EP1474519A2 - Mikroorganismus zur gentherapeutischen behandlung proliferativer erkrankungen - Google Patents

Mikroorganismus zur gentherapeutischen behandlung proliferativer erkrankungen

Info

Publication number
EP1474519A2
EP1474519A2 EP03704314A EP03704314A EP1474519A2 EP 1474519 A2 EP1474519 A2 EP 1474519A2 EP 03704314 A EP03704314 A EP 03704314A EP 03704314 A EP03704314 A EP 03704314A EP 1474519 A2 EP1474519 A2 EP 1474519A2
Authority
EP
European Patent Office
Prior art keywords
microorganism
tumor
oder
expression
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03704314A
Other languages
English (en)
French (fr)
Inventor
Werner Goebel
R. Ulf Rapp
Hans-Harald Sedlacek
Joachim Fensterle
Ivaylo Gentschev
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aeterna Zentaris GmbH
Original Assignee
Zentaris AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zentaris AG filed Critical Zentaris AG
Publication of EP1474519A2 publication Critical patent/EP1474519A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01031Beta-glucuronidase (3.2.1.31)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76Albumins
    • C07K14/765Serum albumin, e.g. HSA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2434Glucanases acting on beta-1,4-glucosidic bonds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/16Exonucleases active with either ribo- or deoxyribonucleic acids and producing 3'-phosphomonoesters (3.16)
    • C12Y301/16001Spleen exonuclease (3.1.16.1), i.e. 5->3 exoribonuclease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the invention relates to a microorganism with foreign nucleotide sequences, by means of which expression products having an antiproliferative or cytotoxic effect can be expressed, and the use of such microorganisms for the production of pharmaceutical compositions, a plasmid and a method for producing such a microorganism, and uses of such microorganisms.
  • Microorganisms reduced in their virulence such as genetically modified viruses or bacteria attenuated in their virulence, are becoming increasingly important as carriers of foreign nucleic acid sequences in the context of gene therapy.
  • the foreign nucleic acids are either introduced into tissue cells in vitro and these cells are administered to the patient, or the microorganisms are injected into the patient in the expectation that the microorganisms, as gene transporters, will transfer the foreign nucleic acid into the desired tissue cell.
  • Microorganisms are particles. After injection into an organism, these particles are mainly absorbed by the so-called reticuloendothelial system. In order to achieve an enrichment of the microorganisms used as gene transporters in a target tissue despite this elimination mechanism, the microorganisms were equipped with cell-specific ligands. So far, the elimination of the Microorganisms are only slightly reduced by the reticuloenothelial system. -
  • a key research goal of gene therapy is the therapy of proliferative diseases, such as tumors, leukemias, chronic inflammation, autoimmune diseases and rejection of transplanted organs, the treatment of which, despite all the successes in drug therapy, is still inadequate.
  • proliferative diseases such as tumors, leukemias, chronic inflammation, autoimmune diseases and rejection of transplanted organs
  • the treatment of which, despite all the successes in drug therapy, is still inadequate for example, despite all the successes of surgery, radiotherapy, chemotherapy and also immunotherapy in the treatment of tumors, it has so far not been possible to cure advanced tumors of the head and neck, the central nervous system, the mammary gland, the lungs, and the gastrointestinal tract , the liver, the pancreas, the kidney, the skin, the ovaries and the prostate.
  • the reasons for this inadequate success of tumor therapy are varied and not yet fully known.
  • the main reasons include i) pre-existing (primary) resistance of the tumor cells to the concentrations of chemotherapeutic agents, radiation or immunotherapeutic agents that can be achieved in vivo, ii) resistance to the respective therapeutic agent that arises in response to the therapy.
  • tumor therapeutics include, iv) an excessively high volume of distribution, v) inadequate accumulation on the tumor or on the tumor cells, vi) inadequate penetration ability in the tumor and / or vii) the toxic effect on the entire organism, which is a Increased dose limits for increased tumor accumulation.
  • Tumor cell-specific ligands for example antibodies or their cleavage products, coupled to cytostatics, to antitumoral cytokines, to cytotoxic proteins, or to isotopes did indeed lead to an accumulation of the cytotoxic active substances on the tumor compared to
  • amplification systems were designed with the help of which the concentration of the respective active substance on the tumor could be increased.
  • the aim of an amplification system was to introduce into the tumor those enzymes which were not generally accessible or foreign in the rest of the body and which in turn could convert or split a non-toxic precursor of a cytostatic into the cytotoxically active cytostatic in the tumor.
  • the enzymes were introduced into the tumor either by the administration of tumor cell-specific ligands coupled to these enzymes (for example in the form of Antibody-Derived Enzymemediated Prodrug Therapy; ADEPT) or by Administration of genes for these enzymes with the aid of tumor cell-specific or non-specific vectors (Gene Derived Enzyme-Mediated Prodrug Therapy; GDEPT) (Sed- lacek et al., Contributions to Oncology 43: 1-145, 1992; Sedlacek, Critical Reviews in Oncology / He atology 37: 169-215, 2001; McCormick Nature Reviews Cancer 1: 130-141,2001; Carter, Nature Reviews Cancer 1: 18-129,2001).
  • GDEPT Gene Derived Enzyme-Mediated Prodrug Therapy
  • Another amplification system is based on the induction of an immune reaction against tumor cells, in the course of which specific antibody-forming cells and cytotoxic cells proliferate.
  • Tu or ⁇ ntigen are administered in a suitable preparation. The aim is to break the immune tolerance that is evident in tumor patients to his tumor and / or resistance of his tumor to his own immune response.
  • a technique has been developed to express expression products of nucleic acid sequences introduced into bacteria on the cell membrane of these bacteria or to have them secreted.
  • This technique is based on the Escherichia coli hamolysin system HlyAs, which is the prototype of a type I secretion system for Gram-negative bacteria.
  • HlyAs secretion vectors were developed that enable protein antigens to be efficiently discharged into Samonella enterica, Yersinia enterocolitica and Vibrio cholerae.
  • Such secretion vectors contain the cDNA of any protein antigen coupled to the nucleotide sequence for the HlyA signal peptide, for the Hamolysm secretion apparatus, hlyB and hlyD and the hly-specific promoter. With the help of this secretion vector, a protein can be expressed on the surface of this bacterium.
  • Such genetically modified bacteria induce as vaccines a much stronger immune protection than bacteria in which the protein expressed by the introduced nuclear acid remains inside the cell (Donner et al EP 1015023 A, Gentschev et al, Gene, 179: 133-140, 1996; Vac - cine 19: 2621-2618, 2001, Hess et al PNAS 93: 1458-1463, 1996).
  • the disadvantage of this system is that the amount of the protein expressed on the outer surface of the bacterium is extremely small due to the use of the hly-specific promoter.
  • Mammalian cells from carrier bacteria such as Salmonella and Listeria monocytogenes have been developed. Genes contained in these plasmids could also be expressed in the mammalian cells if they were under the control of a eukaryotic promoter. Plasmids were introduced into Listeria monocytogenes germs which contain a nucleotide sequence for any antigen under the control of any eukaryotic promoter.
  • Virulence-attenuated variants of bacteria that colonize intracellularly have been developed.
  • Listeria monocytogenes, Salmonella enterica sv. Typhimuriu and Typhi, as well as BCG such variants are already used as well-tolerated live vaccines against typhoid and tuberculosis.
  • These bacteria, including their attenuated mutants, are generally immunostimulatory and can trigger a good cellular immune response.
  • L stimulates. monocytogenes particularly through the activation of TH1 cells the proliferation of cytotoxic lymphocytes.
  • These bacteria deliver secreted antigens directly into the cytosol Antigen-presenting cells (APC; macrophages and dendritic cells), which in turn express the costing molecules and trigger an efficient stimulation of T cells.
  • APC cytosol Antigen-presenting cells
  • the Listeria are partially broken down in phagosomal compartments and the antigens produced by these carrier bacteria can therefore be presented on the one hand via MHC class II molecules and thus lead to the induction of T helper cells.
  • the listeria replicate in the cytosol of APCs; Antigens produced and secreted by these bacteria are therefore preferably presented via the MHC class I route, which induces CTL responses against these antigens.
  • Virulence-attenuated Salmonella enterica strains into which nucleotide sequences coding for tumor antigens had been introduced, were able to provide specific protection against different experimental tumors as oral antigen-expressing bacterial carriers (Medina et al., Eur J Immunol 30: 768- 777, 2000, Zoller and Christ J Immunol 166: 3440- 3450, 2001; Xiang et al. , PNAS 97: 5492-5497, 2000).
  • Recombinant SaJmonelJa strains were also effective as a prophylactic vaccine against viral infections (HPV) infections (Benyacoub et al., Infect Immun 67: 3674-3679, 1999) and for the therapeutic treatment of a mouse tumor immortalized by a tumor virus (HPV) (Revaz et al., Virology 279: 354-360, 2001).
  • HPV viral infections
  • Salmonella strains were selected that colonize specifically selected tumor tissues (Murray et al j Bacteriol 183: 5554-5564, 2001).
  • the invention is based on the technical problem of specifying a pharmaceutical composition which has an increased effectiveness in the treatment of proliferative diseases, in particular in tumor therapy.
  • the invention teaches a coated microorganism, in the genome of which the following components are inserted and expressible: I) a nucleotide sequence coding for a direct or indirect, antiproliferative or cytotoxic expression product or for several different ones
  • Expression products II) a nucleotide sequence which codes for a blood plasma protein under the control of an activation sequence which can be activated in the microorganism or which is constitutively active, III) optionally, a nucleotide sequence which codes or constitutes for a cell-specific ligand under the control of an activation sequence which can be activated in the microorganism is active, IV) a nucleotide sequence for a transport system which the expression of the expression products of components I) and II) and optionally III) on the outer surface of the microorganism or the secretion of the expression products of component I) and expression of component II) and optionally III) and preferably constitutively active, V) optionally a nucleotide sequence for a protein for lysing the microorganism in the cytosol of mammalian cells and for the intracellular release of plasmids with at least one or more of the components I) and VI) contained in the lysed micro organism, and VI) an activation sequence which can be
  • coated microorganisms are preferably described as carriers for genetic information and the use of these covered microorganisms for the prophylaxis and therapy of a proliferative disease.
  • the invention is based on the following experiences and technical developments.
  • the invention thus preferably relates to coated microorganisms as carriers for nucleotide sequences for the treatment of proliferative diseases, the following components having been inserted into the microorganisms: I) at least one nucleotide sequence, coding for at least one directly or indirectly antiproliferative or cytotoxic expression product, II) at least one nucleotide sequence which codes for at least one blood plasma protein under the control of at least one activation sequence which can be activated in the microorganism, III) optionally at least one nucleotide sequence which codes for at least one cell-specific ligand under the control of at least one activation sequence which can be activated in the microorganism, IV) at least one nucleotide sequence for at least one transport system, which the expression of the expression products of components I), II) and III) on the outer surface of the microorganism or the secretion of the compo components I), allows II) and III), V) optionally at least one nucleotide sequence for minde ⁇ least one protein
  • Component I is at least one nucleotide sequence, coding for at least one expression product which has a direct or indirect antiproliferative or cytotoxic expression product.
  • Expression products having a direct antiproliferative effect in the sense of the invention are, for example, interferons such as, for example, IFN-alpha, IFN-gamma, IFN- ⁇ , interleukms which inhibit immune cells or tumor cells, such as IL-10, IL-12, proapoptotic peptides or proteins such as for example TNF-alpha, FAS ligand, TNF-related apoptosis inducing ligand (TRAIL), antibodies or fragments of antibodies which have an inhibitory or cytotoxic effect on an immune cell, a tumor cell, or a cell of the tissue from which the tumor originates How, for example, antibodies directed against l) a tumor-associated or tumor-specific antigen, n) an antigen on lymphocytes, such as, for example, against the T cell receptor, the B cell
  • the receptor for an interleukm such as IL -1, -2, -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15 or -16
  • the receptors for an interferon or the receptor f r a chemokm for example for RANTES, MCAF, MlP-alpha, MlP-ß, IL-8, MGSA / Gro, NPA-2 or IP-10
  • a tissue-specific antigen such as, for example, against a tissue-specific antigen of the cells of the mammary glands , Kidneys, birthmarks, prostate, thyroid gland, gastric mucosa, ova, cervix, bladder mucosa
  • Proteins with an indirect antiproliferative effect are, for example, inducers of acute inflammation and immune reactions, such as, for example, chokines such as RANTES (MCP-2), monocyte chemotactic and activating factor (MCAF), IL-8, macrophage inflammatory protein-1 (MIP-l-alpha, -ß), neutrophil activating protein-2 (NAP-2), interleukins such as IL-1, IL-2, IL-3, IL-4, IL-5, human leukemia inhibitory factor (LIF), IL- 6, IL-7, IL-9, IL-11, IL-13, IL-14, IL-15, IL-16, cytokines such as GM-CSF, G-CSF, M-CSF, enzymes for activating or cleaving the inactive precursor of a cytotoxic substance into a cytotoxic substance, these enzymes being an oxidoreductase, a transferase, a hydrolase or a lyase.
  • Examples of such enzymes are ⁇ -glucuronidase, ⁇ -galactosidase, glucose oxidase, glycosidase, alcohol dehydrogenase, lactoperoxidase, urokinase, tissue plasminogen activator carboxy peptidase, cytosine deainase, deoxycytidine kinase, lipase, thymidine Acid phosphatase, alkaline phosphatase, kinase, purine nucleoside phosphorylase, glucose oxidase, lactoperoxidase, lactaxoxidase, Penicillm-V-amidase, penicillin-G-aidase, lysozyme, ⁇ -lactamase, A mopeptidase, carboxypeptidase A, B or G2, nitroreductase, cytochrome p450 oxidase.
  • the enzyme can be derived from a virus, a bacterium, a yeast, a mollusk, an insect or a nipple. Enzymes which are derived from humans are preferably used.
  • nuclear acid constructs which code for a fusion product of a cell-specific ligand with an enzyme and / or proteins which inhibit angiogenesis, for example plasmmogenactivatonn-h ⁇ b ⁇ tor-1 (PAI-1); PAI-2 or PAI-3, angiostat or endostat, interferon -alpha, -ß, or -gamma, interleukm 12, platelet factor 4, thrombospondm -1 or -2, TGF-ß, TNF-alpha, vascular endothelial cell growth Inhibitor (VEGI).
  • PAI-1 plasmmogenactivatonn-h ⁇ b ⁇ tor-1
  • PAI-2 or PAI-3 angiostat or endostat
  • interferon -alpha interferon -alpha
  • component I) can represent one or more nucleotide sequences coding for one or more identical or different, directly or indirectly antiproliferative or cytotoxic proteins. Combinations of proteins which have an additive or synergistic effect are preferred. Additive or synergistic effects are to be expected, for example, in the following combinations of unequal proteins: cytotoxic proteins and proapoptotic proteins, enzymes and cytotoxic and / or proapoptotic proteins, anti-angiogenic proteins and cytotoxic and / or proapoptotic proteins, inducers of inflammation and enzymes or cytotoxic, proapoptotiscne and / or antiangiogenic proteins.
  • Component II is a nucleotide sequence which for at least one blood plasma protein is under the control of an activatable in the microorganism Activation sequence encoded.
  • Human blood plasma proteins are preferred, specifically those which have an average blood residence time of more than 24 hours. These include in particular, for example, albumin (nucleotides 1-2258, Hinchliffe et al, EP 0248637-A, December 9, 1987).
  • Component III) is a nucleotide sequence which codes for a cell-specific ligand under the control of an activation sequence which can be activated in the microorganism.
  • this ligand depends on the type of proliferative disease, for which the microorganism is used and the cells or the tissue with which component I) is to be brought into contact in the microorganism in order to achieve the therapeutic effectiveness.
  • ligands with specificity for tumor cells i.e.
  • tumor-associated or tumor-specific antigens or tumor endothelial cells or for tissue cells from which the respective tumor originates are used for tumor diseases, for example for cells of the thyroid gland, the prostate, the ovary, the mammary gland, the kidney Gastric mucosa, birthmarks, cervix, bladder; in chronic inflammation, cellular autoimmune diseases and rejection of transplanted organs, ligands with either specificity for macrophages, dentritic cells, T-lymphocytes or for activated endothelial cells.
  • Such ligands are, for example, specific antibodies, or antigen-binding fragments of these antibodies, growth factors, interleukins, cytokines or cell adhesion molecules which are present on tumor cells, on leukemia cells, on tumor endothelial cells, on tissue cells, on macrophages, dentritic cells, T-lymphocytes or on activated endothelial cells bind selectively.
  • Component IV) is a nucleotide sequence coding for a transport system which pression the explosion of the expression products of components I), II) and / or III) to the outer surface of the microorganism he ⁇ made possible.
  • the respective component can either be secreted either selectively or be expressed on the membrane of the microorganism, ie expressed at the membrane.
  • Components II) and III) are preferably expressed in the membrane.
  • Such transport systems are for example Hämolysintransportsignal of E. coli (Nukleotidsequen ⁇ zen containing HlyA, HlyB and HlyD under the control of hly-specific promoters, Gentschev et al Gene, 179: 133-140, 1996).
  • the following transport signals can be used: the C-terminal HlyA transport signal for secretion, in the presence of HlyB and HlyD proteins; for the membrane-permanent expression the C-terminal HlyA transport signal, in the presence of the HlyB protein; the hemolysin transport signal from E.
  • Component V) is a nucleotide sequence coding for at least one lytic protein which is expressed in the cytosol of a mammalian cell and which lyses the microorganism to release the plasmids in the cytosol of the host cell.
  • lytic proteins endolysins
  • endolysins are, for example, listeria-specific lysis proteins such as PLY551 (Loessner et al Mol Microbiol 16: 1231-41, 1995), the Listeria-specific holin under the control of a listerial promoter.
  • a preferred embodiment of this invention is the combination of different components nation ⁇ V), for example the combination of a lysis protein with a holin.
  • Component VI) represents any activator sequence which controls the expression of component I).
  • component VI) is one of the activation sequences which are known to the person skilled in the art and can be activated in the bacterium.
  • Activation sequences of this type are, for example, constitutively active promoter regions, such as the promoter region with the “ribosomal binding site” (RBS) of the beta-lactamase gene from E. coli or the tetA gene (Busby and Ebright, Cell 79: 743-746., 1994 ), inducible promoters, preferably promoters that become active after being taken up into the cell.
  • the latter includes the actA promoter from L.
  • Activator sequences which are activated in this cell after release of the plasmids of the bacterial carrier in the cytosol of the target cell are preferred.
  • the CMV enhancer, the CMV promoter, the SV40 promoter or any other promoter or enhancer sequence known to the person skilled in the art can be used.
  • Cell-specific or function-specific activator sequences are also preferred.
  • the choice of the cell-specific or function-specific activator sequence depends on the cell or the tissue in which the bacterial carrier or the plasmids released from the bacterial carrier are to express component I).
  • Such activator sequences are, for example, tumor cell-associated activator sequences (these include activator sequences of the genes for Midkine, GRP, TCF-4, MUC-1, TERT, MYC-MAX, surfactant protein, alpha-fetoprotein, CEA, tyrosinase, fibrillary acidic protein, EGR -1, GFAP, E2F1, basic myelin, alpha-lactalbumin, osteocalcin, thyroglobulin and PSA (McCormick Nature Reviews Cancer 1: 130-141,2001)), endothelial cell-specific activator sequences (these include activator sequences of the genes for proteins derived from Endothelial cells are preferentially expressed (Sedlacek, Critical Reviews in Onology / Hematology 37: 169-215,
  • Kidney activator sequences of the genes for proteins which are expressed in macrophages, dendritic cells or lymphocytes such as interleukins, cytokines, chemokines, adhesion molecules, interferons, receptors for interleukins, cytokines, chemokines, or interferons, activator sequences which activate in hypoxia such as the activator sequence for VEGF or for erythropoietin.
  • Components I) to VI) are inserted into the microorganisms using the molecular biological methods known to the person skilled in the art.
  • the person skilled in the art is familiar with how the components are inserted into suitable plasmids and how these plasmids are introduced into the bacteria.
  • these microorganisms are administered to a patient for the prophylaxis or therapy of a proliferative disease such as, for example, a tumor, leukemia, chronic inflammation, an autoimmune disease or rejection of an organ transplant.
  • the microorganisms according to the invention are administered locally or systemically in a suitable preparation, for example in the bloodstream, in a body cavity, in an organ, in a joint or in the connective tissue.
  • a suitable preparation for example in the bloodstream, in a body cavity, in an organ, in a joint or in the connective tissue.
  • the suspension and incubation is preferably carried out in solutions of substances or solutions of mixtures of substances which have a long blood residence time.
  • substances include, for example, albumin, transferrin, prealbumin, hemoglobin, haptoglobin, alpha-1 lipoprotein, alpha-2 lipoprotein, ⁇ -1 lipoprotein, alpha-2 macroglobulin, polyethylene glycol (PEG), conjugates of PEG with natural or synthetic polymers, such as with polyethyleneimines, dextrans, polygelines, hydroxyethyl starch.
  • the suspension and incubation in such a solution cause the substances to be adsorbed onto the surface of the microorganisms according to the invention.
  • the microorganisms can also be coated with these substances by conjugation.
  • the methods of conjugation are clearly summarized in Sedlacek et al Contributions to Oncology 32: 1-132, 1988.
  • the coating by adsorption takes place, for example, by suspending the microorganisms in a solution preferably containing 0.1 to 50% of the coating substances over a period of preferably 10 minutes to 24 hours and a temperature of preferably 4 degrees Celsius.
  • bacteria whose virulence has been reduced are preferably used as microorganisms.
  • Bacteria are furthermore preferably selected from a group comprising Escherichia coli, Salmonella enterica, Yersinia enterocolitica, Vibrio cholerae, Listeria monocytogenes, Shigella.
  • Microorganisms in the context of the invention are also membrane casings, so-called ghosts, of living or existing microorganisms.
  • Such membrane casings are manufactured, for example, according to EPA 0540525.
  • the invention relates to pharmaceutical preparations containing the microorganisms according to the invention and the use of this pharmaceutical preparation for the prophylaxis and / or therapy of a proliferative disease.
  • a proliferative disease in the sense of this invention is a disease with excessive or uncontrollable cell proliferation, for example a tumor disease such as carcinoma or sarcoma, leukemia, chronic inflammation, an autoimmune disease or the rejection of an organ transplant.
  • Germination administered to a patient locally or systemically is administered to a patient locally or systemically.
  • the term encased means that on the outside of the membrane of the microorganism, a plurality of the same or different molecules (expressed and / or secreted according to one or more of the features I) to III)) as described above, the geometric degree of coverage being between 0.001 and 1, in particular between 0.01 and 1, for example, can be between 0.1 and 1.
  • the geometric degree of coverage can be calculated from the quotient of the total area of all molecules, in a radial (based on a center of the microorganism) projection into the surface of the microorganism, and the surface of the microorganism. As a rule, a spherical surface of the microorganism is assumed for simplification and is calculated from the volume of the microorganism.
  • the "encased" feature may be optional.
  • Example 1 Construction of a bacterial strain for membrane-based expression of human albumin and beta-glucuronidase
  • Membrane expression can occur in Salmonella by fusing the protein to the C-terminus of the HlyA secretion protein in the presence of the HlyB protein, but in the absence of a fully functional HlyD protein.
  • HlyD must not be completely absent, since otherwise there is no connection between the secretion machine and the TolC protein of the outer membrane (Spreng et al., Mol. Microbiol. 31: 1596-1598, 1999).
  • These examples show one of the possible modifications of the HlyD protein for membrane-based expression.
  • the vector pMOhly DD is constructed, in which no functional HlyD protein is generated.
  • part of the hlyD gene is removed from the vector pMOhlyl by the endonucleases Dralll and Apal. After restriction digestion, the ends are digested with 3 '- 5' exonuclease and the 10923 bps fragment is relegated. The beta-glucuronidase gene is then cloned in-frame to the hlyA gene in this vector.
  • the cDNA is from bglu: amplified from a cDNA library using the following primers by polyvinyl lymerasekettenre force (PCR) (GenBank Accession (Gb) M15182): bglu 5 ': ATGCATTGCAGGGCGGGATGCTGTACC bglu 3': ATGCA ⁇ AAGTAAACGGGCTGTTTTCCAAAC
  • PCR polyvinyl lymerasekettenre
  • Oligonucleotide sequences are shown here, v / ie also in the following 5 '- 3').
  • the primers are chosen so that the gene is amplified without the signal sequence.
  • the product (1899 bps) is subcloned with a suitable "PCR Clonmg Kit", and then the ⁇ 1890 bps fragment is extracted via Nsil digestion.
  • the Nsil fragment is then cloned into the Nsil-cut vector pMOhly DD. This results in the vector pMO DDbglu (Fig. 1). (If the Nsil fragment is cloned into the Nsil-cut vector pMOhlyl, the plasmid pMO bglu is formed, which enables the fusion protein to be secreted).
  • the integration vector for the chromosomal integration of the Albumm-HlyA fusion is created.
  • the vector pMOhly alb is produced.
  • This vector based on pMOhlyl carries a fusion of the albumin cDNA with the HlyA gene.
  • the cDNA of the albumin gene (Gb: A06977) is amplified from a commercially available cDNA bank using PCR and the following Nsil-generating primers:
  • the 1830 bps fragment is subcloned and then cut with Nsil.
  • the 1824 bps fragment is now ligated to pMohlyl digested in Nsil.
  • the finished plasmid pMOhly alb thus expresses HlyB, HlyD and a fusion protein from albumin and HlyA.
  • the Nsil fragment can alternatively also be used in the vector pMO DD, this vector bears the name pMO DDalb.
  • a modification of the cloning strategy already described is used for integration in the Salmonella chromosome (Miller and Mekalanos, J Bacteriol 170: 2575-2583, 1988).
  • the Salmonella aroA gene was first cloned into the vector pUC18 (PCR with the following primers:
  • Primer 5 ' ATGGAATCCCTGACGTTACAACCC
  • Primer 3' GGCAGGCGTACTCATTCGCGC "Blunt” cloning of the 1281 bps fragment into the HincII interface of pUC18). Subsequently, a 341 bps fragment in aroA was removed by HincII digestion and subsequent religion. This vector was named pUC18 aroA 1 . The alb-hlyA fusion gene is then cloned into the vector pUCl ⁇ aroA 'together with the promoter sequence located on pMOhly.
  • the vector pMOhly alb is digested with AacII and Swal and then treated with a 3 '-5' exonuclease.
  • the 3506 bps blunt fragment is extracted and ligated into HincII digested pUCl ⁇ aroA '.
  • the aroA flanked alb-hlyA fragment with the entire activator sequences from the vector pUCaro-alb is cloned into the vector pGP704.
  • pUC aro-alb is digested with Hindlll and then with 5 '-3'
  • Exonuclease treated (blunt). Then digested with EcoRI and the 4497 bps fragment is ligated into the EcoRI / EcoRV (Blunt) digested vector pGP704 (EcoRI / RV fragment: 6387 bps).
  • the integration vector pGParo-alb results (FIG. 2).
  • the vector is transformed into the E.coli strain SMIOlpir. This strain enables the vector to replicate because it forms the p protein required for replication. The vector is then transferred via conjugation into the Salmonella typhi Ty21a acceptor strain, which does not allow replication of the vector. Therefore, only bacteria that have integrated the vector chromosomally are selected by tetracycline selection.
  • the cytoplasmic albumin production is checked by Western blot analysis of the bacterial lysate.
  • St21-alb expresses the alb-hlyA fusion, it can neither secrete it nor express it in the membrane.
  • a plasmid with functional HlyB such as pMO DDbglu
  • HlyD such as pMO bglu
  • the plasmid pMO DDbglu with the strain St21-alb is used.
  • St21-alb pMO DDbglu which uses the Hly secretion system to express both human albumin and human beta-glucuronidase at the membrane. This strain can then be used for pro-drug conversion within the meaning of the patent.
  • Example 2 Construction of a bacterial strain coated with albumin-HlyA fusion, to provide the genetic information of human beta-glucuronidase.
  • the bacterial strain shown in this example is to use passive targeting for DNA encoding human beta-glucuronidase to deliver to tumor cells, which are then to be expressed in the tumor cells.
  • a slightly modified strain as in Example 1 is used for the membrane expression of albumin in this example.
  • Both the gene coding for albumin HlyA and the information for HlyB are to be integrated chromosomally. This strain expresses constitutive me - branch albumin.
  • the vector pMOhly alb described above is digested by BsrBI and EcoRI and then treated with 5 '-3' exonuclease.
  • This digest produces a 5815 bps fragment with blunt ends, which contains the complete prokaryotic activation sequence and the genes hlyC, alb-hlyA and hlyB, but not hlyD.
  • This fragment can now be inserted into the HincII interface of the vector pUCl ⁇ aroA 'described above. This results in the vector pUCaro-alb-B.
  • the 6548 bps fragment can be inserted again into the EcoRI-EcoRV digested vector pGP704 by means of an EcoRI-Nrul digest (FIG. 3).
  • the further procedure (replication and integration in S. typhi Ty21a) then corresponds to the strategy described above.
  • the resulting strain St21-alb-B constitutively expresses membrane-bound albumin-HlyA fusion protein. If a vector encoding HlyD is transfected, the albumin-HlyA fusion protein is secreted.
  • the plasmid for the delivery of the DNA encoding beta-glucuronidase is based on the commercial vector pCMVbeta (Clontech). A fusion of the bglu gene with a secretion signal must first be used for the construction. In this example, the signal peptide of the tPA precursor molecule is to be used.
  • the 5 'UTR of the tPA cDNA (Gb E02027) is amplified by PCR with the following primers using the following primers until the end of the region coding for the signal peptide (amplification with "blunt" -generating polymerase):
  • the resulting plasmid pCMVtp (3972 bps) can now be used for expression of heterologous fusion proteins.
  • the bsp fragment of the bglu (Gb M15182) gene (without sequence for signal peptide) from a suitable cDNA bank is amplified with the following Spei-generating primers:
  • the 1899 bps fragment was ligated into the SpeI digested vector pCMVtp.
  • the resulting plasmid pCMVtp bglu now codes for an N-terminal fusion of the tPA signal peptide with the region of the mature protein of beta-glucuronidase.
  • the plasmid pCMVtp bglu (FIG. 4) is transformed into the strain St21-alb-B. This strain now allows the DNA to be delivered to the tumor tissue with the aid of passive targeting and the expression of the DNA by transfected tumor cells then allows a conversion of suitable pro-drugs.
  • Example 3 Construction of a strain coated with albumin-TolC fusion with membrane-like expression of the extracellular domain of FAS and delivery of a ProDrug converting enzyme
  • the strain shown in this example combines the properties shown in Example 2 with a targeted targeting of (tumor) cells that express Fas ligand (FasL).
  • FasL FasL-expressing tumor cells
  • this strain it is possible to specifically target FasL-expressing tumor cells, such as in certain breast tumors (Herrnring et al., Histochem Cell Biol 113: 189-194, 2000). FasL Expression through Tumor cells have been postulated as a potential mechanism for immune escape, since these cells can eliminate actively attacking, expressing Fas, lymphocytes (Muschen et al., J Mol Med 78: 312-325, 2000).
  • these tumor cells which are very problematic for therapy, can be targeted and then eliminated using an apoptosis-independent mechanism.
  • the carrier strain in this example is based on a fusion of albumin with the TolC protein from E. coli. In this way, a membrane-specific expression of albumin is achieved.
  • the membrane-specific expression of the extracellular domain of Fas takes place via the plasmid pMOhlyDD and the plasmid pCMV-bglu described above is used for delivery.
  • the first step involves generation of the carrier strain expressing TolC albumin.
  • the gene for the fusion protein is first generated, and then this gene is integrated into the Salmonella genome via successive cloning in pUCaroA 'and pGP704, in accordance with the examples above.
  • the TolC gene for E is based on a fusion of albumin with the TolC protein from E. coli. In this way, a membrane-specific expression of albumin is achieved.
  • the membrane-specific expression of the extracellular domain of Fas takes place via the plasmid pMOhlyDD and the plasmid pCMV-
  • coli together with the natural promoter, is present in the plasmid pBRtolC.
  • the 1701 bps fragment was inversely ligated into the Sall cleavage site of the vector pBR322 (Gb J01749), whereby the tet gene was interrupted. Due to the known crystal structure of ' TolC (Koronakis et al., Nature 405: 914-919., 2000) the introduction of heterologous DNA into the singular Kpnl interface in the tolC gene allows the expression of the encoded heterologous fusion protein in an extracellular loop on the Outer membrane. To express albumin, the albumin gene from the cDNA (Gb A06977) is amplified using the following primers generating Kpnl:
  • the DNA can be inserted into the Kpnl-cut vector pBRtolC.
  • the reverse orientation results in the vector pBRtolC-alb.
  • the gene for the tolC-Albu in fusion can now be ligated via EcoRV and PshAI (fragment 3970 bps) in reverse orientation into the HincII site of the vector pUCaroA '.
  • the resulting vector pUCaro-alb-tol (7596 bps) is now linearized with HindIII, 5 '-3' exonuclease is treated and then digested with EcoRI.
  • the 4961 bps fragment is then placed in the
  • the 477 bps fragment is digested with Nsil and inserted into the Nsil digested vector pMOhly DD in frame for the HlyA gene.
  • the resulting vector pMO DD-fas thus produces a membrane-bound Fas fragment after transformation into a Salmonella strain, which can bind to FasL-expressing cells with suitable folding. Consequently these sal onelles can be enriched on FasL-expressing cells, such as tumor cells.
  • the plasmid pCMV bglu (Example 2) is now also transfected into the Salmonella.
  • ProDrug-drug-mediated tumor therapy is possible.
  • the better effectiveness of this example compared to the previous example depends crucially on the correct folding of the extracellular domain of Fas.
  • FasL-specific Fab fragments of monoclonal antibodies (which can be folded correctly in bacteria) can also be used with the same approach as described here. This example shows that with the help of this technique it is possible to construct strains with almost any cell specificity by using suitable specific Fab fragments.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Transplantation (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)

Abstract

Die Erfindung lehrt einen ummantelten Mikroorganismus, in dessen Genom folgende Komponenten eingefügt und exprimierbar sind: I) eine Nukleotidsequenz, kodierend für ein di­rekt oder indirekt, antiproliferativ oder zytotoxisch wirkendes Expressionsprodukt oder für mehrere verschiedene solcher Expressionsprodukte, II) eine Nukleotidsequenz, welche für ein Blutplasmaprotein unter der Kontrolle einer im Mikroorganismus aktivierbaren Aktivierungssequenz kod­iert oder konstitutiv aktiv ist, III) optional, eine Nuk­leotidsequenz, welche für einen zellspezifischen Liganden unter der Kontrolle einer im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert oder konstitutiv aktiv ist, IV) eine Nukleotidsequenz für ein Transportsystem, welches die Expression der Expressionsprodukte der Komponenten (I) und (II) sowie optional (III) auf der Außenfläche des Mikro­organismus oder die Sekretion der Expressionsprodukte der Komponente (I) und Expression der Komponente (II) sowie op­tional (III) bewirkt und vorzugsweise konstitutiv aktiv ist, V) optional eine Nukleotidsequenz für ein Protein zur Lyse des Mikrooganismus im Cytosol von Säugerzellen und zur intrazellulären Freisetzung von Plasmiden mit zumind­est einer oder mehreren der Komponenten (I) und (VI) enthalten in dem lysierten Mikroorganismus, und VI) eine in dem Mikroorganismus aktivierbare, und/oder eine gewebezellspezifische, tumorzellspezifische, funktionsspezi­fische oder nicht zellspezifische Aktivierungssequenz zur Expression von Komponente I), wobei jede der Komponenten (I) bis (VI) einfach oder mehrfach, jeweils gleich oder ver­schieden, eingerichtet sein kann.

Description

Ummantelter Mikroorganismus
Gebiet der Erfindung.
Die Erfindung betrifft einen Mikroorganismus mit fremden Nukleotidsequenzen, mittels v/elcher antiproliferativ oder zytotoxisch wirkende Expressionsprodukte exprimierbar sind, sowie die Verwendung solcher Mikroorganismen zur Herstellung pharmazeutischer Zusammensetzungen, ein Plas- mid sowie ein Verfahren zur Herstellung eines solchen Mikroorganismus, sowie Verwendungen solcher Mikroorganismen.
Hintergrund der Erfindung und Stand der Technik.
In Ihrer Virulenz reduzierte Mikroorganismen wie beispielsweise genetisch modifizierte Viren oder in ihrer Virulenz attenuierte Bakterien gewinnen als Träger von fremden Nukleinsäuresequenzen im Rahmen der Gentherapie zunehmend an Bedeutung. Zur Gentherapie werden die fremden Nukleinsäuren entweder in vitro in Gewebezellen eingeführt und diese Zellen dem Patienten verabreicht, oder die Mikroorganismen werden dem Patienten injiziert in der Erwartung, dass die Mikroorganismen als Genfähren die fremde Nukleinsäure in die gewünschte Gewebezelle übertragen.
Mikroorganismen stellen Partikel dar. Nach Injektion in einen Organismus werden diese Partikel vorwiegend durch das sogenannte retikuloendotheliale System aufgenommen. Um entgegen diesem Eliminationsmechanismus dennoch eine Anreicherung der als Genfähren benutzten Mikroorganismen in einem Zielgewebe zu erreichen, wurden die Mikroorganismen mit zellspezifischen Liganden ausgestattet. Bislang konnte trotz dieser Ausstattung die Elimination der Mikroorganismen durch das retikuloenotheliale System nur geringfügig vermindert werden. -
Ein wesentliches Forschungsziel der Gentherapie ist die Therapie proliferativer Erkrankungen, - wie beispiel- sweise von Tumoren, Leukämien, chronische Entzündungen, Autoimmunerkrankungen und Abstoßungen von transplantierten Organen -, deren Behandlung trotz aller Erfolge der Arzneimitteltherapie immer noch unzureichend ist. Beispielsweise konnte trotz aller Erfolge der Chirurgie, der Radiotherapie, der Chemotherapie und auch der Immuntherapie bei der Behandlung von Tumoren bislang keine Heilung von fortgeschrittenen Tumoren des Kopfes und des Halses, des Zentralen Nervensystems, der Brustdrüse, der Lunge, des Magen-Darm-Traktes, der Leber, der Bauch- Speicheldrüse, der Niere, der Haut, der Ovarien und der Prostata erzielt werden.
Die Gründe für diesen mangelhaften Erfolg der Tumortherapie sind vielgestaltig und noch nicht umfassend bekannt. Zu den wesentlichen Gründen gehören jedoch i) vorab (primär) bestehende Resistenzen der Tumorzellen gegen die in vivo erreichbaren Konzentrationen von Che- motherapeutika, von Bestrahlungen oder gegen Immunthera- peutika, ii) in Reaktion auf die Therapie entstehende Resistenzen gegen das jeweilige Therapeutikum. Diese in- duzierten, sogenannten sekundären Resistenzen haben ihre Ursache in der genetischen Variabilität der Tumorzellen, die es ihnen ermöglicht, den Einwirkungen der Tumorthera- peutika durch die Entwicklung von Resistenzmechanismen auszuweichen, iii) in pharmakokinetischen und/oder phar- makodynamischen Unzulänglichkeiten der bislang verfügbaren Tumortherapeutika, auf Grund derer die Konzentration des jeweiligen Tumortherapeutikums am Ort des Tumors, gleichgültig ob es sich um Primärtumore, Rezidive oder Metastasen handelt, absolut zu gering ist, um den Tumor zu eliminieren. Zu diesen Unzulänglichkeiten der Tumortherapeutika gehören, iv) ein zu hohes Verteilungsvolumen, v) die mangelhafte Anreicherung am Tumor bzw. an den Tu- morzellen, vi) die mangelhafte Penetrationsfähigkeit im Tumor und/oder vii) die toxische Wirkung auf den Gesamtorganismus, welche eine Erhöhung der Dosis für eine erhöhte Anreicherung am Tumor einschränkt.
In der Vergangenheit wurde mit unterschiedlichen Ver- fahren versucht, Tumortherapeutika am Tumor anzureichern. Tumorzellspezifische Liganden, beispielsweise Antikörper oder deren Spaltprodukte, gekoppelt an Zytostatika, an antitumoral wirkende Cytokine, an zytotoxische Proteine, oder an Isotopen führten zwar zu einer Anreicherung der zytotoxischen Wirksubstanzen am Tumor im Vergleich zum
Normalgewebe, jedoch war diese Anreicherung in den weitaus meisten Fällen nicht ausreichend für eine Therapie des Tumors (Übersicht: Sedlacek et al . , Contributions to On- cology 43: 1-145, 1992; Carter, Nature Reviews Cancer 1: 118-129,2001) .
In Konsequenz wurden Amplifikationssysteme entworfen, mit Hilfe derer die Konzentration des jeweiligen Wirkstoffes am Tumor erhöht werden konnte.
Ein Amplifikationssyste hatte zum Ziel, in dem Tumor solche Enzyme einzubringen, welche im restlichen Körper nicht allgemein zugänglich oder fremd waren und die wiederum im Tumor eine untoxische Vorstufe eines Zytostatikums in das zytotoxisch aktive Zytostatikum umwandeln oder spalten konnten. Das Einbringen der Enzyme in den Tumor erfolgte entweder durch die Verabreichung von tumorzell- spezifischen Liganden, gekoppelt an diesen Enzymen (beispielsweise in Form der Antibody- Derived Enzymemediated Prodrug-Therapy; ADEPT) oder durch die Verabreichung von Genen für diese Enzyme mit Hilfe von tumorzellspezifischen oder nicht spezifischen Vektoren (Gene Derived Enzym-mediated Prodrug Therapy; GDEPT) (Sed- lacek et al., Contributions to Oncology 43: 1-145, 1992; Sedlacek, Critical Reviews in Oncology/He atology 37: 169-215, 2001; McCormick Nature Reviews Cancer 1: 130-141,2001; Carter, Nature Reviews Cancer 1:18-129,2001) .
Die bisherigen klinischen Untersuchungen mit ADEPT oder GDEPT haben jedoch unzureichende therapeutische Ergebnisse erbracht. Als wesentliche Probleme erwiesen sich i) die Immunogenität eines körperfremden Enzy es, ii) die relativ geringe Tumor-Lokalisationsrate eines Antikörper- Enzym-Konjugates (ADEPT), iii) die technischen Schwierig- keiten, Fusionsproteine aus einen humanisierten Antikörper mit einem humanem Enzym in ausreichend großer Menge zu tragbaren Kosten herzustellen, iv) die mangelnde Tumor- Penetration der Antikörper-Enzym-Konjugate oder der Gen- Vektoren und v) die zu geringe Transduktionsrate in vivo, d.h., die Anzahl an Tumorzellen eines Tumorknotens, in welchen die Gene für das Enzym exprimiert werden konnten, war zu gering für eine tumor-therapeutische Wirksamkeit.
Ein weiteres Amplifikationssystem basiert auf der Induktion einer Immunreaktion gegen Tumorzellen, im Zuge derer spezifische Antikörper-bildende Zellen und zytotox- ische Zellen proliferieren. Zur Induktion einer Immunreaktion werden Tu orεntigene in geeigneter Zubereitung verabreicht. Ziel ist es, die offensichtlich bei Tumorpatienten bestehende Immuntoleranz gegen seinen Tumor und/oder Resistenz seines Tumors gegen seine eigene Immunreaktion zu durchbrechen.
Innerhalb der letzten Jahrzehnte wurden zahlreiche technische Variationen der Tumorvakzinierung durch Kombination von verschiedenen Tumorantigenen mit Adjuvan- tien klinisch geprüft, jedoch ohne den erhofften Durchbruch in der Tumortherapie zu bringen. Zwar haben neue Ansätze, beispielsweise die Verabreichung von Ko bi- nationen von immunogenen tumorspezifischen Antigenen mit neuen Adjuvantien, oder von dentritische Zellen, beladen mit tumorspezifischen Antigenen, oder von Nukleotidsequen- zen, die für tumorspezifische Antigen kodieren, erste hoffnungsvolle klinische Ergebnisse erbracht, jedoch ist bislang auch hier ein Durchbruch in der Tumortherapie noch nicht erkennbar.
Eine Technik wurde entwickelt, Expressionsprodukte von in Bakterien eingeführten Nukleinsauresequenzen auf der Zellmembran dieser Bakterien zu exprimieren oder von die- sen Bakterien sekretieren zu lassen. Basis dieser Technik ist das Escherichia coli Hamolysinsystems HlyAs, welches den Prototyp eines Typ I Sekretionssystems von gramnegativen Bakterien darstellt. Mit Hilfe des HlyAs wurden Sekretionsvektoren entwickelt, die eine effiziente Ausschleusung von Proteinantigenen in Samonella enterica, Yersinia enterocolitica und Vibrio cholerae ermöglichen. Derartige Sekretionsvektoren enthalten die cDNA eines beliebigen Proteinantigens gekoppelt an die Nukleotidsequenz für das HlyA-Signalpeptid, für den Hamolysm- Sekretionsapparat, hlyB und hlyD und den hly-spezifischen Promoter. Mit Hilfe dieses Sekretionsvektors kann ein Protein auf der Oberflache dieses Bakteriums exprimiert werden. Derartig genetisch modifizierte Bakterien induzieren als Vakzinen einen weitaus stärkeren Immunschutz als Bak- terien, in welchen das von der eingeführten Nuklemsaure expπmierte Protein zellintern verbleibt (Donner et al EP 1015023 A, Gentschev et al, Gene, 179: 133-140,1996; Vac- cine 19:2621- 2618, 2001, Hess et al PNAS 93: 1458-1463, 1996) . Nachteil dieses Systems ist jedoch, dass durch Verwendung des hly-spezifischen Promoters die Menge des auf der Außenfläche des Bakteriums exprimierten Proteins äußerst gering ist. Eine Technik zur Einschleusung von Plasmid-DNA in
Säugerzellen durch Trägerbakterien wie Salmonella und Listeria monocytogenes wurde entwickelt. In diesen Plasmiden enthaltende Gene konnten in den Säugerzellen auch dann exprimiert werden, wenn sie unter der Kontrolle eines eu- karyontischen Promoters standen. In Listeria monocytogenes Keime wurden Plasmide eingeführt, die eine Nukleotidsequenz für ein beliebiges Antigen unter der Kontrolle eines beliebigen eukaryontischen Promoters enthalten. Durch Einführung der Nukleotidsequenzen für ein spezifisches Lysis- Gen wurde bewirkt, dass sich die Listeria monocytogenes Keime im Zytosol der Antigen-präsentierenden Zelle auflösen und ihre Plasmide freisetzen, was zur anschließenden Expression, Prozessierung und Präsentation der plas- midkodierten Proteine führt und die Immunogenität dieser Proteine deutlich steigert (Dietrich et al. Nat. Biotech- nol 16: 181-185,1998; Vaccine 19: 2506-2512, 2001).
Virulenz-attenuierte Varianten von Bakterien, die sich intrazellulär ansiedeln, wurden entwickelt. Beispielsweise wurden von Listeria monocytogenes, Salmonella enterica sv. Typhimuriu und Typhi, sowie BCG derartige Varianten bereits als gut verträgliche Lebendimpfstoffe gegen Typhus und Tuberkulose eingesetzt. Diese Bakterien, einschließlich ihrer abgeschwächten Mutanten sind generell immunstimulierend und können eine gute zelluläre Immunantwort auslösen. Beispielsweise stimuliert L . monocytogenes in besonderem Maße über die Aktivierung von TH1 Zellen die Proliferation von zytotoxischen Lymphozyten. Diese Bakterien liefern sezernierte Antigene direkt in das Cytosol Antigen-präsentierender Zellen (APC; Makrophagen und Dendritische Zellen) , die ihrerseits die kostirαuiierenden Moleküle exprimieren und eine effiziente Stimulierung von T-Zellen auslösen. Die Listerien werden zum Teil in phagosomalen Kompartimenten abgebaut und die von diesen Trägerbakterien produzierten Antigene können daher einerseits über MHC Klasse II Moleküle präsentiert werden und damit zur Induktion von T-Helferzellen führen. Andererseits replizieren die Listerien nach Freisetzung aus dem Phagosom im Cytosol von APCs; von diesen Bakterien produzierte und sezernierte Antigene werden deshalb bevorzugt über den MHC Klasse I-Weg präsentiert, wodurch CTL Antworten gegen diese Antigene induziert werden. Außerdem konnte gezeigt v/erden, dass durch die Interaktion der Lis- terien mit Makrophagen, natürlichen Killerzellen (NK) und Neutrophilen Granulozyten die Expression solcher Cytokine (TNF-alpha, IFN-gamma, 11-2, IL-12; Unanue, Curr.Opin. Immunol, 9: 35-43,1997; Mata and Paterson, J Immunol 163: 1449-14456,1999) induziert wird, für welche eine antitu- morale Wirksamkeit nachgewiesen wurde. So konnte durch die Verabreichung von L. monocytogenes, welche transduziert waren zur Expression von Tumorantigenen, antigenspezi- fisch das Wachstum von experimentellen Tumoren gehemmt werden (Pan et al Nat Med 1:471-477,1995, Cancer Res 59: 5264-5269,1999; Voest et al . Natl Cancer Inst 87:581-586, 1995; Beatty and Paterson, J Immunol 165: 5502-5508, 2000) . Virulenz-attenuierte Salmonella enterica Stämme, in welche Nukleotidsequenzen kodierend für Tumorantigene eingeführt worden waren, konnten als Tumorantigen-expri- mierende bakterielle Träger nach oraler Verabreichung einen spezifischen Schutz gegen unterschiedliche experimentelle Tumoren bewirken (Medina et al., Eur J Immunol 30:768-777, 2000, Zoller und Christ J Immunol 166: 3440- 3450, 2001; Xiang et al . , PNAS 97: 5492-5497, 2000). Rekombinante SaJmonelJa Stämme waren auch als prophylaktische Vakzine gegen Virusinfektionen (HPV) Infektionen (Benyacoub et al . , Infect Immun 67: 3674-3679, 1999) und zur therapeutischen Behandlung eines durch ein Tumorvirus (HPV) immortalisierten Maustumors wirksam (Revaz et al., Virology 279: 354-360, 2001) . Für die systemische Tumortherapie wurden Salmonella-Stämme selektioniert, welche spezifisch ausgewählte Tumorgewebe besiedeln (Murray et al j Bacteriol 183:5554-5564, 2001). In diese Salmonella- Stämme wie auch in Escherichia coli Stämme wurden Nuk- leotidsequenzen kodierend für ausgewählte Enzyme eingeführt und diese bakteriellen Träger erfolgreich für GEDPT in vitro wie auch in vivo in experimentellen Tumorsystemen eingesetzt (Pawelek et al Cancer Res 57: 4537-4544,1997). Entzündungsgewebe und besonders Tumorgewebe zeichnen sich durch eine verstärkte, im Tumor meist chaotisch verlaufende Angiogenese aus. In diese neugebildeten Gefäße können sich lösliche wie auch partikuläre Substanzen an- reichern, soweit sie über ein niedriges Verteilungs- Volumen und damit über eine relativ lange Bluthalbwertzeit verfügen. Diese Anreicherung (auch als passives Targeting bezeichnet) , kann für therapeutische Verfahren genutzt v/erden (Sedlacek, Critical reviews in Oncology/He atology 37: 169-215,2001) .
Technisches Problem der Erfindung.
Der Erfindung liegt das technische Problem zu Grunde, eine pharmazeutische Zusammensetzung anzugeben, welche in der Behandlung proliferativer Erkrankungen, insbesondere in der Tumortherapie, eine erhöhte Wirksamkeit zeigen. Grundkonzeption der Erfindung sowie der Erfindung zu Grunde liegende Erkenntnisse.
Zur Lösung dieses technischen Problems lehrt die Erfindung einen ummantelten Mikroorganismus, in dessen Genom folgende Komponenten eingefügt und exprimierbar sind: I) eine Nukleotidsequenz, kodierend für ein direkt oder indirekt, antiproliferativ oder zytotoxisch wirkendes Expres- sionsprodukt oder für mehrere verschiedene solcher
Expressionsprodukte, II) eine Nukleotidsequenz, welche für ein Blutplasmaprotein unter der Kontrolle einer im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert oder konstitutiv aktiv ist, III) optional, eine Nukleotidse- quenz, welche für einen zellspezifischen Liganden unter der Kontrolle einer im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert oder konstitutiv aktiv ist, IV) eine Nukleotidsequenz für ein Transportsystem, welches die Expression der Expressionsprodukte der Komponenten I) und II) sowie optional III) auf der A.ußenfläche des Mikroorganismus oder die Sekretion der Expressionsprodukte der Komponente I) und Expression der Komponente II) sowie optional III) bewirkt und vorzugsweise konstitutiv aktiv ist, V) optional eine Nukleotidsequenz für ein Protein zur Lyse des Mikrooganismus im Cytosol von Säugerzellen und zur intrazellulären Freisetzung von Plasmiden mit zumindest einer oder mehreren der Komponenten I) und VI) enthalten in dem lysierten Mikroorganismus, und VI) eine in dem Mikroorganismus aktivierbare, und/oder eine gewe- bezellspezifische, tu orzellspezifische, funktionsspezifische oder nicht zellspezifische Aktivierungssequenz zur Expression von Komponente I), wobei jede der Komponenten I) bis VI) einfach oder mehrfach, jeweils gleich oder verschieden, eingerichtet sein kann.
Im Rahmen der Erfindung v/erden vorzugsweise ummantelte Mikroorganismen als Träger für genetische Informationen und die Verwendung dieser ummantelten Mikroorganismen zur Prophylaxe und Therapie einer proliferativen Erkrankung beschrieben. Hierbei beruht die Erfindung auf folgenden Erfahrungen und technischen Entwicklungen.
Gegenstand der Erfindung sind somit vorzugsweise um- mantelte Mikroorganismen als Träger für Nukleotidsequenzen zur Behandlung von proliferativen Erkrankungen, wobei in die Mikroorganismen folgende Komponenten eingefügt worden sind: I) mindestens eine Nukleotidsequenz, kodierend für mindestens ein direkt oder indirekt antiprolif erativ oder zytotoxisch wirkendes Expressionsprodukt, II) mindestens eine Nukleotidsequenz, welche für mindestens ein Blutplasmaprotein unter der Kontrolle mindestens einer, im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert, III) wahlweise mindestens eine Nukleotidsequenz, welche für mindestens einen zellspezifischen Liganden unter der Kontrolle mindestens einer, im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert, IV) mindestens eine Nukleotidsequenz für mindestens ein Transportsystem, welches die Expression der Expressionsprodukte der Komponenten I), II) und III) auf der Außenfläche des Mikroorganismus oder die Sekretion der Komponenten I) , II) und III) ermöglicht, V) wahlweise mindestens eine Nukleotidsequenz für minde¬ stens ein Protein zur Lyse des Mikroorganismus im Cytosol von Säugerzellen und zur intrazellulären Freisetzung von Plasmiden enthalten in dem lysierten Mikroorganismus VI) mindestens eine in dem Mikroorganismus aktivierbare oder mindestens eine gewebezellspezif ische, tumorzellspezifische oder nicht zellspezifische Aktivierungssequenz zur Expression von Komponente I):
Bevorzugte Ausfuhrungsformen der Erfindung.
Komponente I: Komponente I) ist mindestens eine Nukleotidsequenz, kodierend für mindestens ein direkt oder indirekt antiproliferativ oder zytotoxisch wirkendes Ex- pressionsprodukt . Direkt antiproliferativ wirkende Expres- sionsprodukte im Sinne der Erfindung sind beispielsweise Interferone wie beispielsweise IFN-alpha, IFN-gamma, IFN- ß, Interleukme, welche Immunzellen oder Tumorzellen hemmen, wie beispielsweise IL-10, IL-12, proapoptotische Peptide oder Proteine wie beispielsweise TNF-alpha, FAS- Ligand, TNF-related apoptosis inducing Ligand (TRAIL) , Antikörper oder Fragmente von Antikörpern, welche hemmend auf oder zytotoxisch für eine Immunzelle, eine Tumorzelle, oder eine Zelle des Gewebes, von welcher der Tumor stammt, wirken, wie bei- spielsweise Antikörper gerichtet gegen l) ein tumorassoziertes oder tumorspezifisches Antigen, n) ein Antigen auf Ly phozyten, wie beispielsweise gegen den T-Zellrezeptor, den B-Zellrezeptor, den Rezeptor für den CD40Lιganden, das B7.1 oder B7.2, den Rezeptor für ein Interleukm, wie beispielsweise IL -1,-2,-3,-4,-5, -6, -7,-8,-9,-10,-11, -12,-13,-14,-15 oder -16, den Rezeptoren für ein Interferon oder den Rezeptor für ein Chemokm, beispielsweise für RANTES, MCAF, MlP-alpha, MlP-ß, IL-8, MGSA/Gro, NPA-2 oder IP-10, m) ein gewebespezifisches Antigen, wie beispielsweise gegen ein gewebespezifisches Antigen der Zellen von Brustdrusen, Nieren, Muttermalen, Prostata, Schilddrüsen, Magenschleimhaut, Ovaπen, Cervix, Blasenschleimhaut, ein antiproliferativ wirkendes Protein, wie beispielsweise das Retinblastomprotem (pRb = pllO) oder die verwandten pl07 und pl30 Proteine oder antiproliferativ wirkende Mutanten diese Proteine, das p53 Protein und analoge Proteine oder antiproliferativ wirkende Mutanten dieser Proteine, das p21 (WAF-1) Protein, das p27 Protein, das plδ Protein, das GAAD45 Protein, antiproliferativ wirkende Proteine der Bcl2 Familie wie beispielsweise bad oder bak, zytotoxische Proteine wie beispielsweise Perforin, Granzym, Oncostatin, eine an- tisense RNA oder ein Ribozym, spezifisch für eine RNA, welche beteiligt ist an dem Wachstum oder der Proliferation einer Zelle, beispielsweise spezifisch für die mRNA, kodierend für einen Rezeptor, für ein signalübertragendes Enzym, für ein Protein, welches am Zellzyklus beteiligt ist, für einen Transskriptionsfaktor oder für ein Trans- portprotein. Indirekt antiproliferativ wirkende Proteine sind beispielsweise Induktoren von akuten Entzündungen und Immunreaktionen, wie beispielsweise Che okine wie RANTES (MCP-2), Monocyte chemotactic and activating factor (MCAF) , IL-8, Macrophage inflammatory protein-1 (MIP-l-alpha,-ß) , Neutrophil activating Protein-2 (NAP-2), Interleukine wie IL-1, IL-2, IL-3, IL-4, IL-5, Human Leu- ke ia inhibitory factor (LIF), IL-6, IL-7, IL-9, IL-11, IL-13, IL-14, IL-15, IL-16, Cytokine wie GM-CSF, G-CSF, M-CSF, Enzyme zur Aktivierung oder Spaltung der inaktiven Vorstufe einer zytotoxischen Substanz in eine zytotoxische Substanz, wobei diese Enzyme eine Oxydoreduktase, eine Transferase, eine Hydrolase oder eine Lyase sind. Beispiele für derartige Enzyme sind ß-Glucuronidase, ß-Galac- tosidase, Glucose oxidase, Glycosidase, Alkohol Dehydroge- nase, Laktoperoxydase, Urokinase, Tissue Plasminogen- ak- tivatorCarboxy Peptidase, Cytosin-Dea inase, Deoxycytidin Kinase, Thymidin Kinase, Lipase, Saure Phosphatase, Alkalische Phosphatase, Kinase, Purinnucleosid- phosphorylase, Glucose Oxydase, Lactoperoxydase, Lacta- toxydase, Penicillm-V-Amidase, Penicillin-G- Aπidase, Lysozym, ß-Lactamase, A mopeptidase, Carboxypeptidase A,B oder G2, Nitroreduktase, Cytochrom p450 Oxydase. Gemäß der Erfindung kann das Enzym von einem Virus, einem Bakterium, einer Hefe, einem Weichtier, einem Insekt oder einem Sauger stammen. Bevorzugt werden solche Enzyme verwendet, welche vom Menschen stammen. Bevorzugt im Sinne der Erfindung werden des weiteren Nuklemsaurekonstrukte, welche für ein Fusionsprodukt eines zellspezifischen Liganden mit einem Enzym kodieren und/oder Proteine, welche die Angio- genese inhibieren, beispielsweise Plasmmogenactivatonn- hιbιtor-1 (PAI-1); PAI-2 oder PAI-3, Angiostatm oder En- dostatm, Interferon -alpha, -ß, oder -gamma, Interleukm 12, Plattchenfaktor 4, Thrombospondm -1 oder -2, TGF-ß, TNF-alpha, Vascular endothelial cell growth Inhibitor (VEGI) . Im Sinne der Erfindung kann die Komponente I) eine oder mehrere Nukleotidsequenzen darstellen kodierend für ein oder mehrere gleich oder unterschiedliche, direkt oder indirekt antiproliferativ oder zytotoxisch wirkende Proteine. Bevorzugt werden Kombinationen von Proteinen, welche eine additive oder synergistische Wirkung aufweisen. Additive oder synergistische Wirkungen sind beispielsweise bei folgenden Kombinationen ungleich wirkender Proteine zu erwarten: zytotoxische Proteine und proapoptotische Proteine, Enzyme und zytotoxische und/oder proapoptotische Proteine, Antiangiogenetische Proteine und zytotoxische und/oder proapoptotische Proteine, Induktoren von Entzündungen und Enzyme oder zytotoxische, proapoptotiscne und/oder antiangiogenetische Proteine.
Komponente II: Komponente II) ist eine Nukleotidsequenz, welche für mindestens ein Blutplasmaprotein unter der Kontrolle einer im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert. Bevorzugt werden humane Blutplasmaproteine, und zwar solche, welche eine mittlere Blutverweilzeit von mehr als 24 Stunden aufweisen. Hierzu gehören im Besonderen beispielsweise Albumin (Nukleotide 1-2258, Hinchliffe et al, EP 0248637-A, 9.12.1987),.
Transferrin (Nukleotide 1- 2346, Uzan et al, Biochem Bio- phys Res Commun 119:273-281 (1984); Yang et al, PNAS-USA, 81 : 2752-2756 (1984), Caeruloplas in (Baranov et al, Chro osoma 96: 60-66, (1987), Haptoglobin (Nukleotide 1-1412, Raugei et al, Nucleic Acids Res 11: 5811-5819, (1983); Yang et al, PNAS-USA 80: 5875-5879,(1983); Brune et al, Nucleic Acids Res 12: 4531-4538 (1984), Haemoglobin alpha ( Nukleotide 1- 576; Marotta et al, PNAS-USA 71:2300-2304 (1974) Chang et al, PNAS-USA 74: 5145-5149 (1977), Haemoglobin ß (Nukleotide 1-626; Marotta et al,
Prog Nucleic Acid Res Mol Biol 19: 165-175 (1976); Marotta et al, J Bil Chem 252: 5019-5031 (1977), alpha2 Macroglobulin (Nukleotide 1-4599; WO 9103557-A, 21.03.1991). Hierzu gehören jedoch auch andere Blutplas- maproteine, wie beispielsweise Alphal Lipoprotein, Alpha2 Lipoprotein, ßl Lipoprotein. Die Expression mindestens eines dieser Plasmaproteine durch den erfindungsgemäßen Mikroorganismus bewirkt, dass der Mikroorganismus nach systemischer Verabreichung, - besonders nach Injektion in das Blutkreislaufsystem - im geringeren Maße von phagozytierenden Zellen aufgenommen wird, dadurch länger im Blut verweilen und sich im Tumorgefäßsystem oder in den Gefäßen einer chronischen Entzündung anreichern kann. Komponente III) : Komponente III) ist eine Nukleotidse- quenz, welche für einen zellspezifischen Liganden unter der Kontrolle einer im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert. Die Spezifität dieses Liganden ist abhängig von der Art der proliferativen Erkrankung, für welche der Mikroorganismus verwendet wird und den Zellen oder dem Gewebe, mit welchem die Komponente I) im Mikroorganismus in Kontakt gebracht werden soll, um die therapeutische Wirksamkeit zu erzielen. So werden beispielsweise verwendet bei Tumorerkrankungen Liganden mit Spezifität für Tumorzellen, d.h. für tumorassoziierte oder tumorspezifische Antigene oder Tumorendothelzellen oder für Gewebezellen, von denen der jeweilige Tumor stammt, beispielsweise für Zellen der Schildrüse, der Prostata, des Ovars, der Brustdrüse, der Niere, der Magenschleimhaut, der Muttermale, der Cervix, der Harnblase; bei chronischen Entzündungen, zellulären Autoimmunerkrankungen und Abstoßungen von transplantierten Organen Liganden entweder mit Spezifität für Makrophagen, Dentri- tische Zellen, T-Lymphozyten oder für aktivierte Endothel- zellen. Derartige Liganden sind beispielsweise spezifische Antikörper, oder Antigen-bindende Fragmente dieser Antikörper, Wachstumsfaktoren, Interleukine, Cytokine oder Zeiladhäsionsmoleküle die an Tumorzellen, an Leukämiezel- len, an Tumorendothelzellen, an Gewebezellen, an Makrophagen, Dentritischen Zellen, T-Lymphozyten oder an aktivierte Endothelzellen selektiv binden.
Komponente IV) : Komponente IV) ist eine Nukleotidsequenz, kodierend für ein Transportsystem, welches die Ex- pression der Expressionsprodukte der Komponenten I), II) und/oder III) auf die Außenfläche des Mikroorganismus er¬ möglicht. Die jeweilige Komponente kann hierbei v/ahlweise entweder sekretiert werden oder auf der Membran des Mikroorganismus, d.h. membranständig exprimiert v/erden . Kompo- nenten II) und III) werden vorzugsweise membranständig exprimiert. Derartige Transportsysteme sind beispielsweise das Hämolysintransportsignal von E.coli (Nukleotidsequen¬ zen enthaltend HlyA, HlyB und HlyD unter Kontrolle des hly-spezifischen Promoters, Gentschev et al Gene, 179: 133-140,1996). Folgende Transportsignale sind verwendbar: für die Sekretion das C-terminale HlyA-Transportsignal, in Gegenwart von HlyB und HlyD Proteinen; für die membran- ständige Expression das C-terminale HlyA-Transportsignal, in Gegenwart vom HlyB-Protein; das Hämolysintransportsig- nal von E.coli (Nukleotidsequenzen enthaltend HlyA, HlyB und HlyD unter der Kontrolle eines nicht hly-spezifischen bakteriellen Promoters) ; das Transportsignal für das S- layer Protein (Rsa A) von Caulobacter crescentus; für die Sekretion und für die membranständige Expression das C- terminale RsaA-Transportsignal (U elo-Njaka et al Vaccine, 19: 1406 -1415, 2001); das Transportsignal für das TolC- Protein von Escherichia coli (das TolC- Protein wurde von Koronakis et al. (Nature, 405: 914-919, 2000) und von Gentschev et al (Trends in Microbiology, 10: 39-45, 2002) beschrieben) ; für die membranständige Expression das N- terminale Transportsignal.
Komponente V) : Komponente V) ist eine Nukleotidse- quenz, kodierend für mindestens ein lytisches Protein, welches im Cytosol einer Säugerzelle exprimiert wird und den Mikroorganismus lysiert zur Freisetzung der Plasmide im Cytosol der Wirtszelle. Derartige lytische Proteine (Endolysine) sind beispielsweise Listerien-spezifische Lysis-Proteine wie z.B. PLY551 (Loessner et al Mol Micro- biol 16: 1231-41, 1995), das Listeria-spezifische Holin unter der Kontrolle eines listeriellen Promoters. Eine bevorzugte Ausführungsform dieser Erfindung ist die Kombi¬ nation unterschiedlicher Komponenten V) , beispielsweise die Kombination eines Lysis-Proteins mit einem Holin.
Komponente VI) : Komponente VI) stellt eine beliebige Aktivatorsequenz dar, welche die Expression der Komponente I) kontrolliert. Für die Expression der Komponente I) auf der Außenfläche des Mikroorganismus ist die Komponente VI) eine der dem Fachmann bekannten, im Bakterium aktivierbaren Aktivierungssequenzen. Derartige Aktivierungssequenzen sind beispielsweise konstitutiv aktive Po otorre- gionen, wie die Promotorregion mit "Ribosomal binding Site" (RBS) des beta-lactamase Gens von E. coli oder des tetA gens (Busby and Ebright, Cell 79: 743-746., 1994), induzierbare Promotoren, bevorzugt Promotoren, die nach Aufnahme in die Zelle aktiv werden. Zu letzteren gehört der actA Promoter von L. monocytogenes (Dietrich et al . , Nat.Biotechnol. 16: 181-185, 1998) oder der pagC Promoter von S. monocytogenes (Bumann, Infect Immun 69: 7493-7500., 2001) . Bevorzugt werden Aktivatorsequenzen, welche nach Freisetzung der Plasmide des bakteriellen Trägers im Zy- tosol der Zielzelle in dieser Zelle aktiviert werden. Beispielsweise kann der CMV-Enhancer, der CMV-Promoter, der SV40 Promoter oder jede andere, dem Fachmann bekannte Promoter- oder Enhancer - Sequenz verwendet werden. Bevorzugt werden weiterhin zellspezifische oder funktionsspezi- fische Aktivatorsequenzen. Die Wahl der zellspezifischen oder funktionsspezifischen Aktivatorsequenz ist abhängig von der Zelle oder dem Gewebe, in welchem der bakterielle Träger bzw die vom bakteriellen Träger freigesetzten Plasmide Komponente I) exprimieren sollen. Derartige Aktiva- torsequenzen sind beispielsweise tumorzellassoziierte Aktivatorsequenzen (zu diesen gehören Aktivatorsequenzen der Gene für Midkine, GRP, TCF-4, MUC-1, TERT, MYC-MAX, surfactant Protein, alpha-Fetoprotein, CEA, Tyrosinase, Fibrillary acidic Protein, EGR-1, GFAP, E2F1, basisches Myelin, alpha-Lactalbumin, Osteocalcin, Thyroglobulin und PSA (McCormick Nature Reviews Cancer 1: 130-141,2001)), endothelzellspezifische Aktivatorsequenzen (zu diesen gehören Aktivatorsequenzen der Gene für Proteine, welche von Endothelzellen bevorzugt exprimiert werden (Sedlacek , Critical Reviews in Onco- logy/Hematology 37:169-215,2001) wie beispielsweise VEGF, von Willebrand Faktor, Hirnspezi- fischer endothelialer Glucose-1-Transporter, Endoglin, VEGF-Rezeptoren, besonders VEGF-Rl, VEGF-R2 und VEGF-R3, TIE-2, PDECGF-Rezeptor- en, B61, Endothelin-1, Endothelin B, Mannose-6-Phosphat- rezeptoren, VCAM-1 und PECAM-1), Aktivatorsequenzen der Genen für Proteine, welche in solchen Gewebezellen bevorzugt exprimiert werden, von denen die Tumorzellen eines Patienten stammen (hierzu gehören Proteine exprimiert in Zellen des Brustgev/ebes (beispielsweise MUC-1, alpha-Lactalbumin), der Schilddrüse (beispielsweise Thyroglobulin) , der Prostata (beispielsweise Kallikrein-2, Androgen-Rezeptoren, PSA) , des Ovars, der Muttermale (beispielsweise Tyrosinase) , und der
Niere) , Aktivatorsequenzen der Gene für Proteine, welche in Makrophagen, Dentritischen Zellen oder Lymphozyten exprimiert werden wie beispielsweise Interleukine, Cytokine, Chemokine, Adhäsions- moleküle, Interferone, Rezeptoren für Interleukine, Cytokine, Chemokine, oder Interferone, Aktivatorsequenzen, welche bei Hypoxie aktiviert werden, wie beispielsweise die Aktivatorsequenz für VEGF oder für Erythropoietin .
Die Einfügung der Komponenten I) bis VI) in die Mikro- Organismen erfolgt mit den dem Fachmann bekannten molekularbiologischen Methoden. Beispielsweise ist bei Verwendung von Bakterien als Träger dem Fachmann geläufig, wie die Komponenten in geeignete Plasmide eingefügt und diese Plasmide in die Bakterien eingeführt werden. Gemäß dieser Erfindung v/erden diese Mikroorganismen einem Patienten verabreicht zur Prophylaxe oder Therapie einer proliferativen Erkrankung wie beispielsweise eines Tumors, einer Leukämie, einer chronischen Entzündung, einer Autoimmunerkrankung oder der Abstoßung eines Organtransplantates. Zur Behandlung einer derartigen Erkrankung werden die erfindungsgemäßen Mikroorganismen in einer geeigneten Zubereitung lokal oder systemisch, beispiel- sweise in den Blutkreislauf, in eine Körperhöhle, in ein Organ, in ein Gelenk oder in das Bindegewebe verabreicht. Um bei systemischer Verabreichung, im Besonderen bei Verabreichung in den Blutkreislauf die unerwünschte Aufnahme der Mikroorganismen durch das sogenannte retikuloendothe- liale System über die Wirkung der Komponente II) hinaus zu vermindern und die Blutverweilzeit der Mikroorganismen zu verlängern, können die Mikroorganismen in einer Lösung von Substanzen suspendiert v/erden, welche eine lange Blutverweilzeit besitzen. Der Suspension schließt sich eine Inkubation an. Die Suspension und Inkubation der Mikroorganismen kann beispielsweise in Blutplasma oder Blutserum erfolgen. Die Suspension und Inkubation wird jedoch vorzugsweise in Lösungen von Substanzen oder Lösungen von Gemischen von Substanzen durchgeführt, welche eine lange Blutverweilzeit aufweisen. Zu diesen Substanzen gehören beispielsweise Albumin, Transferrin, Präalbumin, Hämoglobin, Haptoglobin, Alpha-1-Lipoprotein, Alpha-2- Lipoprotein, ß-1-Lipoprotein, alpha-2-Macroglobulin, Polyethylenglykol (PEG) , Konjugate von PEG mit natürlichen oder synthetischen Polymeren, wie beispielsweise mit Poly- ethylenimine, Dextrane, Polygeline, Hydroxyethylstärke .
Durch die Suspension und Inkubation in einer derartigen Lösung erfolgt eine Adsorption der Substanzen an die Oberfläche der erfindungsgemäßen Mikroorganismen. Eine Beschichtung der Mikroorganismen mit diesen Substanzen kann jedoch auch erfolgen durch Konjugation. Die Methoden der Konjugation sind in Sedlacek et al Contributions to Oncology 32: 1-132, 1988 übersichtlich zusammengefasst . Die Beschichtung durch Adsorption erfolgt beispielsweise durch Suspension der Mikroorganismen in eine Lösung enthaltend vorzugsweise 0, 1 bis 50% der Beschichtungssub- stanzen über einen Zeitraum von vorzugsweise 10 Minuten bis 24 Stunden und einer Temperatur von vorzugsweise 4 Grad Celsius.
Gemäß der Erfindung werden als Mikroorganismen bevorzugt Bakterien verwendet, deren Virulenz vermindert wurde. Weiterhin bevorzugt werden Bakterien ausgewählt aus einer Gruppe, umfassend Escherichia coli, Salmonella enterica, Yersinia enterocolitica, Vibrio cholerae, Listeria monocytogenes, Shigella.
Mikroorganismen im Rahmen der Erfindung sind des weiteren Membranhüllen, sogenannte Geister, von lebenden bzw. existierenden Mikroorganismen. Derartige Membranhüllen werden beispielsweise gemäß der EPA 0540525 hergestellt .
Gegenstand der Erfindung sind Arzneimittelzubereitungen, enthaltend die erfindungsgemäßen Mikroorganismen und die Verwendung dieser Arzneimittelzubereitung zur Prophylaxe und/oder Therapie einer proliferativen Erkrankung. Eine proliferative Erkrankung im Sinne dieser Erfindung ist eine Erkrankung mit überschießender oder unkontrollierbarer Zellproliferation, beispielsweise ein Tumorer- krankung wie ein Karzinom oder ein Sarkom, eine Leukämie, eine chronische Entzündung, eine Autoimmunerkrankung oder die Abstoßung eines Organtransplantates. Zur Prophyllaxe oder Therapie einer Erkrankung v/erden die erfindungs¬ gemäßen Mikroorganismen in der Arzneimittelzubereitung in einer Dosis von vorzugsweise 100 Keimen bis 100 Mio.
Keimen einem Patienten lokal oder systemisch verabreicht.
Der Begriff ummantelt meint, daß auf der Außenseite der Membran des Mikroorganismus eine Mehrzahl gleicher oder verschiedener Moleküle (exprimiert und/oder sek- retiert gemäß einem oder mehreren der Merkmale I) bis III)), wie vorstehend beschrieben, angebracht se n können, wobei der geometrische Bedeckungsgrad zwischen 0,001 und 1, insbesondere zwischen 0,01 und 1, beispielsweise zwischen 0,1 und 1 liegen kann. Der geometrische Bedeckungsgrad kann berechnet werden aus dem Quotienten der Gesamtflache aller Moleküle, in radialer (bezogen auf einen Mittelpunkt des Mikroorganismus) Projektion in die Oberflache des Mikroorganismus, und der Oberflache des Mikroorganismus. In der Regel wird vereinfachend eine kugelförmige Oberflache des Mikroorganismus angenommen und berechnet werden aus dem Volumen des Mikroorganismus. Das Merkmal "ummantelt" ist ggf. fakultativ.
Ausfuhrungsbeispiele :
Beispiel 1: Konstruktion eines Bakterienstammes zur membranstandigen Expression von Humanem Albumin und Beta-Glucuronidase
In diesem Beispiel soll der Weg zum Bakterienstamm St21-bglu beschrieben werden. Dieser attenuierte Salmo nella typhi Ty21a Stamm (Trager zum humanen Gebrauch zugelassen) exprimiert mit Hilfe der Hly Sekre- tionsmaschmeπe von E. coli membranstandige Fusionsproteinen von humaner Beta-Glucuronidase und HlyA sowie humanem Albumin und HlyA. Die Konstruktion basiert auf den bereits veröffentlichten Plas iden pMOhlyl (Gentschev et al . , Be- hring Inst Mitt 57-66, 1994) und pGP704 (Miller and
Mekalanos, J Bacteriol 170: 2575-2583, 1988) . Der Stamm ermöglicht durch passives Targeting (Bermudes et al . , Adv Exp Med Biol 465: 57-63, 2000) eine Anreicherung von Beta- Glucuronidase am Tumor und somit eine auf Tumorgewebe beschränkte Spaltung von durch Beta-Glucuronidase aktivierbaren Pro-Drugs.
Eine membranständige Expression kann in Salmonellen durch Fusion des Proteins an den C-terminus des HlyA Sekretionsproteins in Anwesenheit des HlyB Proteins, aber in Abwesenheit eines vollständig funktioneilen HlyD Proteins erfolgen. Allerdings darf HlyD nicht vollständig fehlen, da sonst keine Verbindung zwischen der Sekretionsmaschin- erie und dem TolC Protein der äußeren Membran zustande kommt (Spreng et al . , Mol .Microbiol . 31: 1596-1598, 1999). In diesen Beispielen ist eine der möglichen Modifikationen des HlyD Proteins zur membranständigen Expression angegeben. Zuerst wird daher der Vektor pMOhly DD konstuiert, bei dem kein funktionelles HlyD Protein erzeugt wird. Hierfür wird aus dem Vektor pMOhlyl durch die Endonuk- leasen Dralll und Apal ein Teil des hlyD Gens entfernt. Nach dem Restriktionsverdau werden die Enden durch 3' - 5' Exonuklease verdaut und das 10923 bps große Fragment re- ligiert. Anschließend v/ird in diesen Vektor das Beta- Glucuronidase Gen in-Frame zum hlyA Gen kloniert. Hierfür wird die cDNA von bglu (GenBank Accession (Gb) : M15182) aus einer cDNA Bank mit folgenden Primern durch Po- lymerasekettenreaktion (PCR) amplifiziert: bglu 5": ATGCATTGCAGGGCGGGATGCTGTACC bglu 3 ' : ATGCAΓAAGTAAACGGGCTGTTTTCCAAAC . Die zur cDNA von beta-Glucuronidase komplementären Bereiche sind unterstrichen, die Information für die generierte Nsil Stelle ist in kursiv dargestellt (diese Dar- Stellung wird auch im Folgenden beibehalten; die
Oligonukleotidsequenzen sind hier, v/ie auch im folgenden 5' - 3' dargestellt). Die Primer sind so gewählt, dass das Gen ohne die Signalsequenz amplifiziert wird. Das Produkt (1899 bps) wird mit einem geeigneten "PCR Clonmg Kit" subkloniert, und dann wird über Nsil Verdau das ~ 1890 bps Fragment extrahiert. Anschließend wird das Nsil Fragment in den Nsil geschnittenen Vektor pMOhly DD kloniert. Dies ergibt den Vektor pMO DDbglu (Fig. 1) . (Wird das Nsil Fragment in den Nsil geschnittenen Vektor pMOhlyl kloniert, so entsteht das Plasmid pMO bglu, das eine Sezern- lerung des Fusionsproteins ermöglicht) . Im zweiten Teil wird der Integrationsvektor für die chromosomale Integra- tion der Albumm-HlyA Fusion hergestellt. In einem ersten Schritt wird der Vektor pMOhly alb hergestellt. Dieser auf pMOhlyl basierende Vektor tragt eine Fusion der Albumin- cDNA mit dem HlyA Gen. Zur Klonierung wird die cDNA des Albumin-Gens (Gb: A06977) aus einer käuflichen cDNA Bank mit Hilfe von PCR und den folgenden Nsil generierenden Primern amplifiziert:
5 ' : AΓGCAΓGGGTAACCTTTATTTCCCTTC 3 ' : ΛΓGCAΓAGCCTAAGGCAGCTTGACTTG-
Das 1830 bps große Fragment wird subkloniert und anschließend mit Nsil geschnitten. Das 1824 bps Fragment wird nun in Nsil verdauten pMohlyl ligiert. Das fertige Plasmid pMOhly alb exprimiert somit HlyB, HlyD und ein Fusionsprotein aus Albumin und HlyA. Für Experimente zur Verweildauer kann das Nsil Fragment alternativ auch in den Vektor pMO DD eingesetzt werden, dieser Vektor tragt den Namen pMO DDalb. Im weiteren Verlauf wird eine Modifikation der bereits beschriebene Klonierungsstrategie zur Integration im Salmonellenchromosom verwendet (Miller and Mekalanos, J Bacteriol 170: 2575-2583, 1988). Dafür wurde zuerst das aroA Gen von Salmonella in den Vektor pUC18 kloniert (PCR mit folgenden Primern:
Primer 5': ATGGAATCCCTGACGTTACAACCC, Primer 3 ' : GGCAGGCGTACTCATTCGCGC "Blunt" Klonierung des 1281 bps Fragments in die HincII Schnittstelle von pUC18) . Anschließend wurde durch HincII Verdau und anschließende Religierung ein 341 bps großes in aroA liegendes Fragment entfernt. Dieser Vektor wurde pUC18 aroA1 benannt. Anschließend wird das alb-hlyA Fu- sionsgen zusammen mit der auf pMOhly liegenden Promotorsequenz in den Vektor pUClδaroA' kloniert. Dazu wird der Vektor pMOhly alb mit AacII und Swal verdaut und anschließend mit einer 3 '-5' Exonuklease behandelt. Das 3506 bps große Blunt Fragment wird extrahiert und in HincII verdauten pUClδaroA' ligiert. Dies ergibt den Vektor pUCaro-alb. Nun wird das von aroA flankierte alb-hlyA Fragment mit den ganzen Aktivatorsequenzen aus dem Vektor pUCaro-alb in den Vektor pGP704 kloniert. Dazu wird pUC aro-alb mit Hindlll verdaut und anschließend mit 5 '-3'
Exonuklease behandelt (Blunt) . Anschließend wird mit EcoRI verdaut und das 4497 bps Fragment wird in den EcoRI / EcoRV (Blunt) verdauten Vektor pGP704 (EcoRI/RV Fragment: 6387 bps) ligiert. Es ergibt sich der Integrationsvektor pGParo-alb (Fig. 2). Der Vektor wird in den E.coli Stamm SMIOlpir transformiert. Dieser Stamm ermöglicht dem Vektor zu replizieren, da er das für die Replikation benötigte p-Protein bildet. Der Vektor wird nun über Konjugation in den Aktzeptorstamm Salmonella typhi Ty21a transferiert, der keine Replikation des Vektors erlaubt. Daher v/erden durch Tetrazyklin-Selektion nur Bakterien selektioniert, den Vektor chromosomal integriert haben. Die Überprüfung der zytoplasmatischen Albuminproduktion erfolgt über WESTERN-Blot Analyse des Bakterienlysats . Dieser Stamm, St21-alb, exprimiert zwar die alb-hlyA Fusion, kann sie in dieser Form weder sezernieren noch membranständig exprim- ieren. Dazu uss für membranständige Expression zusätzlich ein Plasmid mit funktionellem HlyB (wie pMO DDbglu) oder funktionellem HlyB und HlyD (wie pMO bglu) vorhanden sein. In diesem Beispiel wird das Plasmid pMO DDbglu mit dem Stamm St21-alb verwendet. Dies ergibt den Stamm St21-alb pMO DDbglu, der mit Hilfe des Hly Sekretionssystems sowohl humanes Albumin, als auch humane beta-Glucuronidase membranständig exprimiert. Dieser Stamm kann dann zur Pro- Drug Konversion im Sinne des Patents eingesetzt werden.
Beispiel 2: Konstruktion eines mit Albumin-HlyA Fusion ummantelten Bakterienstammes, zur Lieferung der genetischen Information von humaner Beta-glucuronidase .
Der in diesem Beispiel aufgezeigte Bakterienstamm soll mit Hilfe des passiven Targetings für humane Beta- Glucuronidase kodierende DNA an Tumorzellen liefern, die dann in den Tumorzellen exprimiert werden sollen. Um einen besonders einfach handhabbaren Stamm zu erhalten, wird in diesem Beispiel zur Membranexpression von Albumin ein leicht modifizierter Stamm wie in Beispiel 1 verwendet. Dabei soll sowohl das für Albumin-HlyA kodierende Gen chromosomal integriert werden, als auch die Information für HlyB. Damit exprimiert dieser Stamm konstitutiv- me - branständiges Albumin.
Zu diesem Zweck wird der oben beschriebene Vektor pMOhly alb durch BsrBI und EcoRI verdaut und anschließend mit 5 '-3' Exonuklease behandelt. Dieser Verdau produziert ein 5815 bps großes Fragment mit Blunt-Enden, das die ko - plette prokaryotische Aktivierungssequenz und die Gene hlyC, alb-hlyA und hlyB enthält, nicht aber hlyD. Dieses Fragment kann nun Blunt in die HincII Schnittstelle des oben beschriebenen Vektor pUClδaroA' eingefügt werden. Dabei ergibt sich der Vektor pUCaro-alb-B. Durch einen EcoRI - Nrul Verdau kann das 6548 bps Fragment wieder in den EcoRI - EcoRV verdauten Vektor pGP704 eingefügt werden (Fig. 3). Die weitere Vorgehensweise (Replikation und In- tegration in S. typhi Ty21a) entspricht dann der oben dargestellten Strategie. Der resultierende Stamm St21-alb-B exprimiert konstitutiv membranständiges Albumin-HlyA Fusionsprotein. Wird ein HlyD kodierender Vektor transfiziert, so wird das Albumin-HlyA Fusionspro- tein sezerniert. Das Plasmid für die Lieferung der Beta- Glucuronidase kodierenden DNA basiert auf dem kommerziellen Vektor pCMVbeta (Clontech) . Für die Konstruktion uss zuerst eine Fusion des bglu Gens mit einem Sekretionssignal verwendet werden. In diesem Beispiel soll das Sig- nalpeptid des tPA Precursor Moleküls verwendet werden.
Dieses Signalpeptid erlaubt eine besonders effiziente Produktion und Sekretion von Fusionsproteinen. Zur Klonierung der Fusion wird in einem ersten Schritt die 5' UTR der tPA cDNA (Gb E02027) bis zum Ende des für das Signalpeptid kodierenden Bereichs mit folgenden Primern über PCR amplifiziert (Amplifikation mit "Blunt" generierender Poly erase) :
5 ' : GCGGCCGCAGGGAAGGAGCAAGCCGTGAATTT 3 » : AGCT2ΑGATCTGGCTCCTCTTCTGAATC Das entstehende 166 bp Fragment wird in den Hindlll verdauten, 5 '-3' Exonuklease behandelten, kommerziellen Vektor pCDNA3 (Invitrogen) ligiert. Die Ligation erfolgt in der "Forward" Orientierung. Dadurch lässt sich der tPA Signalsequenz kodierende Bereich über einen Notl Verdau komplett aus dem entstandenen Plasmid pCDNAtp ausschneiden. Dieses 237 bps Fragment wird nun mit dem 3760 bps Fragment des Vektors pCMVbeta nach Notl Verdau (enthält Vektor-Backbone) ligiert. Das entstandene Plasmid pCMVtp (3972 bps) kann nun für Expression heterologer Fusionsproteine verwendet werden. Für die Generierung des Plasmids pCMV bglu wird das mit folgenden, Spei generierenden Primern ein bps Fragment des bglu (Gb M15182) Gens (ohne Sequenz für Signalpeptid) aus einer geeigneten cDNA Bank amplifiziert:
5 * : ACTAGTCAGGGCGGGATGCTGTACCCCCAG
3' : ACTAGTCTTGCTCAAGTAAACGGGCTGTTTTC.
Nach Spei Verdau v/ird das 1899 bps Fragment in den Spei verdauten Vektor pCMVtp ligiert. Das entstandene Plasmid pCMVtp bglu kodiert nun für eine N-terminale Fusion des tPA Signalpeptids mit dem Bereich des maturen Proteins von Beta-Glucuronidase. Nach der Bestimmung der richtigen Lage wird das Plasmid pCMVtp bglu (Fig. 4) in den Stamm St21-alb-B transformiert. Dieser Stamm erlaubt nun eine Lieferung der DNA an das Tumorgewebe mit Hilfe von passivem Targeting und die Expression der DNA durch trans- fizierte Tumorzellen erlaubt dann eine Konversion von geeigneten Pro-Drugs.
Beispiel 3: Konstruktion eines mit Albumin-TolC Fusion ummantelten Stamm mit membranständiger Expression der extrazellulären Domäne von FAS und Lieferung eines ProDrug konvertierenden Enzyms
Der in diesem Beispiel gezeigte Stamm vereinigt die in Beispiel 2 gezeigten Eigenschaften mit einem gezielten Targeting an (Tumor-) Zellen, die Fas-Ligand (FasL) expri - ieren. Mit diesem Stamm ist es möglich, gezielt FasL ex- primierende Tumorzellen, wie beispielsweise in bestimmten Brusttumoren (Herrnring et al . , Histochem Cell Biol 113: 189-194, 2000), anzugreifen. FasL Expression durch Tumorzellen v/urde als potentieller Mechanismus zum I mune- Escape postuliert, da diese Zellen aktiv angreifende, Fas exprimierende, Lymphozyten eliminieren können (Muschen et al . , J Mol Med 78: 312-325, 2000). Mit dem hier gezeigten Stamm lassen sich diese für eine Therapie sehr problematischen Tumorzellen gezielt angreifen und anschließend durch einen Apoptose-unabhängigen Mechanismus eliminieren. Der Trägerstamm basiert in diesem Beispiel auf eine Fusion von Albumin mit dem TolC Protein von E. coli. Dadurch wird eine membranständige Expression von Albumin erreicht. Die membranständige Expression der extrazellulären Domäne von Fas erfolgt über das Plasmid pMOhlyDD und zur Lieferung v/ird das oben beschriebene Plasmid pCMV-bglu verwendet. Der erste Schritt umfasst die Generierung des TolC-Albumin exprimierenden Trägerstamms. Dafür wird zuerst das Gen für das Fusionsprotein generiert, und anschließend wird dieses Gen, entsprechend den obigen Beispielen, über sukkzessive Klonierung in pUCaroA' und pGP704 in das Salmonellengenom integriert. Das TolC Gen für E. coli, mitsamt dem natürli- chen Promotor, liegt in dem Plasmid pBRtolC vor. Dieses wurde mit Hilfe folgender Sall generierenden Primer aus dem Vektor pAX629 (enthält tolC Gen, Bereich im Vektor entspricht Gb X54049 Pos. 18-1914) amplifiziert: 5' toi: TAACGCCCTATGΓCGACTAACGCCAACCTT, 3* toi: AGAGGATGΓCGACTCGAAATTGAAGCGAGA.
Das 1701 bps Fragment wurde nach Spaltung mit Sall invers in die Sall Schnittstelle des Vektors pBR322 (Gb J01749) ligiert, wodurch das tet Gen unterbrochen wurde. Aufgrund der bekannten Kristallstruktur von' TolC (Koronakis et al . , Nature 405: 914-919., 2000) erlaubt das Einbringen het- erologer DNA in die singuläre Kpnl Schnittstelle im tolC Gen die Expression des kodierten heterologen Fusionsproteins in einer extrazellulären Schleife auf der Außenmembran. Zur Expression von Albumin wird das Albumin- Gen aus der cDNA (Gb A06977) mit Hilfe folgender Kpnl generierenden Primer amplifiziert:
5 ' : GGΓACCGAGATGCACACAAGAGTGAGG 3 : GGΓAC TAAGCCTAAGGCAGCTTGACTTGC.
Nach Kpnl Verdau des 1770 bps Fragment kann die DNA in den Kpnl geschnittenen Vektor pBRtolC eingesetzt werden. Die reverse Orientierung (in Frame zu tolC) ergibt dann den Vektor pBRtolC-alb. Das Gen für die tolC-Albu in Fusion kann nun über EcoRV und PshAI (Fragment 3970 bps) wird nun in umgekehrter Orientierung in die HincII Schnittstelle des Vektors pUCaroA' ligiert. Der entstandene Vektor pUCaro-alb-tol (7596 bps) wird nun mit Hindlll line- arisiert, 5 '-3' Exonuklease behandelt und anschließend mit EcoRI verdaut. Das 4961 bps Fragment wird dann in den
EcoRI - EcoRV verdauten Vektor pGP704 eingesetzt (Fig. 5) . Nach Konjugation (entsprechend Beispiel 1) ergibt sich der Stamm St21-tol-alb. Nun wird das Plasmid zur membran- ständigen Expression eines Fas (CD95) - HlyA Fusionspro- teins mit Hilfe der HlyB Komponente der E. coli Typ I Sekretionsmaschinerie. Hierfür wird zuerst der für den extrazelluläre Bereich kodierende Abschnitt des Fas-Gens (Gb: M67454) mit folgenden Nsil generierenden Primern amplifiziert : 5': AΓGCAΓTATCGTCCAAAAGTGTTAATGC
3': ArGCATTAGATCTGGATCCTTCCTCTTTGC . Das 477 bps Fragment wird mit Nsil verdaut und in den Nsil verdauten Vektor pMOhly DD in Frame zum HlyA Gen eingesetzt. Der entstandene Vektor pMO DD-fas (Fig. 6) produz- iert somit nach Transformation in einen Salmonellenstamm ein membranständiges Fas-Fragment, dass bei geeigneter Faltung an FasL exprimierende Zellen binden kann. Somit können diese Sal onellen an FasL exprimierenden Zellen, wie beispielsweise Tumorzellen, angereichert werden.
Zum Abtöten der FasL Tumorzellen wird nun ebenfalls das Plasmid pCMV bglu (Beispiel 2) in die Salmonellen transfiziert . Damit ist dann, wie im obigen Beispiel, nach Expression der Beta-Glucuronidase durch Tumorzellen eine ProDrug-Drug vermittelte Tumortherapie möglich. Die bessere Wirksamkeit dieses Beispiels im Vergleich zum vorigen Beispiel hängt ganz entscheidend von der korrekten Faltung der extrazellulären Domäne von Fas ab. Anstelle von Fas können auch FasL spezifische Fab-Fragmente monok- lonaler Antikörper (die sich in Bakterien korrekt falten lassen) mit dem gleichen Ansatz wie hier beschrieben verwendet v/erden. Dieses Beispiel zeigt, dass mit Hilfe die- ser Technik die Konstruktion von Stämmen mit nahezu beliebiger Zellspezifität über die Verwendung von geeigneten spezifischen Fab Fragmenten möglich ist.

Claims

Patentansprüche :
1) Mikroorganismus, in dessen Genom folgende Komponenten eingefugt und exprimierbar sind: I) eine Nukleotidsequenz, kodierend für ein direkt oder indirekt, antiproliferativ oder zytotoxisch wirkendes Expressionsprodukt oder für mehrere verschiedene solcher Expressionsprodukte,
II) eine Nukleotidsequenz, welche für ein Blutplas- maprotein unter der Kontrolle einer im Mikroorganismus aktivierbaren Aktivierungssequenz kodiert oder konstitutiv aktiv ist,
III) optional, eine Nukleotidsequenz, welche für einen zellspezifischen Liganden unter der Kon- trolle einer im Mikroorganismus aktivierbaren
Aktivierungssequenz kodiert oder konstitutiv aktiv ist,
IV) eine Nukleotidsequenz für ein Transportsystem, welches die Expression der Expressionsprodukte der Komponenten I) und II) sowie optional III) auf der Außenflache des Mikroorganismus oder die Sekretion der Expressionsprodukte der Komponente I) und Expression der Komponente II) sowie optional III) bewirkt und vorzugsweise konstitutiv aktiv ist,
V) optional eine Nukleotidsequenz für ein Protein zur Lyse des Mikrooganismus im Cytosol von Saugerzellen und zur intrazellularen Freisetzung von Plasmiden mit zumindest einer oder mehreren der Komponenten I) und VI) ent- halten in dem lysierten Mikroorganismus, und
VI) eine in dem Mikroorganismus aktivierbare, und/oder eine gewebezellspezifische, tumorzellspezifische, funktionsspezifische oder nicht zellspezifische A.ktivierungssequenz zur Expression von Komponente I), wobei jede der Komponenten I) bis VI) einfach oder mehrfach, jeweils gleich oder verschieden, eingerichtet sein kann.
2) Mikroorganismus nach Anspruch 1, wobei der Mikroorganismus ein Virus, ein Bakterium oder ein einzel- liger Parasit ist.
3) Mikroorganismus nach Anspruch 1 oder 2, wobei die Virulenz des Mikroorganismus reduziert ist.
4) Mikroorganismus nach einem der Ansprüche 1 bis 3, wobei der Mikroorganismus ein gram-positives oder gram-negatives Bakterium ist.
5) Mikroorganismus nach einem der Ansprüche 1 bis 4 aus- gewählt aus einer Gruppe bestehend aus "Escherichia coli, Salmonella, Yersinia enterocolitica, Vibrio cholerae, Listeria monocytogenes, und Shigella".
6) Mikroorganismus nach einem der Ansprüche 1 bis 5, wobei der Mikroorganismus die Hülle eines Bakteriu s
7) Mikroorganismus nach einem der Ansprüche 1 bis 6, bei welchem die Komponente I) kodiert für mindestens eine Protein, ausgev/ahlt aus der Gruppe bestehend aus "In¬ terferone; Interleukine; proapoptotische Proteine; Antikörper oder Antikorperfragmente, welcher hemmend auf oder zytotoxisch ist für eine Immunzelle, für eine Tumorzelle, oder für Zellen des Gewebes, von welchem der Tumor stammt; -antiproliferativ wirkende Proteine; zytotoxische Proteine; Induktoren einer Entzündung, insbesondere Interleukine, Cytokine oder Chemokine; virale, bakterielle, von einer Hefe, von einem Weichtier, von einem Säuger oder vo Menschen stammende Enzyme zur Aktivierung oder Spaltung einer inaktiven Vorstufe eines Zytostatikums in das Zyto- statikum; Fusionsprodukte aus einem zellspezifischen Liganden und einem Enzym; und Inhibitoren der Angiogenese" .
8) Mikroorganismus nach einem der Ansprüche 1 bis 7, wobei die Komponente II) kodiert für mindestens ein Blutplasmaprotein ausgewählt aus einer Gruppe bestehend aus "Albumin, Transferrin, Haptoglobin, Haemoglobin, Alphal Lipoprotein, Alpha2 Lipoprotein, ßl Lipoprotein und alpha2 Macroglobulin" .
9) Mikroorganismus nach einem der Ansprüche 1 bis 8, wobei die Komponente III) kodiert für mindestens einen Liganden spezifisch für einen Zielorganismus ausgewählt aus der Gruppe bestehend aus "Tumorzellen; Tumorendothelzellen; Gewebezellen, von welchen ein Tumor stammt; aktivierte Endothelzellen; Makrophagen; dentritische Zellen; und Lymphozyten" .
10) Mikroorganismus nach einem der Ansprüche 1 bis 9, wobei die Komponente III) kodiert für mindestens einen Liganden, spezifisch für eine Gewebezellenart aus Geweben, ausgewählt aus einer Gruppe bestehend aus "Schilddrüse, Brustdrüse, Speicheldrüse, Lymphdrüse, Brustdrüse, Magenschleimhaut, Niere, Ovar, Prostata, Cervix, Harnblasenschleimhaut, und Muttermal" .
11) Mikroorganismus nach einem der Ansprüche 1 bis 10, 5 wobei die Komponente IV) kodiert für das Hämolysin- transportsignal von Escherichia coli, das S-Layer (Rsa A) Protein von Caulobacter crescentus, und/oder das TolC-Protein von Escherichia coli.
10 12) Mikroorganismus nach einem der Ansprüche 1 bis 11, wobei die Komponente V) kodiert für ein lytisches Protein von gram-positiven Bakterien, für lytische Proteine von Listeria monocytogenes, für PLY551 von Listeria monocytogenes und/oder für das Holin von
15 Listeria monocytogenes.
13) Mikroorganismus nach einem der Ansprüche 1 bis 12, an welchem eine Substanz gebunden ist, welche eine lange Blutverweilzeit aufweist, insbesondere mindestens 0 eine Substanz ausgewählt aus der Gruppe bestehend aus "Albumin, Transferrin, Präalbumin, Hämoglobin, Hapto- globin, Alpha-1-Lipoprotein, Alpha-2-Lipoprotein, ß-1-Lipoprotein, alpha-2-Macroglobulin, Poly- ethylenglykol (PEG) , Konjugate von PEG mit natürli- 5 chen oder synthetischen Polymeren, v/ie beispielsv/eise mit Polyethylenimine, Dextrane, Polygeline, Hy- droxyethylstärke und Mischungen dieser Stoffe", wobei die Bindung der Substanzen durch Physisorption, Chemisorption oder kovalent erfolgt. 0
14) Plasmid oder Expressionsvektor enthaltend die Komponenten I), II), IV) und VI), sowie, optional, eine oder mehrere der Komponenten III) und V) . 15) Verfahren zur Herstellung eines Organismus nach einem der Ansprüche 1 bis 13, v/obei ein Plasmid nach Anspruch 14 erzeugt wird und mit diesem Plasmid ein Mikroorganismus transformiert wird.
16) Verwendung eines Mikroorganismus nach einem der Ansprüche 1 bis 13 zur Herstellung eines pharmazeutischen Zusammensetzung.
17) Verwendung eines Mikroorganismus zur Herstellung einer pharmazeutischen Zusammensetzung für die Prophylaxe und/oder Therapie einer Erkrankung, welche verursacht wird durch eine unkontrollierte Zelltei- lung, insbesondere einer Tumorerkrankung, beispielsweise eines Prostatakarzinoms, eines Ovarkarzinoms, eines Mammakarzinoms, eines Magenkarzinoms, eines Nierentumors, eines Schilddrüsentumors, eines Mela- noms, eines Cervixtumors, eines Harnblasentumors, eines Speicheldrüsentumors und/oder eines
Lymphdrüsentumors, einer Leukämie, einer Entzündung, einer Organabstoßung, und/oder einer Autoimmunerkrankung .
18) Verwendung nach Anspruch 17 für die Entfernung eines Tumors wie auch des gesunden Gewebes, von welchem der Tumor stammt.
19) Verfahren zur Herstellung einer pharmazeutischen
Zusammensetzung nach einem der Ansprüche 16 bis 18, wobei ein ummantelter Mikroorganismus nach einem der Ansprüche 1 bis 13 in physiologisch wirksamer Dosis mit einem oder mehreren physiologisch verträglichen Trägerstoffen zur oralen, i.m., i.v., oder i.p Gabe hergerichtet wird.
EP03704314A 2002-02-14 2003-02-13 Mikroorganismus zur gentherapeutischen behandlung proliferativer erkrankungen Withdrawn EP1474519A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10206325A DE10206325A1 (de) 2002-02-14 2002-02-14 Ummantelter Mikroorganismus
DE10206325 2002-02-14
PCT/DE2003/000470 WO2003068954A2 (de) 2002-02-14 2003-02-13 Mikroorganismus zur gentherapeutischen behandlung proliferativer erkrankungen

Publications (1)

Publication Number Publication Date
EP1474519A2 true EP1474519A2 (de) 2004-11-10

Family

ID=27674670

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03704314A Withdrawn EP1474519A2 (de) 2002-02-14 2003-02-13 Mikroorganismus zur gentherapeutischen behandlung proliferativer erkrankungen

Country Status (19)

Country Link
US (1) US20050244374A1 (de)
EP (1) EP1474519A2 (de)
JP (1) JP2005517405A (de)
KR (1) KR20040103941A (de)
CN (1) CN1646693A (de)
AU (1) AU2003206663B2 (de)
BR (1) BRPI0307722A2 (de)
CA (1) CA2513198A1 (de)
DE (2) DE10206325A1 (de)
HR (1) HRP20040832A2 (de)
IL (1) IL163553A0 (de)
MX (1) MXPA04007934A (de)
NO (1) NO20043800L (de)
NZ (1) NZ535310A (de)
PL (1) PL372901A1 (de)
RS (1) RS72404A (de)
RU (1) RU2004127459A (de)
WO (1) WO2003068954A2 (de)
ZA (1) ZA200407358B (de)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006004992A1 (en) * 2004-06-29 2006-01-12 Anticancer, Inc. Cancer selective auxotrophs
MD3823665T2 (ro) 2018-07-19 2024-05-31 Regeneron Pharma Receptori antigenci chimerici cu specificitate BCMA și utilizările acestora
TWI838389B (zh) 2018-07-19 2024-04-11 美商再生元醫藥公司 雙特異性抗-BCMAx抗-CD3抗體及其用途
WO2020172462A1 (en) * 2019-02-22 2020-08-27 Arizona Board Of Regents On Behalf Of Arizona State University Tumor-navigating, self-eradicating, trail-armed salmonella for precision cancer therapy

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19720761A1 (de) * 1997-05-07 1998-11-12 Schering Ag Verfahren zur Synthese und Sekretion von zur Kontrazeption geeigneter Proteine oder Proteinfragmente durch attenuierte Salmonellen oder einen anderen Gram-negativen attenuierten Impfstamm zur Erzeugung einer oralen Vakzinierung

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03068954A2 *

Also Published As

Publication number Publication date
BRPI0307722A2 (pt) 2017-07-04
CA2513198A1 (en) 2003-08-21
PL372901A1 (en) 2005-08-08
IL163553A0 (en) 2005-12-18
KR20040103941A (ko) 2004-12-09
AU2003206663B2 (en) 2007-11-01
WO2003068954A3 (de) 2003-10-16
NZ535310A (en) 2008-04-30
DE10206325A1 (de) 2003-09-04
AU2003206663B9 (en) 2003-09-04
JP2005517405A (ja) 2005-06-16
DE10390506D2 (de) 2005-01-13
NO20043800L (no) 2004-11-08
CN1646693A (zh) 2005-07-27
RU2004127459A (ru) 2005-05-10
RS72404A (sr) 2006-12-15
US20050244374A1 (en) 2005-11-03
MXPA04007934A (es) 2005-11-23
ZA200407358B (en) 2005-11-18
WO2003068954A2 (de) 2003-08-21
AU2003206663A1 (en) 2003-09-04
HRP20040832A2 (en) 2004-12-31
WO2003068954A8 (de) 2005-10-13

Similar Documents

Publication Publication Date Title
DE69434447T2 (de) Für die gentherapie verwendbare plasmide
DE69433921T2 (de) Rekombinante zellen der monozyten-makrophagen zelllinie zur gen-therapie
EP0871748B1 (de) Verabreichung von biologisch aktiven polypeptiden
Shi et al. Intratumoral injection of interleukin-12 plasmid DNA, either naked or in complex with cationic lipid, results in similar tumor regression in a murine model
DE69731756T2 (de) Melanomzellinien, welche immundominante melanomantigene teilen und verfahren zu deren anwendung
DE69837706T2 (de) Zytolyse der geeigneten zielzellen mit superantigen konjugate mittels der induktion von t-zell aktivierung
JP2002514887A (ja) トロンボポイエチンポリペプチドの分泌方法
DE60319083T2 (de) Pharmazeutische verbindung und methoden zur behandlung von menschlichen karzinomen mittels arginin-entzug
CA2198462A1 (en) Genetic therapy of diseases caused by the immune system, said therapy using a cell-specific active substance regulated by the cell cycle
JP2014509197A (ja) 標的性治療人腫瘍治療の腫瘍溶解性アデノウイルス及びその応用
JP2025061188A (ja) キメラサイトカイン受容体
JP2002506647A (ja) インターフェロンαプラスミドおよび送達システム、およびこれを作製しそして使用する方法
DE10208653A1 (de) Mikroorganismus als Träger von Nukleotidsequenzen kodierend für Zellantigene zur Behandlung von Tumoren
Han et al. In situ chimeric antigen receptor macrophage therapy via co-delivery of mRNA and immunostimulant
EP1308167A1 (de) Antigenpräsentierende Vesikel
DE69828414T2 (de) Mukosale zytotoxische t-lymphozytenantwort
WO2003068954A2 (de) Mikroorganismus zur gentherapeutischen behandlung proliferativer erkrankungen
DE69822453T2 (de) Regulationssystem für induzierbare expression von gene mit lambda-ähnlichen promotoren
EP1491216A1 (de) Arzneimittel mit protein formenden hohlen nanoteilchen und therapeutische substanz zur überführung in damit kondensierte zellen
CN106552259A (zh) 一种融合蛋白及其治疗疾病的用途
CN111909246B (zh) 高效感染支持细胞的aav突变体
EP4495243A1 (de) Neuartiges verfahren zur herstellung von exosom mit zielnukleinsäure als nukleinsäuremedizin
CN119097725B (zh) 一种cd8抗体修饰的抗tim-3的脂质纳米颗粒、制备方法及其应用
Dickler et al. Gene therapy in the treatment of disease
HK1078899A (en) Enveloped microorganism

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20040825

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ZENTARIS GMBH

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ZENTARIS GMBH

17Q First examination report despatched

Effective date: 20070315

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: AETERNA ZENTARIS GMBH

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090930