WO2024136627A1 - 나트륨 포도당 운반체-2 저해제 및 안지오텐신 ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물 - Google Patents

나트륨 포도당 운반체-2 저해제 및 안지오텐신 ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2024136627A1
WO2024136627A1 PCT/KR2023/095114 KR2023095114W WO2024136627A1 WO 2024136627 A1 WO2024136627 A1 WO 2024136627A1 KR 2023095114 W KR2023095114 W KR 2023095114W WO 2024136627 A1 WO2024136627 A1 WO 2024136627A1
Authority
WO
WIPO (PCT)
Prior art keywords
fatty liver
alcoholic fatty
liver disease
pharmaceutical composition
angiotensin
Prior art date
Application number
PCT/KR2023/095114
Other languages
English (en)
French (fr)
Inventor
한태희
유영근
Original Assignee
주식회사 티에치팜
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 티에치팜 filed Critical 주식회사 티에치팜
Publication of WO2024136627A1 publication Critical patent/WO2024136627A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/351—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom not condensed with another ring
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease containing a sodium glucose transporter-2 inhibitor and an angiotensin II receptor blocker.
  • Non-alcoholic fatty liver disease is a disease diagnosed when fat deposition within liver cells is observed imaging or histologically, and the cause of fat accumulation within liver cells is significant alcohol intake, continuous drug use, and liver disease due to other causes, including genetic disease. It is reported as And this disease is known to encompass simple fatty liver, non-alcoholic steatohepatitis, and non-alcoholic fatty liver-related cirrhosis.
  • Non-alcoholic fatty liver disease is a very commonly encountered disease, and its prevalence is rapidly increasing along with the increase in the occurrence of various metabolic syndromes such as obesity and diabetes, and non-alcoholic steatohepatitis or non-alcoholic steatohepatitis-related liver fibrosis compared to simple non-alcoholic fatty liver disease. It is known that the incidence of liver cirrhosis due to cirrhosis is high, and the risk of liver-related mortality as well as the incidence of liver failure or hepatocellular carcinoma due to cirrhosis is reported to increase.
  • Non-alcoholic fatty liver disease is reported to increase with age and to have gender differences. This is known to be caused by decreased insulin sensitivity and hormonal changes with age.
  • Non-alcoholic fatty liver disease is known to be closely related to metabolic syndrome, overweight and obesity, type 2 diabetes, and dyslipidemia. It is reported that 90% of patients with non-alcoholic fatty liver disease have at least one element of metabolic syndrome, and one-third have metabolic syndrome. Overweight and obesity are risk factors for non-alcoholic fatty liver disease, but central obesity is known to be a particularly strong risk factor.
  • the present inventors completed the present invention by conducting research to develop a combination therapy that can be effectively applied to the treatment of non-alcoholic fatty liver disease.
  • One object of the present invention is to use an Angiotensin II Receptor Blocker or a pharmaceutically acceptable salt thereof as the first pharmacological ingredient; and prevention or treatment of non-alcoholic fatty liver disease containing a sodium-glucose cotransporter-2 (SGLT-2) inhibitor or a pharmaceutically acceptable salt thereof as a second pharmacological ingredient.
  • SGLT-2 sodium-glucose cotransporter-2
  • Another object of the present invention is to provide a method for preventing or treating non-alcoholic fatty liver disease, comprising administering the pharmaceutical composition to a subject.
  • Another object of the present invention is to provide a kit containing the composition.
  • One aspect of the present invention is an angiotensin II receptor blocker or a pharmaceutically acceptable salt thereof as the first pharmacological ingredient; and prevention or treatment of non-alcoholic fatty liver disease containing a sodium-glucose cotransporter-2 (SGLT-2) inhibitor or a pharmaceutically acceptable salt thereof as a second pharmacological ingredient.
  • SGLT-2 sodium-glucose cotransporter-2
  • the sodium-glucose cotransporter-2 (SGLT-2) inhibitor may be Dapagliflozin or Empagliflozin.
  • the Angiotensin II Receptor Blocker may be Telmisartan.
  • the non-alcoholic fatty liver disease may be simple steatosis or non-alcoholic steatohepatitis.
  • the weight ratio of the angiotensin II receptor blocker and the sodium glucose transporter-2 inhibitor may be 2:1 to 8:1.
  • the pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease containing a sodium glucose transporter-2 inhibitor and an angiotensin II receptor blocker, there is no problem of interaction between drugs and it exhibits a synergistic effect in preventing or treating non-alcoholic fatty liver disease. , can be effectively applied to patients with non-alcoholic fatty liver disease.
  • Figure 1 is a graph showing the effect of suppressing fat accumulation by treatment concentration of dapagliflozin (DA) and/or telmisartan (Telm).
  • DA dapagliflozin
  • Telm telmisartan
  • Figure 2 shows (A) normal HepG2 cells, (B) HepG2 cells induced into a non-alcoholic fatty liver state by oleic acid (OA), and (C) induced into a non-alcoholic fatty liver state by oleic acid and dapagliflozin 5 ⁇ M and Telmi. This is a fluorescence microscope photo showing HepG2 cells treated with 10 ⁇ M sartan.
  • Figure 3 shows the treatment concentration of dapagliflozin (DA) and telmisartan (Telm) in HepG2 cells induced into non-alcoholic fatty liver state by oleic acid (OA) (5 ⁇ M+5 ⁇ M, 5 ⁇ M+10 ⁇ M, 10 ⁇ M+ 20 ⁇ M)
  • OA oleic acid
  • Figure 4 shows the treatment concentration of dapagliflozin (DA) and telmisartan (Telm) in HepG2 cells induced into non-alcoholic fatty liver state by oleic acid (OA) (5 ⁇ M+5 ⁇ M, 5 ⁇ M+10 ⁇ M, 10 ⁇ M+ 20 ⁇ M)
  • OA oleic acid
  • Figure 5 is a diagram showing the weight loss effect of dapagliflozin and/or telmisartan in male rats subjected to repeated non-clinical administration for 13 weeks.
  • Figure 6 is a diagram showing the weight loss effect in female rats after non-clinical repeated administration of dapagliflozin and/or telmisartan for 13 weeks.
  • One aspect of the present invention is an angiotensin II receptor blocker or a pharmaceutically acceptable salt thereof as the first pharmacological ingredient; and prevention or treatment of non-alcoholic fatty liver disease containing a sodium-glucose cotransporter-2 (SGLT-2) inhibitor or a pharmaceutically acceptable salt thereof as a second pharmacological ingredient.
  • SGLT-2 sodium-glucose cotransporter-2
  • SGLT-2 inhibitors included in the pharmaceutical composition of the present invention include Dapagliflozin, Empagliflozin, Ipragliflozin, Canagliflozin, It may be any one substance selected from the group consisting of Luseogliflozin and Tofogliflozin, but dapagliflozin or empagliflozin is preferred in terms of compatibility and synergistic effect. It is preferred, and dapagliflozin is most preferred.
  • the dosage of the pharmaceutical composition according to one embodiment of the present invention is, for example, about 0.001 mg/kg to about 100 mg/kg, about 0.01 mg/kg to about 10 mg/kg, or about 0.1 mg based on adults. /kg to about 1 mg/kg, once a day, multiple times a day, or once a week, once every two weeks, once every three weeks, or once every four weeks. It can be administered once a year, and depending on the judgment of the doctor or pharmacist, it can be administered in divided doses from once to several times a day at regular intervals.
  • the pharmaceutical composition of the present invention can be prepared by mixing an angiotensin II receptor blocker as a first pharmacological ingredient and an SGLT-2 inhibitor as a second pharmacological ingredient, and their mixing can be carried out simultaneously or sequentially, as known in the art. It can be performed using known methods.
  • the pharmaceutical composition of the present invention may be, for example, a double tablet containing an angiotensin II receptor blocker as a first pharmacological component and a SGLT-2 inhibitor as a second pharmacological component, or an angiotensin II receptor blocker and an agent as the first pharmacological component. 2 It may contain an SGLT-2 inhibitor as a pharmacological ingredient and may have an inner core crystal structure including an outer layer surrounding the inner core layer, but is not limited to this.
  • composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the composition of the present invention are those commonly used in the manufacture of drugs, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, and silicic acid. Including, but not limited to, calcium, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. That is not the case.
  • the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • lubricants wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • suitable pharmaceutically acceptable carriers and agents are described in detail in Remington: the science and practice of pharmacy 22nd edition (2013).
  • the pharmaceutical composition according to one embodiment of the present invention may be administered together with a substance showing pharmacological activity for one or more non-alcoholic fatty liver diseases.
  • composition according to one embodiment of the present invention may be used alone or in combination with methods using surgery, hormone therapy, drug therapy, and/or biological response modifiers for the prevention or treatment of non-alcoholic fatty liver disease. You can.
  • composition of the present invention may contain various bases and/or additives necessary and appropriate for the formulation of the formulation, and may include nonionic surfactants, silicone polymers, extenders, fragrances, preservatives, and disinfectants within the range that do not reduce the effectiveness. , oxidation stabilizers, organic solvents, ionic or non-ionic thickeners, softeners, antioxidants, free radical destroyers, opacifiers, stabilizers, emollients, silicones, ⁇ -hydroxy acids, anti-foaming agents, humectants, vitamins. , insect repellent, fragrance, preservative, surfactant, anti-inflammatory agent, substance P antagonist, filler, polymer, propellant, alkalinizing or acidifying agent, or colorant.
  • the appropriate dosage of the composition of the present invention can be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. there is.
  • the dosage of the composition of the present invention may be 0.001 to 1000 mg/kg per adult.
  • composition of the present invention can be administered orally.
  • composition of the present invention can be administered in various dosage forms when administered orally, such as tablets, pills, hard/soft capsules, solutions, suspensions, emulsifiers, syrups, granules, elixirs, troches, etc.
  • excipients such as wetting agents, sweeteners, flavoring agents, preservatives, etc. may be further included.
  • the composition of the present invention when formulated into an oral dosage form, it may further include appropriate carriers, excipients, and diluents commonly used in its preparation.
  • the carriers, excipients and diluents include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and/or mineral oil may be used, but are not limited to these.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants commonly used in formulation, and may further include lubricants such as magnesium stearate or talc in addition to the above excipients.
  • composition of the present invention may consist of about 0.1% to 90% of the pharmacological ingredient, preferably about 1% to about 80%.
  • Pharmaceutical preparations for enteral or parenteral administration can be prepared by known methods, such as conventional mixing, granulating, coating, solubilizing or freeze-drying methods.
  • Pharmaceutical preparations for oral use are prepared by mixing the active ingredients with solid excipients, preferably granulating the mixture obtained, and processing the mixture or granules into tablets or coated tablet centers after adding suitable auxiliary substances, if necessary or essential. You can get it by doing this.
  • the sodium-glucose cotransporter-2 (SGLT-2) inhibitor may be Dapagliflozin or Empagliflozin.
  • Dapagliflozin means (1S)-1,5-anhydro-1-C- ⁇ 4-chloro-3-[(4-ethoxyphenyl)methyl] Phenyl ⁇ -D-glucitol ((1S)-1,5-anhydro-1-C- ⁇ 4-chloro-3-[(4-ethoxyphenyl)methyl]phenyl ⁇ -D-glucitol), "Empah "Empagliflozin” is (1S)-1,5-anhydro-1-C-[4-chloro-3-[[4-[[(3S)-tetrahydro-3-furanyl]oxy ]phenyl]methyl]phenyl]-D-glucitol ((1S)-1,5-Anhydro-1-C-[4-chloro-3-[[4-[[(3S)-tetrahydro-3-furanyl ]oxy]phenyl]methyl]phenyl]-D-glucitol ((
  • a preferred dosage unit form of the SGLT-2 inhibitor is, for example, about 5 mg to about 800 mg, preferably about 50 mg to about 700 mg, more preferably about 100 mg to about 600 mg, most preferably about It may be a tablet or capsule containing 100 mg to about 300 mg.
  • the Angiotensin II Receptor Blocker may be Telmisartan.
  • Telmisartan refers to 4′-[(1,4′-dimethyl-2′-propyl[2,6′-bi-1H-benzimidazole]-1′ -yl)methyl][1,1′-biphenyl]-2-carboxylic acid (4′-[(1,4′-Dimethyl-2′-propyl[2,6′-bi-1H-benzimidazol]- 1′-yl)methyl][1,1′-biphenyl]-2-carboxylic acid).
  • Telmisartan may be supplied in the form of suitable dosage units, such as capsules or tablets, containing a therapeutically effective amount, for example, about 20 to about 320 mg of telmisartan, which can be applied to a patient.
  • a therapeutically effective amount for example, about 20 to about 320 mg of telmisartan, which can be applied to a patient.
  • Application of the active ingredient for example, starts with a daily dose of 20 mg or 40 mg of telmisartan and increases through a daily dose of 80 mg to a daily dose of 160 mg to 320 mg, up to three times daily. It can be. For example, it may be administered in the morning, midday or evening. In case of non-alcoholic fatty liver disease, administration once or twice a day is preferable.
  • the dapagliflozin, empagliflozin, or telmisartan may refer to both its active metabolites and prodrugs.
  • the "metabolites” are each active derivative that can be produced when dapagliflozin, empagliflozin or telmisartan is metabolized, and the "prodrugs" are dapagliflozin, empagliflozin, and telmisartan. Refers to a compound that is metabolized to rosin or telmisartan, or to the same metabolite(s) as dapagliflozin, empagliflozin or telmisartan.
  • dapagliflozin, empagliflozin or telmisartan may include all of its pharmaceutically acceptable salts, crystalline forms, hydrates, solvates, diastereomers or enantiomers.
  • composition of the present invention may additionally include vitamin D.
  • a preferred dosage unit form of vitamin D is a tablet or capsule containing, for example, about 0.5 mg to about 1,200 mg, preferably about 5 mg to about 600 mg, administered once or twice daily. desirable.
  • the non-alcoholic fatty liver disease may be simple steatosis or non-alcoholic steatohepatitis.
  • NAFLD 'non-alcoholic fatty liver disease
  • MASLD 'metabolic dysfunction-associated steatotic liver disease
  • MASH metabolic dysfunction-associated steatohepatitis
  • NAFLD non-alcoholic fatty liver disease
  • MASLD metabolic dysfunction-associated steatotic liver disease
  • NASH nonalcoholic steatohepatitis
  • the weight ratio of the angiotensin II receptor blocker and the sodium glucose transporter-2 inhibitor may be 2:1 to 8:1.
  • angiotensin II receptor blocker is included in less than 2 parts by weight or more than 8 parts by weight based on 1 part by weight of the sodium glucose transporter-2 inhibitor, the inhibitory effect on intracellular fat accumulation and weight loss effect is not sufficient, leading to non-alcoholic fatty liver disease. It may not achieve sufficient effectiveness for preventing or treating disease.
  • Another aspect of the present invention provides a method for preventing or treating non-alcoholic fatty liver disease, comprising administering the pharmaceutical composition to a subject.
  • the angiotensin II receptor blocker or a pharmaceutically acceptable salt thereof, and the SGLT-2 inhibitor or a pharmaceutically acceptable salt thereof contained in the pharmaceutical composition of the present invention are in amounts effective for the treatment or prevention of an individual or patient, and are effective for the treatment or prevention of the subject. Depending on the circumstances, it may be administered by oral administration.
  • the dosage for a specific subject or patient should be determined based on various related factors such as the patient's weight, age, race, gender, health status, diet, administration time, administration method, and severity of the disease, and should be determined by experts. It should be understood that it can be added or subtracted appropriately. For example, a physician may start the dosage of the pharmaceutical composition of the present invention at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. The dosage can be easily determined and prescribed as needed.
  • the method for preventing or treating metabolic diseases of the present invention may be administering therapeutically effective amounts of each pharmacological component of the composition simultaneously, sequentially, or in any order.
  • the corresponding active ingredient or a pharmaceutically acceptable salt thereof may be used in hydrate form or may contain other solvents used for crystallization.
  • 12.3 mg of dapagliflozin propanediol hydrate is equivalent to 10 mg when converted to the pharmacological ingredient dapagliflozin.
  • Another aspect of the present invention provides a kit comprising the composition.
  • the kit of the present invention includes, as the first pharmacological ingredient, Angiotensin II Receptor Blocker or a pharmaceutically acceptable salt thereof; And the second pharmacological ingredient may include a sodium-glucose cotransporter-2 (SGLT-2) inhibitor or a pharmaceutically acceptable salt thereof.
  • the kit form may be one in which separate pharmacological components are administered in the same dosage form or in different dosage forms (e.g., the first pharmacological component is parenteral and the second pharmacological component is oral), and when administered at multiple administration intervals. It can be particularly advantageous.
  • Example 1 Confirmation of excellent fat accumulation inhibition effect of dapagliflozin and telmisartan complex in non-alcoholic fatty liver-induced cells
  • HepG2 cells were treated with oleic acid (OA) to induce non-alcoholic fatty liver disease, and the effect of suppressing fat accumulation in cells induced with non-alcoholic fatty liver disease by treatment with experimental ingredients was evaluated.
  • OA oleic acid
  • HepG2 cells cultured in DMEM medium supplemented with 10% FBS and 1% penicillin/streptomycin at 37°C and 5% CO 2 were incubated in 1 ⁇ DMEM medium supplemented with 20% oleic acid in a 6-well plate. Fat accumulation was induced for 3 days by dispensing at a cell number of 10 5 cells/well. DMEM medium supplemented with oleic acid was replaced every day. While inducing fat accumulation in HepG2 cells, Dapagliflozin (DA) and/or angiotensin II receptor blocker as a sodium-glucose cotransporter-2 (SGLT-2) inhibitor are used as shown in Table 1.
  • DA Dapagliflozin
  • SGLT-2 sodium-glucose cotransporter-2
  • Telmisartan (Telm), an angiotensin II receptor blocker (ARB), was treated with each culture at different concentrations, and the degree of lipogenesis was observed after 3 days to evaluate the effect of inhibiting fat accumulation by concentration of single and complex components.
  • Telm Telmisartan
  • ARB an angiotensin II receptor blocker
  • Example 1-1 In order to evaluate the effect of inhibiting fat accumulation in non-alcoholic fatty liver-induced cells treated with the test ingredients in Example 1-1, the intracellular triglyceride content was measured using a modified Nile Red Assay/Staining method.
  • Example 1-1 the culture medium of cells treated with the experimental ingredients in Example 1-1 was discarded, washed twice with PBS, and then 10 ⁇ l of 4% formaldehyde was added to each well and fixed for 5 hours at room temperature. . Afterwards, formaldehyde was removed, washed twice with PBS, AdipoRed assay reagent and PBS were mixed at a ratio of 50:1, 100 ⁇ l was added to each well, and staining was performed for 10 minutes at room temperature. Fluorescence was measured at excitation 485 nm and emission 535 nm using a Multifunctional Micro-plate Reade.
  • Example 1-1 cells treated with the experimental ingredients in Example 1-1 were washed twice with PBS, and then total RNA was extracted using an RNA Mini Kit. cDNA was synthesized using 1 ⁇ g of the extracted RNA, and real-time PCR was performed using SYBR Green and the PPAR- ⁇ and PPAR- ⁇ primers in Table 2, and ⁇ -actin was used as a control gene.
  • PCR reagent composition 8 ⁇ l of cDNA was diluted 1/100 with distilled water, 0.5 ⁇ l of each 10pmole primer, 12.5 ⁇ l of ROX plus, and 4 ⁇ l of distilled water were used, adjusting the total volume to 25 ⁇ l. Quantitative fluorescence signals were measured using the MAX Pro program.
  • Example 1-1 For the non-alcoholic fatty liver disease-induced cells treated with the experimental ingredients in Example 1-1, the intracellular triglyceride content was measured by the method of Example 1-2.
  • the dapagliflozin and telmisartan combination ingredient group was found to have a relatively high rate of inhibition of fat accumulation.
  • the combination of dapagliflozin and telmisartan was confirmed to have the most effective inhibition rate in a concentration-dependent manner ( Figure 1).
  • the weight loss effect of dapagliflozin and telmisartan complex which was confirmed to be able to effectively inhibit fat accumulation in a non-alcoholic fatty liver cell model, was confirmed through repeated administration for 13 weeks in non-clinical trials.
  • the group composition was as shown in Table 3, and oral administration was repeated daily to 10 male and female 6-week-old Sprague-Dawley rats per group for 13 weeks. During the test, general symptoms were observed, blood tests, and body weight were measured. At the end of the observation period, the animals were euthanized and autopsied.
  • telmisartan For dapagliflozin, dapagliflozin propanediol hydrate was used, and for telmisartan, telmisartan powder (23.9%) was used according to the administered dose.
  • Weight loss can reduce liver fat and inflammation, and is one of the best treatments for nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) because it alleviates conditions that contribute to fatty liver disease. It has been reported that even losing 3 to 5% of body weight can reduce liver fat, and if it is more than 7%, inflammation is also reduced (Journal of the Korean Society of Internal Medicine: Vol. 79, No. 5, 2010; Dig Dis Sci 52:589-593, 2007; J Hepatol In:103-107, 1997)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 나트륨 포도당 운반체-2 저해제 및 안지오텐신 Ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물에 관한 것으로, 약물 간의 상호작용 문제가 없고, 비알코올성 지방간 질환의 예방 또는 치료에 상승효과를 나타내므로, 비알코올성 지방간 질환 환자에게 효과적으로 적용될 수 있다.

Description

나트륨 포도당 운반체-2 저해제 및 안지오텐신 Ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물
본 발명은 나트륨 포도당 운반체-2 저해제 및 안지오텐신 Ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물에 관한 것이다.
본　발명은　2023년도　교육부의　재원으로　"지자체-대학협력기반지역혁신사업(충북지역혁신플랫폼, 과제고유번호　1345370811,　과제번호　2021RIS-001)"　한국연구재단의　지원을　받아　이루어졌다.
비알코올성 지방간 질환은 영상 또는 조직학적으로 간세포 내에 지방 침착이 관찰되며 간세포 내 지방 축적의 원인으로 유의한 알코올 섭취, 지속적인 약물 복용 그리고 유전 질환을 포함한 다른 원인에 의한 간질환이 없는 경우에 진단되는 병으로 보고되고 있다. 그리고 이 질환은 단순 지방간, 비알코올성 지방간염 및 비알코올성 지방간 연관 간경변증을 포괄하는 것으로 알려져 있다.
비알코올성 지방간 질환은 매우 흔하게 접하게 되는 질환으로써, 비만 및 당뇨 등 각종 대사증후군의 발생 증가와 함께 유병률이 급격하게 증가하고 있고, 단순 비알코올성 지방간에 비해 비알코올성 지방간염이나 비알코올성 지방간염 연관 간 섬유화에 기인한 간경변증 발생률이 높은 것으로 알려져 있으며, 간경화로 인한 간부전 또는 간세포암의 발생률 뿐만 아니라 간 관련 사망률에 대한 위험도 증가하는 것으로 보고되었다.
비알코올성 지방간 질환은 나이에 따라 증가하는 양상을 보이며 성별에 따른 차이도 있는 것으로 보고되고 있고, 이는 나이 증가에 따른 인슐린 민감도의 감소와 호르몬 변화가 원인일 것으로 알려져 있다.
비알코올성 지방간 질환은 대사증후군, 과체중 및 비만, 제2형 당뇨병, 이상지질혈증 등과 밀접한 연관성을 보이는 것으로 알려져 있다. 비알코올성 지방간 질환 환자의 90%에서 대사증후군의 요소 중 한 가지 이상을 가지며 1/3에서 대사증후군을 가지는 것으로 보고되고 있다. 과체중 및 비만은 비알코올성 지방간 질환의 위험인자이지만 특히 중심성 비만이 강력한 위험인자로 알려져 있다.
이에, 본 발명자들은 비알코올성 지방간 질환 치료에 효과적으로 적용될 수 있는 조합 요법을 개발하기 위한 연구를 수행하여 본 발명을 완성하였다.
본 발명의 하나의 목적은 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker) 또는 이의 약학적으로 허용되는 염; 및 제2 약리 성분으로써 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제 또는 이의 약학적으로 허용되는 염을 포함하는 비알코올성 지방간 질환(non-alcoholic fatty liver disease) 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 약학적 조성물을 대상체에 투여하는 단계를 포함하는 비알코올성 지방간 질환을 예방 또는 치료하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 조성물을 포함하는 키트를 제공하는 것이다.
본 발명의 일 양상은 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker) 또는 이의 약학적으로 허용되는 염; 및 제2 약리 성분으로써 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제 또는 이의 약학적으로 허용되는 염을 포함하는 비알코올성 지방간 질환(non-alcoholic fatty liver disease) 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 구체예에 따르면, 상기 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제는 다파글리플로진(Dapagliflozin) 또는 엠파글리플로진(Empagliflozin)일 수 있다.
본 발명의 일 구체예에 따르면, 상기 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker)는 텔미사르탄(Telmisartan)일 수 있다.
본 발명의 일 구체예에 따르면, 상기 비알코올성 지방간 질환은 단순지방간(simple steatosis) 또는 비알코올성 지방간염(non-alcoholic steatohepatitis)일 수 있다.
본 발명의 일 구체예에 따르면, 상기 안지오텐신 Ⅱ 수용체 차단제 및 상기 나트륨 포도당 운반체-2 저해제의 중량비는 2:1 내지 8:1일 수 있다.
나트륨 포도당 운반체-2 저해제 및 안지오텐신 Ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물에 따르면, 약물 간의 상호작용 문제가 없고, 비알코올성 지방간 질환의 예방 또는 치료에 상승효과를 나타내므로, 비알코올성 지방간 질환 환자에게 효과적으로 적용될 수 있다.
도 1은 다파글리플로진(DA) 및/또는 텔미사르탄(Telm)의 처리 농도 별 지방축적 억제 효과를 나타낸 그래프이다.
도 2는 (A) 정상 HepG2 세포, (B) 올레산(OA)에 의해 비알코올성 지방간 상태로 유도된 HepG2 세포 및 (C) 올레산에 의해 비알코올성 지방간 상태로 유도 및 다파글리플로진 5μM 및 텔미사르탄 10μM이 처리된 HepG2 세포를 나타낸 형광현미경 사진이다.
도 3은 올레산(OA)에 의해 비알코올성 지방간 상태로 유도된 HepG2 세포에서, 다파글리플로진(DA) 및 텔미사르탄(Telm)의 처리 농도 별(5μM+5μM, 5μM+10μM, 10μM+20μM) β-actin 대비 PPAR-α의 mRNA 발현 증가율(fold change)을 나타낸 그래프이다.
도 4는 올레산(OA)에 의해 비알코올성 지방간 상태로 유도된 HepG2 세포에서, 다파글리플로진(DA) 및 텔미사르탄(Telm)의 처리 농도 별(5μM+5μM, 5μM+10μM, 10μM+20μM) β-actin 대비 PPAR-γ의 mRNA 발현 증가율(fold change)을 나타낸 그래프이다.
도 5는 다파글리플로진 및/또는 텔미사르탄의 비임상 13주 반복투여 수컷 랫트에서 체중감소 효과를 나타낸 그림이다.
도 6은 다파글리플로진 및/또는 텔미사르탄의 비임상 13주 반복투여 암컷 랫트에서 체중감소 효과를 나타낸 그림이다.
본 발명의 일 양상은 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker) 또는 이의 약학적으로 허용되는 염; 및 제2 약리 성분으로써 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제 또는 이의 약학적으로 허용되는 염을 포함하는 비알코올성 지방간 질환(non-alcoholic fatty liver disease) 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 약학적 조성물에 포함되는 SGLT-2 저해제는 다파글리플로진(Dapagliflozin), 엠파글리플로진(Empagliflozin), 이프라글리플로진(Ipragliflozin), 카나글리플로진(Canagliflozin), 루세오글리플로진(Luseogliflozin) 및 토포글리플로진(Tofogliflozin)으로 이루어진 군으로부터 선택되는 어느 하나의 물질일 수 있으나, 다파글리플로진 또는 엠파글리플로진인 것이 배합 적합성 및 상승효과 측면에서 바람직하며, 다파글리플로진인 것이 가장 바람직하다.
본 발명의 일 구체예에 따른 약학적 조성물의 투여량은 예를 들어, 성인 기준으로 약 0.001㎎/kg 내지 약 100㎎/kg, 약 0.01㎎/kg 내지 약 10㎎/kg, 또는 약 0.1㎎/kg 내지 약 1㎎/kg의 범위 내 일 수 있고, 1일 1회, 1일 다회, 또는 1주일에 1회, 2주일에 1회, 3주일에 1회, 또는 4주일에 1회 내지 1년에 1회 투여될 수 있으며, 의사 또는 약사의 판단에 따라 일정시간 간격으로 1일 1회 내지 수회로 분할 투여될 수 있다.
본 발명의 약학적 조성물은 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제, 제2 약리 성분으로써 SGLT-2 억제제와 혼합되어 제조될 수 있고, 이들의 혼합은 동시 또는 순차로 수행될 수 있으며, 당업계에 알려진 방법을 이용하여 수행될 수 있다.
본 발명의 약학적 조성물은 예를 들어, 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제 및 제2 약리 성분으로써 SGLT-2 억제제를 포함하는 이중정일 수 있고, 또는 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제 및 제2 약리 성분으로써 SGLT-2 억제제를 포함하며 내핵층을 둘러싸는 외부층을 포함하는 내핵정 구조일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 조성물은 약학적으로 허용되는 담체를 포함할 수 있다. 본 발명의 조성물에 포함되는 약학적으로 허용되는 담체는 약제의 제조에 통상적으로 이용되는 것으로써, 락토오스, 덱스트로스, 수크로오스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산칼슘, 알기네이트, 젤라틴, 규산칼슘, 미세결정성 셀룰로오스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸 셀룰로오스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제는 Remington: the science and practice of pharmacy 22nd edition (2013)에 상세히 기재되어 있다.
본 발명의 일 구체예에 따른 약학적 조성물은 하나 이상의 비알코올성 지방간 질환에 약리 활성을 나타내는 물질과 함께 투여될 수 있다.
또한, 본 발명의 일 구체예에 따른 약학적 조성물은 비알코올성 지방간 질환의 예방 또는 치료를 위하여 단독으로, 또는 수술, 호르몬 치료, 약물치료 및/또는 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용될 수 있다.
본 발명의 조성물은 그 제형의 제제화에 필요하고 적절한 각종 기제 및/또는 첨가물을 포함할 수 있으며, 그 효과를 떨어트리지 않는 범위 내에서 비이온 계면활성제, 실리콘 폴리머, 체질안료, 향료, 방부제, 살균제, 산화 안정화제, 유기 용매, 이온성 또는 비이온성 증점제, 유연화제, 산화방지제, 자유 라디칼 파괴제, 불투명화제, 안정화제, 에몰리언트(emollient), 실리콘, α-히드록시산, 소포제, 보습제, 비타민, 곤충 기피제, 향료, 보존제, 계면활성제, 소염제, 물질 P 길항제, 충전제, 중합체, 추진제, 염기성화 또는 산성화제, 또는 착색제 등 공지의 화합물을 더 포함하여 제조될 수 있다.
본 발명의 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 조성물의 투여량은 성인 기준으로 0.001 내지 1000㎎/㎏일 수 있다.
본 발명의 조성물은 경구 투여될 수 있다.
본 발명의 조성물은 경구 투여 시 다양한 제형으로 투여될 수 있는데, 정제, 환제, 경/연질 캅셀제, 액제, 현탁제, 유화제, 시럽제, 과립제, 엘릭시르제, 트로키제 등의 형태로 투여될 수 있으며, 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등을 더 포함할 수 있다. 구체적으로, 본 발명의 조성물을 경구투여 제형으로 제형화할 경우, 이의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 담체, 부형제 및 희석제로는 예를 들어, 락토오스, 덱스트로스, 수크로오스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알기네이트, 젤라틴, 인산칼슘, 규산칼슘, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및/또는 광물유가 사용될 수 있으나 이에 한정되지 않는다. 또한, 제제화에 일반적으로 사용되는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 포함하여 조제될 수 있으며, 상기 부형제 이외에 마그네슘 스테아레이트 또는 탈크 같은 윤활제를 더 포함할 수 있다.
본 발명의 조성물은 약 0.1％ 내지 90％, 바람직하게는 약 1％ 내지 약 80％의 약리 성분으로 구성될 수 있다. 장내 또는 비경구 투여용의 약학적 제제는 공지된 방법, 예를 들어 종래의 혼합, 과립화, 코팅, 가용화 또는 동결 건조 방법에 의해 제조될 수 있다. 경구 사용을 위한 약학적 제제는 활성 성분을 고체 부형제와 혼합하고, 바람직하게는 수득 된 혼합물을 과립화하고, 필요하거나 필수적이라면 적절한 보조제 물질을 첨가한 후에 혼합물 또는 과립을 정제 또는 코팅 정제 중심으로 가공해서 얻을 수 있다.
본 발명의 일 구체예에 따르면, 상기 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제는 다파글리플로진(Dapagliflozin) 또는 엠파글리플로진(Empagliflozin)일 수 있다.
본 명세서에서 사용되는 용어, "다파글리플로진(Dapagliflozin)"은 (1S)-1,5-언하이드로-1-C-{4-클로로-3-[(4-에톡시페닐)메틸]페닐}-D-글루시톨((1S)-1,5-anhydro-1-C-{4-chloro-3-[(4-ethoxyphenyl)methyl]phenyl}-D-glucitol)을 말하고, "엠파글리플로진(Empagliflozin)"은 (1S)-1,5-언하이드로-1-C-[4-클로로-3-[[4-[[(3S)-테트라하이드로-3-퓨란일]옥시]페닐]메틸]페닐]-D-글루시톨((1S)-1,5-Anhydro-1-C-[4-chloro-3-[[4-[[(3S)-tetrahydro-3-furanyl]oxy]phenyl]methyl]phenyl]-D-glucitol)을 말한다
SGLT-2 억제제의 바람직한 투여량 단위 형태는, 예를 들어 매일 1회 투여되는 약 5mg 내지 약 800mg, 바람직하게는 약 50mg 내지 약 700mg, 더욱 바람직하게는 약 100mg 내지 약 600mg, 가장 바람직하게는 약 100mg 내지 약 300mg을 포함하는 정제 또는 캡슐일 수 있다.
본 발명의 일 구체예에 따르면, 상기 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker)는 텔미사르탄(Telmisartan)일 수 있다.
본 명세서에서 사용되는 용어, "텔미사르탄(Telmisartan)"은 4′-[(1,4′-다이메틸-2′-프로필[2,6′-bi-1H-벤즈이미다졸]-1′-일)메틸][1,1′-바이페닐]-2-카르복실산(4′-[(1,4′-Dimethyl-2′-propyl[2,6′-bi-1H-benzimidazol]-1′-yl)methyl][1,1′-biphenyl]-2-carboxylic acid)을 말한다.
텔미사탄은 치료학적 유효량, 예를 들어, 환자에게 적용될 수 있는 약 20 내지 약 320mg의 텔미사탄을 포함하는 적절한 투여 단위 형태, 예를 들어 캡슐 또는 정제의 형태로 공급될 수 있다. 유효 성분의 적용은, 예를 들어 20mg 또는 40mg의 텔미사탄의 1일 투여량으로 출발해서, 80mg의 1일 투여량을 거쳐서 160mg 내지 320mg까지의 1일 투여량으로 상승시키면서, 매일 3회까지 투여될 수 있다. 예를 들어, 아침, 한낮 또는 저녁에 투여될 수 있다. 비알코올성 지방간 질환의 경우에는 하루 1회 또는 하루 2회의 투여가 바람직하다.
상기 다파글리플로진, 엠파글리플로진 또는 텔미사르탄은 그의 활성 대사물질 및 전구약물을 모두 포함하여 지칭할 수 있다. 상기 "대사물질"은 다파글리플로진, 엠파글리플로진 또는 텔미사르탄이 대사되는 경우에 생성될 수 있는 각 활성 유도체이고, 상기 "전구약물"은 다파글리플로진, 엠파글리플로진 또는 텔미사르탄으로 대사되거나, 또는 다파글리플로진, 엠파글리플로진 또는 텔미사르탄과 동일한 대사 물질(들)로 대사되는 화합물을 말한다. 또한, 다파글리플로진, 엠파글리플로진 또는 텔미사르탄은 그의 제약상 허용되는 염, 그의 결정형, 수화물, 용매화물, 부분입체 이성질체 또는 거울상이성질체를 모두 포함할 수 있다.
본 발명의 조성물은 추가적으로 비타민 D를 더 포함할 수 있다. 비타민 D의 바람직한 투여량 단위 형태는, 예를 들어 약 0.5mg 내지 약 1,200mg, 바람직하게는 약 5mg 내지 약 600mg을 포함하는 정제 또는 캡슐로써, 1일 투여량이 매일 1회 또는 2회 투여되는 것이 바람직하다.
본 발명의 일 구체예에 따르면, 상기 비알코올성 지방간 질환은 단순지방간(simple steatosis) 또는 비알코올성 지방간염(non-alcoholic steatohepatitis)일 수 있다.
최근, 미국과 유럽 등 전 세계 주요 간 학회에서, '비알코올성 지방간 질환(non-alcoholic fatty liver disease, NAFLD)은 '대사이상 연관 지방간질환(metabolic dysfunction-associated steatotic liver disease, MASLD)'으로, '비알코올성 지방간염(nonalcoholic steatohepatitis, NASH)'은 '대사이상 연관 지방간염(metabolic dysfunction-associated steatohepatitis, MASH)'으로 명칭이 변경되었다.
이에, 본 발명에서 사용되는 용어, '비알코올성 지방간 질환(non-alcoholic fatty liver disease, NAFLD)'은 '대사이상 연관 지방간질환(metabolic dysfunction-associated steatotic liver disease, MASLD)'과 서로 동일한 의미로 사용된다.
또한, 본 발명에서 사용되는 용어, '비알코올성 지방간염(nonalcoholic steatohepatitis, NASH)'은 '대사이상 관련 지방간염(metabolic dysfunction-associated steatohepatitis, MASH)'과 서로 동일한 의미로 사용된다.
본 발명의 일 구체예에 따르면, 상기 안지오텐신 Ⅱ 수용체 차단제 및 상기 나트륨 포도당 운반체-2 저해제의 중량비는 2:1 내지 8:1일 수 있다.
나트륨 포도당 운반체-2 저해제 1중량부를 기준으로 안지오텐신 Ⅱ 수용체 차단제가 2중량부 미만으로 포함되거나, 8중량부 초과로 포함될 경우, 세포 내 지방축적 억제 효과 및 체중감소 효과가 충분하지 않아, 비알코올성 지방간 질환의 예방 또 치료를 위한 충분한 효과를 달성하지 못할 수 있다.
본 발명의 다른 양상은 상기 약학적 조성물을 대상체에 투여하는 단계를 포함하는 비알코올성 지방간 질환을 예방 또는 치료하는 방법을 제공한다.
본 발명의 약학적 조성물에 포함되는 안지오텐신 Ⅱ 수용체 차단제 또는 이의 약학적으로 허용되는 염, 및 SGLT-2 저해제 또는 이의 약학적으로 허용되는 염은 개체 또는 환자의 치료 또는 예방에 유효한 양으로써, 목적하는 바에 따라 경구투여 방법으로 투여될 수 있다. 상기 투여는 특정 개체 또는 환자에 대한 투여 용량은 환자의 체중, 연령, 인종, 성별, 건강 상태, 식이, 투여 시간, 투여 방법, 질환의 중증도 등의 여러 관련 인자에 근거하여 결정되어야 하는 것이고 전문가에 의해 적절히 가감될 수 있는 것으로 이해되어야 한다. 예를 들어, 의사는 본 발명의 약학적 조성물의 용량을 목적하는 치료효과를 달성하는데 요구되는 것보다 낮은 수준에서 출발하여, 목적하는 효과가 달성될 때까지 투여량을 점진적으로 증가시킬 수 있으며, 필요에 따라 투여량을 용이하게 결정 및 처방할 수 있다.
본 발명의 대사성 질환을 예방 또는 치료하는 방법은 상기 조성물의 각 약리 성분의 치료학적 유효량을 동시에 또는 차례로 또는 임의의 순서로 투여하는 것일 수 있다.
상응하는 유효 성분 또는 악학적으로 허용 가능한 그의 염을 수화물 형태로 사용할 수 있고 또는 결정화를 위해 사용되는 기타 용매를 포함할 수 있다. 예를 들어, 다파글리플로진 프로판디올 수화물 12.3mg을 약리 성분인 다파글리플로진으로 환산할 경우 10mg에 해당한다.
본 발명의 또 다른 양상은 상기 조성물을 포함하는 키트를 제공한다.
본 발명의 키트는 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker) 또는 이의 약학적으로 허용되는 염; 및 제2 약리 성분으로써 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제 또는 이의 약학적으로 허용되는 염을 포함할 수 있다. 상기 키트 형태는 별개의 약리 성분이 동일한 투여 형태 또는 다른 투여 형태(예를 들어, 제1 약리 성분은 비경구 및 제2 약리 성분은 경구)로 투여되는 것일 수 있으며, 여러 투여 간격으로 투여되는 경우에 특히 유리할 수 있다.
이하 본 발명을 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 비알코올성 지방간 유도 세포에서 다파글리플로진 및 텔미사르탄 복합 성분의 우수한 지방축적 억제효과 확인
1-1. 비알코올성 지방간 유도 및 실험 성분 처리
HepG2 세포에 올레산(Oleic acid, OA)을 처리하여 비알코올성 지방간 상태로 유도하고, 실험 성분을 처리하여 비알코올성 지방간이 유도된 세포에서 지방축적 억제 효과를 평가하였다.
구체적으로, 10% FBS, 1% penicillin/streptomycin이 첨가된 DMEM 배지에서 37℃ 및 5% CO2의 조건으로 배양된 HepG2 세포를 6-well plate에서 20%의 올레산이 첨가된 DMEM 배지에 1×105 cell/well의 세포수로 분주하여 3일 동안 지방 축적을 유도하였다. 올레산이 첨가된 DMEM 배지는 1일 간격으로 교체하였다. HepG2 세포에 지방축적을 유도하는 동안 표 1과 같이 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제로서 다파글리플로진(Dapagliflozin, DA) 및/또는 안지오텐신 Ⅱ 수용체 차단제(angiotensin Ⅱ receptor blocker, ARB)로서 텔미사르탄(Telmisartan, Telm)을 농도 별로 각 배양액에 처리하였으며, 3일 후 지방생성 정도를 관찰하여 단일 성분 및 복합 성분의 농도 별 지방축적 억제 효과를 평가하였다. 표 1에서 A군은 비알코올성 지방간이 유도되지 않은 정상 세포를 사용하였으며, B 내지 I군은 올레산으로 비알코올성 지방간이 유도된 세포를 사용하였다.
구분 실험 성분
SGLT-2 저해제 ARB
A - -
B 다파글리플로진 5μM -
C - 텔미사르탄 5μM
D 다파글리플로진 10μM -
E - 텔미사르탄 10μM
F 다파글리플로진 5μM 텔미사르탄 5μM
G 다파글리플로진 5μM 텔미사르탄 10μM
H - 텔미사르탄 20μM
I 다파글리플로진 10μM 텔미사르탄 20μM
1-2. Nile Red Assay/Staining 방법에 따른 세포 내 중성지방 함량 측정
실시예 1-1에서 실험 성분이 처리된 비알코올성 지방간 유도 세포에서 지방축적 억제 효과를 평가하기 위하여, 수정된 Nile Red Assay/Staining 방법을 통하여 세포 내 중성지방 함량을 측정하였다.
구체적으로, 실시예 1-1에서 실험 성분이 처리된 세포의 배양액은 버리고, PBS로 2회 세척한 다음, 4% 포름알데하이드(formaldehyde)를 10㎕씩 각 well에 넣어 실온에서 5시간 동안 고정하였다. 그 후, 포름알데하이드를 제거하고 PBS로 2회 세척한 뒤 50:1의 비율로 AdipoRed assay reagent와 PBS를 혼합하여 각각의 well에 100㎕ 넣고 상온에서 10분간 염색하였다. 형광 측정은 Multifunctional Micro-plate Reade를 이용하여 excitation 485㎚, emission 535㎚에서 측정하였다.
1-3. PPAR-α 및 PPAR-γ의 mRNA 발현량 측정
실시예 1-1에서 실험 성분이 처리된 비알코올성 지방간 유도 세포에서 비알코올성 지방간 개선 효능의 분자생물학적 기전을 알아보기 위하여, 세포 내 지방산 합성 및 산화에 관련된 유전자에 대한 mRNA 발현의 상대적 수준을 RT-PCR 방법으로 측정하였다.
구체적으로, 실시예 1-1에서 실험 성분이 처리된 세포를 PBS로 두 번 세척한 후, RNA Mini Kit를 이용하여 total RNA를 추출하였다. 추출된 RNA 1㎍을 사용하여 cDNA를 합성하고, SYBR Green과 표 2의 PPAR-α 및 PPAR-γ 프라이머를 사용하여 Real-time PCR을 진행하였으며, 대조군 유전자로는 β-actin을 사용하였다.
프라이머명　 핵산서열(5'→3') 서열번호
PPAR-alpha forward TCCTGAGCCATGCAGAATTTAC 서열번호 1
reverse AGTCTAAGGCCTCGCTGGTG 서열번호 2
PPAR-gamma forward ATTCCATTCACAAGAACAGATCCAG 서열번호 3
reverse TTTATCTCCACAGACACGACATTCA 서열번호 4
beta-actin forward CCTGGCACCCAGCACAAT 서열번호 5
reverse GCCGATCCACACACGGAGTACT 서열번호 6
PCR 시약 조성은 cDNA를 증류수로 1/100으로 희석하여 8㎕를 사용하였고, 10pmole 프라이머를 각각 0.5㎕, ROX plus 12.5㎕, 증류수 4㎕로 사용하여 총 부피를 25㎕로 조정하여 사용하였다. 형광신호 정량은 MAX Pro program을 사용하여 측정하였다.
1-4. 다파글리플로진 및 텔미사르탄 복합 성분의 지방축적 억제 효과 확인
실시예 1-1에서 실험 성분이 처리된 비알코올성 지방간 유도 세포에 대하여, 실시예 1-2의 방법으로 세포 내 중성지방 함량을 측정하였다.
다파글리플로진 또는 텔미사르탄 단일 성분을 처리한 군과 복합 성분을 처리한 군을 비교한 결과, 다파글리플로진 및 텔미사르탄 복합 성분 군이 상대적으로 지방축적 억제율이 높은 것으로 나타났으며, 특히, 다파글리플로진 및 텔미사르탄 복합 성분이 농도의존적으로 가장 효과적인 억제율을 나타내는 것으로 확인되었다(도 1).
한편, 단일 성분을 처리한 군 대비 특히 상승효과가 현저한 것으로 나타난 다파글리플로진 5μM 및 텔미사르탄 10μM을 처리한 G군에 대하여 형광현미경을 사용하여 지방의 축적을 관찰한 결과, 지방의 축적이 효과적으로 억제된 것으로 확인되었다(도 2).
이와 같은 결과를 통하여, 올레산에 의해 축적된 지방을 가진 HepG2 세포에서 다파글리플로진 및 텔미사르탄 복합 성분이 우수한 지방축적 억제 효과를 나타내는 것으로 확인되었다.
1-5. 다파글리플로진 및 텔미사르탄 복합 성분의 PPAR-α 및 PPAR-γ mRNA 발현 조절에 따른 지방축적 억제 기전 확인
실시예 1-1에서 실험 성분이 처리된 비알코올성 지방간 유도 세포에 대하여, 실시예 1-3의 방법으로 세포 내 지방산 합성 및 산화에 관련된 유전자인 PPAR-α 및 PPAR-γ에 대한 mRNA 발현의 상대적 수준을 RT-PCR 방법으로 측정하였다.
그 결과, 올레산이 20% 처리된 HepG2 세포에서 PPAR-α의 mRNA는 올레산이 처리되지 않은 A 군에 비해 발현이 감소되었으며, 다파글리플로진 및 텔미사르탄 복합 성분이 처리된 F(5μM 및 5μM), G(5μM 및 10μM) 및 I(10μM 및 20μM) 군에서 모두 유의적으로 증가하는 것으로 확인되었다(도 3).
또한, 올레산이 20% 처리된 HepG2 세포에서 PPAR-γ의 mRNA는 올레산이 처리되지 않은 A 군에 비해 발현이 증가하였으며, 다파글리플로진 및 텔미사르탄 복합 성분이 처리된 F(5μM 및 5μM), G(5μM 및 10μM) 및 I(10μM 및 20μM) 군에서 모두 농도의존적으로 감소하는 것으로 확인되었다(도 4).
이와 같은 결과를 통하여, 올레산에 의해 축적된 지방을 가진 HepG2 세포에서 다파글리플로진 및 텔미사르탄 복합 성분은 PPAR-α의 발현을 증가시켜 지방의 산화를 촉진하고, PPAR-γ의 발현은 오히려 감소시켜 지방의 축적을 효과적으로 억제함으로써, 지방의 축적을 효과적으로 억제하는 것으로 확인되었다.
실시예 2. 비임상 13주 반복 투여에 따른 다파글리플로진 및 텔미사르탄 복합 성분의 우수한 체중감소 효과 확인
2-1. 비임상 13주 반복 투여 방법
비알코올성 지방간 세포 모델에서 효과적으로 지방축적을 억제할 수 있는 것으로 확인된 다파글리플로진 및 텔미사르탄 복합 성분에 대하여, 비임상 13주 반복투여를 통하여 체중감소 효과를 확인하였다.
구체적으로, 군 구성은 표 3과 같이 구성하였고, 군당 암수 각 10마리의 6주령 Sprague-Dawley 랫트에 13주간 매일 반복 경구투여하였으며, 시험이 진행되는 동안 일반증상 관찰, 혈액검사 및 체중 측정을 실시하였고, 관찰기간 종료 후 안락사하여 부검하였다.
군 투여용량
(mg/kg/day)		 투여액량
(mL/kg)
다파글리플로진 텔미사르탄
G1 대조군 0 0 10
G2 복합 저용량군 1 8 10
G3 복합 중용량군 3 24 10
G4 복합 고용량군 9 72 10
G5 다파글리플로진 단독투여군 9 0 10
G6 텔미사르탄 단독투여군 0 72 10
다파글리플로진은 다파글리플로진 프로판디올 수화물을 사용하였고, 텔미사르탄은 텔미사르탄 파우더(23.9%)를 사용하여 각각 투여용량에 맞추어 사용하였다.
2-2. 다파글리플로진 및 텔미사르탄 복합 성분의 체중감소 효과 확인
체중 감소는 간의 지방과 염증을 감소시킬 수 있으며, 체중 감소는 지방간 질환에 기여하는 상태를 완화하기 때문에 비알코올성 지방간(NAFLD) 및 비알코올성 지방간염(NASH)에 대한 최상의 치료법 중 하나이다. 체중의 3 내지 5% 감량하더라도 간의 지방을 줄일 수 있으며, 7% 이상일 경우 염증도 감소한다고 보고되고 있다(대한내과학회지: 제79권 제5호 2010; Dig Dis Sci 52:589-593, 2007; J Hepatol In:103-107, 1997)
13주간 다파글리플로진 및/또는 텔미사르탄 단독/복합 성분을 반복 경구 투여결과, 다파글리플로진 및 텔미사르탄 복합 성분 저, 중 및 고용량군에서 체중감소 효과가 확인되었다. 반면, 텔미사르탄 단독투여군의 경우, 암컷에서는 체중감소 효과가 확인되지 않았고, 다파글리플로진 단독투여군에서는 암컷 및 수컷 모두에서 체중감소 효과가 확인되지 않았다(도 5 및 도 6).
이와 같은 결과를 통하여, 체중감소에 있어서 다파글리플로진 및 텔미사르탄 복합 성분의 상승효과가 확인되었으며, 이와 같은 효과에 의하여 비알코올성 지방간 질환의 치료 효과가 달성될 수 있음이 확인되었다.
이제까지 본 발명에 대하여 그 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (6)

  1. 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker) 또는 이의 약학적으로 허용되는 염; 및
    제2 약리 성분으로써 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제 또는 이의 약학적으로 허용되는 염
    을 포함하는 비알코올성 지방간 질환(non-alcoholic fatty liver disease) 예방 또는 치료용 약학적 조성물.
  2. 제 1 항에 있어서, 상기 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제는 다파글리플로진(Dapagliflozin) 또는 엠파글리플로진(Empagliflozin)인 것인 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물.
  3. 제 1 항에 있어서, 상기 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker)는 텔미사르탄(Telmisartan)인 것인 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물.
  4. 제 1 항에 있어서, 상기 비알코올성 지방간 질환은 단순지방간(simple steatosis) 또는 비알코올성 지방간염(non-alcoholic steatohepatitis)인 것인 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물.
  5. 제 1 항에 있어서, 상기 안지오텐신 Ⅱ 수용체 차단제 및 상기 나트륨 포도당 운반체-2 저해제의 중량비는 2:1 내지 8:1인 것인 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물.
  6. 제1 약리 성분으로써 안지오텐신 Ⅱ 수용체 차단제(Angiotensin Ⅱ Receptor Blocker) 또는 이의 약학적으로 허용되는 염; 및
    제2 약리 성분으로써 나트륨 포도당 운반체-2(sodium-glucose cotransporter-2, SGLT-2) 저해제 또는 이의 약학적으로 허용되는 염
    을 포함하는 약학적 조성물을 대상체에 투여하는 단계를 포함하는 비알코올성 지방간 질환을 예방 또는 치료하는 방법.
PCT/KR2023/095114 2022-12-20 2023-12-15 나트륨 포도당 운반체-2 저해제 및 안지오텐신 ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물 WO2024136627A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0179807 2022-12-20
KR20220179807 2022-12-20

Publications (1)

Publication Number Publication Date
WO2024136627A1 true WO2024136627A1 (ko) 2024-06-27

Family

ID=91589539

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/095114 WO2024136627A1 (ko) 2022-12-20 2023-12-15 나트륨 포도당 운반체-2 저해제 및 안지오텐신 ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR20240099045A (ko)
WO (1) WO2024136627A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150138859A (ko) * 2013-04-05 2015-12-10 베링거 인겔하임 인터내셔날 게엠베하 엠파글리플로진의 치료적 용도
KR20180124123A (ko) * 2016-03-28 2018-11-20 인터셉트 파마슈티컬즈, 인크. Fxr 효능제 및 arb의 조합에 의해 얻어지는 의약
KR20200096791A (ko) * 2017-12-06 2020-08-13 바스프 에이에스 비알콜성 지방간염 치료용 지방산 유도체
KR20220097854A (ko) * 2020-07-27 2022-07-08 아스트라제네카 아베 다파글리플로진을 이용하여 만성 신장 질환을 치료하는 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150138859A (ko) * 2013-04-05 2015-12-10 베링거 인겔하임 인터내셔날 게엠베하 엠파글리플로진의 치료적 용도
KR20180124123A (ko) * 2016-03-28 2018-11-20 인터셉트 파마슈티컬즈, 인크. Fxr 효능제 및 arb의 조합에 의해 얻어지는 의약
KR20200096791A (ko) * 2017-12-06 2020-08-13 바스프 에이에스 비알콜성 지방간염 치료용 지방산 유도체
KR20220097854A (ko) * 2020-07-27 2022-07-08 아스트라제네카 아베 다파글리플로진을 이용하여 만성 신장 질환을 치료하는 방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MAKRI EVANGELIA S., MAKRI ELEFTHERIA, POLYZOS STERGIOS A.: "Combination Therapies for Nonalcoholic Fatty Liver Disease", JOURNAL OF PERSONALIZED MEDICINE, MOLECULAR DIVERSITY PRESERVATION INTERNATIONAL, vol. 12, no. 7, 18 July 2022 (2022-07-18), pages 1166, XP093182999, ISSN: 2075-4426, DOI: 10.3390/jpm12071166 *

Also Published As

Publication number Publication date
KR20240099045A (ko) 2024-06-28

Similar Documents

Publication Publication Date Title
EP1663185B1 (en) Prevention and treatment of inflammation-induced and/or immune-mediated bone loss
WO2011118976A2 (en) Pharmaceutical composition for the prevention or the treatment of non-alcoholic fatty liver disease and the method for prevention or treatment of non-alcoholic fatty liver disease using the same
WO2022131428A1 (ko) 오를리스타트 및 아커만시아 뮤시니필라 eb-amdk19 균주를 포함하는 조성물
WO2015026114A1 (ko) 모노아세틸디아실글리세롤 화합물을 유효성분으로 함유하는 류마티스 관절염의 예방 또는 치료용 조성물
WO2018117659A1 (ko) 청대 추출물 또는 이의 분획물을 유효성분으로 포함하는 염증성 장질환의 예방 또는 치료용 약학적 조성물
JP5020227B2 (ja) 癌療法性粘膜炎の治療および予防のためのベンズアミジン誘導体
NO309454B1 (no) Anvendelse av et derivat av spirooksatiolankinuklidin for fremstilling av et farmasöytisk preparat for behandling av xerostomi som ikke er forårsaket av Sjögrens syndrom
WO2020159171A2 (ko) 스트렙토니그린 및 항암제를 포함하는 대장암 예방 또는 치료용 약학적 조성물
CN111437393B (zh) 用于糖尿病及其并发症治疗的联合用药及其药物组合物
US20210186986A1 (en) Uses of celastrol in preventing and/or treating cholestatic liver disease and liver fibrosis
WO2009119987A2 (ko) 피라졸 유도체를 포함하는 골다공증 예방 및 치료용 조성물
WO2018155921A1 (ko) 고시폴 및 펜포르민을 유효성분으로 포함하는 췌장암 예방 및 치료용 약학적 조성물
WO2024136627A1 (ko) 나트륨 포도당 운반체-2 저해제 및 안지오텐신 ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물
WO2011008052A2 (ko) 콜포신 다로페이트를 포함하는 골 질환의 예방 또는 치료용 조성물
WO2020096328A1 (ko) 시클로-히스프로를 유효성분으로 포함하는 비만 예방 또는 치료용 약제학적 조성물
WO2020184884A1 (ko) 비만 또는 지질 관련 대사성 질환의 예방 또는 치료용 조성물
CN115192573B (zh) 盐酸去亚甲基小檗碱在制备治疗肺纤维化药物中的应用
TW202404616A (zh) 鼠李糖在製備用於治療或預防神經退行性疾病的藥物中的用途、藥物組合物及其應用
WO2022245089A1 (ko) 타우로데옥시콜린산 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 코로나바이러스감염증-19(covid-19) 치료용 조성물
WO2022245171A1 (ko) 이나보글리플로진을 포함하는 개과 동물의 당뇨병 예방 또는 치료용 약학 조성물
JP2006515361A (ja) ヘルペスウイルス感染の症候を治療又は予防する方法
KR0133555B1 (ko) 5-플루오로우라실계 화합물에 기인한 염증의 발생을 억제할 수 있는 비-주사제 형태의 항암조성물
CN1731991A (zh) 丁二酸衍生物酯类化合物治疗痴呆症的用途
WO2022139489A1 (ko) 알코올성 및 비알코올성 지방간의 예방 또는 치료용 약학 조성물
WO2021085849A1 (ko) 이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23907910

Country of ref document: EP

Kind code of ref document: A1