WO2021085849A1 - 이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물 - Google Patents

이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2021085849A1
WO2021085849A1 PCT/KR2020/012383 KR2020012383W WO2021085849A1 WO 2021085849 A1 WO2021085849 A1 WO 2021085849A1 KR 2020012383 W KR2020012383 W KR 2020012383W WO 2021085849 A1 WO2021085849 A1 WO 2021085849A1
Authority
WO
WIPO (PCT)
Prior art keywords
bone
pharmaceutical composition
formula
compound represented
derivative
Prior art date
Application number
PCT/KR2020/012383
Other languages
English (en)
French (fr)
Inventor
황기철
임소연
이지윤
최정원
이세형
김상우
Original Assignee
가톨릭관동대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭관동대학교산학협력단 filed Critical 가톨릭관동대학교산학협력단
Publication of WO2021085849A1 publication Critical patent/WO2021085849A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/306—Foods, ingredients or supplements having a functional effect on health having an effect on bone mass, e.g. osteoporosis prevention
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/30—Other Organic compounds

Definitions

  • the present invention relates to isoriquiitigenin derivatives and their use in the prevention or treatment of bone diseases.
  • the normal bone remodeling process consists of a balance between bone formation and bone resorption, and bone formation and bone resorption are largely achieved by the interaction of three cells, chondrocytes, osteoblasts, and osteoclasts. .
  • osteoclasts are cells derived from hematopoietic stem cells and are responsible for the absorption of aged bone
  • osteoblasts are cells derived from bone marrow stromal cells in the bone marrow and play a major role in bone formation. Bone formation is maintained by continuously controlling the balance between bone resorption by osteoclast and bone formation by osteoblast.
  • excessive activity of osteoclasts or decrease in activity of osteoblasts causes imbalance in the remodeling process of bone formation, and may cause bone disease by breaking the balance between osteoclasts and osteoblasts in vivo.
  • Osteoporosis a representative example of bone disease
  • Osteoporosis is a disease in which the balance between bone formation and bone resorption is broken, resulting in a decrease in bone mass and a continuous increase in the risk of fracture due to deterioration of the microstructure of bone tissue. This is a reduced state, and occurs when the balance of bone remodeling is broken and the osteoclast action is increased than the osteoblast action.
  • the gap between the bone microstructures becomes wider and the microstructures become thinner, increasing the risk of bone fractures easily even with a small impact, and osteoporosis after menopause, which occurs gradually in men and women over 70 years of age.
  • Substances currently used as treatments for osteoporosis include estrogen, androgenic anagolic ateroid, calcium preparations, phosphates, fluoride preparations, ipriflavone, and vitamin D3.
  • Estrogen inhibits apoptosis of osteoblasts, increases the survival time of cells, and reduces the survival time of cells by promoting apoptosis of osteoclasts, which is somewhat effective in treating menopausal symptoms and maintaining bone density, but breast cancer, endometrial hyperplasia. There are side effects that cause the back.
  • drugs that inhibit the activity of osteoclasts to inhibit bone destruction or increase the activity of bone regeneration units through proliferation of osteoblasts include calcitonin, paragap acid hormone, and bisphosphonate preparations.
  • existing osteoporosis treatments cause many side effects when administered for a long time. Therefore, in addition to the existing treatments, there is a need to develop novel osteoporosis treatments.
  • the present inventors have made efforts to discover a novel substance capable of effectively treating bone diseases, and as a result, it has been confirmed that isoriquiitigenin compounds have excellent preventive and therapeutic effects for bone diseases, and the present invention has been completed.
  • an aspect of the present invention is a compound or mixture selected from the group consisting of a compound represented by the following formula (1), a compound represented by the following formula (2), a pharmaceutically acceptable salt thereof, or a mixture thereof. It provides a pharmaceutical composition for preventing or treating bone diseases, including as an active ingredient.
  • the compound represented by Chemical Formula 1 may be referred to as (2E)-1-(2,4-Dihydroxyphenyl)-3-(4-fluorophenyl)-2-propen-1-one, and is represented by Chemical Formula 2
  • the displayed compound may be referred to as 2',3,4,4',5-pentahydroxychaclone or robtein.
  • IDG isoliquiritigenin
  • the present inventors have tried to discover substances that have therapeutic effects on bone-related diseases, such as osteoporosis, and as a result, derivatives of isoriquiitigenin inhibit the differentiation of macrophages into osteoclasts, and inhibit the activity of osteoclasts. It was confirmed that it inhibits and protects osteoblasts from apoptosis.
  • the derivatives of isoriquiitigenin of the present invention are more effective than isoriquiitigenin (FIGS. 2 to 6).
  • the pharmaceutical composition may include both a compound represented by Formula 1 and a compound represented by Formula 2, and a salt of a compound represented by Formula 1 and a compound represented by Formula 2, or It may include a salt of a compound represented by Formula 1 and a compound represented by Formula 2.
  • the pharmaceutical composition when the pharmaceutical composition includes both a compound represented by Formula 1 and a compound represented by Formula 2, the pharmaceutical composition is represented by Formula 2 per 1 part by weight of the compound represented by Formula 1
  • the compound may be included in an amount of 0.05 to 10 parts by weight, for example, 0.2 to 5 parts by weight of the compound represented by Formula 2 per 1 part by weight of the compound of Formula 1 may be included.
  • the present inventors have confirmed that when the compound represented by Formula 1 and the compound represented by Formula 2 are treated together, the osteoclast differentiation and activity inhibitory effect and the osteoblast protective effect are significantly increased compared to treatment with each compound alone.
  • the compound may be included in the pharmaceutical composition together (FIGS. 4 to 6).
  • the pharmaceutical composition is an osteoclast differentiation marker selected from the group consisting of cathepsin K (cathepsin K), DC STAMP (dendritic cell specific transmembrane protein) and TRAP (tartrate-resistant acid phosphate). Expression can be inhibited.
  • macrophages were pretreated with ILG, a compound of Formula 1 (Derivative 1 of Example) or a compound of Formula 2 (Derivative 2 of Example), and treated with RANKL (receptor activator of NK- ⁇ B ligand), an osteoclast differentiation inducer. It was confirmed after doing. As a result, it was confirmed that the expression level of the differentiation markers was significantly reduced, and it was confirmed that the derivatives of isoriquiitigenin of the present invention can inhibit the differentiation of macrophages into osteoclasts.
  • RANKL receptor activator of NK- ⁇ B ligand
  • the pharmaceutical composition can protect osteoblasts from apoptosis due to oxidative stress.
  • Osteoblasts are cells that create bone (bone) by synthesizing and secreting the bone matrix. If the balance between osteoclasts and osteoblasts is broken and the action of osteoclasts increases, bone-related diseases can occur.
  • the present inventors pretreated ILG, a compound of formula 1 (a derivative 1 of the example), a compound of formula 2 (a derivative 2 of an example), or a compound of formula 1+2 to osteoblasts, and the result of applying oxidative stress, which is the main cause of osteoporosis. , It was confirmed that osteoblasts are protected from cell death by oxidative stress (FIG. 6).
  • the bone disease may be selected from the group consisting of osteoporosis, periodontal disease, osteomalacia, osteopenia, bone defect, bone atrophy, bone necrosis, fracture, osteolysis, osteoarthritis, and bone insufficiency, preferably osteoporosis. have.
  • osteoporosis refers to a condition in which minerals (especially calcium) and substrates constituting bone are reduced, resulting in deterioration of the microstructure of bone tissue, and as a result, the risk of fracture is continuously increased.
  • the osteoclast action increases over the osteoblast action, resulting in a break in the balance of bone remodeling, and causes include calcium absorption disorder, vitamin D deficiency, drug side effects, lack of exercise, excessive drinking, menopause, and depression.
  • estrogen secretion decreases after menopause, it is known that free radicals accumulate in cells, triggering bone loss.
  • Types of osteoporosis include primary osteoporosis such as postmenopausal osteoporosis and senile osteoporosis, and secondary osteoporosis caused by diseases that affect bone formation and reduction, drugs, alcohol, and smoking.
  • the pharmaceutical composition of the present invention may further include an appropriate carrier, excipient, and diluent commonly used in the manufacture of a medicament.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium Silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition of the present invention it is prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc. that are usually used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in the composition of the present invention, such as starch, calcium carbonate, and sucrose. It is prepared by mixing (sucrose) or lactose, gelatin, and the like.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc.
  • various excipients such as humectants, sweeteners, fragrances, and preservatives may be included.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
  • composition of the present invention may be administered orally or parenterally, and oral administration is preferred.
  • oral administration is preferred.
  • the preferred dosage of the composition of the present invention varies depending on the condition and weight of the patient, the degree of disease, the form of the drug, the route and duration of administration, but may be appropriately selected by those skilled in the art. Administration may be administered once a day, or may be divided several times, and the dosage does not limit the scope of the present invention in any way.
  • Another aspect of the present invention provides a method for treating a bone disease comprising administering the pharmaceutical composition for preventing or treating the bone disease to a subject in need of treatment.
  • the compound represented by Formula 1 and/or the compound represented by Formula 2 contained in the composition inhibits the differentiation of macrophages into osteoclasts, inhibits the activity of osteoclasts, and protects osteoblasts from apoptosis. Excellent disease treatment effect.
  • Another aspect of the present invention is a bone comprising a compound or mixture selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, a pharmaceutically acceptable salt thereof, or a mixture thereof as an active ingredient. It provides a food composition for preventing or improving disease.
  • the food composition uses the same ingredients as the pharmaceutical composition for preventing or treating bone disease, overlapping content between the two will be omitted in order to avoid excessive description of the specification.
  • the food composition may be provided in the form of powder, granule, tablet, capsule, syrup, beverage or pill, and is used with other foods or food additives in addition to the compound represented by Formula 1 or Formula 2 as an active ingredient, It can be suitably used according to a conventional method.
  • the mixing amount of the active ingredient may be appropriately determined according to the purpose of use, for example, prevention, health or therapeutic treatment.
  • the effective dose of the active ingredient contained in the food composition may be used in accordance with the effective dose of the pharmaceutical composition, but in the case of long-term intake for the purpose of health and hygiene or health control, it may be less than the above range, It is clear that the active ingredient can be used in an amount beyond the above range because there is no problem in terms of safety.
  • the food composition includes ingredients that are commonly added during food production, and includes, for example, proteins, carbohydrates, fats, nutrients, flavoring agents, and flavoring agents.
  • examples of the aforementioned carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclotexline, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • flavoring agents natural flavoring agents and synthetic flavoring agents can be used.
  • citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, etc. may be additionally included in addition to the active ingredients of the present invention.
  • Another aspect of the present invention provides a composition for inhibiting osteoclast differentiation in vitro using the compound represented by Formula 1 or 2.
  • the compounds since the compound represented by Formula 1 or 2 effectively inhibits the differentiation of macrophages into osteoclasts induced by RANKL treatment, the compounds may be used for inhibiting osteoclast differentiation.
  • the isoriquiitigenin derivatives according to the present invention may be used alone or in combination, and without significant cytotoxicity, inhibit the differentiation of macrophages into osteoclasts, inhibit the activity of osteoclasts, and inhibit apoptosis of osteoblasts. Because it has the effect of preventing or treating bone diseases, it can be usefully used.
  • A cell viability
  • B cytotoxicity
  • IGF isoriquiitigenin
  • Figure 2 shows the degree of differentiation into osteoclasts after treatment with an osteoclast differentiation inducer (RANKL) and isoriquiitigenin (ILG), derivative 1 or derivative 2 on macrophages, as a micrograph (A) and a graph (B). This is the showing result.
  • RNKL osteoclast differentiation inducer
  • IDG isoriquiitigenin
  • DC STAMP dendritic cell specific transmembrane protein
  • RTKL osteoclast differentiation inducer
  • IDG isoriquiitigenin
  • FIG. 5 is a graph showing the degree of differentiation of a bone-mimicking mattress by osteoclasts after treatment with an osteoclast differentiation inducer (RANKL) and isoriquiitigenin (ILG), derivative 1, derivative 2, or derivative 1+2 on macrophages ( The results are shown in A) and microscopic photographs (B).
  • RNKL osteoclast differentiation inducer
  • IGF isoriquiitigenin
  • ILG Isoliquiritigenin
  • 2E -1-(2,4-Dihydroxyphenyl)-3-(4-fluorophenyl)-2-propen-1-one
  • robtein 2E
  • LDH lactate dehydrogenase
  • a 48-well plate 3 ⁇ 10 3 cells of the mouse macrophage line, RAW264.7 cells, were dispensed per well, and ILG, derivative 1, and derivative 2 were pretreated at concentrations of 0.1, 1, 5 or 10 ⁇ M, respectively.
  • the osteoclast differentiation inducer RANKL receptor activator of NK- ⁇ B ligand
  • the culture medium was changed every 2 days for a total of 5 days, and when differentiation into osteoclasts was confirmed under a microscope, the cell medium was discarded and washed with PBS.
  • the differentiated cells were fixed with a fixative for 5 minutes at room temperature and washed several times with distilled water.
  • a substrate solution of sodium tartrate and acid phosphatase was mixed, and the prepared mixture was added to each well to stain the osteoclast differentiation marker TRAP (tartrate-resistant acid phosphate).
  • Dyeing was performed at 37° C. for 15 to 45 minutes after covering the lid of the plate to prevent drying. Thereafter, the dye was discarded and the reaction was stopped by washing with distilled water three times, and the number of cells stained with the Image J program was calculated by taking a picture after observing with a microscope. Since osteoclasts are characterized by having a large number of nuclei, TRAP + osteoclasts having three or more nuclei in one cell were counted as effective cells.
  • the ILG-treated group showed an inhibitory effect on osteoclast differentiation from the concentration of 5 ⁇ M
  • the derivative 1 treatment group and the derivative 2 treatment group also showed an inhibitory effect on osteoclast differentiation from the 5 ⁇ M concentration. It was excellent (Fig. 2).
  • cDNA was synthesized using a cDNA synthesis kit (oligo dT primer) with 500 ng of the isolated mRNA, and RT-PCR was performed using the synthesized cDNA as a template. RT-PCR annealing at 56°C for 30 seconds and elongation at 72°C for 1 minute cycles were performed a total of 35 times.
  • the primer sequence used for RT-PCR is as follows:
  • DC-STAMP F (SEQ ID NO: 1): TTGAACCGAGCTGCATTCCT;
  • DC-STAMP R (SEQ ID NO: 2): GCACTACCTTGGCCTTACCT;
  • Cathepsin K F (SEQ ID NO: 3): GCAGATGTTTGTGTTGGTCTCT;
  • Cathepsin K R (SEQ ID NO: 4): TGGTGGAAAGGTGTGACAGG.
  • Example 3 Derivative 1 and Derivative 2 combined treatment effect
  • Example 2-1 The experiment was carried out in the same manner as in Example 2-1, but the effect of inhibiting differentiation into osteoclasts was confirmed by adding an experimental group treated with derivative 1 and derivative 2 together.
  • Treatment concentrations of derivative 1 and derivative 2 were set to 1+1, 1+5, and 5+1 uM, respectively.
  • ILG treatment group (5 uM), derivative 1 treatment group (5 uM), and derivative 2 treatment group (5 uM) all inhibit the differentiation of RAW264.7 cells into osteoclasts, but this differentiation inhibitory effect is derivative 1+ It was found that it was significantly increased in the 2 treatment group (1+5 uM, 5+1 uM treatment) (Fig. 4).
  • a bone resorption assay kit (CSR-BRA-48KIT, COSMOBIO) was used. Specifically, RAW264.7 cells were dispensed on a culture dish coated with a bone-mimicking mattress containing a calcium-phosphate layer, and ILG, derivative 1, derivative 2, and derivative 1+2 were pretreated for 1 hour. Thereafter, RANKL at a concentration of 40 ng/ml was treated at intervals of 2 days for a total of 6 days, and after 6 days, 5% sodium hypochlorite was treated for 5 minutes to remove osteoclasts attached to the culture dish.
  • the culture dish was further washed with water, dried, and a picture of each well was taken, and the pit area formed by disintegrating the bone-mimicking mattress by osteoclasts was measured as image J.
  • the decomposition area is proportional to the activity of osteoclasts.
  • the ILG-treated group showed a significant decrease in decomposition area from the 5 uM concentration, and at the same concentration, the derivative 1 treatment group and the derivative 2 treatment group showed more excellent decomposition area reduction.
  • the effect of reducing the decomposition area was the best in the derivative 2 treatment group at 10 uM concentration, and the derivative 1+2 treatment group (1+5 uM, 5+1 uM treatment group) had a similar effect to the derivative 2 treatment group at 5 uM concentration.
  • Fig. 5 The effect of reducing the decomposition area was the best in the derivative 2 treatment group at 10 uM concentration, and the derivative 1+2 treatment group (1+5 uM, 5+1 uM treatment group) had a similar effect to the derivative 2 treatment group at 5 uM concentration.
  • Saos2 human bone osteosarcoma cells, a type of osteoblast, were dispensed into a 96-well plate at 5x10 3 cells per well and incubated for 24 hours, and ILG, derivative 1 and derivative 2 were treated at each concentration for 6 hours. During incubation (pretreatment). Subsequently, each well was treated with 100 uM of H 2 O 2 , which is an osteoporosis-inducing substance, and cultured for 2 hours, and EZ-cytox reagent (DOGEN) was added to each well and left at 37° C. for 2 hours. After 2 hours, the absorbance was measured at 450 nm with a microplate reader (Thermo Fisher Scientific, MA, USA).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Epidemiology (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 이소리퀴리티제닌 유도체 및 이들의 용도에 관한 것으로, 상기 이소리퀴리티제닌 유도체들은 단독 또는 병용하여 사용될 수 있으며, 유의미한 세포 독성은 없으면서 대식세포의 파골세포로의 분화를 억제하고, 파골세포의 활성을 저해하며, 조골세포의 세포사멸을 억제하는 효과가 있으므로 골 질환의 예방 또는 치료 용도로 유용하게 사용될 수 있다.

Description

이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물
본 발명은 이소리퀴리티제닌 유도체 및 이의 골 질환의 예방 또는 치료 용도에 관한 것이다.
정상적인 뼈의 재형성과정은 뼈 형성과 뼈 흡수의 균형으로 이루어지며, 이러한 뼈 형성과 뼈 흡수는 크게 세 가지 세포, 연골세포, 조골세포(osteoblast) 및 파골세포(osteoclast)의 상호작용에 의해 이루어진다. 이들 중 파골세포는 조혈모세포로부터 유래한 세포로서 노화된 골의 흡수를 담당하며, 조골세포는 골수 내 간질세포(bone marrow stromal cell)로부터 유래한 세포로서 골 형성에 주된 역할을 담당한다. 골 형성은 파골세포(osteoclast)에 의한 골 흡수(bone resorption)와 조골세포(osteoblast)에 의한 골 형성(bone formation)의 균형이 지속적으로 조절됨으로써 유지된다. 그러나 파골세포의 과도한 활성이나 조골세포의 활성 저하는 골 형성의 리모델링 과정에서 불균형을 초래하며, 생체 내에서 파골세포와 조골세포의 평형을 깨뜨려 골 질환을 유발할 수 있다.
골 질환의 대표적인 예인 골다공증은 골 형성과 골 흡수의 평형이 깨져 뼈의 질량이 감소하고 뼈 조직의 미세구조의 퇴화로 골절 위험이 지속적으로 증가하는 질환으로 뼈를 구성하는 미네랄(특히 칼슘)과 기질이 감소한 상태이며, 골 재형성의 균형이 깨져서 파골 작용이 조골 작용보다 증가된 경우 발생한다. 골 미세구조 사이의 간격이 넓어지고 미세구조가 얇아져 조그만 충격에도 뼈가 쉽게 골절될 위험이 증가하며, 폐경기 이후 골다공증, 70세 이상의 남녀 노인에게 서서히 발생한다.
현재 골다공증 치료제로 사용되고 있는 물질로는 에스트로겐(estrogen), 남성화 스테로이드 호르몬(androgenic anagolic ateroid), 칼슘 제제, 인산염, 불소제제, 이프리플라본(ipriflavone), 비타민 D3 등이 있다. 에스트로겐은 조골세포의 세포사멸을 억제하여 세포의 생존기간을 증가시키고 파골세포의 세포고사를 촉진하여 세포의 생존기간을 감소시켜 폐경 증상의 치료와 골밀도 유지에 어느 정도 효과적인 방법이나 유방암, 자궁내막증식증 등을 유발하는 부작용이 있다. 이외에 파골세포의 활성을 억제하여 골 파괴를 억제시키거나 조골세포의 증식을 통해 골 재생 단위의 활성을 증가시키는 약물로 칼시토닌, 부갑산성호르몬, 비스포스포네이트 제제 등이 있다. 그러나 기존 골다공증 치료제들은 장기간 투여시 많은 부작용을 유발하고 있다. 따라서 기존의 치료제 이외에도 신규한 골다공증 치료제 개발이 요구되고 있다.
이에 본 발명자들은 효과적으로 골 질환 치료 효과를 나타낼 수 있는 신규한 물질을 발굴하기 위하여 노력한 결과, 이소리퀴리티제닌 화합물들이 우수한 골 질환의 예방 및 치료 효과를 갖는 것을 확인하고 본 발명을 완성하였다.
본 발명의 목적은 이소리퀴리티제닌 유도체를 유효성분으로 포함하는 골 질환 예방 또는 치료용 약학 조성물, 골 질환 예방 또는 개선용 식품 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여 본 발명의 일 양상은 하기 화학식 1로 표시되는 화합물, 하기 화학식 2로 표시되는 화합물, 이들의 약제학적으로 허용가능한 염 또는 이들의 혼합물로 이루어진 군에서 선택되는 화합물 또는 혼합물을 유효성분으로 포함하는 골 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
Figure PCTKR2020012383-appb-img-000001
Figure PCTKR2020012383-appb-img-000002
본 발명에서, 상기 화학식 1로 표시되는 화합물은 (2E)-1-(2,4-Dihydroxyphenyl)-3-(4-fluorophenyl)-2-propen-1-one으로 지칭될 수 있고, 화학식 2로 표시되는 화합물은 2',3,4,4',5-pentahydroxychaclone 또는 롭테인(robtein)으로 지칭될 수 있다. 이들 두 화합물은 하기 화학식 3으로 표시되는 이소리퀴리티제닌(isoliquiritigenin, ILG)의 유도체로 이소리퀴리티제닌은 기존에 파골세포 분화 억제 효과가 있는 것으로 알려져 있으나(비특허문헌 1), 상기 화학식 1 또는 화학식 2로 표시되는 화합물의 파골세포 분화 및 활성 억제, 조골세포 보호 효과는 알려진 바가 없다.
Figure PCTKR2020012383-appb-img-000003
본 발명자들은 골 관련 질환, 예를 들어 골다공증과 같은 질환에 치료 효과를 갖는 물질을 발굴하기 위해 노력한 결과 이소리퀴리티제닌의 유도체들이 대식세포가 파골세포로 분화하는 것을 억제하고, 파골세포의 활성을 억제하며, 세포사멸로부터 조골세포를 보호하는 것을 확인하였다. 또한, 본 발명의 이소리퀴리티제닌의 유도체들은 이소리퀴리티제닌보다 효과가 우수하다(도 2 내지 6).
본 발명의 일 구체예에서, 상기 약학적 조성물은 화학식 1로 표시되는 화합물 및 화학식 2로 표시되는 화합물 모두를 포함할 수 있고, 화학식 1로 표시되는 화합물과 화학식 2로 표시되는 화합물의 염, 또는 화학식 1로 표시되는 화합물의 염과 화학식 2로 표시되는 화합물을 포함할 수 있다.
본 발명의 일 구체예에서, 상기 약학적 조성물이 화학식 1로 표시되는 화합물 및 화학식 2로 표시되는 화합물 모두를 포함하는 경우, 약학적 조성물은 화학식 1로 표시되는 화합물 1 중량부당 화학식 2로 표시되는 화합물을 0.05 내지 10 중량부로 포함할 수 있으며, 예를 들어 화학식 1의 화합물 1 중량부당 화학식 2로 표시되는 화합물을 0.2 내지 5 중량부로 포함할 수 있다.
본 발명자들은 화학식 1로 표시되는 화합물 및 화학식 2로 표시되는 화합물을 같이 처리하면 각 화합물을 단독으로 처리하는 것보다 파골세포 분화 및 활성 억제 효과, 조골세포 보호 효과가 현저히 상승하는 것을 확인하였으므로 상기 두 화합물은 약학적 조성물에 같이 포함될 수 있다(도 4 내지 6).
본 발명의 일 구체예에서, 상기 약학적 조성물은 카텝신 K (cathepsin K), DC STAMP (dendritic cell specific transmembrane protein) 및 TRAP(tartrate-resistant acid phosphate)으로 이루어진 군에서 선택되는 파골세포 분화 마커의 발현을 억제할 수 있다.
구체적으로 대식세포에 ILG, 화학식 1의 화합물(실시예의 유도체 1) 또는 화학식 2의 화합물(실시예의 유도체 2)을 전처리하고, 파골세포 분화 유도물질인 RANKL(receptor activator of NK-κB ligand)을 처리한 후 확인하였다. 그 결과, 상기 분화 마커들의 발현 수준이 현저히 감소하는 것을 확인하여 본 발명의 이소리퀴리티제닌의 유도체들이 대식세포가 파골세포로 분화하는 것을 억제할 수 있음을 확인하였다.
또한, 상기 약학적 조성물은 산화적 스트레스에 의한 세포사멸로부터 조골세포를 보호할 수 있다. 조골세포는 골 기질을 합성하고 분비하여 골(뼈)를 만드는 세포로 파골세포와 조골세포의 균형이 깨지면서 파골세포의 작용이 증가하면 골관련 질환이 발생할 수 있다.
본 발명자들은 골아세포에 ILG, 화학식 1의 화합물(실시예의 유도체 1), 화학식 2의 화합물(실시예의 유도체 2) 또는 화학식 1+2의 화합물을 전처리하고, 골다공증의 주요 원인인 산화 스트레스를 가한 결과, 산화적 스트레스에 의한 세포 사멸로부터 골아세포가 보호되는 것을 확인하였다(도 6).
본 발명에서, 상기 골 질환은 골다공증, 치주 질환, 골연화증, 골감소증, 골결손, 골위축, 골괴사, 골절, 골용해, 골관절염 및 골형성 부전증으로 이루어진 군에서 선택될 수 있으며, 바람직하게는 골다공증일 수 있다.
본 명세서에 사용된 용어, "골다공증"은 뼈를 구성하는 미네랄(특히 칼슘)과 기질이 감소하여 뼈 조직의 미세구조가 퇴화하고, 결과적으로 골절 위험이 지속적으로 증가하는 상태를 말한다. 파골 작용이 조골 작용보다 증가함으로써 골 재형성의 균형이 깨져서 발생하며, 원인으로는 칼슘 흡수 장애, 비타민 D 결핍, 약물 부작용, 운동 부족, 과음, 폐경, 우울증 등이 있다. 특히 여성의 경우 폐경기 이후 에스트로겐 분비량이 감소하면 활성산소가 세포에 축적되어 골 손실이 촉발되는 것으로 알려져 있다.
골다공증의 종류에는 폐경 후 골다공증 및 노인성 골다공증과 같은 1차성 골다공증과 뼈의 형성과 감소에 영향을 미치는 질병, 약물, 음주, 흡연 등으로 발생하는 2차성 골다공증이 있다.
본 발명의 약학적 조성물은 약제의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 추가로 포함할 수 있다. 본 발명의 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등이 있다.
본 발명의 약학적 조성물을 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘(calcium carbonate), 슈크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명의 조성물은 경구 또는 비경구로 투여될 수 있으며, 경구 투여가 바람직하다. 본 발명의 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있으며, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 다른 양상은 상기 골 질환의 예방 또는 치료용 약학적 조성물을 치료가 필요한 개체(subject)에 투여하는 단계를 포함하는 골 질환의 치료 방법을 제공한다. 상기 조성물에 포함된 화학식 1로 표시되는 화합물 및/또는 화학식 2로 표시되는 화합물은 대식세포가 파골세포로 분화하는 것을 억제하고, 파골세포의 활성을 억제하며, 세포사멸로부터 조골세포를 보호하므로 골 질환 치료 효과가 우수하다.
본 발명의 다른 양상은 상기 화학식 1로 표시되는 화합물, 상기 화학식 2로 표시되는 화합물, 이들의 약제학적으로 허용가능한 염 또는 이들의 혼합물로 이루어진 군에서 선택되는 화합물 또는 혼합물을 유효성분으로 포함하는 골 질환의 예방 또는 개선용 식품 조성물을 제공한다.
상기 식품 조성물은 골 질환의 예방 또는 치료용 약학적 조성물과 동일한 성분을 사용하므로 이 둘 사이에 중복되는 내용은 명세서의 과도한 기재를 피하기 위하여 생략한다.
본 발명에서, 상기 식품 조성물은 분말, 과립, 정제, 캡슐, 시럽, 음료 또는 환의 형태로 제공될 수 있으며, 유효성분인 화학식 1 또는 화학식 2로 표시되는 화합물 이외에 다른 식품 또는 식품 첨가물과 함께 사용되고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합량은 그의 사용 목적 예를 들어 예방, 건강 또는 치료적 처치에 따라 적합하게 결정될 수 있다.
상기 식품 조성물에 함유된 유효성분의 유효용량은 상기 약학 조성물의 유효용량에 준해서 사용할 수 있으나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간 섭취의 경우에는 상기 범위 이하일 수 있으며, 유효성분은 안전성 면에서 아무런 문제가 없기 때문에 상기 범위 이상의 양으로도 사용될 수 있음은 확실하다.
상기 식품 조성물은 식품 제조시에 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드, 예를 들어 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스, 올리고당 등; 및 폴리사카라이드, 예를 들어 덱스트린, 사이클로텍스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제 및 합성 향미제를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제로 제조되는 경우에는 본 발명의 유효성분 외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙 등을 추가로 포함시킬 수 있다.
본 발명의 또 다른 양상은 상기 화학식 1 또는 2로 표시되는 화합물을 이용한 시험관내 파골세포 분화 억제용 조성물을 제공한다.
본 발명의 일 구체예에서, 상기 화학식 1 또는 2로 표시되는 화합물은 RANKL 처리에 의하여 유도되는 대식세포의 파골세포로의 분화를 효과적으로 억제하였으므로 상기 화합물들은 파골세포 분화 억제 용도로 사용될 수 있다.
본 발명에 따른 이소리퀴리티제닌 유도체들은 단독 또는 병용하여 사용될 수 있으며, 유의미한 세포 독성은 없으면서 대식세포의 파골세포로의 분화를 억제하고, 파골세포의 활성을 저해하며, 조골세포의 세포사멸을 억제하는 효과가 있으므로 골 질환의 예방 또는 치료 용도로 유용하게 사용될 수 있다.
도 1은 대식세포에 파골세포 분화 유도물질(RANKL)과 이소리퀴리티제닌 (ILG), 유도체 1 또는 유도체 2를 처리한 후 세포 생존율(A) 및 세포 독성(B)을 측정한 결과이다.
도 2는 대식세포에 파골세포 분화 유도물질(RANKL)과 이소리퀴리티제닌 (ILG), 유도체 1 또는 유도체 2를 처리한 후 파골세포로의 분화 정도를 현미경 사진(A)과 그래프(B)로 보여주는 결과이다.
도 3은 대식세포에 파골세포 분화 유도물질(RANKL)과 이소리퀴리티제닌 (ILG), 유도체 1 또는 유도체 2를 처리한 후 파골세포 분화 및 활성화 마커인 DC STAMP(dendritic cell specific transmembrane protein)와 카텝신 K (cathepsin K)의 mRNA 수준을 확인한 결과이다.
도 4는 대식세포에 파골세포 분화 유도물질(RANKL)과 이소리퀴리티제닌 (ILG), 유도체 1, 유도체 2 또는 유도체1+2를 처리한 후 파골세포로의 분화 정도를 확인한 결과이다.
도 5는 대식세포에 파골세포 분화 유도물질(RANKL)과 이소리퀴리티제닌 (ILG), 유도체 1, 유도체 2 또는 유도체1+2를 처리한 후 파골세포에 의한 뼈 모사 매트리스의 분화 정도를 그래프(A) 및 현미경 사진(B)으로 보여주는 결과이다.
도 6은 조골세포에 산화스트레스 유도물질(H2O2)과 이소리퀴리티제닌 (ILG), 유도체 1 또는 유도체 2를 처리한 후 세포 생존율을 확인한 결과이다.
이하 하나 이상의 구체예를 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
이소리퀴리티제닌(isoliquiritigenin; 이하, ILG로 기재함)은 파골세포 분화 억제 효과가 있는 것으로 알려져 있다. 이에 ILG의 유도체 중에서 (2E)-1-(2,4-Dihydroxyphenyl)-3-(4-fluorophenyl)-2-propen-1-one (이하, 유도체 1로 기재함)과 롭테인(robtein, 2',3,4,4',5-pentahydroxychalcone; 이하, 유도체 2로 기재함)의 효과를 하기 실시예 1 내지 5에서 확인하였다.
실시예 1: 유도체 1 및 2의 세포 독성 확인
유도체 1 및 2의 독성을 확인하기 위하여 하기와 같이 실험하였다.
먼저 세포 생존능을 확인하기 위해 세포질 내에 존재하는 탈수소효소 (dehydrogenase)의 활성을 측정하였다. 96-웰 플레이트에 RAW264.7 세포를 각 웰당 5x10 3개씩 분주하여 24시간 동안 배양하고, 파골세포 분화 유도물질인 RANKL(receptor activator of NK-κB ligand) 40 ng/㎖ 및 ILG, 유도체 1, 유도체 2를 각 농도별로 처리한 뒤 48시간 동안 추가로 배양하였다. 이후 EZ-cytox reagent(DOGEN, 대한민국)를 각 웰에 첨가하고 37℃에서 2시간 동안 방치한 뒤 마이크로플레이트 리더기(Thermo Fisher Scientific, MA, USA)로 450 ㎚에서 흡광도를 측정하였다.
또한, 세포 독성 수준을 확인하기 위해 세포에서 배양배지로 방출되는 젖산 탈수소효소(lactate dehydrogenase, LDH)의 수준을 LDH Cytotoxicity detection kit (TAKARABIO, 일본)로 측정하였다. 구체적으로 상기 세포 생존능 확인 실험에서 남은 배양배지를 새로운 96-웰 플레이트로 옮기고 테트라졸륨염이 함유된 반응 혼합물을 각 웰에 첨가하여 상온에서 10분 내지 30분 동안 반응시켰다. 이후 1N HCl을 첨가하여 추가 반응을 중지시키고, 마이크로플레이트 리더기로 490 내지 492 ㎚에서 흡광도를 측정하여 세포 독성을 계산하였다.
그 결과, 각 실험군 모두에서 세포 배양 48시간까지는 세포 생존율 및 세포 독성에 유의한 변화가 발견되지 않았고, 유도체 1 또는 유도체 2를 10 uM 처리한 경우 대조군과 비교하여 세포 생존율이 약간 감소하였으나 통계적 유의성은 없는 것을 알 수 있었다(도 1).
실시예 2: 파골세포의 분화 및 활성화 억제
2-1. 파골세포의 분화 억제
48-웰 플레이트에 마우스 대식세포주인 RAW264.7 세포를 각 웰당 3x10 3개씩 분주하고, ILG, 유도체 1 및 유도체 2를 각각 0.1, 1, 5 또는 10 μM 농도로 전처리하였다. 1시간 후 파골세포 분화 유도물질인 RANKL(receptor activator of NK-κB ligand)을 40 ng/㎖ 농도로 처리하였다. 이후 2일마다 배지를 교체하면서 총 5일동안 배양하고, 현미경 상에서 파골세포로의 분화가 확인되면 세포 배지를 버리고 PBS로 세척하였다. 분화된 세포를 고정액으로 상온에서 5분 동안 고정시키고 증류수로 여러 번 세척하였다. 타타르산 나트륨(sodium tartrate)과 산성 인산분해효소(acid phosphatase)의 기질 용액을 혼합하고, 상기 준비된 혼합액을 각 웰에 첨가하여 파골세포 분화 마커인 TRAP(tartrate-resistant acid phosphate)을 염색하였다. 염색은 건조 방지를 위해 플레이트의 뚜껑을 덮은 뒤 37℃에서 15분 내지 45분 동안 진행하였다. 이후 염색약을 버리고 증류수로 3번 세척하여 반응을 중단시켰으며, 현미경으로 관찰한 뒤 사진을 찍어 이미지 J 프로그램으로 염색된 세포의 수를 계산하였다. 파골세포는 다수의 핵을 가지는 것이 특징이므로 한 세포에 3개 이상의 핵을 가지는 TRAP + 파골세포를 유효한 세포로 계산하였다.
그 결과, ILG 처리군에서는 5 μM 농도부터 파골세포 분화 억제 효과가 나타났고, 유도체 1 처리군 및 유도체 2 처리군 또한 5 μM 농도부터 파골세포 분화 억제 효과를 보였으며, 특히 유도체 2의 효과가 현저히 우수하였다(도 2).
2-2. 파골세포 분화 마커 발현 억제 효과
6-웰 플레이트에 RAW264.7 세포를 각 웰당 3x10 4개씩 분주하고 ILG, 유도체 1 및 유도체 2를 각각 5 uM 또는 10 uM 농도로 1시간 동안 전처리하였다. 이후 각 웰에 RANKL을 40 ng/㎖ 농도로 처리하고, 2일마다 배지를 교체하면서 총 4일동안 배양한 뒤 트라이졸(trizol)로 세포를 회수하였다. 회수한 세포에서 트라이졸-클로로포름 방법으로 mRNA를 분리하고, 나노-드랍(nano-drop)으로 정량하였다. 이후 분리한 mRNA 500 ng으로 cDNA 합성 키트(올리고 dT 프라이머)를 사용하여 cDNA를 합성하고, 합성한 cDNA를 주형으로 RT-PCR을 진행하였다. RT-PCR 어닐링 56℃에서 30초 및 신장 72℃에서 1분 사이클을 총 35회 진행하였다. RT-PCR에 사용한 프라미어 서열은 다음과 같다:
DC-STAMP F (서열번호 1): TTGAACCGAGCTGCATTCCT;
DC-STAMP R (서열번호 2): GCACTACCTTGGCCTTACCT;
카텝신 K F (서열번호 3): GCAGATGTTTGTGTTGGTCTCT; 및
카텝신 K R (서열번호 4): TGGTGGAAAGGTGTGACAGG.
그 결과, 파골세포 분화 및 활성화 마커인 DC STAMP (dendritic cell specific transmembrane protein) 및 카텝신 K (cathepsin K)의 mRNA 수준이 ILG 처리군, 유도체 1 처리군 및 유도체 2 처리군 모두에서 감소하는 것을 확인할 수 있었으며, 유도체 2를 10 uM 처리한 경우 mRNA 감소 효과가 가장 우수하였다(도 3).
실시예 3: 유도체 1 및 유도체 2의 병용 처리 효과
상기 실시예 2-1과 동일한 방법으로 실험을 진행하되 유도체 1 및 유도체 2를 같이 처리하는 실험군을 추가하여 파골세포로의 분화 억제 효과를 확인하였다. 유도체 1과 유도체 2의 처리 농도는 각각 1+1, 1+5 및 5+1 uM로 설정하였다.
확인 결과, ILG 처리군(5 uM), 유도체 1 처리군(5 uM) 및 유도체 2 처리군(5 uM) 모두 RAW264.7 세포가 파골세포로 분화하는 것을 억제하지만 이러한 분화 억제 효과는 유도체 1+2 처리군(1+5 uM, 5+1 uM 처리)에서 현저히 증가하는 것을 알 수 있었다(도 4).
실시예 4: 분화된 파골세포의 활성 확인
RAW264.7 세포가 RANKL 처리에 의해 파골세포로 분화되었을 때의 활성을 확인하기 위해 Bone resorption assay kit (CSR-BRA-48KIT, COSMOBIO)를 사용하였다. 구체적으로 칼슘-포스페이트 층을 함유한 뼈 모사 매트리스가 도포되어 있는 배양접시 위에 RAW264.7 세포를 분주하고 ILG, 유도체 1, 유도체 2, 및 유도체 1+2를 1시간 동안 전처리하였다. 이후 40 ng/㎖ 농도의 RANKL을 2일 간격으로 총 6일 동안 처리하고, 6일 후 5% 차아염소산 나트륨(sodium hypochlorite)을 5분 동안 처리하여 배양접시에 붙어 있는 파골세포를 제거하였다. 배양접시는 물로 추가로 세척한 후 건조시키고, 각 웰의 사진을 찍은 후 파골세포가 뼈 모사 매트리스를 분해하여 형성된 분해 면적(pit area)을 이미지 J로 측정하였다. 상기 분해 면적은 파골세포의 활성과 비례한다.
측정 결과, RANKL과 각 화합물을 동시에 처리하였을 때 ILG 처리군은 5 uM 농도부터 유의미한 분해 면적 감소를 보였으며, 동일 농도에서 유도체 1 처리군, 유도체 2 처리군은 분해 면적 감소가 더 우수하였다. 분해 면적 감소 효과는 10 uM 농도의 유도체 2 처리군에서 가장 우수하였으며, 유도체 1+2 처리군(1+5 uM, 5+1 uM 처리군)은 5 uM 농도의 유도체 2 처리군과 유사한 효과를 보였다(도 5).
실시예 5: 조골세포 보호 효과
조골세포(osteoblast)의 한 종류인 Saos2(human bone osteosarcoma) 세포를 96-웰 플레이트에 각 웰당 5x10 3개씩 분주하여 24시간 동안 배양하고, ILG, 유도체 1, 유도체 2를 각 농도별로 처리하여 6시간 동안 배양하였다(전처리). 이후 각 웰에 골다공증 유발물질인 H 2O 2를 100 uM로 처리하여 2시간 동안 배양하고, EZ-cytox reagent(DOGEN)를 각 웰에 첨가하여 37℃에서 2시간 동안 방치하였다. 2시간 뒤 마이크로플레이트 리더기(Thermo Fisher Scientific, MA, USA)로 450 ㎚에서 흡광도를 측정하였다.
측정 결과, H 2O 2 처리에 의하여 Saos2 세포의 생존율이 40%까지 감소하나 유도체 2를 5 또는 10 uM 농도로 처리한 경우 세포 생존율이 유의하게 증가하는 것을 알 수 있었다(도 6). 이 결과는 유도체 2의 화합물이 산화적 스트레스에 의한 세포사멸로부터 조골세포를 보호할 수 있음을 의미한다.

Claims (10)

  1. 하기 화학식 1로 표시되는 화합물, 하기 화학식 2로 표시되는 화합물, 이들의 약제학적으로 허용가능한 염 또는 이들의 혼합물로 이루어진 군에서 선택되는 화합물 또는 혼합물을 유효성분으로 포함하는 골 질환의 예방 또는 치료용 약학적 조성물.
    [화학식 1]
    Figure PCTKR2020012383-appb-img-000004
    [화학식 2]
    Figure PCTKR2020012383-appb-img-000005
  2. 제1항에 있어서, 상기 약학적 조성물은 상기 화학식 1로 표시되는 화합물 및 상기 화학식 2로 표시되는 화합물을 포함하는 것인, 골 질환의 예방 또는 치료용 약학적 조성물.
  3. 제2항에 있어서, 상기 약학적 조성물은 화학식 1로 표시되는 화합물 1 중량부당 화학식 2로 표시되는 화합물을 0.05 내지 10 중량부로 포함하는 것인, 골 질환의 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서, 상기 골 질환은 골다공증(osteoporosis), 치주 질환(periodontal disease), 골연화증 (osteomalacia), 골감소증(osteopenia), 골결손, 골위축(bone atrophy), 골괴사, 골절(fracture), 골용해(osteolysis), 골관절염(osteoarthritis) 및 골형성 부전증(osteogenesis imperfecta)으로 이루어진 군에서 선택되는 것인, 골 질환의 예방 또는 치료용 약학적 조성물.
  5. 제1항에 있어서, 상기 약학적 조성물은 카텝신 K (cathepsin K), DC STAMP (dendritic cell specific transmembrane protein) 및 TRAP(tartrate-resistant acid phosphate)으로 이루어진 군에서 선택되는 파골세포 분화 마커의 발현을 억제하는 것인, 골 질환의 예방 또는 치료용 약학적 조성물.
  6. 제1항에 있어서, 상기 약학적 조성물은 산화적 스트레스에 의한 세포사멸로부터 조골세포를 보호하는 것인, 골 질환의 예방 또는 치료용 약학적 조성물.
  7. 하기 화학식 1로 표시되는 화합물, 하기 화학식 2로 표시되는 화합물, 이들의 약제학적으로 허용가능한 염 또는 이들의 혼합물로 이루어진 군에서 선택되는 화합물 또는 혼합물을 유효성분으로 포함하는 골 질환의 예방 또는 개선용 식품 조성물.
    [화학식 1]
    Figure PCTKR2020012383-appb-img-000006
    [화학식 2]
    Figure PCTKR2020012383-appb-img-000007
  8. 제7항에 있어서, 상기 식품 조성물은 상기 화학식 1로 표시되는 화합물 및 상기 화학식 2로 표시되는 화합물을 포함하는 것인, 골 질환의 예방 또는 개선용 식품 조성물.
  9. 제7항에 있어서, 상기 골 질환은 골다공증, 치주 질환, 골연화증, 골감소증, 골결손, 골위축, 골괴사, 골절, 골용해, 골관절염 및 골형성 부전증으로 이루어진 군에서 선택되는 것인, 골 질환의 예방 또는 개선용 식품 조성물.
  10. 제1항의 골 질환의 예방 또는 치료용 약학적 조성물을 치료가 필요한 개체(subject)에 투여하는 단계를 포함하는 골 질환의 치료 방법.
PCT/KR2020/012383 2019-11-01 2020-09-14 이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물 WO2021085849A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0138791 2019-11-01
KR1020190138791A KR102263396B1 (ko) 2019-11-01 2019-11-01 이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물

Publications (1)

Publication Number Publication Date
WO2021085849A1 true WO2021085849A1 (ko) 2021-05-06

Family

ID=75715320

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/012383 WO2021085849A1 (ko) 2019-11-01 2020-09-14 이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR102263396B1 (ko)
WO (1) WO2021085849A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113662970A (zh) * 2021-08-30 2021-11-19 杭州易文赛生物技术有限公司 一种脐带干细胞制剂在制备治疗骨关节炎药物中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050032882A1 (en) * 2002-03-06 2005-02-10 Sophie Chen Botanical extract compositions and methods of use
KR20090037395A (ko) * 2006-05-11 2009-04-15 액티브파이토 테크놀로지즈 리미티드 오리도닌을 포함하는 저항성 암의 치료를 위한 조성물
KR20100031211A (ko) * 2008-09-12 2010-03-22 연세대학교 산학협력단 리코칼콘계 화합물의 제조방법
CN109651121A (zh) * 2019-01-25 2019-04-19 陕西理工大学 一种Robtein的合成方法

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140147619A (ko) * 2013-06-20 2014-12-30 이화여자대학교 산학협력단 신규한 칼콘 유도체 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050032882A1 (en) * 2002-03-06 2005-02-10 Sophie Chen Botanical extract compositions and methods of use
KR20090037395A (ko) * 2006-05-11 2009-04-15 액티브파이토 테크놀로지즈 리미티드 오리도닌을 포함하는 저항성 암의 치료를 위한 조성물
KR20100031211A (ko) * 2008-09-12 2010-03-22 연세대학교 산학협력단 리코칼콘계 화합물의 제조방법
CN109651121A (zh) * 2019-01-25 2019-04-19 陕西理工大学 一种Robtein的合成方法

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JEONG SEONGTAE, LEE SEAHYOUNG, KIM KUNDO, LEE YUNMI, LEE JIYUN, OH SENA, CHOI JUNG-WON, KIM SANG WOO, HWANG KI-CHUL, LIM SOYEON: "Isoliquiritigenin Derivatives Inhibit RANKL-Induced Osteoclastogenesis by Regulating p38 and NF-κB Activation in RAW 264.7 Cells", MOLECULES, vol. 25, no. 17, pages 3908, XP055808226, DOI: 10.3390/molecules25173908 *
VUORINEN ANNA, ENGELI ROGER T., LEUGGER SUSANNE, BACHMANN FABIO, AKRAM MUHAMMAD, ATANASOV ATANAS G., WALTENBERGER BIRGIT, TEMML VE: "Potential Antiosteoporotic Natural Product Lead Compounds That Inhibit 17β-Hydroxysteroid Dehydrogenase Type 2", JOURNAL OF NATURAL PRODUCTS, AMERICAN CHEMICAL SOCIETY, US, vol. 80, no. 4, 28 April 2017 (2017-04-28), US, pages 965 - 974, XP055808222, ISSN: 0163-3864, DOI: 10.1021/acs.jnatprod.6b00950 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113662970A (zh) * 2021-08-30 2021-11-19 杭州易文赛生物技术有限公司 一种脐带干细胞制剂在制备治疗骨关节炎药物中的应用
CN113662970B (zh) * 2021-08-30 2023-11-24 杭州易文赛生物技术有限公司 一种脐带干细胞制剂在制备治疗骨关节炎药物中的应用

Also Published As

Publication number Publication date
KR102263396B1 (ko) 2021-06-10
KR20210053025A (ko) 2021-05-11

Similar Documents

Publication Publication Date Title
WO2012070890A2 (en) Pharmaceutical composition comprising extract of lonicera japonica for prevention and treatment of gastroesophageal reflux disease
WO2021085849A1 (ko) 이소리퀴리티제닌 유도체를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물
JP5562515B2 (ja) 骨疾患の予防及び／又は治療用組成物、その組成物を含有する機能性食品もしくは健康食品、並びにその組成物を有効成分とする医薬製剤
KR101509554B1 (ko) 골질환의 예방 및/또는 치료용 의약 조성물, 그 조성물을 함유하는 기능성 식품 또는 건강 식품, 그리고 그 조성물을유효 성분으로 하는 의약 제제
WO2014054880A1 (ko) 신규한 폴리에틸렌글리콜과 비타민 씨를 함유하는 안정성이 개선된 장관 하제 조성물
WO2024048998A1 (ko) 살비아놀산을 유효성분으로 함유하는 골질환의 예방, 개선 또는 치료용 조성물
WO2009119987A2 (ko) 피라졸 유도체를 포함하는 골다공증 예방 및 치료용 조성물
US9839660B2 (en) Metabolism accelerating composition comprising Astragali radix extract
KR101308144B1 (ko) 아젤라신 ｄ를 유효성분으로 함유하는 골질환 예방 또는 치료용 약학적 조성물
KR101656834B1 (ko) 콜포신 다로페이트를 포함하는 골 질환의 예방 또는 치료용 조성물
CN111388490B (zh) 一种具有防治酒精性脂肪肝功能的人参皂苷组合物
WO2017179914A1 (ko) 바이오틴이 결합된 카페인산 화합물을 유효성분으로 함유하는 통풍 예방 또는 치료용 조성물
WO2020262838A1 (ko) 천연물 추출물을 포함하는 안정성이 개선된 약제학적 조성물
WO2022186608A1 (ko) 해삼 생식선 추출물 또는 이로부터 유래된 화합물의 항암 용도
WO2014084669A1 (ko) 프래럽토린 a 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 골다공증 예방 또는 치료용 약학적 조성물
WO2022092884A1 (ko) 13-ｏ-아세틸포볼을 포함하는 골질환 및 혈관석회화증 예방 또는 치료용 약학적 조성물
KR20090110401A (ko) 견우자 추출물을 포함하는 치주질환의 예방 또는 치료용약학 조성물
WO2020101181A1 (ko) 압타머를 유효성분으로 포함하는 퇴행성 뇌질환 치료 및 예방용 조성물
WO2022045673A1 (ko) 신규한 화합물을 유효성분으로 포함하는 심근경색 후 심부전 예방 또는 치료용 조성물 및 이의 용도
KR20190015942A (ko) 골 질환 예방 또는 치료용 화합물 및 이의 용도
WO2023200171A1 (ko) 함초 추출물 또는 이의 분획물을 포함하는 골 질환 예방, 치료 또는 개선용 조성물
KR101797454B1 (ko) 시아니딘-3-글루코시드 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 골형성 촉진용 약학적 조성물
US20030229137A1 (en) Methods of inhibiting osteoclast activity
KR102580435B1 (ko) 피페리린을 포함하는 골 질환의 예방 또는 치료용 조성물
WO2023075461A1 (ko) 안지오텐신 수용체 차단제 및 sglt2 억제제를 포함하는 복합 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20881113

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20881113

Country of ref document: EP

Kind code of ref document: A1