 195 bp and 33 bp respectively.
• Vat and Vat-like genes have been identified within the backcross population [FI (Védrantais x PI 16135) x Védrantais]. Plants carrying only the Vat-like gene are sensitive to Aphis gossypii, for example, plant 848 (Table 2). Conversely, plants not having the Vat-like gene are resistant to A. gossypii aphids, for example the plant P4940 (Table 2).
• the genomic DNA of the Vat gene without its promoter is introduced into the binary vector pBin 61 (BENDAHMANE et al, The Plant Journal 32, 195-204, 2002; sequence also available on the site http: //www.sainsbury-laboratory. ac.uk/david-baulcombe / Services / pBin ⁇ l.doc) containing in particular the chimeric NOS / NPTII gene, the kanamycin resistance selection marker and the p35S promoter.
• the Vat gene in sense orientation is introduced after the p35S promoter.
• the vector pBin ⁇ l is introduced into different strains of Agrobacterium tumefaciens (LBA4404, C58Cl-pch32)
• the complete genomic DNA comprising approximately 2.5 kb upstream and downstream of the Vat gene in order to ensure the presence of the promoter and regulatory sequences, is introduced with blunt ends into the vector SLJ7292 (JONES and a , Transgenic Research, 1, 285-30297, 1992) and pBin 19 (BEVAN et a, Nucleic Acids Res 12: 8711-8721, 1984).
• the binary vectors SLJ7292 and pBin 19 containing the Vat gene are introduced into different strains of Agrobacterium tumefaciens (LBA4404, C58Cl-pch32, C58Cl-pMP90) (SCHWEITZER et al, Plasmid, 4 (2), 196-204, 1980; GOODNER and al, Science, 294 (5550), 2323-2328, 2001), or C58pGV2260 (DEBLAERE. et al., Nucleic Acids Res. 13, 4777-4788, 1985).
• Table 3 shows the constructions used depending on the plants.
• Young explants of sensitive melon leaves of the Védrantais variety are incubated with shaking in a suspension of Agrobacterium tumefaciens (10 6 to 10 8 cells / mL), for 30 minutes.
• the transformations are carried out with the constructions described in Example 5.
• the potentially transformed explants are then transferred to Whatman paper No. 1 for 10 minutes, then incubated for 2 days at 27 ° C. in the dark on a coculture medium containing l ⁇ M of 6-benzylaminopurine (BAP), l ⁇ M of 6- (g, g- dimethylallylamino) -purine (2iP), 0.2mM of acetosyringone and 0.7g.L _1 of agar.
• BAP 6-benzylaminopurine
• 2iP l ⁇ M of 6- (g, g- dimethylallylamino) -purine
• the regeneration of leaf explants is obtained using the conditions described by KATHAL et al. (Plant Cell Reports, 7, 449-451, 1988) with some modifications.
• the leaf explants are transferred to a regeneration medium composed of MURASHIGE and SKOOG medium (MS) (Physiol. Plant, 15, 473-497, 1962) supplemented with 1 ⁇ M of 6-benzylaminopurine (BAP), 1 ⁇ M of 6- (g, g-dimethylallylamino) -purine (2iP), containing 100 mg.L "1 of kanamycin and 225 mg.L _1 of timentin and solidified in agar 0.7g.L _1 .
• the buds formed on the leaf explants are excised and incubated on a development medium constituted by the MS medium supplemented with 1 ⁇ M of BAP and 0.3 ⁇ M of gibberelic acid (GA3) containing 100 mg.L "1 of kanamycin and 225 mg.L _1 of timentin and solidified in 0.7g.L 'of agar.
• the buds are then placed in the rooting medium constituted by the MS medium without growth regulator and containing the same amounts of antibiotics and agar.
• the PCR conditions are as follows:
• Reaction mixture water qs lO ⁇ L; 10X l ⁇ L buffer; dNTP's (4mM) 0.6 ⁇ L; primer 1 (10 pM) 0.4 ⁇ L and primer 2 (10 pM) 0.4 ⁇ L; Taq Takara (5U / ⁇ L) 0.08 ⁇ L; DNA 1.2 ⁇ L.
• step 1 2 min at 94 ° C step 2 denaturation: 30 sec at 94 ° C step 3 pairing: 45 sec at 60 ° C step 4 elongation: 2 min at 72 ° C step 5: 30 cycles from step 2 to step 4 step 6: 10 min at 72 ° C b-
• step 1 2 min at 94 ° C step 2 denaturation: 30 sec at 94 ° C step 3 pairing: 45 sec at 60 ° C step 4 elongation: 2 min at 72 ° C step 5: 30 cycles from step 2 to step 4 step 6: 10 min at 72 ° C b-
• Kana II 5'-CCGGCTACCTGCCCATTC-3 '(SEQ ID NO: 25) and Kana III: 5'-GCGATAGAAGGCGATGCG-3' (SEQ ID NO: 26) are used under the following conditions:
• step 1 2 min at 94 ° C step 2 denaturation: 30 sec at 94 ° C step 3 pairing: 1 min at 53 ° C step 4 elongation: 1 min at 72 ° C step 5: 30 cycles from step 2 to step 4 step 6: 10 min at 72 ° C.
• step 2 2 min at 94 ° C step 2 denaturation: 30 sec at 94 ° C step 3 pairing: 1 min at 53 ° C step 4 elongation: 1 min at 72 ° C step 5: 30 cycles from step 2 to step 4 step 6: 10 min at 72 ° C.
• PicA + primers ATGCGCATGAGGCTCGTCTTCGAG; SEQ ID NO : 27
• PicA " GCGCAACGCATCCTCGATCAGCT; SEQ ID NO: 28
• construction B1-1 are identified as carriers of the insert containing the nptll and Vat genes.
• the rooted diploid plants are cuttings in vitro on medium devoid of antibiotics, then weaned and acclimatized in an air-conditioned room (8h night at 18 ° C-16h day at 24 ° C) for 4 weeks before carrying out the biological tests.
• Nml clone collected from melons G. LABONNE, INRA, Montpellier
• clone 13 LUPOLI et al, Entomologia Experimentalis and Applicata, 65, 291-300, 1992
• Aphids A. gossypii are reared on Védrantais melons in a culture chamber (16 hours of day at 24 ° C and 8 hours of night at 18 ° C).
• the colonization resistance test by A. gossypii is adapted from PITRAT and LECOQ (Phytopathology, 70, 958-961, 1980). Wingless adults are removed with a fine brush and fasted for 1 hour in a petri dish. Ten aphids are placed on two spread sheets of each plant to be tested. 48 hours after deposit, the number of aphids attached to the leaves is counted. At 48 hours, on susceptible plants the 10 deposited aphids are fixed while on resistant plants only a few aphids (generally less than 5) remain on the leaves. Then 7 days after infestation, the number of adult aphids and larvae, as well as their stage of development is observed.
• the sensitive control used is the Védrantais cultivar and the resistant control is the cultivar Margot homozygous for the Vat locus.
• 3 aphids can be placed instead of 10 on the leaves of each plant to be tested. Aphids can be kept in a cage or not. Seven days after the aphids were deposited, the number of adult aphids and larvae present on the plants were counted.
• CMV Cucumber Mosaic Virus
• strain II 7F can be used for transmission tests by A. gossypii in transformed plants and Védrantais and Margot control lines. The virus is multiplied on Védrantais melons by mechanical inoculation. After 1 hour lunch, the adult aphids are deposited for 5 minutes of acquisition on the virose leaves placed in a Petri dish. The aphids are then transferred to the plants to be tested.
• the aphids are removed with a brush and then the plants are treated with an insecticide and placed in a culture chamber (12 hours of day at 24 ° C and 12 hours of night at 18 ° C). Fifteen days after inoculation, plants sensitive to CMV transmission by A. gossypii develop severe mosaic symptoms. Resistant plants have no symptoms and the virus is not detected by ELISA in these plants.
• the ELISA test follows the protocol described by CLARK and ADAMS (J. Gen. Virol, 34, 475-483, 1977) with an antibody directed against the capsid protein of CMV (ADGEN, supplied by the company LCA, Bordeaux, France) .
• the transformation protocol is adapted from HAMZA and CHUPEAU (J. Exp. Bot., 44, 1837-1845, 1993) by P. Rousselle (INRA, Montfavet, France) from cotyledons of several Férum genotypes (INRA line), and Montfavet 63.5 (FI hybrid).
• the strains used for the transformation are those described in Example 5.
• the regenerated and rooted plants are analyzed by flow cytometry and only the diploid plants are preserved. Molecular analyzes intended to verify the presence of
• Pinsert containing the nptll gene and the Vat gene as well as its expression in the genome of the regenerated plants are carried out by PCR and RT-PCR.
• the PCR conditions used are identical to those described in Example 6.
• Four pairs of primers were used: V1684 (SEQ ID No. 13 and SEQ ID No. 14) located at the level of the Vat promoter, the pairs of primers markers D (SEQ ID No 23 and SEQ ID No 24) and E (SEQ ID No 21 and SEQ ID No 22) located in the middle of the Vat gene and primers V632 which amplify a fragment located 3 'to the uncomfortable.
• V632 primers are as follows: Vat 632R: CTGGTGATGACATTCATATCTTCC (SEQ ID NO: 29) Vat 632F: CCCAGCAACATACTGATTCCAAGC (SEQ ID NO: 30) Several series of transformations are carried out on tomatoes from the different constructions (Table 8) and on two different genotypes Ferum and Montfavet (INRA).
• Vat gene including the marker V1684.
• V1684 (located on a region of the Vat promoter) does not make it possible to screen the transformants.
• the set of primers used on the transformed plants of the Montfavet genotype makes it possible to determine 14 plants coming from different explants having integrated all of the transgene.
• the same strain of A. gossypii (Nml) and the same transmission protocol by A. gossypii as for tests for resistance to transmission of the virus to melon are used.
• the virus chosen is the CMV (cucumber mosaic virus) strain II 7F which infects melons and tomatoes. This strain is effectively transmitted to the tomato, when it is inoculated mechanically or transmitted by Myzus persic ⁇ e (JACQUEMOND et ⁇ /., Molecular Breeding, 8 (1), 85-94, 2001).
• the virus is multiplied on Védrantais melon seedlings.
• the acquisition of CMV by A. gossypii is made on these infected melon seedlings.
• Transmission is done on tomato seedlings from in vitro at the 5 leaf stage or on seedlings from sowing at the 2 leaf stage (about 5 weeks after sowing) by depositing 10 viruliferous aphids on each plant.
• the transmission rate on each genotype (control and transformed tomatoes) is evaluated on at least 2 repetitions of 20 plants.
• the sensitive control variety is the Ferum variety.
• the ELISA test follows the protocol described by CLARK and AD AMS (J. Gen. Virol., 34, 475-483, 1977) with an antibody directed against the capsid protein of CMV (ADGEN, supplied by the company LCA, Bordeaux, France).
• the plants of the T1 code, carrying a truncated Vat gene, and those of the sensitive control are 100% infected.
• the virus was not transmitted, which suggests that the Vat gene would have an effect on resistance to viral transmission by A. gossypii in transgenic tomatoes having integrated Vat.
• the genetic transformation of cotton is based on the regeneration of transformants via a somatic embryogenesis process published by SHOEMAKER et al. (Plant Cell Reports, 3, 178-181, 1986) and by TROLINDER and GOODIN (Plant Cell Reports, 6, 231-234, 1987).
• This transformation process uses the bacterium Agrobacterium tumefaciens as a transformation vector according to UMBECK et al. (Biotechnology, 5, 263-266, 1987) and FIROOZABADY et al. (Plant Molecular Biology, 10, 105-116, 1987) with some modifications and adaptations compared to the publications mentioned.
• the Agrobacteria strains used for the transformation are the same as those described in Example 5 and in particular the LBA4404, C58ClpGV2260 and C58ClpMP90 strains.
• the first strain contains either the plasmid pSLJ7292 composed inter alia of the kanamycin resistance gene under the control of the Nos promoter and the Vat gene under the control of its own promoter, namely the plasmid pBin 61 which comprises the Vat gene under the control of the 35S promoter.
• the other two strains carry the plasmid pBin19 composed, inter alia, of the kanamycin resistance gene under the control of the Nos promoter and the Vat gene under the control of its own promoter.
• Explants of hypocotyls taken from young plants cultivated under aseptic conditions are used. They are placed in the presence of the Agrobacterium for 20 minutes then cultured for 48 hours on a culture medium (base medium) composed of the mineral elements of MURASHIGE and SKOOG (MS), 30 g L "1 of glucose, the vitamins from MOREL and WETMORE (Am. J. Bot. 38, 141-143, 1951), 0.1 to 0.05 mg L "1 of 2,4 dichlorophenoxyacetic acid and 0.1 to 0.01 mg L " 1 of kinetin. This medium contains no selection agent or antibiotic intended to stop the growth of the bacteria.
• base medium composed of the mineral elements of MURASHIGE and SKOOG (MS), 30 g L "1 of glucose, the vitamins from MOREL and WETMORE (Am. J. Bot. 38, 141-143, 1951), 0.1 to 0.05 mg L "1 of 2,4 dichlorophenoxyacetic acid and 0.1 to 0.01 mg L " 1 of kinetin.
• This medium contains
• the explants are subcultured on the same medium supplemented with kanamycin at a concentration of 25 mg L " 1 and cefotaxime at a concentration of 500 mg L "1.
• the explants are then subcultured every 15 days on this same medium. Calluses resulting from the proliferation of transformed cells appear after 3 to 5 weeks of culture. When their size reaches approximately 0.5 cm in diameter, they are isolated and transplanted onto the same medium in which the cefotaxime concentration has been reduced by half and the concentration of growth substances (2,4 dichlorophenoxyacetic acid and kinetin) has also been reduced.
• the subcultures then take place every 2 weeks until the appearance of the embryonic tissues.
• sequences of media varying for the concentration of growth substances can be applied.
• the embryonic tissues are isolated from the base medium without the addition of growth substances. On this medium a certain proportion of the pro-embryos develops into seedlings. The latter are transferred into a tube on a vermiculite support "sprinkled" by the liquid base medium devoid of growth substances and where sucrose replaces glucose. When they reach a size of around 4-6 cm, they are directly transferred to the S2 greenhouse.
• the molecular analysis intended to verify the presence of the Vat gene and its expression in the genome of the regenerated plants is carried out by PCR.
• a pair of primers is used to amplify the npt IL gene
• Two pairs of primers were used for the Vat gene: the first pair called 632 amplifies a fragment of Vat located 3 ′ of the gene, the second called LRR amplifies a fragment located in the middle of the gene.
• sequences of the pair of primers used to amplify the npt11 gene are as follows:
• the sequences of the primer pair 632 are as follows: Vat632F: CCCAGCAACATACTGATTCCAAGC (SEQ ID NO: 30) Vat632R: CTGGTGATGACATTCATATCTTCC (SEQ ID NO: 29) The sequences of the LRR primer pair are as follows:
• LRR F GTTGTTGAGAGCAATAGTGTAC (SEQ ID NO: 32)
• LRR R CCTTAGAGAAGAATGAAGTCTC (SEQ ID NO: 33)
• the PCR conditions are as follows, whatever the primers used: For 25 ⁇ L of reaction medium:
• Oligo 1 (10 ⁇ M): 2.5 ⁇ L Oligo 2 (10 ⁇ M) 2.5 ⁇ L
• a clone of A. gossypii taken from cotton (Reunion Island origin) is used and maintained on cotton. Indeed, it has been shown that populations ⁇ 'A. gossypii are strongly structured genetically according to the host plant (VANLERBERGHE-MASUTTI and CHAVIGNY, Molecular Ecology, 7, 905-914, 1998). The test is carried out according to the same protocol as on melon but with plant culture conditions suitable for cotton. Cotton plants are kept in greenhouse type S2 at a temperature of 28 ° C to 30 ° C, additional lighting, in intensity and duration, is provided for a photoperiod of 12-12.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Biomedical Technology (AREA)
• Biophysics (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Zoology (AREA)
• Pest Control & Pesticides (AREA)
• Gastroenterology & Hepatology (AREA)
• Physics & Mathematics (AREA)
• Cell Biology (AREA)
• Plant Pathology (AREA)
• Insects & Arthropods (AREA)
• Botany (AREA)
• Microbiology (AREA)
• Medicinal Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Saccharide Compounds (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=32524849

Family Applications (1)

Country Status (13)

Families Citing this family (12)

Family Cites Families (2)

• 2003
  • 2003-01-13 FR FR0300287A patent/FR2849863B1/fr not_active Expired - Fee Related
• 2004
  • 2004-01-12 AR ARP040100071A patent/AR042841A1/es unknown
  • 2004-01-13 CN CNA200480004223XA patent/CN1751065A/zh active Pending
  • 2004-01-13 BR BR0406754-1A patent/BRPI0406754A/pt not_active IP Right Cessation
  • 2004-01-13 EP EP04701619A patent/EP1585759A1/de not_active Withdrawn
  • 2004-01-13 AU AU2004210748A patent/AU2004210748B2/en not_active Ceased
  • 2004-01-13 MX MXPA05007538A patent/MXPA05007538A/es unknown
  • 2004-01-13 JP JP2006502094A patent/JP2007527694A/ja active Pending
  • 2004-01-13 US US10/542,337 patent/US7576264B2/en not_active Expired - Fee Related
  • 2004-01-13 WO PCT/FR2004/000050 patent/WO2004072109A1/fr active Application Filing
  • 2004-01-13 CA CA002512644A patent/CA2512644A1/fr not_active Abandoned
• 2005
  • 2005-07-12 IL IL169653A patent/IL169653A0/en unknown
  • 2005-07-12 ZA ZA200505616A patent/ZA200505616B/xx unknown

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events