WO2024039163A1 - 고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도 - Google Patents

고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도 Download PDF

Info

Publication number
WO2024039163A1
WO2024039163A1 PCT/KR2023/012051 KR2023012051W WO2024039163A1 WO 2024039163 A1 WO2024039163 A1 WO 2024039163A1 KR 2023012051 W KR2023012051 W KR 2023012051W WO 2024039163 A1 WO2024039163 A1 WO 2024039163A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
schizochytrium
culture
weight
biomass
Prior art date
Application number
PCT/KR2023/012051
Other languages
English (en)
French (fr)
Inventor
장성훈
신원섭
최정운
강혜원
유애진
곽준석
김지영
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2024039163A1 publication Critical patent/WO2024039163A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6432—Eicosapentaenoic acids [EPA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6434—Docosahexenoic acids [DHA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/89—Algae ; Processes using algae

Definitions

  • the present invention is a novel Schizochytrium sp. strain that produces biomass containing high content of protein, antioxidant pigment, and omega-3 fatty acid, and contains high content of protein, antioxidant pigment, and omega-3 fatty acid using the same. It is about biomass production method.
  • Nutrients can be broadly classified into sugars mainly used for calories, calories from lipid components, proteins, mineral components, and regulatory nutrients such as vitamins.
  • protein components play a variety of important roles, such as being a component within living organisms, serving as catalysts for various chemical reactions within cells, and forming antibodies to form antibodies, making their supply and consumption within the body particularly important.
  • soybean which is used as food protein itself, or soybean meal, which is the residue left after extracting food oil, is used as animal feed.
  • GMO genetically modified
  • SCP Single Cell Protein
  • Spirulina and chlorella are particularly well known. It is nutritionally excellent as it contains protein ingredients with a variety of amino acid compositions, including essential amino acids, but has the disadvantage of being unpalatable for the unique odor and taste derived from chlorophyll and increasing the supply price due to the cultivation and production method through photosynthesis. there is.
  • it has the advantage of containing unsaturated fatty acids of omega-3 components, including intracellular DHA and EPA, and has the advantage of being able to supply additional essential fatty acids, unlike existing SCPs derived from soybean meal or other microorganisms.
  • it has the advantage of having a cell membrane mainly composed of protein without a cell wall, so it has a high digestibility in the body.
  • DHA docosahexaenoic acid
  • EPA eicosapentaenoic acid
  • ARA arachidonic acid
  • docosapentaenoic acid Research and industrialization on the production of polyunsaturated fatty acids, including omega-3 unsaturated fatty acids such as docosapentaenoic acid (DPA) and ⁇ -linolenic acid, are progressing very rapidly.
  • DPA docosapentaenoic acid
  • US Patent No. 5,130,242 discloses Schizochytrium sp, a microorganism of the genus Schizochytrium. ATCC20888 ( Schizochytrium sp. ATCC20888) and Schizochytrium sp.
  • a method for producing omega-3 polyunsaturated fatty acids using PTA10208 Schizochytrium sp. PTA10208 is disclosed.
  • the present invention provides a novel mutant strain of Schizochytrium that simultaneously contains and/or produces antioxidant pigments in addition to high amounts of protein and omega-3 fatty acids, thereby suggesting the possibility of mass production as a new vegetable protein material.
  • An example of the present application provides a novel Schizochytrium sp. CD03-7004 strain (accession number KCTC15006BP).
  • Another example of the present application provides biomass containing the Schizochytrium genus strain, a culture medium of the strain, dried product of the culture solution, or shredded material of the dried product.
  • Another example of the present application provides a feed composition containing the Schizochytrium genus strain, a culture medium of the strain, a dried product of the culture solution, or a shredded product of the dried product.
  • Another example of the present application provides a food composition containing the Schizochytrium genus strain, a culture of the strain, a dried product of the culture, or a shredded product of the dried product.
  • Another example of the present application provides an antioxidant composition containing the Schizochytrium genus strain, the culture medium of the strain, the dried product of the culture solution, or the shredded product of the dried product.
  • Another example of the present application includes culturing the Schizochytrium genus strain.
  • Extracting carotenoid-based antioxidant pigments from the culture of the strain Provides a method for producing antioxidant pigments comprising.
  • An example of the present application provides a novel Schizochytrium sp. CD03-7004 strain (accession number KCTC15006BP), a microalgae.
  • Thraustochytrid refers to microalgae of the order Thraustochytriales.
  • Schizochytrium sp used in this specification is one of the genus names belonging to the family Thraustochytriaceae of the order Thraustochytriales, and the term “genus Schizochytrium” )” can be used interchangeably.
  • microalgae may be used interchangeably with "strain” in this specification, and refers to small algae that cannot be seen with the naked eye and can only be seen through a microscope, and are organisms that live freely floating in water. it means. There are various types of microalgae, including strains that cannot photosynthesize and grow only heterotrophically.
  • mutations are generated by irradiating gamma rays to the wild-type Schizochytrium genus CD01-5000 strain, and among the mutant strains, strains with the ability to produce antioxidant pigments are selected, which are selected from the wild-type Schizochytrium genus ( Schizochytrium sp.) CD03 It was named -7004, and on June 20, 2022, it was deposited at the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Bioscience and Biotechnology, an international depository under the Budapest Treaty, and was given accession number KCTC15006BP.
  • KCTC Korean Collection for Type Cultures
  • the CD03-7004 strain of the Schizochytrium genus produces and/or contains carotenoid antioxidant pigments with high antioxidant and anti-inflammatory effects, or has the ability to produce carotenoid antioxidant pigments.
  • the carotenoid-based antioxidant pigment may be beta-carotene or canthaxanthin, but is not limited thereto.
  • production capacity refers to an increase in the total amount of protein per unit population or unit dry weight of microalgae, an increase in the amount of polyunsaturated fatty acids, an increase in omega-3 unsaturated fatty acids, or docosahexaenoic acid.
  • C40 isoprenoid compounds that have antioxidant activity and exist in various colors such as yellow, red, and orange depending on the molecular structure.
  • Carotenoids are known to have an antioxidant effect that can prevent damage due to oxidation, an effect in preventing or treating diseases including cancer, and an effect in reducing skin damage from UV exposure or suppressing melanin production, so they are used as health foods and food colorants. , It is used in animal feed, etc.
  • Beta-carotene as used herein is one of the antioxidant pigments of the carotenoid series and is the precursor of almost all carotenoids. Beta-carotene is a yellow-colored precursor of vitamin A, which is converted to vitamin A in the body and has little coloring effect on egg yolk or skin. Beta-carotene is widely used as a food additive due to its antioxidant effect that can prevent damage caused by oxidation, high nutritional value, and unique color. It can also prevent adult diseases such as cancer, arteriosclerosis, arthritis, and cataracts caused by harmful oxygen. It can be useful as an anticancer agent, vascular disease agent, eye disease agent, and antioxidant related to skin aging.
  • Canthaxanthin herein is a type of carotenoid pigment produced by oxidation of beta-carotene, has an orange color, and is 4,4' diketo-beta-carotene (4,4'-diketo-beta- Also called carotene. Canthaxanthin is used in cosmetics and food colorants; Antioxidants (Palozza, P et al., Arch. Biochem. Biophys., 297, 291-295, 1992; Palozza, P et al., Arch. Biochem. Biophys., 325, 145-151, 1996); Anticancer drugs (Tanaka, T.
  • the Schizochytrium genus strains produce and/or contain a high content of omega-3 unsaturated fatty acids.
  • the omega-3 unsaturated fatty acid may be docosahexaenoic acid (DHA) or eicosapentaenoic acid (EPA), but is not limited thereto.
  • DHA docosahexaenoic acid
  • EPA eicosapentaenoic acid
  • DHA docosahexaenoic acid
  • ALA alpha-linolenic acid
  • EPA eicosapentaenoic acid
  • cervonic acid is one of the polyunsaturated fatty acids with the chemical formula C 22 H 32 O 2 , including alpha-linolenic acid (ALA) and Eicosahexaenoic acid. It is an omega-3 fatty acid along with eicosapentaenoic acid (EPA). Its common name is cervonic acid, and it can also be abbreviated as 22:6 n-3.
  • EPA eicosapentaenoic acid
  • EPA is one of the polyunsaturated fatty acids with the chemical formula of C 20 H 30 O 2 and corresponds to an omega-3 fatty acid along with ALA and DHA; It can also be abbreviated as 20:5 n-3.
  • the Schizochytrium genus strain may produce and/or contain 35 to 60% by weight of docosahexaenoic acid based on the total weight of fatty acids.
  • the strains of the Schizochytrium genus contain 35 to 60% by weight, 40 to 60% by weight, 42 to 60% by weight, 45 to 60% by weight, 49 to 60% by weight, and 35 to 55% by weight, based on the total weight of fatty acids.
  • the Schizochytrium genus strain may produce and/or contain 0.1 to 5% by weight of eicosapentaenoic acid based on the total weight of fatty acids.
  • the strains of the Schizochytrium genus contain 0.1 to 5% by weight, 0.5 to 5% by weight, 0.7 to 5% by weight, 1 to 5% by weight, 1.5 to 5% by weight, and 2 to 5% by weight based on the total weight of fatty acids.
  • % 0.1 to 3% by weight, 0.5 to 3% by weight, 1 to 3% by weight, 1.5 to 3% by weight, 2 to 3% by weight, 0.1 to 2.5% by weight, 0.5 to 2.5% by weight, 1 to 2.5% by weight, It may produce and/or contain 1.5 to 2.5 wt%, 1.7 to 2.5 wt%, 2 to 2.5 wt%, or 1.8 to 2.4 wt% of eicosapentaenoic acid.
  • the genomic DNA of the Schizochytrium genus CD03-7004 strain may include a sequence containing the base sequence of SEQ ID NO: 5 (tgcttgcttgctttt) twice in succession.
  • the genomic DNA of the Schizochytrium genus CD03-7004 strain is 15 nucleotides in the nucleotide sequence of SEQ ID NO. 2 of the wild-type Schizochytrium genus CD01-5000 strain (parent strain of the Schizochytrium genus CD03-7004 mutant strain). It may include a base sequence with added nucleotides, and the 15 nucleotides may be “tgcttgcttgcttttt (SEQ ID NO: 5).”
  • the base sequence of SEQ ID NO: 1 can be confirmed using a primer set, probe, etc., and specifically, can be confirmed using a primer set, and more specifically, a primer consisting of SEQ ID NO: 3 and a primer consisting of SEQ ID NO: 4. It can be confirmed using a primer set containing primers.
  • the CD03-7004 strain of the Schizochytrium genus can be confirmed (selected, selected) from the wild-type strain using a primer set including a primer consisting of SEQ ID NO: 3 and a primer consisting of SEQ ID NO: 4.
  • the Schizochytrium genus CD03-7004 strain is the genome of the parent strain, the wild-type CD01-5000 strain. It was confirmed that there was a part where 15 bp of nucleotides were added, and as a result of PCR using this primer set to amplify the DNA fragment containing the part, the parent strain, the wild type strain, and the Schizochytrium genus CD03-7004 strain. It was confirmed that it is possible to distinguish (confirm, screen, select).
  • This application provides a primer set for identifying (selecting) the CD03-7004 strain of the Schizochytrium genus.
  • the primer set may be a primer set including a primer consisting of SEQ ID NO: 3 and a primer consisting of SEQ ID NO: 4.
  • the base sequence amplified by the primer set may be the base sequence of SEQ ID NO: 1 and/or SEQ ID NO: 2.
  • the Schizochytrium genus CD03-7004 strain can be distinguished (confirmed, screened, selected) from the wild-type Schizochytrium genus CD01-5000 strain.
  • the present application provides biomass or bio-oil containing the Schizochytrium genus strain, a culture of the strain, a dried product of the culture, or a shredded product of the dried product.
  • the Schizochytrium genus strains are as described above.
  • biomass used in this specification refers to living organisms such as plants, animals, and microorganisms that can be used as chemical energy, that is, an energy source of bioenergy, and refers to a specific energy source that exists ecologically within unit time and space. It also refers to the weight or amount of energy of a living organism.
  • the biomass includes, but is not limited to, compounds secreted by cells, and may contain cells and/or intracellular contents as well as extracellular materials.
  • the biomass may be the Schizochytrium genus strain itself, its culture, its dried product, its lysate, or a product produced by cultivating or fermenting the strain, or may be a concentrate or dried product of the biomass. However, it is not limited to this.
  • the “culture” of the Schizochytrium genus strain refers to a product produced by culturing the strain, and may specifically be a culture medium containing the strain or a culture filtrate from which the strain has been removed from the culture medium, but is limited thereto. no.
  • the “dried product” of the culture of the Schizochytrium genus strain is one in which moisture has been removed from the culture of the strain, and may, for example, be in the form of dried cells of the strain, but is not limited thereto.
  • the “shredded material” of the dried product refers to a general term for the result of crushing the dried material from which moisture has been removed from the culture of the above-mentioned strain, and may be, for example, dried bacterial cell powder, but is not limited thereto.
  • the culture of the Schizochytrium genus strain can be prepared according to a culture method known in the art by inoculating the strain in a microalgae culture medium, and the dried product of the culture and its lysate can also be a strain known in the art or It can be prepared according to the treatment or drying method of the culture medium.
  • bio-oil refers to oil obtained from biomass through biological, thermochemical and physicochemical extraction processes, and the bio-oil produced in this application contains polyunsaturated fatty acids. It may contain DHA and EPA specifically, but is not limited thereto.
  • the bio-oil may include an extract of biomass.
  • a method of producing the bio-oil extract involves using enzymes such as protease, cellulase, pectinase, or chitinase, depending on the method of breaking or dissolving cell membrane or cell wall components, homogenizer, ultrasonic shredder, and bead treatment.
  • enzymes such as protease, cellulase, pectinase, or chitinase, depending on the method of breaking or dissolving cell membrane or cell wall components, homogenizer, ultrasonic shredder, and bead treatment.
  • Methods such as physically breaking the cell membrane or cell wall components, adding a solvent directly to extract it by permeating it into the cells, and solvent-free extraction processes that separate it through a centrifugation process after various disruption processes can be used. It is not limited.
  • the biomass derived from the Schizochytrium genus strain may contain carotenoid-based antioxidant pigments.
  • the biomass derived from the Schizochytrium genus strain is 10 mg/kg or more, 20 mg/kg or more, 30 mg/kg or more, 40 mg/kg or more, and 50 mg based on the total weight of biomass.
  • /kg or more 60 mg/kg or more, 70 mg/kg or more, 80 mg/kg or more, 90 mg/kg or more, 100 mg/kg or more, 110 mg/kg or more, 10 to 200 mg/kg, 30 to 200 mg/kg, 50 to 200 mg/kg, 70 to 200 mg/kg, 90 to 200 mg/kg, 100 to 200 mg/kg, 110 to 200 mg/kg, 10 to 150 mg/kg, 30 to 150 mg /kg, 50 to 150 mg/kg, 70 to 150 mg/kg, 90 to 150 mg/kg, 100 to 150 mg/kg, 110 to 150 mg/kg, 10 to 120 mg/kg, 30 to 120 mg/ kg, 50 to 120 mg/kg, 70 to 120 mg/kg, 90 to 120 mg/kg, 100 to 120 mg/kg, or 110 to 120 mg/kg of a carotenoid-based antioxidant pigment.
  • the carotenoid-based antioxidant pigment may be beta-carotene or canthaxanthin, but is not limited thereto.
  • the biomass derived from the Schizochytrium genus strain is 0.1 mg/kg or more, 0.5 mg/kg or more, 1 mg/kg or more, 1.5 mg/kg or more, and 2 mg based on the total weight of biomass.
  • /kg or more 2.5 mg/kg or more, 0.1 to 5 mg/kg, 0.5 to 5 mg/kg, 1 to 5 mg/kg, 1.5 to 5 mg/kg, 2 to 5 mg/kg, 2.5 to 5 mg/ kg, 0.1 to 4 mg/kg, 0.5 to 4 mg/kg, 1 to 4 mg/kg, 1.5 to 4 mg/kg, 2 to 4 mg/kg, 2.5 to 4 mg/kg, 0.1 to 3 mg/kg , 0.5 to 3 mg/kg, 1 to 3 mg/kg, 1.5 to 3 mg/kg, 2 to 3 mg/kg, or 2.5 to 3 mg/kg of beta-carotene.
  • the biomass derived from the Schizochytrium genus strain is 10 mg/kg or more, 20 mg/kg or more, 30 mg/kg or more, 40 mg/kg or more, and 50 mg based on the total weight of biomass.
  • /kg or more 60 mg/kg or more, 70 mg/kg or more, 80 mg/kg or more, 90 mg/kg or more, 100 mg/kg or more, 110 mg/kg or more, 10 to 200 mg/kg, 30 to 200 mg/kg, 50 to 200 mg/kg, 70 to 200 mg/kg, 90 to 200 mg/kg, 100 to 200 mg/kg, 110 to 200 mg/kg, 10 to 150 mg/kg, 30 to 150 mg /kg, 50 to 150 mg/kg, 70 to 150 mg/kg, 90 to 150 mg/kg, 100 to 150 mg/kg, 110 to 150 mg/kg, 10 to 120 mg/kg, 30 to 120 mg/ kg, 50 to 120 mg/kg, 70 to 120 mg/kg, 90 to 120 mg/kg, 100 to 120 mg/kg, or 110 to 120 mg/kg of canthaxanthin.
  • the biomass derived from the Schizochytrium genus strain may contain a high content of protein.
  • the biomass derived from the Schizochytrium genus strain is 60% by weight or more, 70% by weight or more, 75% by weight or more, 60 to 90% by weight, 65 to 90% by weight based on the total weight of biomass.
  • the biomass derived from the Schizochytrium genus strain may contain a high content of omega-3 unsaturated fatty acids.
  • the biomass derived from the Schizochytrium genus strain is 42% by weight, 45% by weight, 50% by weight, 52% by weight, 55% by weight, or 60% by weight based on the total weight of fatty acids. % or more, 65% or more, 70% or more, 42 to 70% by weight, 45 to 70% by weight, 50 to 70% by weight, 52 to 70% by weight, 55 to 70% by weight, 42 to 65% by weight, 45 to 65 wt%, 50 to 65 wt%, 52 to 65 wt%, 55 to 65 wt%, 42 to 60 wt%, 45 to 60 wt%, 50 to 60 wt%, 52 to 60 wt%, or 55 to It may contain 60% by weight of omega-3 unsaturated fatty acids.
  • the omega-3 unsaturated fatty acid may be docosahexaenoic acid (DHA) or eicosapentaenoic acid (EPA), but is not limited thereto.
  • DHA docosahexaenoic acid
  • EPA eicosapentaenoic acid
  • the biomass derived from the Schizochytrium genus strain is 5 to 60% by weight, 40 to 60% by weight, 42 to 60% by weight, 45 to 60% by weight, 49 to 60% by weight, based on the total weight of fatty acids.
  • the biomass derived from the Schizochytrium genus strain is 0.1 to 5% by weight, 0.5 to 5% by weight, 0.7 to 5% by weight, 1 to 5% by weight, 1.5 to 5% by weight, based on the total weight of fatty acids.
  • compositions comprising Schizochytrium sp. CD03-7004 strain, a culture of the strain, a dried product of the culture, and a shredded material of the dried product.
  • the composition may include the Schizochytrium genus strain, biomass derived from the strain, bio-oil derived from the strain, or a combination thereof.
  • the composition may be in the form of a solution, powder, or suspension, but is not limited thereto.
  • the composition may be, for example, a food composition, a feed composition, or a feed additive composition.
  • feed composition refers to the feed fed to animals.
  • the feed composition refers to a substance that supplies organic or inorganic nutrients necessary to maintain animal life or produce meat, milk, etc.
  • the feed composition may additionally contain nutrients necessary for maintaining animal life or producing meat, milk, etc.
  • the feed composition can be manufactured from various types of feed known in the art, and may specifically include concentrate feed, roughage feed, and/or special feed.
  • feed additive is added to feed for the purpose of various effects such as supplementing nutrients and preventing weight loss, improving digestibility of fiber in feed, improving milk quality, preventing reproductive disorders and improving conception rate, and preventing high temperature stress in the summer.
  • the feed additive of this application corresponds to supplementary feed under the Feed Management Act, and includes mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals, mineral preparations such as trace minerals such as zinc, copper, cobalt, and selenium, and kerotene.
  • Vitamins such as vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex, protective amino acids such as methionine and lysine, protective fatty acids such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture, and fungal fermentation. Probiotics such as water, yeast, etc. may be additionally included.
  • food composition includes all forms of functional food, nutritional supplements, health food, and food additives, and includes all forms of the above types. Food compositions can be manufactured in various forms according to conventional methods known in the art.
  • the food may be in a form containing the Schizochytrium sp. CD03-7004 strain, and may also be used as an additive to other foods.
  • foods to which the above substances can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, These include alcoholic beverages and vitamin complexes, and include all health foods in the conventional sense.
  • Compositions of the present application may include grains such as ground or ground wheat, oats, barley, corn and rice; Vegetable protein feeds, such as those based on soybean and sunflower; Animal protein feeds such as blood meal, meat meal, bone meal and fish meal; It may further include dry ingredients such as sugar and dairy products, such as various powdered milk and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, etc.
  • composition of the present application may be administered to animals alone or in combination with other feed additives in an edible carrier. Additionally, the composition can be easily administered to animals as a top dressing, by mixing them directly into feed, or in an oral formulation separate from feed. When the composition is administered separately from feed, it can be prepared as an immediate-release or sustained-release formulation by combining it with a pharmaceutically acceptable edible carrier, as is well known in the art.
  • a pharmaceutically acceptable edible carrier can be solid or liquid, such as corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil and propylene glycol.
  • a solid carrier the composition may be a tablet, capsule, powder, troche or sugar-containing tablet, or a top dressing in microdisperse form.
  • a liquid carrier the composition may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution.
  • composition of the present application may contain, for example, preservatives, stabilizers, wetting or emulsifying agents, cryoprotectants, or excipients.
  • cryoprotectant may be one or more selected from the group consisting of glycerol, trehalose, maltodextrin, skim milk powder, and starch.
  • the preservative, stabilizer, or excipient may be included in the composition in an effective amount sufficient to reduce deterioration of Schizochytrium strains included in the composition.
  • the cryoprotectant may be included in the composition in an effective amount sufficient to reduce the degradation of Schizochytrium strains included in the composition when the composition is in a dried state.
  • the composition can be used by injecting, spraying, or mixing it and adding it to animal feed.
  • compositions of the present application can be applied to the diet of a number of animals, including, but not limited to, mammals, birds, fish, crustaceans, cephalopods, reptiles and amphibians.
  • the mammals may include pigs, cows, sheep, goats, laboratory rodents, or pets, and the birds may include poultry, and the poultry may include chickens, turkeys, ducks, geese, It may include, but is not limited to, pheasant or quail.
  • the fish may include commercial farmed fish, their fry, ornamental fish, etc.
  • the crustaceans may include shrimp, barnacles, etc., but are not limited thereto.
  • the composition can also be applied to the diet of rotifers, which are zooplankton.
  • Another aspect of the present application provides an antioxidant composition comprising Schizochytrium sp. CD03-7004 strain, a culture of the strain, a dried product of the culture, and a shredded material of the dried product.
  • the antioxidant composition may include the Schizochytrium genus strain, biomass derived from the strain, bio-oil derived from the strain, or a combination thereof.
  • the Schizochytrium sp. CD03-7004 strain of the present invention produces and/or contains carotenoid antioxidant pigments with high antioxidant and anti-inflammatory effects, or has the ability to produce carotenoid antioxidant pigments, so it can be used as an antioxidant composition. It can be useful.
  • the antioxidant composition may be a pharmaceutical composition, food composition, feed composition, or feed additive composition.
  • the food composition may be a functional food composition.
  • the functional food of the present invention may additionally contain various auxiliary ingredients as needed.
  • vitamins such as vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B12, folic acid, vitamin C, vitamin D3, and vitamin E, as well as copper, calcium, and iron , minerals such as magnesium, potassium, and zinc, or lactic acid bacteria.
  • health drinks may contain various flavoring agents or natural carbohydrates as additional ingredients like ordinary drinks.
  • Flavoring agents include natural sweeteners such as thaumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame.
  • Natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • Another aspect of the present application includes culturing Schizochytrium sp. CD03-7004 strain; And it provides a method for producing biomass derived from microalgae of the Schizochytrium genus, comprising recovering biomass from the strain, the culture of the strain, the dried product of the culture, or the shredded product of the dried product.
  • the Schizochytrium genus strain, biomass, culture of the strain, dried product of the culture, and shredded material of the dried product are as described above.
  • culture means growing the strain under appropriately controlled environmental conditions.
  • the culture process of the present application can be carried out according to appropriate media and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art depending on the strain selected.
  • the cultivation of Schizochytrium genus strains of the present application may be performed under heterotrophic conditions, but is not limited thereto.
  • heterotrophic material used in this specification is a nutritional method that relies on organic matter obtained from outside the body as an energy or nutrient source, and is a term corresponding to autotrophy, and can be used interchangeably with the term 'cancer culture'.
  • the step of cultivating the Schizochytrium genus strain is not particularly limited thereto, but may be performed by known batch culture methods, continuous culture methods, fed-batch culture methods, etc.
  • the medium and other culture conditions used for cultivating the strain of the present application can be any medium used for cultivating conventional strains without any particular restrictions.
  • the strain of the present application can be cultured under aerobic conditions in a typical medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and/or vitamin, etc. while controlling temperature, pH, etc.
  • a basic compound e.g. sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound e.g. phosphoric acid or sulfuric acid
  • pH e.g. pH 5 to 9, specifically pH 6 to 8, most specifically can adjust pH 6.8
  • oxygen or oxygen-containing gas can be injected into the culture, or nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection or in order to maintain the anaerobic and microaerobic state. It is not limited.
  • the culture temperature can be maintained at 20 to 45°C or 25 to 40°C, and culture can be performed for about 10 to 160 hours, but is not limited thereto. Additionally, during culturing, foam generation may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester, but is not limited thereto.
  • an antifoaming agent such as fatty acid polyglycol ester, but is not limited thereto.
  • the carbon source contained in the medium used in the step of cultivating the Schizochytrium strain may be one or more selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose, and glycerol.
  • the carbon source used to cultivate microalgae is not limited thereto.
  • the nitrogen source contained in the medium used in the step of cultivating the Schizochytrium strain is i) at least one organic nitrogen source selected from the group consisting of yeast extract, beef extract, peptone, and tryptone. , or ii) it may be any one or more inorganic nitrogen sources selected from the group consisting of ammonium acetate, ammonium nitrate, ammonium chloride, ammonium sulfate, sodium nitrate, urea, and MSG (Monosodium glutamate), but is used for cultivating microalgae. If it is a nitrogen source, it is not limited thereto.
  • the medium used in the step of cultivating the Schizochytrium strain may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts individually or in combination as a phosphorus source, but is limited thereto. It doesn't work.
  • the step of recovering biomass from the strain, the culture of the strain, the dried product of the culture, or the shredded product of the dried product may be collecting the desired biomass using a suitable method known in the art. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC may be used, and may further include a purification process.
  • Another aspect of the present application includes culturing Schizochytrium sp. CD03-7004 strain; and recovering lipids from the strain, the culture of the strain, the dried product of the culture, or the crushed product of the dried product. It provides a method for producing bio-oil derived from a Schizochytrium strain.
  • the steps of cultivating the Schizochytrium genus strain, bio-oil, culture of the strain, dried product of the culture, and shredded material of the dried product, and the strain are as described above.
  • the step of recovering lipids from the strain, the culture of the strain, the dried product of the culture, or the lysate of the dried product may be collecting the lipid of interest using a suitable method known in the art. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC may be used, and may further include a purification process.
  • lipids and lipid derivatives such as fatty aldehydes, fatty alcohols and hydrocarbons (e.g. alkanes) can be extracted with hydrophobic solvents such as hexane.
  • Lipids and lipid derivatives can also be extracted using methods such as liquefaction, oil liquefaction and supercritical CO 2 extraction.
  • known microalgae lipid recovery methods include, for example, i) collecting cells by centrifugation, washing with distilled water, drying by freeze-drying, ii) pulverizing the obtained cell powder, and n- There is a method for extracting lipids with hexane (Miao, X and Wu, Q, Biosource Technology (2006) 97:841-846).
  • the antioxidant pigment may be beta-carotene or canthaxanthin, but is not limited thereto.
  • the Schizochytrium genus strain and the steps of cultivating the strain are as described above.
  • antioxidant pigments beta-carotene and canthaxanthin are as described above.
  • the antioxidant pigment can be extracted or separated and purified by conventional methods in the art.
  • Antioxidant pigments present in bacterial cells are organic solvents, such as hexane, acetone, chloroform, ethyl acetate, methyl alcohol, dichloromethane, and methyl alcohol. It can be extracted using cyclohexane, ethanol, benzene, carbon disulfide, diethyl ether, or a mixed solvent thereof.
  • the present invention is a novel Schizochytrium sp. strain that produces biomass containing high content of protein, antioxidant pigment, and omega-3 fatty acid, and contains high content of protein, antioxidant pigment, and omega-3 fatty acid using the same.
  • the novel Schizochytrium sp. strain of the present invention contains a high content of protein components including amino acids such as intracellular glutamic acid, arginine, and aspartic acid, beta-carotene, and cantha.
  • biomass that simultaneously contains the antioxidant pigment of xanthine and the omega-3 unsaturated fatty acid components of eicosapentaenoic acid and docosahexaenoic acid, so it is produced by the strain itself or by culturing and fermenting the strain.
  • the biomass and bio-oil can be usefully used as feed compositions or food compositions.
  • Figure 1 is a diagram showing the difference in color as a result of pure isolation and culture of the Schizochytrium sp. CD03-7004 mutant strain and the wild-type Schizochytrium sp. strain CD01-5000.
  • Figure 2 shows that after performing PCR using a primer set to amplify a DNA fragment containing 15 bp of base sequence added from the mutant CD03-7004 strain compared to the wild-type CD01-5000 strain, the wild-type CD01-5000 strain and the mutant CD03- This is a diagram confirming the size of the amplified DNA fragment of strain 7004.
  • the gamma ray irradiation experiment was conducted at the Advanced Radiation Research Institute of the Korea Atomic Energy Research Institute, and gamma ray doses of 2000 to 5000 GY were irradiated.
  • Gamma-irradiated microalgae culture samples undergo a recovery process during O/N in a dark room, then are spread on GYEP medium containing 20 g/L of agar, cultured at 30°C for about 5 days, and the number of growing colonies is counted. The death rate for each gamma dose was measured.
  • the appropriate dose was confirmed to reduce the number of growing colonies and the CFU value of viable bacteria by more than 95% according to the gamma irradiation dose.
  • gamma irradiation doses of 2.0, 3.0, 4.0, 4.5, and 5.0 kGY resulted in death of 0%, 90.8%, 98.2%, 100%, and 100%, respectively.
  • gamma ray dose conditions of 4.5 GY or more all microalgae colonies were killed and no microalgae colonies could be secured, and the gamma ray dose condition of 4.0 kGY, which showed a 98.2% death rate, was selected.
  • the new microalgae strain CD01-5000 was irradiated with gamma rays at a dose of 4.0 kGY and then cultured in GYEP medium. Colonies capable of growth were selected during culture and passaged under the same medium and culture environment conditions. Colonies that were morphologically red between passages were selected, isolated and cultured as a single cell line, and the results of photographing them are shown in Figure 1.
  • the strain of the Schizochytrium genus was named Schizochytrium sp. CD03-7004 strain, and was deposited at the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Bioscience and Biotechnology on June 20, 2022. It was given accession number KCTC15006BP.
  • Example 2-1 Culture of strain CD01-5000 and strain CD03-7004
  • each strain was inoculated into GYEP medium containing 50 ml working volume and 30 g/L of glucose in a 500 ml flask, and incubated at 30°C in a shaking incubator. , cultured at 180 rpm for about 20 hours.
  • the pre-culture was inoculated into a 30L fermenter containing medium under the same conditions and fermented and cultured in a total working volume of 20L.
  • Glucose equivalent to 20% of the working volume is continuously added under the conditions of 30°C, 500 rpm, 0.5-1 vvm, and pH 5-7 to be used for cell culture, and the glucose concentration at this time is at the level of 20 g/L. Injected to maintain.
  • the culture was terminated when all of the supplied carbon source, glucose, was consumed. After culturing, the culture medium was dried to a moisture content of about 5-8% using a freeze dryer, and the obtained dried cells were used for analysis of crude fat, crude protein, and carotenoid components.
  • Example 2-2 Crude fat and fatty acid content analysis of CD01-5000 and CD03-7004 strain cultures
  • Wild type Schizochytrium genus ( Schizochytrium sp.) CD01-5000 strain and the mutant Schizochytrium genus of the present invention ( Schizochytrium sp.) The following method was used to analyze the crude fat and fatty acid content of the CD03-7004 strain culture medium.
  • the weight of the dried oil was measured by subtracting the weight of the empty flask from the weight of the flask, and the total oil content was calculated.
  • the DHA content contained in the oil was measured by gas chromatography after pretreatment with methanolic 0.5N NaOH and 14% trifluoroborane methanol (BF3).
  • Biomass in Table 1 below refers to the concentration of bacterial cells in the culture medium and can be used interchangeably with DCW (dry cell weight).
  • C20:5 n-3 means Eicosapentaenoic acid (EPA), and C22:6 n-3 means Docosahexaenoic acid (DHA).
  • both the wild-type strain CD01-5000 and the mutant CD03-7004 strain digested the entire amount of glucose, the supplied carbon source, within about 30 hours, and produced a biomass of about 100 g/L. produced and showed similar biomass growth performance.
  • the crude fat content in biomass was lower at 14.4% compared to the CD01-5000 strain, but the eicosapentaenoic acid (EPA, C20:5 n-3) content was 2.1%, docosahexa Docosahexaenoic acid (DHA, C22:6 n-3) content was found to be 49.4%, which was significantly higher than that of the CD01-5000 strain. In other words, it was confirmed that the CD03-7004 strain contained a high content of omega-3 fatty acids of more than 50% in crude fat.
  • EPA eicosapentaenoic acid
  • DHA docosahexaenoic acid
  • the following method was used to analyze the crude protein and amino acid content of the wild-type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain culture medium of the present invention. .
  • Example 1-1 1 g of dried microalgae cells obtained in Example 1-1 were placed in an analysis tube using a Kjeldahl system (Kjeltec 2100), and 12-15 mL of 98% sulfuric acid and a catalyst were added and decomposed in a decomposer. , the digestion tube was mounted on an autosampler. In the Kjeldahl apparatus, the gaseous ammonia generated by heating and distilling with caustic soda and steam is cooled and collected, then titrated with a 0.1N hydrochloric acid solution to automatically calculate the nitrogen content, thereby calculating the crude protein of dry biomass of microalgae. The content was measured.
  • Kjeltec 2100 Kjeldahl system
  • Example 1-1 0.5 to 1 g of dried microalgae cells obtained in Example 1-1 were acid hydrolyzed with 6N HCl solution, and total amino acid analysis was performed using liquid chromatography. The analysis results of individual amino acids were normalized to the amount of dried microalgae cells used to calculate the content ratio of individual amino acids in the dried cells, and the content ratios of all amino acids detected as a result of the analysis were added to calculate the total amino acid content ratio in the cells.
  • the amount of amino acids in biomass means the amount (g) of each amino acid in biomass (kg) expressed as a ratio (%).
  • the crude protein content in the dried cells of the CD03-7004 mutant strain culture was 75.1%, which was significantly higher than the crude protein content of 59.7% in the dried cells of the wild-type CD01-5000 strain culture.
  • the amino acid content in the dried cells of the CD03-7004 mutant strain culture was confirmed to be glutamic acid, followed by phenylalanine, arginine, aspartic acid, and lysine.
  • the following method was used to analyze the antioxidant pigment content of the wild-type Schizochytrium sp. CD01-5000 strain and the mutant Schizochytrium sp. CD03-7004 strain culture of the present invention.
  • Example 1-1 an appropriate amount of dried microalgal cells obtained in Example 1-1 was weighed, extracted and concentrated with an extraction solution consisting of hexane, acetone, chloroform, and ethyl acetate to produce a high-performance liquid. It was analyzed by chromatography (high performance liquid chromatography; HPLC), and the results are shown in Table 4 below.
  • beta-carotene was not detected in the dried cells of the culture medium culturing the CD01-5000 strain of Schizochytrium sp., and the canthaxanthin content was 6.22 mg/kg, while Schizochytrium sp.
  • the beta-carotene content was 2.77 mg/kg and the canthaxanthin content was 112.09 mg/kg, showing that the Schizochytrium sp. of the present invention was It was confirmed that the CD03-7004 mutant strain produces high levels of antioxidant pigments such as beta-carotene and canthaxanthin.
  • mutant CD03-7004 strain was confirmed to have an added portion of 15 base pairs (bold portion in the sequence of SEQ ID NO: 1 below) when compared to the genome of the wild-type CD01-5000 strain.
  • Primer A 5'-TTTCAGACTGCTTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTTCT-3' (SEQ ID NO: 4) to amplify this part were selected, and a PCR amplification reaction was performed using these.
  • the PCR reaction was performed using a reaction solution containing taq polymerase, followed by denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and polymerization at 72°C for 15 seconds, repeated 35 times, followed by 5 minutes at 72°C.
  • a polymerization reaction was performed.
  • the reaction solution amplified through the PCR process was subjected to electrophoresis on a 1.7% agarose gel to confirm the size of the amplified DNA, and is shown in Figure 2.
  • the DNA fragment amplified from the mutant CD03-7004 strain was approximately 140 bp in size, confirming that it was different from the wild-type CD01-5000 strain in which a DNA fragment of approximately 120 bp was amplified. .
  • primer A 5'-TTTCAGACTGCTTTTTTGCTTTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTTCT-3' (SEQ ID NO: 4) can be used to select the mutant CD03-7004 strain. You can see that there is.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Molecular Biology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Husbandry (AREA)
  • Physiology (AREA)
  • Nutrition Science (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Botany (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 고함량의 단백질, 항산화 색소 및 오메가3 지방산을 포함하는 신규한 스키조키트리움 속(Schizochytrium sp.) 균주 및 이를 이용한 고함량의 단백질, 항산화 색소 및 오메가3 지방산을 함유하는 바이오매스 생산방법에 관한 것으로, 본 발명의 신규한 스키조키트리움 속(Schizochytrium sp.) 균주는 세포 내 글루탐산, 알지닌 및 아스파르트산 등의 아미노산을 포함하는 고함량의 단백질 성분, 베타카로틴 및 칸타산틴의 항산화 색소, 및 에이코사펜타엔산와 도코사헥사엔산을 포함하는 오메가-3 불포화지방산 성분을 동시에 포함하는 특성을 가지므로, 균주 그 자체 또는 균주의 배양 및 발효에 의해 생산된 바이오매스 및 바이오오일은 사료용 조성물 또는 식품용 조성물 등으로 유용하게 활용될 수 있다.

Description

고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도
관련 출원(들)과의 상호 인용
본 출원은 2022년 8월 18일자 한국 특허 출원 제10-2022-0103398호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌들에 개시된 모든 내용은 본 명세서의 일부로서 포함된다.
본 발명은 고함량의 단백질, 항산화 색소 및 오메가3 지방산을 포함하는 바이오매스를 생산하는 신규한 스키조키트리움 속 (Schizochytrium sp.) 균주 및 이를 이용한 고함량의 단백질, 항산화 색소 및 오메가3 지방산을 함유하는 바이오매스 생산방법에 관한 것이다.
생물이 생명을 유지하고 성장, 발육하기 위해서는 외부에서 여러 가지 영양 물질을 체내로 섭취하여 이용해야 한다. 영양물질은 열량에 주로 이용되는 당류, 지질 성분의 열량소와 단백질, 무기질의 구성 영양소 그리고 비타민 등의 조절 영양소로 크게 분류할 수 있다. 이 중, 단백질 성분은 생물체 내의 구성 성분, 세포 안의 각종 화학반응의 효소로서의 촉매 역할, 항체를 형성하여 면역을 담당하는 등의 여러 가지 중요한 역할을 수행함으로 특히 체내에의 공급과 소비가 중요하다.
영양학적으로 품질이 우수한 동물성 단백원이 가장 큰 시장을 형성하며 소비되어 왔지만, 최근 인구 증가와 온실 가스 저감 등의 환경적인 이슈 대응 및 동물 복지 증진 등의 전세계적인 사회적 변화에 발맞추어 식물성 단백원이 많은 주목을 받고 있다. 식물성 단백질 공급원으로 가장 잘 알려진 것은 대두로서, 그 자체로서의 식품 단백질로 활용되거나 식품용 오일을 추출하고 남은 잔류물인 대두박을 동물 사료로서 활용하고 있다. 그러나 대두 단백질의 수요가 증가함에 따라 대두 집중 경작에 따른 생물 다양성의 부족 및 이에 따른 다른 식물에의 피해 발생, 유전적 변형(GMO) 종자의 확대에 따른 이슈 등으로부터 자유롭지 못하다. 또한 사료로서의 활용 시에 탄수화물 조성 비율이 높아 소화율이 낮고, 피틴산(Phytic acid)의 함유량이 높아 단백질 흡수 저하 및 미네랄 이용성의 저하 등의 문제가 있다. 또한 대두 경작 시 활용되는 잔류 농약 성분과 기타 곰팡이 등의 유해 미생물 오염 이슈가 여전히 존재한다.
이에 대한 대안으로서, 식물성 플랑크톤인 미세조류를 활용한 SCP(Single Cell Protein) 형태의 단백질이 주목을 받고 있다. 특히 스피룰리나 및 클로렐라가 잘 알려져 있다. 필수 아미노산을 포함한 다양한 아미노산 조성의 단백질 성분을 함유하여 영양학적으로 우수하지만, 클로로필 성분 유래의 특유의 취(臭)와 맛에 대한 비기호성과 광합성을 통한 배양 및 생산 방식으로 공급가가 높아진다는 단점이 있다.
본 연구에서는 이러한 기존의 식물성 단백원의 단점을 보완할 수 있는 새로운 소재를 제시하고자, 해양 미세조류인 스키조키트리움 속(Schizochytrium sp.) 균주 유래의 식물성 단백원을 개발하고자 하였다. 스키조키트리움 속 (Schizochytrium sp.) 균주는 해양 미세조류로, 체내에 클로로필이 없으며, 종래의 종속발효 방식으로 발효조에서 배양이 가능하다. 이를 통해, 잔류 농약 및 기타 오염원 이슈로부터 자유로우며, 일정한 품질의 제품으로 대량 생산이 가능하다. 또한 세포 내 DHA 와 EPA 를 포함한 오메가 3 성분의 불포화 지방산을 함유할 수 있다는 장점이 있어, 기존 대두박 또는 기타 미생물 유래의 SCP 와 달리 필수지방산을 추가로 공급할 수 있다는 장점이 있다. 또한, 세포벽이 없이 단백질을 주성분으로 하는 세포막을 가지는 특징으로 체내 소화율 역시 높은 장점을 지닌다.
이러한 장점을 바탕으로, 최근 미세조류를 이용한 도코사헥사엔산(Docosahexaenoic acid, DHA), 에이코사펜타엔산 (Eicosapentaenoic acid, EPA), 아라키돈산(Arachidonic acid, ARA), 도코사펜타엔산 (Docosapentaenoic acid, DPA), 및 α-리놀렌산 등과 같은 오메가-3 불포화 지방산(Omega-3 unsaturated fatty acid)을 포함하는 다중불포화 지방산 생산에 관한 연구 및 산업화가 매우 빠르게 진행되고 있다. 일 예로, 미국 특허 제5,130,242호는 스키조키트리움 속 미생물인 스키조키트리움 sp. ATCC20888 (Schizochytrium sp. ATCC20888) 및 스키조키트리움 sp. PTA10208 (Schizochytrium sp. PTA10208)를 이용하여 오메가-3 다중불포화지방산을 제조하는 방법을 개시하고 있다.
본 발명은 고함량의 단백질과 오메가3 지방산 외에 항산화 색소를 동시에 포함 및/또는 이를 생산하는 신규한 스키조키트리움 속의 돌연변이 균주를 제공하여 이를 통한 새로운 식물성 단백질 소재로서의 대량 생산 가능성을 제시한다.
본 출원의 일 예는 신규한 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주(기탁번호 KCTC15006BP)를 제공한다.
본 출원의 다른 예는 상기 스키조키트리움 속 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 바이오매스를 제공한다.
본 출원의 다른 예는 상기 스키조키트리움 속 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 사료용 조성물을 제공한다.
본 출원의 다른 예는 상기 스키조키트리움 속 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 식품용 조성물을 제공한다.
본 출원의 다른 예는 상기 스키조키트리움 속 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 항산화용 조성물을 제공한다.
본 출원의 다른 예는 상기 스키조키트리움 속 균주를 배양하는 단계; 및
상기 균주의 배양물로부터 카로티노이드 계열의 항산화 색소를 추출하는 단계; 를 포함하는 항산화 색소 생산 방법을 제공한다.
본 출원에서 개시되는 각각의 설명 및 실시 형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 일 예는 미세조류인 신규한 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주(기탁번호 KCTC15006BP)를 제공한다.
본 명세서에서 사용되는 용어, "트라우스토키트리드(Thraustochytrid)"는 트라우스토키트리알레스(Thraustochytriales) 목의 미세조류를 의미한다. 또한, 본 명세서에서 사용되는 용어, "스키조키트리움 속(Schizochytrium sp.)"은 트라우스토키트리알레스 목의 트라우스토키트리아세애(Thraustochytriaceae) 과에 속하는 속명 중 하나로, 용어 "스키조키트리움 속(genus Schizochytrium)"과 혼용될 수 있다. 또한, 상기 용어 "미세조류(microalgae)"는 본 명세서에서“균주”와 혼용될 수 있고, 육안으로 볼 수 없어 현미경을 통해서만 볼 수 있는 수준의 작은 조류이며, 물 속에서 자유로이 부유하여 살아가는 생물을 의미한다. 상기 미세조류에는 다양한 종류가 있으며, 광합성이 불가능하여 종속영양으로만 생장하는 균주까지 포함한다.
본 출원에서는 일 예로, 야생형 스키조키트리움 속 CD01-5000 균주에 감마선을 조사하여 돌연변이를 발생시키고, 상기 돌연변이 균주 중 항산화 색소 생산능이 있는 균주를 선별하여, 이를 스키조키트리움 속(Schizochytrium sp.) CD03-7004로 명명하였고, 2022년 6월 20일자로 부다페스트 조약 하의 국제 기탁 기관인 한국생명공학연구원 생물자원센터(Korean Collection for Type Cultures: KCTC)에 기탁하여 수탁번호 KCTC15006BP를 부여받았다.
상기 스키조키트리움 속 CD03-7004 균주는 높은 항산화, 항염 등의 효능을 가진 카로티노이드 계열 항산화 색소를 생산 및/또는 포함하거나, 카로티노이드 계열 항산화 색소 생산능을 가진다.
상기 카로티노이드 계열의 항산화 색소는 베타카로틴(Beta-carotene) 또는 칸타잔틴(Canthaxanthin)일 수 있으나, 이에 제한되지 않는다.
본 명세서에서 사용되는, “생산능”이란 미세조류 단위 개체수 또는 단위 건조 중량 당 총 단백질 양 증가, 다가불포화지방산의 양의 증가, 오메가-3 불포화 지방산의 증가, 또는 도코사헥사엔산 (docosahexaenoic acid: DHA) 및 에이코사펜타엔산 (eicosapentaenoic acid: EPA) 양의 증가 또는 생산된 지방산 중 다가불포화 지방산의 상대적 비율 증가, 생산된 총 지방산 또는 다가불포화지방산 중 오메가-3 불포화 지방산의 상대적 비율 증가, 또는 도코사헥사엔산 및 에이코사펜타엔산 양의 상대적 비율 증가; 또는 미세조류 단위 개체수 또는 단위 건조 또는 습 중량 당 총 바이오매스 양 증가, 또는 미세조류 단위 개체수 또는 단위 건조 중량 당 총 카로티노이드 계열의 항산화 색소 양 증가, 베타카로틴 및 칸타잔틴의 양의 증가, 또는 생산된 카로티노이드 계열의 항산화 색소 중 베타카로틴 및 칸타잔틴의 상대적 비율 증가를 포함한다. 상술한 것 중 어느 하나라도 목적하는 유용 물질의 생산 증가로 이어질 수 있으며, 예를 들면 상대적 비율이 증가하는 경우에는 목적하는 유용 물질 증가는 물론, 농도가 높아지게 되어, 분리가 용이해질 수 있다.
본 명세서에서 사용되는 용어, “카로티노이드(carotenoid)”는 항산화 활성을 가지고 있는 C40 이소프레노이드 화합물(isoprenoid compounds)로서, 분자 구조에 따라 노란색, 적색, 주황색 등 여러 색으로 존재한다. 카로티노이드는 산화로 인한 손상을 방지할 수 있는 항산화 효과, 암을 포함한 질환을 예방 또는 치료하는 효과 및 자외선 노출로부터 피부의 손상을 줄여 주거나 멜라닌 생성을 억제하는 효과가 있음이 알려져 있어 건강식품, 식품 착색제, 동물용 사료 등에 사용되고 있다.
본 명세서의 “베타카로틴(beta-carotene)”은 카로티노이드 계열의 항산화 색소 중 하나로, 거의 모든 카로티노이드들의 전구체이다. 베타카로틴은 황색을 띠는 비타민 A의 전구물질로서 체내에서 비타민 A로 전환되며 난황이나 피부의 착색 효과가 적다. 베타카로틴은 산화로 인한 손상을 방지할 수 있는 항산화 효과, 높은 영양가 및 특유의 색으로 인해 식품 첨가제로 널리 사용되고 있을 뿐만 아니라 유해 산소로 인한 암, 동맥경화증, 관절염, 백내장 등과 같은 성인병을 예방할 수 있어 항암제, 혈관 질환제, 안구 질환제 및 피부 노화와 관련된 산화 방지제 등으로 유용하게 사용될 수 있다.
본 명세서의 “칸타잔틴(Canthaxanthin)”은 베타카로틴의 산화로 생성되는 카로티노이드 색소의 한 종류로, 오렌지색을 가지며, 4,4' 디케토-베타-카로틴(4,4'-diketo-beta-carotene)으로도 불린다. 칸타잔틴은 화장품 및 식품 착색제; 항산화제(Palozza, P et al., Arch. Biochem. Biophys., 297, 291-295, 1992; Palozza, P et al., Arch. Biochem. Biophys., 325, 145-151, 1996); 항암제(Tanaka, T. et al., Cancer Res., 55, 4059-4064, 1995; Tanaka, T. et al., Carcinogenesis, 16, 2957-2963, 1995; Grubbs, C. J. et al., 48, 239-245, 1991; Katsumura, N. et al., Nutr. Cancer, 26, 203-208, 1996) 등으로 사용되고 있다.
상기 스키조키트리움 속 균주는 고함량의 오메가-3 불포화 지방산을 생산 및/또는 포함한다.
상기 오메가-3 불포화 지방산은 도코사헥사엔산(Docosahexaenoic acid: DHA) 또는 에이코사펜타엔산(eicosapentaenoic acid: EPA)일 수 있으나, 이에 제한되지 않는다.
본 명세서에서 사용되는 용어, "도코사헥사엔산(docosahexaenoic acid: DHA)"은 C22H32O2의 화학식을 갖는 다중불포화지방산 중 하나로, 알파-리놀렌산(α-linolenic acid: ALA) 및 에이코사펜타엔산(eicosapentaenoic acid: EPA)과 함께 오메가-3 지방산에 해당하며, 관용명은 세르본산(cervonic acid)이고, 약칭으로 22:6 n-3으로도 표기될 수 있다.
본 명세서에서 사용되는 용어, "에이코사펜타엔산(eicosapentaenoic acid: EPA)"은 C20H30O2의 화학식을 갖는 다중불포화지방산 중 하나로, ALA 및 DHA와 함께 오메가-3 지방산에 해당하며, 약칭으로 20:5 n-3으로도 표기될 수 있다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주는 지방산 총 중량을 기준으로 35 내지 60 중량%의 도코사헥사엔산을 생산 및/또는 포함하는 것일 수 있다. 구체적으로, 상기 스키조키트리움 속 균주는 지방산 총 중량을 기준으로 35 내지 60 중량%, 40 내지 60 중량%, 42 내지 60 중량%, 45 내지 60 중량%, 49 내지 60 중량%, 35 내지 55 중량%, 40 내지 55 중량%, 42 내지 55 중량%, 45 내지 55 중량%, 35 내지 50 중량%, 40 내지 50 중량%, 42 내지 50 중량%, 45 내지 50 중량%, 또는 48 내지 52 중량%의 도코사헥사엔산을 생산 및/또는 포함하는 것일 수 있다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주는 지방산 총 중량을 기준으로 0.1 내지 5 중량%의 에이코사펜타엔산을 생산 및/또는 포함하는 것일 수 있다. 구체적으로, 상기 스키조키트리움 속 균주는 지방산 총 중량을 기준으로 0.1 내지 5 중량%, 0.5 내지 5 중량%, 0.7 내지 5 중량%, 1 내지 5 중량%, 1.5 내지 5 중량%, 2 내지 5 중량%, 0.1 내지 3 중량%, 0.5 내지 3 중량%, 1 내지 3 중량%, 1.5 내지 3 중량%, 2 내지 3 중량%, 0.1 내지 2.5 중량%, 0.5 내지 2.5 중량%, 1 내지 2.5 중량%, 1.5 내지 2.5 중량%, 1.7 내지 2.5 중량%, 2 내지 2.5 중량%, 또는 1.8 내지 2.4 중량%의 에이코사펜타엔산을 생산 및/또는 포함하는 것일 수 있다.
상기 스키조키트리움 속 CD03-7004 균주의 유전체(genomic) DNA는 서열번호 5 (tgcttgcttgctttt)의 염기서열을 연속적으로 두번 포함하는 서열을 포함하는 것일 수 있다.
상기 스키조키트리움 속 CD03-7004 균주의 유전체(genomic) DNA는 야생형인 스키조키트리움 속 CD01-5000 균주(스키조키트리움 속 CD03-7004 변이 균주의 모균주)의 서열번호 2의 염기서열에서 15개의 뉴클레오티드가 추가된 염기서열을 포함하는 것일 수 있고, 상기 15개의 뉴클레오티드는 “tgcttgcttgctttt(서열번호 5)”일 수 있다.
본 명세서에 있어서, 서열번호 1의 염기서열은 프라이머 세트, 프로브 등을 이용하여 확인할 수 있고, 구체적으로, 프라이머 세트로 확인할 수 있으며, 보다 구체적으로, 서열번호 3로 이루어진 프라이머 및 서열번호 4로 이루어진 프라이머를 포함하는 프라이머 세트를 이용하여 확인할 수 있다.
상기 스키조키트리움 속 CD03-7004 균주는 서열번호 3으로 이루어진 프라이머 및 서열번호 4로 이루어진 프라이머를 포함하는 프라이머 세트를 이용하여 야생형 균주로부터 확인(선별, 선택)할 수 있다.
본 발명의 일 구체예에서, 본 발명의 신규한 스키조키트리움 속 돌연변이 균주와 야생형 균주의 전체 유전체 서열을 비교한 결과, 스키조키트리움 속 CD03-7004 균주는 모균주인 야생형 CD01-5000 균주의 유전체에서 15 bp의 뉴클레오티드가 추가된 부분이 있음을 확인하였고, 이를 이용하여 해당 부분을 포함하는 DNA 단편을 증폭할 수 있는 프라이머 세트로 PCR 결과, 모균주인 야생형 균주와 스키조키트리움 속 CD03-7004 균주를 구별(확인, 선별, 선택)할 수 있음을 확인하였다.
본 출원은 스키조키트리움 속 CD03-7004 균주를 확인(선별)하기 위한 프라이머 세트를 제공한다.
상기 프라이머 세트는 서열번호 3으로 이루어진 프라이머 및 서열번호 4로 이루어진 프라이머를 포함하는 프라이머 세트일 수 있다.
상기 프라이머 세트가 증폭하는 염기서열은 서열번호 1 및/또는 서열번호 2의 염기서열인 것일 수 있다.
상기 프라이머 세트를 이용하여 증폭된 DNA 단편의 크기를 비교하여 스키조키트리움 속 CD03-7004 균주를 야생형 스키조키트리움 속 CD01-5000 균주로부터 구별(확인, 선별, 선택)할 수 있다.
또한, 본 출원은 상기 스키조키트리움 속 균주, 상기 균주의 배양물, 상기 배양물의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 바이오매스 또는 바이오오일을 제공한다.
상기 스키조키트리움 속 균주는 상술한 바와 같다.
본 명세서에서 사용되는 용어, "바이오매스(biomass)"는 화학적 에너지로 사용 가능한 식물, 동물, 미생물 등의 생물체, 즉 바이오에너지의 에너지원을 의미하며, 생태학적으로 단위 시간 및 공간 내에 존재하는 특정 생물체의 중량 또는 에너지량을 의미하기도 한다. 또한, 상기 바이오매스는 세포에 의해 분비되는 화합물을 포함하지만 이에 제한되지 않고, 세포 외 물질뿐만 아니라 세포 및/또는 세포 내 내용물을 함유하는 것일 수 있다. 본 출원에서 상기 바이오매스는 스키조키트리움 속 균주 그 자체, 이의 배양물, 이의 건조물, 이의 파쇄물, 또는 상기 균주를 배양하거나 발효하여 생산된 산물일 수 있으며, 또는 상기 바이오매스의 농축물 또는 건조물일 수 있으나, 이에 제한되는 것은 아니다.
상기 스키조키트리움 속 균주의 "배양물"은 상기 균주를 배양하여 생성된 산물을 지칭하는 것으로, 구체적으로 균주를 포함하는 배양액 또는 상기 배양액에서 균주가 제거된 배양여액일 수 있으나, 이에 제한되는 것은 아니다. 상기 스키조키트리움 속 균주 배양물의 "건조물"은 상기 균주의 배양물에서 수분이 제거된 것으로, 예를 들어 상기 균주의 건조 균체 형태일 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 건조물의 "파쇄물"은 상기 균주의 배양물에서 수분이 제거된 건조물을 파쇄한 결과물을 총칭하는 것으로, 예를 들어 건조 균체 분말일 수 있으나, 이에 제한되는 것은 아니다. 상기 스키조키트리움 속 균주의 배양물은 미세조류 배양 배지에 상기 균주를 접종하고, 당업계에 공지된 배양 방법에 따라 제조될 수 있고, 상기 배양물의 건조물 및 이의 파쇄물 역시 당업계에 공지된 균주 또는 배양액의 처리 또는 건조 방법에 따라 제조될 수 있다.
본 명세서에서 사용되는 용어, "바이오오일(bio-oil)"은 생물학적, 열화학 그리고 물리화학 추출공정에 의해 바이오매스로부터 얻어지는 오일을 의미하며, 본 출원에서 제조된 바이오오일은 다중불포화지방산을 함유하는 것일 수 있고, 구체적으로 DHA 및 EPA를 함유하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서, 상기 바이오오일은 바이오매스의 추출물을 포함하는 것일 수 있다.
상기 바이오오일 추출물을 제조하는 방법으로, 세포막 또는 세포벽 성분을 파쇄 또는 용해시키는 방법에 따라 프로테아제, 셀룰라아제, 펙티나아제 또는 키티나아제 등의 효소를 활용하는 방법, 호모게나이저, 초음파 분쇄기, 비드 처리 등을 이용하여 물리적으로 세포막 또는 세포벽 성분을 파쇄하는 방법, 용매를 직접 첨가하여 세포 내 투과하여 추출하는 방법, 다양한 파쇄 공정 후에 원심분리 과정을 통해 분리하는 무용매 추출 공정 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.
상기 스키조키트리움 속 균주 유래 바이오매스는 카로티노이드 계열 항산화 색소를 포함하는 것일 수 있다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주 유래 바이오매스는 바이오매스 총 중량을 기준으로 10 mg/kg 이상, 20 mg/kg 이상, 30 mg/kg 이상, 40 mg/kg 이상, 50 mg/kg 이상, 60 mg/kg 이상, 70 mg/kg 이상, 80 mg/kg 이상, 90 mg/kg 이상, 100 mg/kg 이상, 110 mg/kg 이상, 10 내지 200 mg/kg, 30 내지 200 mg/kg, 50 내지 200 mg/kg, 70 내지 200 mg/kg, 90 내지 200 mg/kg, 100 내지 200 mg/kg, 110 내지 200 mg/kg, 10 내지 150 mg/kg, 30 내지 150 mg/kg, 50 내지 150 mg/kg, 70 내지 150 mg/kg, 90 내지 150 mg/kg, 100 내지 150 mg/kg, 110 내지 150 mg/kg, 10 내지 120 mg/kg, 30 내지 120 mg/kg, 50 내지 120 mg/kg, 70 내지 120 mg/kg, 90 내지 120 mg/kg, 100 내지 120 mg/kg, 또는 110 내지 120 mg/kg의 카로티노이드 계열 항산화 색소를 포함하는 것일 수 있다.
상기 카로티노이드 계열의 항산화 색소는 베타카로틴(Beta-carotene) 또는 칸타잔틴(Canthaxanthin)일 수 있으나, 이에 제한되지 않는다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주 유래 바이오매스는 바이오매스 총 중량을 기준으로 0.1 mg/kg 이상, 0.5 mg/kg 이상, 1 mg/kg 이상, 1.5 mg/kg 이상, 2 mg/kg 이상, 2.5 mg/kg 이상, 0.1 내지 5 mg/kg, 0.5 내지 5 mg/kg, 1 내지 5 mg/kg, 1.5 내지 5 mg/kg, 2 내지 5 mg/kg, 2.5 내지 5 mg/kg, 0.1 내지 4 mg/kg, 0.5 내지 4 mg/kg, 1 내지 4 mg/kg, 1.5 내지 4 mg/kg, 2 내지 4 mg/kg, 2.5 내지 4 mg/kg, 0.1 내지 3 mg/kg, 0.5 내지 3 mg/kg, 1 내지 3 mg/kg, 1.5 내지 3 mg/kg, 2 내지 3 mg/kg, 또는 2.5 내지 3 mg/kg의 베타카로틴을 포함하는 것일 수 있다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주 유래 바이오매스는 바이오매스 총 중량을 기준으로 10 mg/kg 이상, 20 mg/kg 이상, 30 mg/kg 이상, 40 mg/kg 이상, 50 mg/kg 이상, 60 mg/kg 이상, 70 mg/kg 이상, 80 mg/kg 이상, 90 mg/kg 이상, 100 mg/kg 이상, 110 mg/kg 이상, 10 내지 200 mg/kg, 30 내지 200 mg/kg, 50 내지 200 mg/kg, 70 내지 200 mg/kg, 90 내지 200 mg/kg, 100 내지 200 mg/kg, 110 내지 200 mg/kg, 10 내지 150 mg/kg, 30 내지 150 mg/kg, 50 내지 150 mg/kg, 70 내지 150 mg/kg, 90 내지 150 mg/kg, 100 내지 150 mg/kg, 110 내지 150 mg/kg, 10 내지 120 mg/kg, 30 내지 120 mg/kg, 50 내지 120 mg/kg, 70 내지 120 mg/kg, 90 내지 120 mg/kg, 100 내지 120 mg/kg, 또는 110 내지 120 mg/kg의 칸타잔틴을 포함하는 것일 수 있다.
상기 스키조키트리움 속 균주 유래 바이오매스는 고함량의 단백질을 포함하는 것일 수 있다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주 유래 바이오매스는 바이오매스 총 중량을 기준으로 60 중량% 이상, 70 중량% 이상, 75 중량% 이상, 60 내지 90 중량%, 65 내지 90 중량%, 70 내지 90 중량%, 75 내지 90 중량%, 60 내지 85 중량%, 65 내지 85 중량%, 70 내지 85 중량%, 75 내지 85 중량%, 60 내지 80 중량%, 65 내지 80 중량%, 70 내지 80 중량%, 또는 75 내지 80 중량%의 조단백을 포함하는 것일 수 있다.
상기 스키조키트리움 속 균주 유래 바이오매스는 고함량의 오메가-3 불포화 지방산을 포함하는 것일 수 있다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주 유래 바이오매스는 지방산 총 중량을 기준으로 42 중량% 이상, 45 중량% 이상, 50 중량% 이상, 52 중량% 이상, 55 중량% 이상, 60 중량% 이상, 65 중량% 이상, 70 중량% 이상, 42 내지 70 중량%, 45 내지 70 중량%, 50 내지 70 중량%, 52 내지 70 중량%, 55 내지 70 중량%, 42 내지 65 중량%, 45 내지 65 중량%, 50 내지 65 중량%, 52 내지 65 중량%, 55 내지 65 중량%, 42 내지 60 중량%, 45 내지 60 중량%, 50 내지 60 중량%, 52 내지 60 중량%, 또는 55 내지 60 중량%의 오메가-3 불포화 지방산을 포함하는 것일 수 있다.
상기 오메가-3 불포화 지방산은 도코사헥사엔산(Docosahexaenoic acid: DHA) 또는 에이코사펜타엔산(eicosapentaenoic acid: EPA)일 수 있으나, 이에 제한되지 않는다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주 유래 바이오매스는 지방산 총 중량을 기준으로 5 내지 60 중량%, 40 내지 60 중량%, 42 내지 60 중량%, 45 내지 60 중량%, 49 내지 60 중량%, 35 내지 55 중량%, 40 내지 55 중량%, 42 내지 55 중량%, 45 내지 55 중량%, 35 내지 50 중량%, 40 내지 50 중량%, 42 내지 50 중량%, 45 내지 50 중량%, 또는 48 내지 52 중량%의 도코사헥사엔산을 포함하는 것일 수 있다.
본 출원의 일 예에서, 상기 스키조키트리움 속 균주 유래 바이오매스는 지방산 총 중량을 기준으로 0.1 내지 5 중량%, 0.5 내지 5 중량%, 0.7 내지 5 중량%, 1 내지 5 중량%, 1.5 내지 5 중량%, 2 내지 5 중량%, 0.1 내지 3 중량%, 0.5 내지 3 중량%, 1 내지 3 중량%, 1.5 내지 3 중량%, 2 내지 3 중량%, 0.1 내지 2.5 중량%, 0.5 내지 2.5 중량%, 1 내지 2.5 중량%, 1.5 내지 2.5 중량%, 1.7 내지 2.5 중량%, 2 내지 2.5 중량%, 또는 1.8 내지 2.4 중량%의 에이코사펜타엔산을 포함하는 것일 수 있다.
본 출원의 다른 하나의 양태는 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주, 상기 균주의 배양물, 상기 배양물의 건조물, 상기 건조물의 파쇄물을 포함하는 조성물을 제공한다.
상기 조성물은 상기 스키조키트리움 속 균주, 상기 균주 유래 바이오매스, 상기 균주 유래 바이오오일, 또는 이들의 조합을 포함하는 것일 수 있다.
상기 조성물은 용액, 분말, 또는 현탁액 형태일 수 있으나, 이에 제한되는 것은 아니다. 상기 조성물은 예를 들어, 식품용 조성물, 사료용 조성물 또는 사료 첨가제 조성물일 수 있다.
본 명세서에서 사용되는 용어, "사료 조성물"은 동물에게 급여되는 먹이를 지칭한다. 상기 사료 조성물은 동물의 생명을 유지, 또는 고기, 젖 등을 생산하는데 필요한 유기 또는 무기 영양소를 공급하는 물질을 말한다. 상기 사료 조성물은 동물의 생명 유지, 또는 고기, 젖 등을 생산하는 필요한 영양성분을 추가적으로 포함할 수 있다. 상기 사료 조성물은 당업계의 공지된 다양한 형태의 사료로 제조 가능하며, 구체적으로는 농후사료, 조사료 및/또는 특수사료가 포함될 수 있다.
본 명세서에서 사용되는 용어, "사료 첨가제"는 영양소 보충 및 체중감소 예방, 사료 내 섬유소의 소화 이용성 증진, 유질 개선, 번식장애 예방 및 수태율 향상, 하절기 고온 스트레스 예방 등 다양한 효과를 목적으로 사료에 첨가하는 물질을 포함한다. 본 출원의 사료 첨가제는 사료관리법상의 보조사료에 해당하며, 탄산수소나트륨, 벤토나이트(bentonite), 산화마그네슘, 복합광물질 등의 광물질제제, 아연, 구리, 코발트, 셀레늄 등의 미량 광물질인 미네랄제제, 케로틴, 비타민 E, 비타민 A, D, E, 니코틴산, 비타민 B 복합체 등의 비타민제, 메티오닌, 라이신 등의 보호아미노산제, 지방산 칼슘염 등의 보호지방산제, 생균제(유산균제), 효모배양물, 곰팡이 발효물 등의 생균, 효모제 등이 추가로 포함될 수 있다.
본 명세서에서 사용되는 용어, "식품 조성물"은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food) 및 식품 첨가제(food additives)등의 모든 형태를 포함하며, 상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 바람직하게는 식품은 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주를 함유하는 형태일 수 있으며, 또한 다른 식품의 첨가물로서도 이용될 수 있다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다.
본 출원의 조성물은 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 콩 및 해바라기를 주성분으로 하는 사료; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조 성분 등을 더 포함할 수 있으며, 이외에도 영양 보충제, 소화 및 흡수 향상제, 성장 촉진제 등을 더 포함할 수 있다.
본 출원의 조성물은 동물에게 단독으로 투여하거나 식용 담체 중에서 다른 사료 첨가제와 조합하여 투여할 수도 있다. 또한, 상기 조성물은 탑 드레싱으로서 또는 이들을 사료에 직접 혼합하거나 또는 사료와 별도의 경구 제형으로 용이하게 동물에게 투여할 수 있다. 상기 조성물을 사료와 별도로 투여할 경우, 당해 기술분야에 잘 알려진 바와 같이 약제학적으로 허용 가능한 식용 담체와 조합하여, 즉시 방출 또는 서방성 제형으로 제조할 수 있다. 이러한 식용 담체는 고체 또는 액체, 예를 들어 옥수수 전분, 락토오스, 수크로오스, 콩 플레이크, 땅콩유, 올리브유, 참깨유 및 프로필렌글리콜일 수 있다. 고체 담체가 사용될 경우, 상기 조성물은 정제, 캡슐제, 산제, 트로키제 또는 함당정제 또는 미분산성 형태의 탑 드레싱일 수 있다. 액체 담체가 사용될 경우, 상기 조성물은 젤라틴 연질 캡슐제, 또는 시럽제나 현탁액, 에멀젼제, 또는 용액제의 제형일 수 있다.
본 출원의 조성물은, 예를 들어, 보존제, 안정화제, 습윤제 또는 유화제, 동결보호제, 또는 부형제 등을 함유할 수 있다. 상기 동결보호제는, 글리세롤, 트레할로스, 말토덱스트린, 탈지분유 및 전분으로 이루어진 군으로부터 선택되는 하나 이상일 수 있다.
상기 보존제, 안정화제, 또는 부형제는 상기 조성물에 포함되는 스키조키트리움 속 균주의 저하(deterioration)를 감소시키는데 충분한 유효량으로 조성물에 포함되는 것일 수 있다. 또한, 상기 동결보호제는 상기 조성물이 건조된 상태일 때 조성물에 포함되는 스키조키트리움 속 균주의 저하를 감소시키는데 충분한 유효량으로 조성물에 포함되는 것일 수 있다.
상기 조성물은 침주, 분무 또는 혼합하여 동물의 사료에 첨가하여 이용될 수 있다.
본 출원의 조성물은 포유류, 조류, 어류, 갑각류, 두족류, 파충류 및 양서류를 포함하는 다수의 동물 식이에 적용할 수 있으나, 이에 제한되지 않는다. 예를 들어, 상기 포유류는 돼지, 소, 양, 염소, 실험용 설치 동물, 또는 애완 동물 등을 포함할 수 있고, 상기 조류는 가금류를 포함할 수 있고, 상기 가금류는 닭, 칠면조, 오리, 거위, 꿩, 또는 메추라기 등을 포함할 수 있으나, 이에 제한되지 않는다. 또한, 상기 어류는 상업적 축양 어류 및 이의 치어류, 관상어 등을 포함할 수 있고, 상기 갑각류는 새우, 따개비 등을 포함할 수 있으나, 이에 제한되지 않는다. 또한, 상기 조성물은 동물성 플랑크톤인 로티퍼(rotifer)의 식이에도 적용될 수 있다.
본 출원의 또 다른 하나의 양태는 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주, 상기 균주의 배양물, 상기 배양물의 건조물, 상기 건조물의 파쇄물을 포함하는 항산화용 조성물을 제공한다.
상기 항산화용 조성물은 상기 스키조키트리움 속 균주, 상기 균주 유래 바이오매스, 상기 균주 유래 바이오오일, 또는 이들의 조합을 포함하는 것일 수 있다.
본 발명의 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주는 높은 항산화, 항염의 효능을 가진 카로티노이드 계열 항산화 색소를 생산 및/또는 포함하거나, 카로티노이드 계열 항산화 색소 생산능을 가지므로 항산화용 조성물로 유용하게 사용할 수 있다.
상기 항산화 조성물은 약학적 조성물, 식품 조성물, 사료 조성물 또는 사료 첨가제 조성물일 수 있다.
상기 식품 조성물은 기능성 식품 조성물일 수 있다.
본 발명의 기능성 식품에는 상기 유효성분 외에도 필요에 따라 다양한 보조성분을 추가로 함유할 수 있다. 본 발명의 기능성 식품의 경우, 비타민 A, 비타민 B1, 비타민 B2, 비타민 B3, 비타민 B6, 비타민 B12, 엽산 (folic acid), 비타민 C, 비타민 D3, 비타민 E 등의 비타민류와 구리, 칼슘, 철, 마그네슘, 칼륨, 아연 등의 미네랄 또는 유산균 등을 포함할 수 있다.
또한 본 발명의 기능성 식품 중, 건강음료는 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 포함할 수 있다. 향미제로는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 들 수 있다. 천연 탄수화물로는 포도당, 과당 등의 단당류, 말토스, 수크로오스 등의 이당류, 덱스트린, 사이클로덱스트린 등의 다당류, 자일리톨, 소르비톨, 에리트리톨 등의 당알코올류 등을 들 수 있다.
본 출원의 또 다른 하나의 양태는 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주를 배양하는 단계; 및 상기 균주, 상기 균주의 배양물, 상기 배양물의 건조물, 또는 상기 건조물의 파쇄물로부터 바이오매스를 회수하는 단계를 포함하는, 스키조키트리움 속 미세조류 유래 바이오매스 제조방법을 제공한다.
상기 스키조키트리움 속 균주, 바이오매스, 상기 균주의 배양물, 상기 배양물의 건조물, 및 상기 건조물의 파쇄물은 상기한 바와 같다.
본 명세서에서 사용되는 용어, "배양"은 상기 균주를 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양 과정은 당업계에 알려진 적당한 배지와 배양 조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다.
구체적으로, 본 출원의 스키조키트리움 속 균주의 배양은 종속영양 조건 하에서 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 사용되는 용어, "종속영양"은 에너지원 또는 영양원을 체외에서 얻어낸 유기물에 의존하는 영양 방식으로, 독립영양에 대응되는 용어이며, 용어 '암배양'과 혼용될 수 있다.
상기 스키조키트리움 속 균주를 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 본 출원의 균주의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 균주의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있다. 구체적으로, 본 출원의 균주를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있으나, 이에 제한되는 것은 아니다.
또한, 배양물의 호기상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나, 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으나, 이에 제한되는 것은 아니다.
또한, 배양온도는 20 내지 45℃ 또는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160시간 동안 배양할 수 있으나, 이에 제한되는 것은 아니다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있으나, 이에 제한되는 것은 아니다.
상기 스키조키트리움 속 균주를 배양하는 단계에서 사용되는 배지에 포함되는 탄소원은 글루코스, 프럭토스, 말토스, 갈락토스, 만노스, 수크로스, 아라비노스, 자일로스 및 글리세롤로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있으나, 미세조류를 배양하는데 사용되는 탄소원이라면 이에 제한되지 않는다.
상기 스키조키트리움 속 균주를 배양하는 단계에서 사용되는 배지에 포함되는 질소원은 i) 효모 추출물(yeast extract), 우육 추출물(beef extract), 펩톤 및 트립톤으로 이루어진 군으로부터 선택되는 어느 하나 이상의 유기질소원, 또는 ii) 암모늄 아세테이트, 암모늄 나이트레이트, 암모늄 클로라이드, 암모늄 설페이트, 소듐 나이트레이트, 우레아 및 MSG(Monosodium glutamate)로 이루어진 군으로부터 선택되는 어느 하나 이상의 무기질소원일 수 있으나, 미세조류를 배양하는데 사용되는 질소원이라면 이에 제한되지 않는다.
상기 스키조키트리움 속 균주를 배양하는 단계에서 사용되는 배지에, 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유염 등을 개별적으로 포함하거나 또는 혼합하여 포함할 수 있으나, 이에 제한되지 않는다.
상기 균주, 상기 균주의 배양물, 상기 배양물의 건조물, 또는 상기 건조물의 파쇄물로부터 바이오매스를 회수하는 단계는 당해 분야에 공지된 적합한 방법을 이용하여 목적하는 바이오매스를 수집하는 것일 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있고, 정제 공정을 더 포함하는 것일 수 있다.
본 출원의 또 다른 하나의 양태는 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주를 배양하는 단계; 및 상기 균주, 상기 균주의 배양물, 상기 배양물의 건조물, 또는 상기 건조물의 파쇄물로부터 지질을 회수하는 단계를 포함하는, 스키조키트리움 속 균주 유래 바이오오일 제조방법을 제공한다.
상기 스키조키트리움 속 균주, 바이오오일, 상기 균주의 배양물, 상기 배양물의 건조물, 및 상기 건조물의 파쇄물, 상기 균주를 배양하는 단계는 상기한 바와 같다.
상기 균주, 상기 균주의 배양물, 상기 배양물의 건조물, 또는 상기 건조물의 파쇄물로부터 지질을 회수하는 단계는 당해 분야에 공지된 적합한 방법을 이용하여 목적하는 지질을 수집하는 것일 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있고, 정제 공정을 더 포함하는 것일 수 있다.
예를 들면, 지방 알데하이드, 지방 알콜 및 탄화수소(예를 들어, 알칸)와 같은 지질 및 지질 유도체는 헥산과 같은 소수성 용매로 추출할 수 있다. 지질 및 지질 유도체는 또한 액화, 오일 액화 및 초임계 CO2 추출 등 방법을 사용하여 추출할 수 있다. 또한, 공지된 미세조류 지질 회수 방법은 예를 들어, i) 원심분리에 의해 세포를 수거하고 증류수로 세척한 후, 동결 건조에 의해 건조시키고, ii) 수득한 세포 분말을 분쇄한 후, n-헥산으로 지질을 추출하는 방법이 있다(Miao, X and Wu, Q, Biosource Technology (2006) 97:841-846).
본 출원의 또 다른 양태는
스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주를 배양하는 단계; 및 상기 균주의 배양물로부터 카로티노이드 계열의 항산화 색소를 추출하는 단계; 를 포함하는 항산화 색소 생산 방법을 제공한다.
상기 항산화 색소는 베타카로틴 또는 칸타잔틴일 수 있으나, 이에 제한되지 않는다.
상기 스키조키트리움 속 균주, 상기 균주를 배양하는 단계는 상기한 바와 같다.
상기 항산화 색소, 베타카로틴 및 칸타잔틴은 상기한 바와 같다.
상기 항산화 색소는 당 분야의 통상의 방법으로 추출 또는 분리 정제할 수 있다. 균체 내에 존재하는 항산화 색소는 유기 용매, 예를 들어, 헥산(hexane), 아세톤(acetone), 클로로포름(chloroform), 에틸아세테이트(ethyl acetate), 메틸 알콜(methyl alcohol), 디클로로메탄(dichloromethane), 사이크로헥산(cyclohexane), 에탄올(ethanol), 벤젠(benzene), 카본 디설피드(carbon disulfide), 디에틸 에테르(diethyl ether) 또는 이들의 혼합 용매를 사용하여 추출할 수 있다.
본 발명은 고함량의 단백질, 항산화 색소 및 오메가3 지방산을 포함하는 바이오매스를 생산하는 신규한 스키조키트리움 속(Schizochytrium sp.) 균주 및 이를 이용한 고함량의 단백질, 항산화 색소 및 오메가3 지방산을 함유하는 바이오매스 생산방법에 관한 것으로, 본 발명의 신규한 스키조키트리움 속(Schizochytrium sp.) 균주는 세포 내 글루탐산, 알지닌 및 아스파르트산 등의 아미노산을 포함하는 고함량의 단백질 성분, 베타카로틴 및 칸타산틴의 항산화색소, 및 에이코사펜타엔산 및 도코사헥사엔산의 오메가-3 불포화지방산 성분을 동시에 포함하는 바이오매스를 생산하는 특성을 가지므로, 균주 그 자체 또는 균주의 배양 및 발효에 의해 생산된 바이오매스 및 바이오오일은 사료용 조성물 또는 식품용 조성물 등으로 유용하게 활용될 수 있다.
도 1은 스키조키트리움 속 (Schizochytrium sp.) CD03-7004 변이균주와 야생형 스키조키트리움 속(Schizochytrium sp.) 균주 CD01-5000의 순수 분리 배양 결과, 색깔의 차이를 나타낸 도이다.
도 2는 야생형 CD01-5000 균주 대비 돌연변이 CD03-7004 균주에서 추가된 15 bp의 염기서열을 포함하는 DNA 단편을 증폭하는 프라이머 세트를 이용하여 PCR을 수행한 후, 야생형 CD01-5000 균주와 돌연변이 CD03-7004 균주의 증폭된 DNA 단편의 크기를 확인한 도이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
실시예 1. 감마선 조사 방법을 통한 신규 스키조키트리움 속( Schizochytrium sp.) CD03-7004 변이균주의 개발
순수 분리된 야생형 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주(기탁번호 KCTC 14344BP)를 글루코스 30 g/L를 포함하는 modified-GYEP(글루코스 10 g/L, 효모 추출물 1 g/L, 펩톤 1 g/L, MgSO4·7H2O 2 g/L, H3BO3 5.0 mg/L, MnCl2 3.0 mg/L, CuSO4 0.2 mg/L, NaMo4·2H2O 0.05 mg/L, CoSO4 0.05 mg/L, ZnSO4·7H2O 0.7 mg/L) 배지에 약 24시간 이상 배양하여 초기 대수기(Early Exponential phase)단계에 이르도록 한 후, 배양액 샘플을 원심분리하여 균체를 수확하였다. 수확된 균체는 세포수가 약 109 cells/mL가 되도록 NaCl 1.0%를 포함하는 0.1M Phosphate Buffer Solution에 현탁하여 감마선 조사에 활용하였다.
감마선 조사 실험은 한국원자력연구원 첨단방사선연구소에서 진행하였으며, 2000~5000 GY 선량의 감마선을 조사하였다. 감마선이 조사된 미세조류 배양액 샘플은 암실에서 O/N 동안 Recovery 과정을 거친 후, 한천(Agar) 20 g/L를 포함한 GYEP 배지에 도말하여 30℃에서 약 5일간 배양한 후 생육 콜로니 수를 계수하여 감마선량 별 사멸율을 측정하였다.
[계산식 1]
사멸률(%) = [{(무처리구의 콜로니 수) - (처리구의 콜로니 수)}/(무처리구의 콜로니 수)] X 100
감마선 선량 (kGY) 생육 콜로니 수 (EA) 사멸률 (%)
2.0 ≥ 250 -　
3.0 ≥ 23 90.8
4.0 ≥ 7 98.2
4.5 0 100
5.0 0 100
방사선 무처리구 ≥ 250 0
그 결과, 표 1에 나타낸 바와 같이, 감마선 조사선량에 따른 생육 콜로니 수, 생균수의 CFU값이 95% 이상 감소되는 적정 선량을 확인하였다. 구체적으로, 2.0, 3.0, 4.0, 4.5, 5.0 kGY의 감마선 조사선량에서 각각 0%, 90.8%, 98.2%, 100%, 100%가 사멸되는 결과를 나타냈다. 4.5 GY 이상의 감마선 선량 조사 조건에서는 모두 사멸되어 미세조류 콜로니를 확보할 수 없었으며, 98.2%의 사멸률을 나타내는 4.0 kGY의 감마선 선량 조건을 선택하였다.
동일한 방법으로 신규 미세조류 균주 CD01-5000에 4.0 kGY 선량의 감마선을 조사한 후 GYEP 배지에서 배양하였다. 배양 중에 생육이 가능한 콜로니를 선별하여, 동일한 배지 및 배양 환경 조건에서 계대를 진행하였다. 계대 간 형태적으로 붉은색을 띄는 콜로니를 선별하여 단일 세포주로 순수 분리 배양한 후, 이를 촬영한 결과를 도 1에 나타내었다. 상기 스키조키트리움 속 균주를 스키조키트리움 속 (Schizochytrium sp.) CD03-7004 균주로 명명하고, 2022년 6월 20일자로 한국생명공학연구원 생물자원센터(Korean Collection for Type Cultures: KCTC)에 기탁하여 수탁번호 KCTC15006BP를 부여받았다.
실시예 2. 스키조키트리움 속( Schizochytrium sp.) CD03-7004 변이균주 배양액의 조지방 및 지방산 함량 분석
실시예 2-1. CD01-5000 균주 및 CD03-7004 균주의 배양
야생형 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주와 감마선 조사를 통해 얻은 돌연변이 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주 배양액의 성분을 비교하기 위하여 각 균주를 발효 배양한 배양액을 건조한 건조 균체를 성분 분석 시료로 사용하였다. 30L scale의 본 배양에 앞선 예비 배양을 위해, 500 ml 플라스크에서 작업량(working volume) 50 ml 및 글루코스 30 g/L를 포함하는 GYEP 배지에 각 균주를 접종하고, 진탕 인큐베이터(Shaking incubator)에서 30℃, 180 rpm으로 약 20시간 동안 배양하였다. 예비 배양물은 동일한 조건의 배지를 포함한 30L 발효조에 접종하여 총 작업량(working volume) 20L에서 발효 배양하였다. 30℃, 500 rpm, 0.5-1 vvm, pH 5-7 조건에서 작업량(working volume)의 20%에 해당하는 글루코스를 연속 투입하여 세포 배양에 활용하고, 이때의 글루코스 농도는 20 g/L 수준에서 유지되도록 주입하였다. 공급한 탄소원인 글루코스가 모두 소모되면 배양을 종료하였다. 배양이 끝난 배양액은 동결건조기를 활용하여 수분 함량이 약 5~8%가 되도록 건조하였으며, 획득된 건조 균체는 조지방, 조단백 및 카로티노이드 성분 분석에 사용하였다.
실시예 2-2. CD01-5000 균주와 CD03-7004 균주 배양액의 조지방 및 지방산 함량 분석
야생형 스키조키트리움 속 (Schizochytrium sp.) CD01-5000 균주와 본 발명의 돌연변이 스키조키트리움 속 (Schizochytrium sp.) CD03-7004 균주 배양액의 조지방 및 지방산 함량을 분석하기 위해 하기와 같은 방법을 이용하였다.
구체적으로, 미세조류 균체의 세포벽을 가수분해하기 위하여 상기 실시예 1-1에서 수득한 건조된 미세조류 균체 2 g에 8.3M 염산 용액을 가하여 80℃로 가열한 후, 에틸 에테르(Ethyl ether) 30 mL 및 석유 에테르(Petroleum ether) 20 mL을 첨가하고 30초간 섞어준 후 원심분리하는 과정을 3회 이상 반복하였다. 분리된 용매 층을 회수하여, 미리 무게를 측정해 둔 라운드 플라스크(round-flask)에 옮기고, 질소를 주입하여 용매를 제거한 후 데시게이터(Desicator)에서 냉각 항량하였다. 건조 후 플라스크 무게에서 빈 플라스크 무게를 뺀 값으로 건조된 오일의 무게를 측정하여, 전체 오일 함량을 산출하였다. 오일 중에 포함된 DHA함량은 메탄올성 0.5N NaOH 및 14% 트리플루오로보란메탄올(BF3)을 전처리하여 기체크로마토그래피법으로 측정하여 나타내었다.
[계산식 2]
전체 오일 함량(%)= (*오일 g/건조 균체량 g) X 100
*오일 g: 산 가수분해 및 용매 제거 후 플라스크 무게 - 공 플라스크 무게
하기 표 1의 “바이오매스”는 배양액 내의 균체 농도를 의미하는 것으로서, DCW(dry cell weight)와 혼용되어 사용될 수 있다.
　 Schizochytrium 　sp. CD01-5000 Schizochytrium 　sp. CD03-7004
배양시간(hr) 26.6 28.3
O.D (680nm) 166.9 124.6
DCW (g/L) 107.9 105
바이오매스 중 조지방량　(%) 25.3 14.4
조지방 중 지방산　(%)
- C20:5 n-3 0.6 2.1
-　C22:6 n-3 41.3 49.4
(상기 표에서 C20:5 n-3는 에이코사펜타엔산(Eicosapentaenoic acid: EPA)을 의미하고, C22:6 n-3는 도코사헥사엔산(Docosahexaenoic acid: DHA)을 의미한다.)
그 결과, 표 2에 나타낸 바와 같이, 실험 결과, 야생형 균주 CD01-5000 균주와 돌연변이 CD03-7004 균주는 모두 약 30시간 내 공급된 탄소원인 글루코스를 전량 소화하였으며, 약 100 g/L 수준의 바이오매스를 생산하여 비슷한 바이오매스 생장성을 나타냈다. CD03-7004 균주의 경우 CD01-5000 균주에 비해 바이오매스 중 조지방 함량이 14.4%로 낮았으나, 에이코사펜타엔산(Eicosapentaenoic acid: EPA, C20:5 n-3) 함량은 2.1%, 도코사헥사엔산(Docosahexaenoic acid: DHA, C22:6 n-3) 함량은 49.4%로 나타나 CD01-5000 균주에 비해 현저히 높은 것을 확인하였다. 즉, CD03-7004 균주는 조지방 내 50% 이상의 높은 함량의 오메가 3 지방산을 함유하였음을 확인하였다.
실시예 3. 스키조키트리움 속( Schizochytrium sp.) CD03-7004 변이 균주 배양액의 조단백 및 아미노산 함량 분석
야생형 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주와 본 발명의 돌연변이 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주 배양액 건조 균체의 조단백 및 아미노산 함량을 분석하기 위해 아래와 같은 방법을 이용하였다.
구체적으로, 상기 실시예 1-1에서 수득한 건조된 미세조류 균체 1 g을 킬달 장치 (Kjeldahl system, Kjeltec 2100) 분석용 튜브에 담고, 98% 황산 12~15 mL 및 촉매제를 넣어 분해기에서 분해 후, 분해 튜브를 오토 샘플러에 장착하였다. 킬달 장치 내에서 가성소다와 스팀으로 가열 증류하여 발생하는 기체 암모니아를 냉각 포집한 후, 이를 0.1N 염산 용액으로 적정하여 자동으로 질소 함량을 계산하는 방식으로 미세조류 건조 바이오매스 (dry biomass)의 조단백 함량을 측정하였다. 실시예 1-1에서 수득한 건조된 미세조류 균체 0.5 내지 1 g을 6N HCl 용액으로 산 가수분해한 뒤, 액체크로마토그래피를 이용하여 총 아미노산 분석을 수행하였다. 개별 아미노산의 분석 결과는 사용된 미세조류 건조 균체 양으로 표준화하여 건조 균체 내 개별 아미노산의 함량비를 산출하였고, 분석 결과 검출된 모든 아미노산의 함량비를 합하여 균체 내 총 아미노산 함량비를 계산하였다.
Schizochytrium sp. CD01-5000 Schizochytrium sp. CD03-7004
바이오매스 중 조단백량 (%) 59.7 75.1
바이오매스 중 아미노산량 (%)
아스파르트산 3.98 3.86
트레오닌 1.82 1.75
세린 2.23 1.99
글루탐산 13.57 21.30
글라이신 1.87 1.86
알라닌 2.50 2.53
시스테인 0.59 0.52
발린 1.90 2.21
메티오닌 0.76 0.70
이소류신 1.16 1.34
류신 2.80 2.72
타이로신 1.24 1.10
페닐알라닌 1.52 1.66
리신 2.50 2.61
히스티딘 0.72 0.84
아르기닌 5.59 8.27
프롤린 0.77 0.16
(상기 표에서 바이오매스 중 아미노산량은 바이오매스 중(kg) 각 아미노산의 양(g)을 비율(%)로 나타낸 것을 의미한다.)
그 결과, 표 3에 나타낸 바와 같이, CD03-7004 변이 균주 배양액 건조 균체 내의 조단백 함량은 75.1%로, 야생형 CD01-5000 균주 배양액 건조 균체 내의 조단백 함량 59.7% 보다 현저히 높음을 확인하였다. 또한, CD03-7004 변이 균주 배양액 건조 균체 내의 아미노산 함량은 글루탐산이 가장 높았으며, 페닐알라닌, 아르기닌, 아스파르트산, 리신의 순서로 높음을 확인하였다.
실시예 4. 스키조키트리움 속( Schizochytrium sp.) CD03-7004 변이균주 배양액의 항산화 색소 함량 분석
야생형 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주와 본 발명의 돌연변이 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주 배양액의 항산화 색소 함량을 분석하기 위해 하기와 같은 방법을 이용하였다.
구체적으로, 상기 실시예 1-1에서 수득한 건조된 미세조류 균체를 적정량 칭량하여, 헥산(Hexane), 아세톤(Acetone), 클로로포름(Chloroform) 및에틸아세테이트로 구성된 추출 용액으로 추출 및 농축하여 고성능 액체 크로마토그래피(high performance liquid chromatography; HPLC)로 분석하여 그 결과를 하기 표 4에 나타내었다.
항산화 색소 Schizochytrium sp. CD01-5000 Schizochytrium sp. CD03-7004
베타카로틴 (mg/kg) 불검출 2.77
칸타잔틴 (mg/kg) 6.22 112.09
그 결과, 표 4에 나타낸 바와 같이, 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주를 배양한 배양액 건조 균체에서 베타카로틴은 불검출되었고, 칸타산틴 함량은 6.22 mg/kg인데 비해, 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주를 배양한 배양액 건조 균체에서는 베타카로틴 함량은 2.77mg/kg, 칸타잔틴 함량은 112.09 mg/kg로 나타나, 본 발명의 스키조키트리움 속(Schizochytrium sp.) CD03-7004 변이균주는 베타카로틴 및 칸타잔틴의 항산화 색소를 고생산함을 확인하였다.
실시예 5. CD03-7004 돌연변이 균주와 야생형 CD01-5000 균주의 구별 마커 도출
야생형 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주와 돌연변이 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주의 전체 게놈 서열(whole genome sequence)를 비교하여 CD03-7004에서 변이된 서열을 찾아 PCR 마커(marker)를 제작하였다.
구체적으로, 돌연변이 CD03-7004 균주는 게놈 상에서 야생형 CD01-5000 균주의 게놈과 비교하였을 때, 15 base pairs의 추가된 부분(하기 서열번호 1의 서열에서 굵은 글씨 부분)이 있음을 확인하였다.
[돌연변이 CD03-7004 균주의 증폭 대상 DNA 단편 서열(서열번호 1)]
tttcagactgctttttgctttttgcttgcttgctttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag
[야생형 CD01-5000 균주의 증폭 대상 DNA 단편 서열(서열번호 2)]
tttcagactgctttttgctttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag
이 부분을 증폭하는 프라이머 A: 5’-TTTCAGACTGCTTTTTGCTTTTTG-3’(서열번호 3), 프라이머 B: 5’-CTCTCTTCGGATTGACTCTTTTCT-3’(서열번호 4)를 선정하였고, 이를 이용하여 PCR 증폭 반응을 진행하였다. PCR 반응은 taq polymerase를 함유하는 반응용액을 활용하여 95℃에서 5분간 변성 후, 95℃ 10초 변성, 50℃ 10초 어닐링, 72℃ 15초 중합을 35회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. PCR 과정을 통하여 증폭된 반응액은 1.7% 아가로즈겔에 전기영동하여 증폭된 DNA 크기를 확인하여 도 2에 나타내었다.
그 결과, 도 2에 나타난 바와 같이, 돌연변이 CD03-7004 균주에서 증폭된 DNA 단편은 약 140 bp 크기로 나타나, 약 120 bp 크기의 DNA 단편이 증폭된 야생형 CD01-5000 균주와 차이가 있음을 확인하였다.
따라서, 상기 결과를 통해, 돌연변이 CD03-7004 균주를 선별하기 위해 프라이머 A: 5’-TTTCAGACTGCTTTTTGCTTTTTG-3’(서열번호 3)와 프라이머 B: 5’-CTCTCTTCGGATTGACTCTTTTCT-3’(서열번호 4)를 활용할 수 있음을 알 수 있다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 통상의 지식을 가진 자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
[수탁번호]
기탁기관명: 한국생명공학연구원 생물자원센터 (KCTC)
수탁번호: KCTC15006BP
수탁일자: 20220620
Figure PCTKR2023012051-appb-img-000001

Claims (18)

  1. 신규한 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주(기탁번호 KCTC15006BP).
  2. 제1항에 있어서, 상기 균주는 카로티노이드 계열의 항산화 색소 생산능을 가지는 것인, 균주.
  3. 제2항에 있어서, 상기 항산화 색소는 베타카로틴(Beta-carotene) 또는 칸타잔틴(Canthaxanthin)인, 균주.
  4. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 균주는 오메가-3 불포화 지방산 생산능을 가지는 것인, 균주.
  5. 제4항에 있어서, 상기 오메가-3 불포화 지방산은 도코사헥사엔산(Docosahexaenoic acid: DHA) 및 에이코사펜타엔산(eicosapentaenoic acid: EPA)인, 균주.
  6. 제1항에 있어서, 상기 균주의 유전체(genomic) DNA는 서열번호 1의 염기 서열을 포함하는 것을 특징으로 하는, 균주.
  7. 제1항에 있어서, 상기 균주는 서열번호 3으로 이루어진 프라이머 및 서열번호 4로 이루어진 프라이머를 포함하는 프라이머 세트로 선별될 수 있는 것을 특징으로 하는, 균주.
  8. 제1항의 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 바이오매스.
  9. 제8항에 있어서, 상기 바이오매스는 카로티노이드 계열의 항산화 색소를 포함하는 것인, 바이오매스.
  10. 제9항에 있어서, 상기 항산화 색소는 베타카로틴(Beta-carotene) 또는 칸타잔틴(Canthaxanthin)인, 바이오매스.
  11. 제8항 내지 제10항 중 어느 한 항에 있어서, 상기 바이오매스는 지방산 총 중량을 기준으로 42% 이상의 오메가-3 불포화 지방산을 함유하는 것인, 바이오매스.
  12. 제11항에 있어서, 상기 오메가-3 불포화 지방산은 도코사헥사엔산(Docosahexaenoic acid: DHA) 및 에이코사펜타엔산(eicosapentaenoic acid: EPA)인, 바이오매스.
  13. 제8항 내지 제10항 중 어느 한 항에 있어서, 상기 바이오매스는 단백질을 건조 중량 대비 60% 이상 포함하는 것인, 바이오매스.
  14. 제1항의 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 사료용 조성물.
  15. 제1항의 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 포함하는 식품용 조성물.
  16. 제1항의 균주, 상기 균주의 배양액, 상기 배양액의 건조물, 또는 상기 건조물의 파쇄물을 유효성분으로 포함하는 항산화 조성물.
  17. 제1항의 균주를 배양하는 단계; 및
    상기 균주의 배양물로부터 카로티노이드 계열의 항산화 색소를 추출하는 단계; 를 포함하는 항산화 색소 생산 방법.
  18. 제17항에 있어서, 상기 항산화 색소는 베타카로틴 또는 칸타잔틴인, 항산화 색소 생산 방법.
PCT/KR2023/012051 2022-08-18 2023-08-14 고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도 WO2024039163A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220103398 2022-08-18
KR10-2022-0103398 2022-08-18

Publications (1)

Publication Number Publication Date
WO2024039163A1 true WO2024039163A1 (ko) 2024-02-22

Family

ID=89941890

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/012051 WO2024039163A1 (ko) 2022-08-18 2023-08-14 고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도

Country Status (3)

Country Link
KR (1) KR20240026429A (ko)
TW (1) TW202413625A (ko)
WO (1) WO2024039163A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080111586A (ko) * 2007-06-19 2008-12-24 이정열 Schizochytrium mangrovei MM103을 이용한 Docosahexanoic acid(DHA)의 생산 방법
KR101847551B1 (ko) * 2016-11-04 2018-04-10 전북대학교산학협력단 카로티노이드 계열의 항산화 색소 및 dha를 포함한 바이오오일을 고생산하는 돌연변이 미세조류인 스키조키트리움 속 shg104 균주 및 이의 용도
US20210340583A1 (en) * 2019-11-26 2021-11-04 Hanpeng QU Schizochytrium strain and use thereof, microbial oil containing dha at sn-2 position and preparation and use thereof
KR20220080594A (ko) * 2020-12-07 2022-06-14 씨제이제일제당 (주) 신규한 스키조키트리움 속 균주 및 이를 이용한 다중불포화지방산 생산방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080111586A (ko) * 2007-06-19 2008-12-24 이정열 Schizochytrium mangrovei MM103을 이용한 Docosahexanoic acid(DHA)의 생산 방법
KR101847551B1 (ko) * 2016-11-04 2018-04-10 전북대학교산학협력단 카로티노이드 계열의 항산화 색소 및 dha를 포함한 바이오오일을 고생산하는 돌연변이 미세조류인 스키조키트리움 속 shg104 균주 및 이의 용도
US20210340583A1 (en) * 2019-11-26 2021-11-04 Hanpeng QU Schizochytrium strain and use thereof, microbial oil containing dha at sn-2 position and preparation and use thereof
KR20220080594A (ko) * 2020-12-07 2022-06-14 씨제이제일제당 (주) 신규한 스키조키트리움 속 균주 및 이를 이용한 다중불포화지방산 생산방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PARK HANSUNG; KWAK MINSOO; SEO JEONGWOO; JU JEONGHYUN; HEO SUNYEON; PARK SEUNGMOON; HONG WONKYUNG: "Enhanced production of carotenoids using a Thraustochytrid microalgal strain containing high levels of docosahexaenoic acid-rich oil", BIOPROCESS AND BIOSYSTEMS ENGINEERING, SPRINGER, DE, vol. 41, no. 9, 13 June 2018 (2018-06-13), DE , pages 1355 - 1370, XP036570753, ISSN: 1615-7591, DOI: 10.1007/s00449-018-1963-7 *

Also Published As

Publication number Publication date
KR20240026429A (ko) 2024-02-28
TW202413625A (zh) 2024-04-01

Similar Documents

Publication Publication Date Title
WO2022124590A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 다중불포화지방산 생산방법
KR0148133B1 (ko) 제아키산틴의 제조 및 제아키산틴 함유 조성물
JP3755898B2 (ja) 抗寄生虫薬
WO2021251575A1 (ko) 신규한 페디오코커스 펜토사세우스 균주 및 이의 유청 발효물을 포함하는 비만 또는 지방간 질환의 예방 또는 개선용 식품 조성물
WO2017209510A1 (ko) 두나리엘라 변이주 및 이를 이용한 색소 생산 방법
KR102614551B1 (ko) 단일 미세조류로부터 단백질 및 오메가-3 지방산을 포함하는 바이오매스를 제조하는 방법 및 이에 의해 제조된 바이오매스
WO2020045765A1 (ko) 클라미도모나스 변이주 및 이의 제조방법
WO2021085854A1 (ko) 글루타치온을 생산하는 효모 균주 및 이를 이용한 글루타치온 생산방법
WO2024039163A1 (ko) 고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도
WO2023120896A1 (ko) 신규한 락티플란티바실러스 플란타럼 ｂｎｔ＿ｇ401 균주 및 이의 용도
WO2020145685A1 (ko) 클라미도모나스 변이주 및 이의 용도
KR20160143100A (ko) 바실러스 서브틸리스 모리를 이용한 고상 배양물의 제조방법
WO2021251574A1 (ko) 신규한 와이셀라 시바리아 균주 및 이의 유청 발효물을 포함하는 비만 또는 지방간 질환의 예방 또는 개선용 식품 조성물
WO2024128494A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가-3를 함유한 오일 생산방법
WO2023204396A1 (ko) 펩신 소화율이 우수한 고단백 미세조류 바이오매스, 배양 방법 및 이의 용도
WO2024150941A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 아라키돈산을 함유한 오일 생산 방법
WO2023080399A1 (ko) 세포 내 오일 추출이 용이한 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가3를 함유한 오일 생산방법
JP2540292B2 (ja) 新規な微生物
WO2023080400A1 (ko) 세포 내 오일 함유량이 높은 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가3를 함유한 오일 생산방법
KR102397299B1 (ko) 언에어로스케프트룸 프로피오니게네스 균주 및 이의 용도
JPH07505280A (ja) ストレプトマイセス　アベルミチリス株によりグリコシル化されたアベルメクチン化合物
RU2827970C1 (ru) Новый штамм schizochytrium sp. и способ получения полиненасыщенных жирных кислот с его использованием
WO2024219797A1 (ko) Romboutsia sp. u2u2a18을 포함하는 체중 또는 지방 증가용 조성물 및 이의 용도
JPH08242774A (ja) 産卵鶏用色調改善飼料
JPH0613520B2 (ja) 抗生物質ＬＬ―Ｄ４２０６７αおよびＬＬ―Ｄ４２０６７β

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23855130

Country of ref document: EP

Kind code of ref document: A1