WO2020045765A1 - 클라미도모나스 변이주 및 이의 제조방법 - Google Patents

클라미도모나스 변이주 및 이의 제조방법 Download PDF

Info

Publication number
WO2020045765A1
WO2020045765A1 PCT/KR2018/016518 KR2018016518W WO2020045765A1 WO 2020045765 A1 WO2020045765 A1 WO 2020045765A1 KR 2018016518 W KR2018016518 W KR 2018016518W WO 2020045765 A1 WO2020045765 A1 WO 2020045765A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
mutant
culture
cultures
chlamydomonas
Prior art date
Application number
PCT/KR2018/016518
Other languages
English (en)
French (fr)
Inventor
진언선
백광열
송인화
Original Assignee
주식회사 아크에이르
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 아크에이르 filed Critical 주식회사 아크에이르
Publication of WO2020045765A1 publication Critical patent/WO2020045765A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/105—Aliphatic or alicyclic compounds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)

Definitions

  • the present invention relates to algae having a zeaxanthin production capacity, a method for producing the algae, and the use of the algae.
  • Macular degeneration is a disease that causes vision impairment due to degeneration in the macular tissue, a nerve tissue located in the center of the inner retina of the eye.Most of the eye cells are collected in the macula and the image is formed at the center of the macula. Is in charge of. The most common causes of macular degeneration are age-related macular degeneration and are known to be associated with family history, race and smoking.
  • Macular degeneration is largely divided into non-exudative (dry) and exudative (wet). About 80-90% of the macular degeneration is non-exudative macular degeneration. Non-exudative macular degeneration is progressing slowly and the symptoms worsen rarely, but there is no special treatment, such as health foods can be greatly helped to alleviate the symptoms and not worsen anymore. Exudative macular degeneration proceeds quite urgently and requires active treatment for vision preservation. If the boundary of the site of degeneration can be clearly understood, thermal laser photocoagulation, photodynamic therapy, antibody injection, vitrectomy, etc. may be performed, but there is no method or treatment for treating macular degeneration completely.
  • Macular pigmentation reduces senile deterioration caused by the central part of the retina and prevents damage to retinal tissues caused by bright light.
  • Representative examples include carotenoid-based oxycarotenoid pigments produced by oxygenation of carotenoids as xanthophyll (xanthophyll) and lutein or zeaxanthin as pigments belonging to xanthophylls.
  • lutein is abundant in most green leafy vegetables, including marigold, but since zeaxanthin is a pigment produced by oxidative stress, its content is much smaller than that of lutein, making it difficult to use green plants as a raw material of zeaxanthin.
  • Bacteria systems have been devised to replace green plant systems, but pigments from bacteria are ultimately unsuitable for use as food additives, and bacterial cultures and bioreactors are also very expensive to maintain.
  • microalgae are attracting attention as photosynthetic cell plants that convert carbon dioxide into high value products such as biofuels, antioxidants, fatty acids and carotenoids.
  • Microalgae have more carotenoid content than other sources, have high growth rate and productivity, no limitation of arable land, and short harvest cycle, which makes it very suitable for producing carotenoid pigments, but it is difficult to separate between pigments. There is still a need for research to selectively produce pigments.
  • unmodified wild type microalgae are generally rich in lutein like green plants, but have low content of zeaxanthin and cannot produce zeaxanthin selectively under cultivation conditions. Not suitable for xanthine pigment production. Therefore, there is a need for a new aspect of approach for industrial production of zeaxanthin using microalgae.
  • An object of the present invention is to provide a method for effective production of zeaxanthin and zeaxanthin through the same, and specifically to provide a microalgae having excellent zeaxanthin production ability and its use for efficient and improved production of zeaxanthin. .
  • the present inventors developed a mutant strain with improved biological properties from wild-type or existing microalgae using mutations other than genetic recombination methods, and identified an optimal method for producing zeaxanthin using the same.
  • the present invention was completed.
  • the mutant strain of the present invention has a markedly improved zeaxanthin production ability in the xanthophyll pigment, lutein is not produced, and thus only the zeaxanthin can be easily obtained in the process of extracting and separating the pigment after culturing the algae.
  • the present invention provides adenine (A) between the 816th and 817th bases in the ZEP gene sequence of Chlamydomonas reinhardtii represented by SEQ ID NO: 1; A nucleotide sequence represented by SEQ ID NO: 3; Or ZEP gene mutation into which the nucleotide sequence represented by SEQ ID NO: 5 is inserted; And a nucleotide sequence represented by SEQ ID NO: 9 between 599 and 600 bases in the LCYE gene sequence of Chlamydomonas reinhardtii represented by SEQ ID NO: 2; Or Chlamydomonas reinhardtii mutants comprising the LCYE gene mutation inserted nucleotide sequence represented by SEQ ID NO: 11 is provided.
  • A adenine
  • the mutant strain may be zeaxanthin-producing ability while not producing lutein.
  • the present invention also provides a culture of the mutant strains.
  • the present invention is the above variant strain; Its culture; Dried products of the mutant strains or cultures; And it provides a pigment composition comprising one or more selected from the group consisting of the mutant strain or the extract of the culture.
  • the pigment may be zeaxanthin.
  • the present invention is the above variant strain; Its culture; Dried products of the mutant strains or cultures; And eye health enhancement or maintenance comprising at least one selected from the group consisting of extracts of the mutant strains or cultures; Macular degeneration prevention or improvement; Preventing or improving deterioration of the eye; Improving or preventing damage to the retina; Inhibiting aging of the eye; Maintaining retinal health; Reduced risk of developing macular degeneration; Or it provides a composition for preventing or improving macular degeneration.
  • the present invention is the above variant strain; Its culture; Dried products of the mutant strains or cultures; And it provides a food or food additive composition comprising at least one selected from the group consisting of the mutant strain or the extract of the culture.
  • the present invention is the above variant strain; Its culture; Dried products of the mutant strains or cultures; And it provides a feed or feed additive composition comprising at least one selected from the group consisting of the mutant strain or the extract of the culture.
  • the present invention is the above variant strain; Its culture; Dried products of the mutant strains or cultures; And it provides a composition for injection comprising one or more selected from the group consisting of the mutant strain or the extract of the culture.
  • the present invention is the above variant strain; Its culture; Dried products of the mutant strains or cultures; And enhancing or maintaining eye health at least one selected from the group consisting of extracts of the mutant strains or cultures; Macular degeneration prevention or improvement; Preventing or improving deterioration of the eye; Improving or preventing damage to the retina; Anti-aging; Maintaining retinal health; Reduced risk of developing macular degeneration; Or provide a dietary supplement for preventing or improving macular degeneration.
  • the present invention also provides a pigment production method comprising culturing the mutant strain.
  • the present invention provides a method for producing a raw material of food or feed comprising culturing the mutant strain.
  • a mutation position capable of simultaneously knocking out a ZEP gene and an LCYE gene without introducing foreign DNA in the microalga Chlamydomonas reinhardtia was developed, and thus a new mutant strain including simultaneous knockout was developed.
  • it has a significant increase in the production of industrially useful pigment zeaxanthin and at the same time does not produce lutein, so that the step of separating / purifying zeaxanthin and lutein Without knowing that it can efficiently produce zeaxanthin on a commercial scale, it is expected to have a great economic effect in terms of industrial production of zeaxanthin using microalgae.
  • Figure 1 shows an overall description of the method for producing ZEP and LCYE genetically corrected Chlamydomonas mutant strains according to one embodiment of the invention.
  • Figures 2a, 2b and 2c shows ZEP gene information (2a, SEQ ID NO: 4) of the Chlamydomonas Reinhardthia mutant strain ⁇ Z1, ZEP gene information (2b, SEQ ID NO: 6) and Chlamydo of the Chlamydomonas Reinhardtia variant strain ⁇ Z2, respectively.
  • the ZEP gene information (2c, SEQ ID NO: 8) of the Monas Reinhardtia variant strain ⁇ Z3 is shown.
  • 3A and 3B show mutations in the ZEP gene induced by DNA-free RGEN RNPs
  • 3a RGEN-transfected cells and wild type mutation (insertion and deletion; indel) frequency for each sgRNA targeted Measured by Targeted deep sequencing. Indel frequency was measured to about 0.46%.
  • 3b Representative mutant DNA sequence (RGEN3), ie TCCGGCGAACGCACCTGGATGGG, obtained from the third most efficient sgRNA observed in the targeted deep sequencing analysis of a.
  • Targeted deep sequencing analysis revealed various indel patterns identified at the target sequence, 3nt upstream of the PAM sequence. 20-bp target sequences are underlined and PAM sequences are shown in bold.
  • FIG. 4 shows the results of confirming the target DNA sequence change of the actual ZEP gene position by Sanger sequencing in three ZEP mutants generated by DNA-free RGEN RNPs [a: wildtype, b : ZEP mutant 1 ( ⁇ Z1), c: ZEP mutant 2 ( ⁇ Z2) d. ZEP mutant 3 ( ⁇ Z3)].
  • FIG. 5 shows the Cas9 protein sequence (SEQ ID NO: 15) used in one embodiment of the present invention.
  • FIGS. 6a, 6b and 6c are photographs showing the morphological characteristics of Chlamydomonas Reinhardtia cw15 wild type bird, Chlamydomonas Reinhardtia mutants ⁇ Z1, ⁇ Z2, ⁇ Z3
  • 6a Hundreds of colonies for studying ZEP gene knockout Of chlorophyll fluorescence (Chl) fluorescence
  • 6b Photo incubated in a colony state in solid TAP medium containing agar
  • Figure 7 shows the sequence information (SEQ ID NO: 2) of the LCYE (Lycopene epsilon cyclase) gene of wild type Chlamydomonas .
  • FIGS. 8A and 8B show information about the LCYE gene (SEQ ID NOs: 10, 8a) and the dZL2 variant LCYE gene (SEQ ID NOs: 12, 8b) of Chlamydomonas reinhardti, respectively .
  • the underlined sequences in red refer to the sequences inserted into the variant strains respectively.
  • Figure 9 shows the cell photographs in solid TAP medium of wild type Chlamydomonas Reinhardti cw15, ZEP 1 mutant, dZA1 mutant, dZA2 mutant.
  • Figure 10a and 10b shows the results of the pigment analysis according to an embodiment of the present invention
  • 10a is a comparison of the pigment profile of Chlamydomonas Reinhard ti cw15 wild type algae, ZEP Mutant 1, mutant dZL1 and mutant dZL2
  • 10b is a HPLC analysis graph comparing the pigment profiles of Chlamydomonas Reinhardtia mutants ⁇ Z1, ⁇ Z2, ⁇ Z3: lutein and zeaxanthin content of chlorophyll a (Chl a): neo-neoxanthin ), vio-violaxanthin, An-antheraxanthin, lut-lutein, zea-zeaxanthin, chl a-chlorophyll a, chl b: chlorophyll b ( chlorophyll b).
  • Figure 10c is a graph confirming the zeaxanthin and lutein production characteristics and production of Chlamydomonas Reinhardti cw15 wild type alga, ZEP Mutant 1, mutant dZL1 and mutant dZL2 according to an embodiment of the present invention.
  • Figure 11 shows an autotrophic culture vessel according to an embodiment of the present invention.
  • Figure 12 shows a mixed nutrient culture vessel according to an embodiment of the present invention.
  • the present invention Chlamydomonas Reinhardti reinhardtii ) on mutant strains .
  • Chlamydomonas Reinhard tiai of the present invention is a unicellular green alga (Chlorophyta) is a eukaryotes distributed in various environments, such as fresh water, the ocean, and has a doubling time of 6 to 8 hours. It is also one of the most widely used microalgal model systems, which can be produced in bioreactors.
  • Variant of the present invention using RGNE RNPs, CRISPR gene scissors technology but not the general mutation treatment ZEP ( Zeaxanthin It can be produced by knocking out the epoxidase gene and the LCYE gene Lycopene epsilon cyclase .
  • the variant strain of the present invention ZEP ( Zeaxanthin epoxidase ) gene and LCYE ( Lycopene epsilon cyclase ) may include mutations at specific positions of the gene.
  • the mutant of the present invention is defined by the ZEP (Zeaxanthin epoxidase ) gene and LCYE ( Lycopene epsilon Variation of cyclase ) genes can be specified through location, and the production of mutant strains from wild type Chlamydomonas reinhardtia microalgae is possible.
  • mutation indicates that the base sequence is changed by the insertion, deletion, or substitution of the base in the original base sequence.
  • insertion variation is generated by inserting a portion of the base between the original base sequence. Meaning the variation, the number of the base to be inserted may be different depending on the variation, and is not limited accordingly.
  • Variant of the present invention may include an insertion mutation in which some bases are inserted between the 816th base and the 817th base in the ZEP gene sequence of Chlamydomonas reinhardtii, which is represented by SEQ ID NO: 1.
  • the ZEP gene can be knocked out.
  • the present invention provides adenine (A) between the 816th base and the 817th base in the ZEP gene sequence (SEQ ID NO: 1) of wild-type Chlamydomonas reinhardtii cw15; A nucleotide sequence represented by SEQ ID NO: 3; Or it may include a ZEP gene mutation in which the nucleotide sequence represented by SEQ ID NO: 5 is inserted, it was confirmed that the ZEP gene is effectively knocked out in each of the mutant strains.
  • mutant strains of the present invention comprise adenine (A) between the 816th base and the 817th base in the ZEP gene sequence (SEQ ID NO: 1); A nucleotide sequence represented by SEQ ID NO: 3; Or a ZEP gene mutation into which the nucleotide sequence represented by SEQ ID NO: 5 is inserted.
  • the variant strain of the present invention may include a mutation in which some bases are inserted between the 599th and 600th base in the LCYE gene sequence of Chlamydomonas reinhardtii represented by SEQ ID NO: 2, It is possible to knock out the LCYE gene.
  • a variant strain wherein 94 or 1870 bases are inserted between 599th and 600th bases in the LCYE gene sequence (SEQ ID NO: 2) of wild-type Chlamydomonas reinhardtii cw15. It was confirmed that the LCYE gene was knocked out effectively in each of the mutant strains .
  • the present invention has a very large technical feature in that a mutation strain in which the LCYE gene is knocked out can be obtained when an insertion mutation occurs between the 599th base and the 600th base in the LCYE gene sequence of SEQ ID NO: 2.
  • the mutant strain is a nucleotide sequence represented by SEQ ID NO: 9 between the 599th base and the 600th base in the LCYE gene sequence (SEQ ID NO: 2); Alternatively, the nucleotide sequence represented by SEQ ID NO: 11 may include an LCYE gene mutation inserted.
  • the mutant strain of the present invention is a nucleotide sequence represented by column number 9 between the 599th base and the 600th base in the LCYE gene sequence (SEQ ID NO: 2); Alternatively, the nucleotide sequence represented by SEQ ID NO: 11 may include an LCYE gene mutation inserted.
  • the variant strains of the present invention are ZEP and LCYE It may be to include genetic variation simultaneously.
  • a nucleotide sequence represented by SEQ ID NO: 9 between 599 and 600 bases in the LCYE gene sequence of Chlamydomonas reinhardtii represented by SEQ ID NO: 2; Or it may be a Chlamydomonas Reinhardtia mutant strain containing the LCYE gene mutation inserted into the base sequence represented by SEQ ID NO: 11.
  • mutant strain of the present invention is a ZEP gene mutation represented by SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8; And SEQ ID NO: 8; Or LCYE gene mutation represented by SEQ ID NO: 10.
  • the ZEP gene mutation of SEQ ID NO: 8; And a ZEP / LCYE double gene knockout variant comprising the LCYE gene mutation represented by SEQ ID NO: 10 was designated dZL1 (double ZEP / LCYE mutant 1), and the ZEP gene mutation of SEQ ID NO: 8; And a double gene knockout mutant comprising the LCYE gene mutation represented by SEQ ID NO: 12 was designated dZL2 (double ZEP / LCYE mutant 2).
  • the inventors also found that Chlamydomonas among the selected mutants.
  • Hard Rain tiahyi the deposit of the double ZEP / LCYE mutant 1 (dZL1 ) mutant August 21, 2018 Date of the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center (KCTC), was given an accession number of KCTC 13626BP.
  • both strains were effectively ZEP / LCYE double gene knockout was confirmed to have a significantly improved zeaxanthin production without lutein production.
  • the mutant strains of the present invention have significantly improved zeaxanthin production capacity compared to the chlamydomonas reinhardtia cw15 wild type without the conventional zeaxanthin production ability, and in particular, it does not produce lutein, and thus can only selectively produce zeaxanthin. It has the advantage that it can be used effectively in the production of zeaxanthin.
  • the mutant strains of the present invention are viable in dim light and specifically can be cultured under luminous conditions in the range of 10 to 2,000 ⁇ mol photons / m 2 s. Photosynthesis is not possible at complete darkness where the mutant strain is below the weak light condition, and cells may be damaged by light stress at too high light conditions.
  • culturing the mutant strain of the present invention under the above conditions there is an advantage of having a high growth rate, while having a high zeaxanthin content in the mutant strain.
  • the mutant strains of the present invention can grow appropriately in a growth environment (brightness conditions, temperature conditions, medium, etc.) capable of culturing conventional Chlamydomonas reinhardtia algae.
  • a growth environment (brightness conditions, temperature conditions, medium, etc.) capable of culturing conventional Chlamydomonas reinhardtia algae.
  • it has an excellent ability of accumulating zeaxanthin even at low brightness, and thus can be used industrially as a zeaxanthin pigment-producing microorganism due to its excellent ability to produce zeaxanthin, and the density in the colony is relatively low even under high brightness compared to other algae.
  • the pigment production efficiency due to photosynthesis in a single cell has an excellent effect.
  • the Chlamydomonas Reinhardtia wild type produced almost no zeaxanthin, but the mutant strains of the present invention contained about 30 times higher zeaxanthin content than the wild type and do not produce lutein, which is very suitable for the production of zeaxanthin. Do.
  • the mutant strain of the present invention can be cultured according to the general conditions of the general Chlamydomonas reinhardtia, and specifically, a culture medium capable of culturing algae under weak luminous conditions can be used.
  • a culture medium capable of culturing algae under weak luminous conditions
  • the nutrient substance required by the microorganism to be cultured that is, the culture medium
  • the medium may also be referred to as an incubator or a culture medium, and includes a natural medium, a synthetic medium, or a selective medium.
  • the Chlamydomonas Reinhardtia mutants can be cultured according to a conventional culture method.
  • the mutant strain of the present invention may be cultured in a photosynthetic medium, HS medium or TAP medium, and may further include a carbon source.
  • a photosynthetic medium for example, it may be cultured in a photosynthetic medium, HS medium or TAP medium, and may further include a carbon source.
  • the mutant strain of the present invention has excellent zeaxanthin production capacity.
  • the pH of the culture medium is not particularly limited as long as the range of Chlamydomonas reinhardti can survive and grow, for example, at pH 6 or more, specifically, pH 6 to pH 9, and may be pH 7.0 or more and less than pH 8.0. It can have an optimal growth rate.
  • Variant strains of the present invention can be prepared by introducing the RGEN RNPs directly into the target sequence in the ZEP gene and LCYE gene using the Christopher gene shear technique.
  • Chlamydomonas Reinhardtia mutants of the present invention can accumulate high amounts of zeaxanthin pigment in cells, and thus, zeaxanthin obtained from the mutant strain of the present invention or its culture can be effectively used as a raw material for food, feed, medicine, etc. have.
  • the present invention relates to a culture of said Chlamydomonas reinhardtia variant strain.
  • the term "culture” refers to a medium in which a specific microorganism is cultured, that is, a medium after culture, and the culture comprises a residue containing the Chlamydomonas Reinhardtia mutants or the mutants removed after culturing them. It includes everything.
  • the culture is meant to include both the concentrate of the culture or the dried product of the culture in which the culture medium is concentrated, dried and the like after the culture.
  • the culture may include by-products thereof, and the formulation is not limited, and may be, for example, liquid or solid.
  • the medium may contain a nutritional substance required by the microorganism to be cultured, that is, the culture medium in order to cultivate the characteristic microorganism, and may be mixed with an additional substance for a special purpose.
  • the medium may also be referred to as an incubator or a culture medium, and is a concept including all natural, synthetic, or selective media.
  • the pH of the medium may be in the range in which the Chlamydomonas Reinhardtia mutants can be grown, for example pH 6 or more, preferably pH 6 to pH 9.
  • the present invention also relates to a composition
  • a composition comprising one or more selected from the group consisting of Chlamydomonas reinhardtia mutants, cultures of the algae, dried products of the mutants or cultures and extracts thereof.
  • Variation of the present invention has a characteristic of generating a xanthophyll-based pigment containing zeaxanthin to accumulate in the body, in this aspect the composition may be a pigment composition, or may be a zeaxanthin pigment composition.
  • the pigment composition may be used as a raw material for food or feed, may be used as an oral administration or an oral administration formulation, and specifically, may be used as a preparation for oral, ocular or injection administration. Therefore, the pigment composition or the xanthophyll pigment composition containing the composition or extract may be a composition for oral administration or injection in that it can be supplied orally in food, medicine or feed.
  • compositions for oral administration include powders, granules, tablets, pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions, and the like, oral formulations formulated using methods known in the art. Can be.
  • oral formulations can obtain tablets or tablets of sugars by combining the active ingredients with solid excipients, milling them, adding suitable auxiliaries and then processing them into granule mixtures.
  • excipients examples include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol and starch, cellulose, including starch, corn starch, wheat starch, rice starch and potato starch, etc. Fillers such as cellulose, gelatin, polyvinylpyrrolidone, and the like, including methyl cellulose, sodium carboxymethylcellulose, hydroxypropylmethyl-cellulose, and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate and the like may optionally be added as a disintegrant.
  • the composition can be used for the purpose of promoting the health of humans and animals.
  • the mutant strain of the present invention has a high ability to produce zeaxanthin and can selectively produce only zeaxanthin without producing lutein, and thus can be used as a raw material for foods, health functional foods, feeds, or medicines containing zeaxanthin as an active ingredient. have.
  • the present invention is a variant of the present invention; Its culture; Dried products of the mutant strains or cultures; And eye health enhancement or maintenance comprising at least one selected from the group consisting of extracts of the mutant strains or cultures; Macular degeneration prevention or improvement; Preventing or improving deterioration of the eye; Improving or preventing damage to the retina; Inhibiting aging of the eye; Maintaining retinal health; Reduced risk of developing macular degeneration; Or it relates to a composition for preventing or improving macular degeneration.
  • the composition may be added to food or feed to achieve a particular purpose use, and in this aspect may be a food composition, a composition for food additives, a feed composition or a composition for feed additives.
  • the body may be maintained or strengthened by zeaxanthin produced by Chlamydomonas reinhardtia mutants and accumulated in cells.
  • the zeaxanthin may be used as a macular pigment to prevent or improve degeneration of the macula, and is effective in preventing or improving eye diseases associated with macular degeneration.
  • the zeaxanthin may be used to enhance or maintain eye health; Macular degeneration prevention or improvement; Preventing or improving deterioration of the eye; Improving or preventing damage to the retina; Anti-aging; Maintaining retinal health; Reduced risk of developing macular degeneration; Or since there is an effect of preventing or improving macular degeneration, the feed or food composition may be used for the prevention or amelioration of the symptoms, or for the effect.
  • additives is included if all the ingredients are added to the food or feed in addition to the main ingredients, specific examples of food and drug safety added in the active ingredient or processed foods having a functional function in food or feed for coloring, preservation, etc. It may be a food additive as defined by the department.
  • the food may be a health functional food. More specifically, it may be a health functional food for eye health.
  • Feed composition in the present invention may be prepared in the form of fermented feed, compound feed, pellet form and silage (silage) and the like.
  • the fermented feed includes Chlamydomonas reinhardtia mutant strain of the present invention, the dry strain of the mutant strain, the culture of the mutant strain and extracts thereof, and may be prepared by additionally including various microorganisms or enzymes.
  • the combination feed may be prepared by mixing, including various kinds of general feed and the mutant strain of the present invention, the dry cells of the mutant strain, the culture of the algae and extracts thereof.
  • Pellet feed can be prepared by formulating the fermented feed or blended feed into a pellet machine.
  • Silage may be prepared by mixing a cultivated feed and Chlamydomonas Reinhardtia mutants, dry cells of the mutants, cultures of the mutants and / or extracts thereof, but the use of the composition of the present invention is not limited thereto. .
  • the composition may be mixed with carriers and flavoring agents commonly used in the food or pharmaceutical field to form tablets, troches, capsules, elixirs, syrups, powders. It may be prepared and administered in the form of a suspension or granules.
  • binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents and the like can be used as the carrier.
  • the mode of administration may be oral, parenteral or application, but preferably oral administration.
  • the dosage may be appropriately selected depending on the absorbency, inactivation rate and excretion rate of the active ingredient in the body, age, sex, condition, etc. of the recipient.
  • the pH of the composition can be easily changed in accordance with the manufacturing conditions, such as drugs, foods, etc. that the composition is used.
  • the composition is 0.001 to 99.99% by weight, based on the total weight of the composition of any one selected from the group consisting of Chlamydomonas Reinhardtia mutant strain, culture of the mutant strain, dried product of the mutant strain or culture and extract of the mutant strain or culture.
  • Chlamydomonas Reinhardtia mutants may be included in the composition in its own or in dried form, and the culture of the algae may be included in the composition in concentrated or dried form.
  • the dried means the dried form of the algae or its culture, it may be in the form of powder prepared by lyophilization and the like.
  • the extract is meant to be obtained by extracting from Chlamydomonas Reinhardtia mutant strain of the present invention, its culture solution or dried product thereof, obtained by crushing the extract using a solvent or the like, Chlamydomonas Reinhardtia mutant strain of the present invention It includes.
  • the pigment accumulated in the cells of Chlamydomonas reinhardtia variant of the present invention may be extracted and separated by physical or chemical methods.
  • the extraction process may be carried out by a conventional method, for example, by adding an extraction solvent and homogenizing, pulverizing the cells can be extracted the target pigment.
  • the algae crushed material is removed by centrifugation, and the extraction solvent can be removed by distillation under reduced pressure. It may also further comprise a conventional purification process. Since the pigment has a property of being insoluble in water, it can be more easily extracted from the algae of the present invention.
  • Chlamydomonas Reinhardtia mutant of the present invention has excellent production capacity of xanthophyll, especially zeaxanthin at low brightness
  • the composition comprising the mutant and its by-products can improve the body activity, maintain body function and prevent degradation
  • the xanthophyll pigment is known to have macular degeneration inhibitory effect, antioxidant, anticancer effect, etc.
  • the composition of the present invention is for maintaining physical health, and in particular, preventing maintenance and deterioration of body functions related to the xanthophyll pigment. Or it can be used as a raw material contained in food, health food, medicine or feed for the purpose of improvement.
  • another object of the present invention is to provide a method for producing a pigment using the Chlamydomonas rain hard tia mutant of the present invention.
  • the pigment production method may include culturing Chlamydomonas reinhardtia mutants of the present invention.
  • another object of the present invention is to provide a raw material production method of food or feed comprising culturing the Chlamydomonas Reinhardtia mutants of the present invention.
  • the pigment may be zeaxanthin.
  • the mutant strain of the present invention it is possible to produce a high content of zeaxanthin without producing lutein, and thus there is a great advantage in that it can be effectively used for selective production of zeaxanthin.
  • Chlamydomonas Reinhardtia mutant of the present invention can increase the amount of zeaxanthin accumulation in the algae cultured, and do not produce lutein, so it is not necessary to go through the step for separating / purifying only zeaxanthin, which is used industrially It can be effectively used to supply zeaxanthin as a raw material.
  • the production method may further include, after the culturing step, separating the Chlamydomonas Reinhardtia mutants of the present invention from the culture.
  • the separated algae may be subjected to further processing steps including drying.
  • the production method may further include extracting a pigment from the Chlamydomonas rain hardy mutant strain of the present invention, the culture of the mutant strain, the concentrate of the culture or the dried product of the culture.
  • the culture may be performed in a medium of pH 6.0 to 8.0 conditions. It may also be carried out under light conditions, in particular light conditions in the range from 10 to 2,000 ⁇ mol photons / m 2 s.
  • Chlamydomonas reinhardtia variant of the present invention it is excellent in pigment production ability even at low brightness, and can increase the content of zeaxanthin in the body, and thus it is possible to achieve excellent zeaxanthin accumulation without administering high-brightness energy. Can be effectively used.
  • the extraction may be performed by a conventional method for extracting a pigment from a microorganism, and examples thereof include an enzyme method, an ultrasonic extraction method, a mechanical extraction method, and the like.
  • the production method may further include a concentration step of increasing the content of algae after the cultivation, and a drying step of drying by further reducing the moisture of the algae after the concentration step.
  • concentration step or the drying step is not necessarily required, and in general, it may be performed using a concentration and drying method or machine commonly used in the field to which the present invention belongs.
  • the production method may be performed by further including a purification step after the extraction step, which may be performed by a conventional purification method in the art.
  • Xanthophyll prepared through the concentration or drying step may be used as a raw material for food, health functional food, cosmetics or drugs.
  • the xanthophyll production method may be performed by employing another method within a range that does not impair the effects of the present invention.
  • mutant strains and compositions may be mutatis mutandis also for the production method of the present invention.
  • Clomidomonas algae was carried out according to the following medium and culture conditions, unless otherwise specified.
  • culture was performed by supplying 5% CO 2 in a minimum medium of HS medium.
  • the autoclave was autoclaved, using a cell in an active growth stage (growth stage) to start the growth by making a concentration of 10 6 cells / mL in the culture.
  • the culture vessel was supplied with air from the bottom using a glass column (column) as shown in FIG. 11, and light was emitted using a fluorescent lamp at a brightness of 200 uE from both sides.
  • acetic acid was added in TAP medium.
  • the autoclave was autoclaved and sterilized, and growth was started by making a concentration of 10 6 cells / mL in a culture medium using cells in an active growth stage.
  • the culture vessel was incubated in a large volume using a glass flask or bottle as shown in FIG. 12 and stirred using a magnetic bar.
  • the light of 70uE was given by using a fluorescent lamp.
  • sgRNAs Five sgRNAs were carefully designed within half of the coding sequence region of the ZEP gene which differed from any other target sites by 3 nucleotides (nt) in the whole genome and had an out-of-frame score higher than 66.
  • 'CDS (coding sequence) position' means the relative position of a cleavage point in an RNA transcript. + Of Direction is the sequence of RGEN in the same direction as the target sequence, that is, the same sequence is the sequence of RGEN, and-is the sequence of complement complementary relationship, which is the reverse of the target sequence, i.e., the sequence which is associated with the target sequence. Means.
  • 'Out-of-frame score' refers to the possibility of frameshift-induced deletions that occur when broken double-stranded DNA is repaired by the microhomology-mediated end joining (MMEJ) pathway.
  • MMEJ microhomology-mediated end joining
  • '# Of target-off sites' refers to the number of mismatched sequences throughout the entire genome. Linking the remaining sgRNA sequence (Gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc, SEQ ID NO: 18) to the target sequence shows the entire sgRNA.
  • Cas9 protein was prepared through purification by expressing a recombinant Cas9 protein (recombinant Cas9 protein) using E. coli .
  • the wild-type Chlamydomonas reinhardtia cw15 mt (CC-4349) used in the experiment was obtained through the Chlamydomonas Resource Center (www.chlamycollection.org) [http://www.chlamycollection.org/product/cc-4349- cw15-mt-goodenough-330a /].
  • Chlamydomonas cells were incubated in a 50 ml flask at 25 ° C. using TAP medium of Table 2 to provide light using a fluorescent lamp at a light intensity of 70 uE and shaking at 90 rpm. The concentration of cells was measured using a spectrophotometer, and cells of about 0.3 to 0.5 at OD 750 were actively cultured.
  • RNPs complex 200 ⁇ g of Cas9 protein (FIG. 5, SEQ ID NO: 15) was mixed with 140 ⁇ g of sgRNA (SEQ ID NO: 16) in nuclease-free water and incubated at room temperature for 10 minutes.
  • the bound RNPs complex was used with a Biorad Gene Pulser Xcell TM Electroporation System in a 4 mm electroporation cuvette with 50 ⁇ 10 4 wild-type Chlamydomonas Reinhardtia cw15 mt (CC-4349) cells. (Voltage 600V, Capacity 50uF), transformed by electric shock, incubated in dark for 12 hours, gDNA was extracted, and analyzed by targeted deep sequencing. Dilution was carried out on a TAP agar plate to obtain a single colony.
  • FIG. 3A and 3B show the results of confirming the mutation of the ZEP gene induced by RGEN-RNPs by target deep sequencing.
  • a single colony induced by the third most efficient sgRNA (0.456%) was isolated to identify mutations in the target gene.
  • Figure 3b is a result of the target in-depth sequencing, after the transformation experiment using the RNP to collect all the cells and gDNA extracted by analyzing all the mutations occurring in the DNA strands of the target site for all cells analyzed the pattern and frequency (frequency Can be seen.
  • FIG. 3B shows the patterns of mutations actually identified at the target site through target depth sequencing, since large size changes, such as insertions of 42 bp or more, are difficult to find with the principle of target depth sequencing, thus actually obtaining a single colony. (single colony) may vary.
  • the red circle in FIG. 6A indicates the putative ZEP knockout mutant grown on TAP agar medium under light (50 ⁇ mol photons / m 2 s) conditions.
  • NPQ / 4 images were measured by Imaging PAM (Walz).
  • Single cell colonies of wild type (WT) and ⁇ ZEP mutant strains were grown on at least agar medium under light (50 ⁇ mol photons / m 2 s) conditions (FIGS. 6A and 6B).
  • Three variants ( ⁇ Z1 , ⁇ Z2 , ⁇ Z3 ) with increased macula pigment content were selected from the colonies thus identified, and the target DNA sequence change of the actual ZEP gene position in three ZEP mutants generated by RGEN RNPs. was confirmed by Sanger sequencing (Figs. 2a, 2b and 2c).
  • Chlamydomonas rain hard tiahyi ZEP mutation 1 ( ⁇ Z1) to (Chlamydomonas reinhardtii ZEP mutant 1 ( ⁇ Z1)) in the mutant Korea Research Institute of Bioscience and Biotechnology Biological Resource Center (KCTC) was named 2017 It was deposited on March 22, 2011 and was granted accession number KCTC 13230BP.
  • mutant Z1 was used for double gene correction.
  • Example 3 From Chlamydomonas Crisper Genetic scissors technology ( CRISPR - Cas9 RNP With) LCYE ( Lycopene epsilon cyclase A) gene knockout Chlamydomonas Mutant Manufacturing
  • sgRNAs used Cas-Designer (www.rgenome.net) to construct four sgRNAs to induce microhomology-driven frame shift mutations.
  • Cas-Designer www.rgenome.net
  • Four sgRNAs designed to target the LCYE gene are shown in Table 4 below (see Table 3 for the meaning of each item; target locations in Table 4 describe base positions based on CDS sequences).
  • RNPs complex 200 ⁇ g of Cas9 protein (SEQ ID NO: 15) and 140 ⁇ g of sgRNA (SEQ ID NO: 17) were mixed in nuclease-free water and incubated at room temperature for 10 minutes.
  • the combined RNPs complex was prepared with a Biorad Gene Pulser Xcell TM Electroporation System in a 4 mm electroporation cuvette with 1 ⁇ g hygromycin resistant gene cassette and 50 ⁇ 10 4 Chlamydomonas cells. By transfection (Voltage 600V, Capacity 50uF), incubated for 12 hours, and then all were plated on TAP agar plates with hygromycin added to single colony. Got.
  • Figure 7 shows the gene information and target sequence of the LCYE of wild-type Chlamydomonas Reinhardtia birds, the dZL1 and dZL2 mutants selected through the genetic correction has the genetic information of Figures 8a and 8b respectively. Sanger sequencing) confirmed.
  • mutant dZL1 was named Chlamydomonas Reinhardti double ZEP / LCYE mutant 1 (dZL1), which was deposited on August 21, 2018 at the Korea Institute of Bioscience and Biotechnology (KCTC). Accession number KCTC 13626BP was assigned.
  • the total flow rate of the solvent was 1.2 mL / min, and uniformly decreased Tris of pH 8.0 to 14%, acetonitrile to 84% to 0%, respectively, from 0 minutes to 15 minutes, Methanol and ethyl acetate started at 2% and increased by 68% and 32%, respectively, by the 15th minute.
  • the solvent ratio is then maintained for 3 minutes (15th to 18th minutes), then for 1 minute (18th to 19th minutes), return to the rate at which each solvent is started and then for the remaining 6 minutes. Postruns were maintained as they were.
  • FIGS. 10A and 10B are ZEP It is the result of the analysis of the pigment
  • FIG. 10a the pigment profile of the cells was analyzed using HPLC
  • FIG. 10b the amounts of lutein and zeaxanthin per chlorophyll a (Chl a) were compared with wild type.
  • the mutant of ZEP / LCYE double gene knockout showed no lutein content, unlike the Z1 mutant strain . It can be seen that it has a very different bacteriological properties from the mutant strains containing only mutations.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Food Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Nutrition Science (AREA)
  • Animal Husbandry (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 개선된 지아잔틴 색소 생산능을 갖는 새로운 조류에 관한 것으로, 본 발명의 변이주를 이용하면 잔토필 색소 중에서도 지아잔틴만을 손 쉽게 생산할 수 있고, 특히, 잔토필 색소 중에서 루테인과 지아잔틴 색소를 분리하는 단계를 요구하지 않으므로, 산업 수준에서 효율적으로 색소를 생산할 수 있어, 이를 포함하는 식품, 건강기능식품 및 의약품의 원료로 적용이 가능하다. 특히, 지아잔틴은 산화적 스트레스에 의해 생성되는 항산화 색소로서 자연계에서 적은 함량으로 존재하기 때문에 그동안 중요도에 비해 활용이 어려웠던 만큼 본 발명의 변이주는 미세조류를 이용한 지아잔틴을 생산하는 산업적인 측면에서 큰 경제 효과를 갖는다.

Description

클라미도모나스 변이주 및 이의 제조방법
본 발명은 지아잔틴 생산능을 갖는 조류, 상기 조류의 생산 방법, 그리고 상기 조류의 용도에 관한 것이다.
황반변성이란 눈의 안쪽 망막의 중심부에 위치한 신경조직인 황반에 변성이 일어나 시력장애를 일으키는 질환으로, 시세포의 대부분이 황반에 모여있고 물체의 상이 맺히는 곳도 황반의 중심이므로 황반은 시력에 대단히 중요한 역할을 담당하고 있다. 황반변성을 일으키는 가장 많은 원인은 연령증가(연령관련 황반변성)를 들 수 있고, 가족력, 인종, 흡연과 관련이 있다고 알려져 있다.
황반변성은 크게 비삼출성(건성)과 삼출성(습성)으로 구분하게 되는데, 80-90% 정도가 비삼출성 황반변성에 해당한다. 비삼출성 황반변성은 서서히 진행되고 증상이 급격히 나빠지는 상황은 거의 일어나지 않으나 특별한 치료제가 없어, 건강식품 등을 통해서 증상을 완화하고 더 이상 나빠지지 않게 하는데 큰 도움을 받을 수 있다. 삼출성 황반변성은 상당히 위급하게 진행되므로, 시력보존을 위한 적극적인 치료가 필요하다. 변성이 일어난 부위의 경계를 명확히 알 수 있는 경우 열레이저광응고술, 광역학 치료, 항체주사, 유리체절제술 등을 시행할 수 있으나, 현재 황반변성을 완벽히 치료할 수 있는 방법 또는 치료제는 존재하지 않는다.
열레이저응고술의 경우 장기적인 시력저하 예방에는 효과가 있으나, 레이저치료 후 즉시 망막을 손상시켜 시력이 감소되는 문제점이 있고, 이러한 문제점을 보완하기 위해 약물과 레이저를 함께 사용하는 광역학 치료(photodynamic therapy, PDT)가 개발되어 신생혈관성 병변을 안정화시키는데 도움이 되기는 하나, 치료의 적응에 제한이 있고, 치료약이 비싸 재치료를 필요로하는 경우가 많은 단점이 여전히 존재한다. 최근 신생혈관 생성 촉진 인자인 혈관내피세포 성장인자(VEGF)를 억제하여 신생혈관의 생성 및 삼출물의 누출을 차단하는 혈관내피세포 성장인자 억제 항체들이 임상시험에서 삼출성 황반변성 환자에서 시력의 유지 및 개선에 좋은 결과를 보였으나, 비용이 매우 비싸고, 반복 주사가 필요하며, 감염, 안압 상승 등의 부작용이 발생할 가능성이 높고, 결절맥락막 혈관병증의 30% 정도는 효과가 없다는 문제가 여전히 존재한다.
이러한 황반변성은 황반색소의 꾸준한 섭취 등을 통해서 예방 또는 그 진행을 늦출 수 있는데, 황반색소는 망막의 중앙부분에서 기인한 노인성 시력 감퇴를 줄여주고, 밝은 광선에 의한 망막조직의 손상을 막아주는 역할을 한다. 대표적인 예로 카로티노이드의 산소화에 의해 생산되는 카로티노이드계의 옥시카로티노이드 색소로 잔토필(크산토필, xanthophyll)로, 잔토필류에 속하는 색소로는 루테인(lutein) 또는 지아잔틴(zeaxanthin) 등이 있다.
동물은 잔토필을 생성할 수 없고, 음식의 섭취를 통해서만 얻을 수 있는데, 종래에는 마리골드와 같은 고등 식물로부터 추출하였으나, 그 효율이 낮고, 특히 고등식물의 경우 생산을 위한 토지 면적에 비해서 생산량이 많지 않아 생산 단가가 높은 문제가 있다. 또한, 루테인은 마리골드를 포함한 대다수의 녹색 잎채소에 풍부하지만 지아잔틴은 산화적 스트레스에 의해 생성되는 색소이므로 이들의 함량은 루테인과 비교시 훨씬 적어서 지아잔틴의 원료로 녹색 식물을 사용하기가 어렵다. 녹색 식물 시스템을 대체하기 위해 박테리아 시스템이 고안되었으나, 박테리아에서 얻어지는 색소는 궁극적으로 식품첨가물로 이용되기에는 부적합하고, 박테리아의 배양액 이나 바이오리액터 역시 유지비가 매우 비싸다는 문제가 있다.
이에 대한 해결책으로 미세조류가 이산화탄소를 바이오 연료, 산화 방지제, 지방산 및 카로티노이드와 같은 고부가가치 제품으로 전환시키는 광합성 세포 공장으로 주목받고 있는다. 미세조류는 다른 원천보다 더 많은 카로티노이드 함량을 가지며, 성장률 및 생산성이 높고, 경작지의 제한이 없고, 수확 주기가 짧아 카르티노이드 색소를 생산하는데 매우 적합한 장점이 있으나, 색소 간의 분리에 어려움이 있어, 특정 색소를 선택적으로 생산하기 위한 연구가 아직 필요한 상황이다.
특히, 이러한 장점에도 불구하고, 개량되지 않은 야생형 미세조류는 녹색식물과 같이 일반적으로 루테인이 풍부하지만 지아잔틴의 함량은 낮고, 배양 조건 만으로 지아잔틴을 선택적으로 생산할 수 없어, 야생형 미세조류는 여전히 지아잔틴 색소 생산에는 적합하지 않다. 따라서, 미세조류를 이용한 지아잔틴의 산업적 생산을 위한 새로운 측면에서의 접근이 필요하다.
본 발명의 목적은 지아잔틴의 효과적인 생산을 위한 방법 및 이를 통한 지아잔틴을 제공하기 위한 것으로, 구체적으로 효율적이고 개선된 지아잔틴 생산을 위해 우수한 지아잔틴 생성능을 갖는 미세조류 및 이의 용도를 제공하는데 있다.
상기한 목적을 달성하기 위해서, 본 발명자들은 유전적 재조합 방법이 아닌 다른 변이를 이용하여 야생형 또는 종래 존재하던 미세조류로부터 생물학적 특성이 개선된 변이주를 개발하고, 이를 이용한 최적의 지아잔틴 생산 방법을 확인하여 본 발명을 완성하였다. 특히, 본 발명의 변이주는 잔토필 색소 중에서 현저히 개선된 지아잔틴 생성능을 가지면서, 루테인은 생성하지 않아 조류의 배양 후 색소를 추출 및 분리하는 과정에서 지아잔틴만을 손쉽게 얻을 수 있다는 장점이 있다.
이러한 측면에서, 본 발명은 서열번호 1로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 ZEP 유전자 서열에서 816번째 염기와 817번째 염기 사이에 아데닌(A); 서열번호 3으로 표시되는 염기서열; 또는 서열번호 5로 표시되는 염기서열이 삽입된 ZEP 유전자 변이; 및 서열번호 2로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 LCYE 유전자 서열에서 599번째 염기와 600번째 염기 사이에 서열번호 9로 표시되는 염기서열; 또는 서열번호 11로 표시되는 염기서열이 삽입된 LCYE 유전자 변이를 포함하는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii) 변이주를 제공한다.
상기 변이주는 지아잔틴(zeaxanthin) 생성능을 가지면서, 루테인(lutein)을 생산하지 않는 것 일 수 있다.
또한, 본 발명은 상기 변이주의 배양물을 제공한다.
또한, 본 발명은 상기 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 색소 조성물을 제공한다. 상기 색소는 지아잔틴(zeaxanthin)일 수 있다.
또한, 본 발명은 상기 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 눈 건강 강화 또는 유지; 황반변성 예방 또는 개선; 눈의 기능 저하 예방 또는 개선; 망막의 손상 개선 또는 예방; 눈의 노화 억제; 망막 건강 유지; 황반변성 발병 위험 감소; 또는 시력감퇴 예방 또는 개선용 조성물을 제공한다.
또한, 본 발명은 상기 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 식품 또는 식품첨가제용 조성물 을 제공한다.
또한, 본 발명은 상기 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 사료 또는 사료첨가제용 조성물을 제공한다.
또한, 본 발명은 상기 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 주사제용 조성물을 제공한다.
또한, 본 발명은 상기 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 눈 건강 강화 또는 유지; 황반변성 예방 또는 개선; 눈의 기능 저하 예방 또는 개선; 망막의 손상 개선 또는 예방; 노화 억제; 망막 건강 유지; 황반변성 발병 위험 감소; 또는 시력감퇴 예방 또는 개선을 위한 건강기능식품을 제공한다.
또한, 본 발명은 변이주를 배양하는 것을 포함하는 색소 생산방법을 제공한다.
또한, 본 발명은 상기 변이주를 배양하는 것;을 포함하는 식품 또는 사료의 원료 생산방법을 제공한다.
본 발명을 통해 미세조류 클라미도모나스 레인하드티아이에서 외부 DNA의 도입이 없는 ZEP 유전자와 LCYE 유전자를 동시에 녹아웃 시킬 수 있는 변이 위치를 밝히고, 이에 따라 동시 녹아웃을 포함하는 새로운 변이주를 개발하였다. 상기 부위의 변이를 포함하는 변이주의 세포 특성을 확인한 결과 산업적으로 유용한 색소인 지아잔틴 생산량의 현저한 증가와 동시에 루테인을 생산하지 않는 특성을 보유하고 있어, 지아잔틴과 루테인을 분리/정제하는 단계를 거치지 않고도, 상업적 규모에서 효율적으로 지아잔틴을 생산할 수 있음을 확인하여, 미세조류를 이용한 지아잔틴의 산업적인 생산 측면에서 큰 경제효과를 낼 수 있을 것으로 기대된다.
도 1은 본 발명의 일 실시예에 따라 ZEP 및 LCYE 유전자 교정된 클라미도모나스 변이주의 제작 방법에 대한 전반적인 기술을 나타낸다.
도 2a, 2b 및 2c는 각각 클라미도모나스 레인하드티아이 변이주 ΔZ1의 ZEP 유전자 정보(2a, 서열번호 4), 클라미도모나스 레인하드티아이 변이주 ΔZ2의 ZEP 유전자 정보(2b, 서열번호 6) 및 클라미도모나스 레인하드티아이 변이주 ΔZ3의 ZEP 유전자 정보(2c, 서열번호 8)를 나타낸다.
도 3a 및 3b는 DNA-free RGEN RNPs에 의해 유도된 ZEP 유전자의 돌연변이를 나타낸 것이다[3a: 각 sgRNA에 대한 RGEN-트랜스펙션된 세포 및 야생형의 돌연변이 (삽입 및 결실; indel) 빈도가 표적화된 심층 서열화(Targeted deep sequencing)에 의해 측정되었다. Indel 빈도는 약 0.46%까지 측정되었다. 3b: a의 표적화된 심층 서열화(Targeted deep sequencing) 분석 결과에서 관찰된 가장 효율이 높은 세 번째 sgRNA로부터 얻어진 대표적인 돌연변이체 DNA 서열(RGEN3), 즉 TCCGGCGAACGCACCTGGATGGG. 표적화된 심층 서열화(Targeted deep sequencing) 분석 결과에 의해 타겟 서열에서 확인된 다양한 indel 패턴, PAM 서열의 3nt 상류에서 나타났다. 20-bp 표적 서열은 밑줄로 표시되고 PAM 서열은 굵게 표시하였다.]
도 4는 DNA-free RGEN RNPs에 의해 발생된 세 개의 ZEP 돌연변이체에서 실제적인 ZEP 유전자 위치의 표적 DNA 서열 변화를 생어 분석법(Sanger sequencing)을 통해 확인한 결과를 나타낸다[a: 야생형(wildtype), b: ZEP mutant 1(ΔZ1), c: ZEP mutant 2(ΔZ2) d. ZEP mutant 3 (ΔZ3)].
도 5는 본 발명의 일 실시예에서 사용된 Cas9 단백질 서열(서열번호 15)을 나타낸다.
도 6a, 6b 및 6c는 클라미도모나스 레인하드티아이 cw15 야생형 조류, 클라미도모나스 레인하드티아이 변이주 ΔZ1, ΔZ2, ΔZ3의 형태적인 특성을 나타내는 사진이다[6a: ZEP 유전자 녹아웃을 연구하기 위한 수백 개의 콜로니들에 대한 클로로필(Chl) 형광의 측정, 6b: 한천이 들어간 고체 TAP 배지에서 콜로니(Colony) 상태로 배양된 사진, 6c: HS 배지에서 액체 배양한 후 동일한 농도(OD 750 = 1)로 맞췄을 때의 상태를 보여주는 사진].
도 7은 야생형 클라미도모나스의 LCYE(Lycopene epsilon cyclase) 유전자의 서열정보(서열번호 2)를 나타낸다.
도 8a 및 도 8b는 각각 클라미도모나스 레인하드티아이 dZL1 변이주의 LCYE 유전자(서열번호 10, 8a)와 dZL2 변이주의 LCYE 유전자(서열번호 12, 8b)에 대한 정보를 나타낸다. 붉은색으로 밑줄 표시된 서열은 각각 변이주에 삽입된 서열을 의미한다.
도 9는 야생형 클라미도모나스 레인하드티아이 cw15, ZEP 1 변이주, dZA1 변이주, dZA2 변이주 각각의 고체 TAP 배지에서 세포 사진을 나타낸다.
도 10a 및 10b는 본 발명의 일 실시예에 따른 색소 분석결과를 나타내는 것으로, 10a는 클라미도모나스 레인하드티아이 cw15 야생형 조류, ZEP Mutant 1, 변이주 dZL1 및 변이주 dZL2의 색소의 프로파일을 비교한 것이고, 10b는 클라미도모나스 레인하드티아이 변이주 ΔZ1, ΔZ2, ΔZ3의 색소 프로파일을 비교한 HPLC 분석 그래프: 엽록소 a(chlorophyll a; Chl a) 당 루테인과 지아잔틴의 함량 분석 그래프이다: neo - 네오잔틴(neoxanthin), vio - 비올라잔틴(violaxanthin), An - 안테라잔틴(antheraxanthin), lut - 루테인(lutein), zea - 지아잔틴(zeaxanthin), chl a - 엽록소 a(chlorophyll a), chl b: 엽록소 b(chlorophyll b).
도 10c는 본 발명의 일 실시예에 따라 클라미도모나스 레인하드티아이 cw15 야생형 조류, ZEP Mutant 1, 변이주 dZL1 및 변이주 dZL2의 지아잔틴 및 루테인 생산 특성 및 생산량을 확인한 그래프이다.
도 11은 본 발명의 일 실시예에 따른 독립영양 배양 용기를 나타낸 것이다.
도 12는 본 발명의 일 실시예에 따른 혼합영양 배양 용기를 나타낸 것이다.
본 발명은 다양한 변경을 가할 수 있고 여러 가지 형태를 가질 수 있는바, 이하에서 기술하는 특정 실시예 및 설명은 본 발명의 이해를 돕기 위한 것일 뿐, 본 발명을 특정한 개시 형태에 대해 한정하려는 것이 아니다. 본 발명의 범위는 본 발명의 사상 및 기술 범위에 포함되는 모든 변경, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
본 발명은 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii) 변이주에 관한 것이다.
본 발명의 클라미도모나스 레인하드티아이는 단세포 녹조류(Chlorophyta)로서 민물, 해양 등의 다양한 환경에 분포하는 진핵생물이며, 6~8시간의 분열시간(doubling time)을 가진다. 또한, 가장 널리 보급되어 있는 미세조류 모델 시스템들 중 하나로, 바이오리액터에서 생산이 가능하다.
본 발명의 변이주는 일반적인 돌연변이 처리가 아닌 RGNE RNPs, 크리스퍼 유전자 가위 기술을 이용하여 ZEP(Zeaxanthin epoxidase) 유전자와 LCYE(Lycopene epsilon cyclase) 유전자를 녹아웃시켜 제작될 수 있다. 이러한 측면에서, 본 발명의 변이주는 ZEP(Zeaxanthin epoxidase) 유전자와 LCYE(Lycopene epsilon cyclase) 유전자의 특정 위치에서 변이를 포함하는 것 일 수 있다. 크리스퍼 유전자 가위 기술을 이용하는 경우 원하는 유전자의 위치에 특이적으로 유전자 녹아웃이 가능하므로, 본 발명의 변이주는 정에하여 ZEP(Zeaxanthin epoxidase) 유전자와 LCYE(Lycopene epsilon cyclase) 유전자의 변이를 위치를 통해서 특정될 수 있고, 야생형 클라미도모나스 레인하드티아이 미세조류로부터 변이주의 생산이 가능하다.
본 발명에서 "변이"란 원래의 염기서열에 염기의 삽입, 결실, 또는 치환 등에 의하여 염기서열이 달라지는 것을 나타내는 것으로, 구체적으로"삽입 변이"란 일부의 염기가 원래의 염기서열 사이로 삽입되어 발생되는 변이를 의미하는 것으로, 상기 삽입되는 염기의 개수는 변이에 따라 상이할 수 있고, 이에 따라 제한되지 않는다.
본 발명의 변이주는 서열번호 1로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 ZEP 유전자 서열에서 816번째 염기와 817번째 염기 사이에 일부 염기가 삽입된 삽입 변이를 포함할 수 있고, 이를 통해서 ZEP 유전자를 녹아웃 시킬 수 있다.
본 발명은 일 실시예에서, 야생형 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii) cw15의 ZEP 유전자 서열(서열번호 1)에서 816번째 염기와 817번째 염기 사이에 아데닌(A); 서열번호 3으로 표시되는 염기서열; 또는 서열번호 5로 표시되는 염기서열이 삽입된 ZEP 유전자 변이를 포함할 수 있고, 상기 각 변이주에서 ZEP 유전자가 효과적으로 넉아웃 된 것을 확인하였다. 따라서, 본 발명의 변이주는 ZEP 유전자 서열(서열번호 1)에서 816번째 염기와 817번째 염기 사이에 아데닌(A); 서열번호 3으로 표시되는 염기서열; 또는 서열번호 5로 표시되는 염기서열이 삽입된 ZEP 유전자 변이를 포함할 수 있다.
또한, 본 발명의 변이주는 서열번호 2로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 LCYE 유전자 서열에서 599번째 염기와 600번째 염기 사이에 일부 염기가 삽입된 변이를 포함할 수 있고, 이를 통해서 LCYE 유전자를 녹아웃 시킬 수 있다.
본 발명은 일 실시예에서, 야생형 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii) cw15의 LCYE 유전자 서열(서열번호 2)에서 599번째 염기와 600번째 염기 사이에 94개 또는 1870개의 염기가 각각 삽입된 변이주를 제조하였고, 상기 각 변이주에서 LCYE 유전자가 효과적으로 넉아웃 된 것을 확인하였다.
본 발명의 일 실시예서 서열번호 2의 LCYE 유전자 서열에서 4개의 타겟 부위를 선정하여, sgRNA를 설계하고 이를 이용해서, Cas9을 통한 유전자 교정을 시도한 결과, 다른 타겟부위를 이용한 경우 LCYE 유전자의 녹아웃이 효과적으로 발생하지 않았으나, 186번째 염기부터 209번째의 연속하는 염기를 타겟으로하여 599번째 염기와 600번째 염기 사이에 변이를 발생시킨 경우에만 LCYE 유전자가 효과적으로 녹아웃되었음을 확인하였다. 따라서, 본 발명은 상기 서열번호 2의 LCYE 유전자 서열에서 599번째 염기와 600번째 염기 사이에 삽입 변이가 발생하는 경우 LCYE 유전자가 녹아웃 된 변이주를 얻을 수 있다는 점에서 매우 큰 기술적 특징이 있다.
본 발명의 일 실시예에 따른, 변이주는 LCYE 유전자 서열(서열번호 2)에서 599번째 염기와 600번째 염기 사이에 서열번호 9로 표시되는 염기서열; 또는 서열번호 11로 표시되는 염기서열이 삽입된 LCYE 유전자 변이를 포함할 수 있다. 따라서, 본 발명의 변이주는 LCYE 유전자 서열(서열번호 2)에서 599번째 염기와 600번째 염기 사이에 열번호 9로 표시되는 염기서열; 또는 서열번호 11로 표시되는 염기서열이 삽입된 LCYE 유전자 변이를 포함할 수 있다.
바람직하게, 본 발명의 변이주는 ZEP 및 LCYE 유전자 변이를 동시헤 포함하는 것 일 수 있다. 구체적으로, 서열번호 1로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 ZEP 유전자 서열에서 816번째 염기와 817번째 염기 사이에 아데닌(A); 서열번호 3으로 표시되는 염기서열; 또는 서열번호 5로 표시되는 염기서열이 삽입된 ZEP 유전자 변이; 및 서열번호 2로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 LCYE 유전자 서열에서 599번째 염기와 600번째 염기 사이에 서열번호 9로 표시되는 염기서열; 또는 서열번호 11로 표시되는 염기서열이 삽입된 LCYE 유전자 변이를 포함하는 클라미도모나스 레인하드티아이 변이주 일 수 있다.
보다 구체적인 예로, 본 발명의 변이주는 서열번호 4, 서열번호 6, 또는 서열번호 8로 표시되는 ZEP 유전자 변이; 및 서열번호 8; 또는 서열번호 10으로 표시되는 LCYE 유전자 변이를 포함하는 것 일 수 있다.
본 발명의 구체적인 일 실시예에서, 서열번호 8의 ZEP 유전자 변이; 및 서열번호 10으로 표시되는 LCYE 유전자 변이를 포함하는 ZEP/LCYE 이중 유전자 녹아웃 변이주를 dZL1(double ZEP/LCYE mutant 1)으로 명명하였고, 서열번호 8의 ZEP 유전자 변이; 및 서열번호 12로 표시되는 LCYE 유전자 변이를 포함하는 이중 유전자 녹아웃 변이주를 dZL2(double ZEP/LCYE mutant 2)로 명명하였다.
본 발명자는 또한, 상기 선발된 변이주 중 클라미도모나스 레인하드티아이 double ZEP/LCYE mutant 1(dZL1) 변이주를 한국생명공학연구원 생명자원센터(KCTC)에 2018년 8월 21일자로 기탁되어, 수탁번호 KCTC 13626BP를 부여받았다.
상기 두 변이주 모두 ZEP/LCYE 이중 유전자 녹아웃이 효과적으로 이루어져 루테인은 생산하지 않으면서, 현저히 향상된 지아잔틴 생상능을 가짐을 확인하였다. 특히, 본 발명의 변이주는 종래 지아잔틴 생산능이 없는 클라미도모나스 레인하드티아이 cw15 야생형과 비교해서 지아잔틴 생산능이 현저하게 향상되었고, 특히, 루테인을 생산하지 않아, 지아잔틴 만을 선택적으로 생산할 수 있는 특성을 가져, 지아잔틴 생산에 효과적으로 사용할 수 있는 장점을 갖는다.
본 발명의 변이주는 약광(dim light)에서 생존 가능하고, 구체적으로 10 내지 2,000 μmol photons/m2s 범위의 광도 조건 하에서 배양될 수 있다. 상기 변이주가 약광 조건 이하인 완전한 어둠에서는 광합성을 할 수 없고, 너무 높은 광 조건에서는 광 스트레스에 의해 세포가 데미지를 입을 수 있다. 상기 조건에서 본 발명의 변이주를 배양하는 경우, 변이주 내 지아잔틴 함량이 높으면서도, 우수한 생장률을 갖는 장점이 있다.
본 발명의 변이주는 통상의 클라미도모나스 레인하드티아이 조류를 배양할 수 있는 생장환경(광도 조건, 온도 조건, 배지 등) 내에서 적절한 성장을 할 수 있다. 또한, 낮은 광도에서도 우수한 지아잔틴의 축적능을 갖는 바, 이러한 우수한 지아잔틴 생산능에 의하여 지아잔틴 색소 생산 미생물로 산업적으로 효과적으로 사용될 수 있고, 고광도 하에서도 군집 내의 밀도가 다른 조류와 비교해서 상대적으로 낮아, 단일 세포 내 광합성에 의한 색소 생산 효율이 우수한 효과를 갖는다. 구체적으로 클라미도모나스 레인하드티아이 야생형은 지아잔틴을 거의 생산하지 못하였으나, 본 발명의 변이주는 야생형 보다 지아잔틴 함유량이 약 30 배 이상 더 높고, 루테인을 생산하지 않아, 지아잔틴의 생산에 매우 적합하다.
본 발명의 변이주는 일반적인 클라미도모나스 레인하드티아이의 배양 조건에 따라 배양할 수 있고, 구체적으로 약한 광도 조건에서 조류를 배양할 수 있는 배양 배지를 사용할 수 있다. 특정 미생물을 배양하기 위하여 배양대상 즉 배양체가 되는 미생물이 필요로 하는 영양물질을 포함하는 것으로 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 배양기 또는 배양액이라고도 하며, 천연 배지, 합성 배지 또는 선택 배지를 모두 포함하는 개념이다. 상기 클라미도모나스 레인하드티아이 변이주는 통상의 배양방법에 따라 배양할 수 있다. 예를 들면, 광합성 배지인 HS 배지 또는 TAP 배지로 배양할 수 있으며, 탄소원을 추가로 포함할 수 있다. 일 구현예에 있어서, 본 발명의 실시예 내 표 1 또는 표 2의 배양액 조성환경에서, 본 발명의 변이주가 우수한 지아잔틴 생산능을 가짐을 확인하였다.
상기 배양배지의 pH는 클라미도모나스 레인하드티아이가 생존 및 성장 가능한 범위라면 특별히 제한되지 않고, 일 예로 pH 6 이상, 구체적으로 pH 6 내지 pH 9에서 생존가능하며, pH 7.0 이상 내지 pH 8.0 미만에서 최적의 성장률을 가질 수 있다.
본 발명의 변이주는 크리스퍼 유전자 가위 기술을 이용하여 ZEP 유전자 및 LCYE 유전자 내 타겟 서열에 직접 RGEN RNPs로 도입함으로써 제작할 수 있다.
본 발명의 클라미도모나스 레인하드티아이 변이주는 세포 내에 지아잔틴 색소를 고함량으로 축적할 수 있어, 본 발명의 변이주 또는 이의 배양물로부터 얻은 지아잔틴을 식품, 사료, 의약품 등의 원료로 효과적으로 사용될 수 있다.
이러한 측면에서, 본 발명은 상기 클라미도모나스 레인하드티아이 변이주의 배양물에 관한 것이다.
본 발명에서 "배양물"이란 특정 미생물이 배양된 배지, 즉 배양 후 배지를 의미하는 것으로, 상기 배양물은 상기 클라미도모나스 레인하드티아이 변이주를 포함하거나 또는 이를 배양한 후 변이주를 제거한 잔여물을 모두 포함한다. 상기 배양물은 배양 후 배양배지를 농축, 건조 등의 가공을 한 상기 배양물의 농축물 또는 상기 배양물의 건조물을 모두 포함하는 의미이다. 상기 배양물은 그의 부산물을 포함할 수 있고, 그 제형이 한정되지 아니하며, 일 예로 액체 또는 고체일 수 있다.
상기 배지는 특성 미생물을 배양하기 위하여 배양대상 즉 배양체가 되는 미생물이 필요로 하는 영양물질을 포함하는 것으로 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 배양기 또는 배양액이라고도 하며, 천연배지, 합성배지 또는 선택배지를 모두 포함하는 개념이다. 상기 배지의 pH는 클라미도모나스 레인하드티아이 변이주가 생장 가능한 범위일 수 있고, 일 예로 pH 6 이상, 바람직하게는 pH 6 내지 pH 9 일 수 있다.
또한, 본 발명의 클라미도모나스 레인하드티아이 변이주, 상기 조류의 배양물, 상기 변이주 또는 배양물의 건조물 및 이의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 조성물에 관한 것이다.
본 발명의 변이주는 지아잔틴을 포함하는 잔토필계 색소를 생성하여 체내 축적하는 특성을 가지는 바, 이러한 측면에서 상기 조성물은 색소 조성물일 수 있고, 또는 지아잔틴 색소 조성물일 수 있다.
본 발명의 일 실시예에 따라, 클라미도모나스 레인하드티아이 야생형 조류, 클라미도모나스 레인하드티아이 변이주 각 세포당 총 색소 내 지아잔틴의 함량을 측정한 결과, 클라미도모나스 레인하드티아이 변이주의 경우 야생형 또는 ZEP 유전자 변이만을 포함하는 변이주와 비교해서도 색소 중 지아잔틴의 함량이 현저하게 높은 것을 확인할 수 있었다(도 10의 b).
상기 색소 조성물은 식품 또는 사료의 원료로 사용될 수 있고, 경구 투여 또는 경구 외 투여 제제로 사용될 수 있고, 구체적으로 경구, 안구 또는 주사제 투여를 위한 제제로 사용될 수 있다. 따라서, 상기 조성물 또는 추출물을 포함하는 색소 조성물 또는 잔토필 색소 조성물은 식품, 의약품 또는 사료 등에 포함되는 경구로 공급될 수 있다는 점에서 경구 투여 또는 주사제용 조성물일 수 있다.
경구 투여용 조성물의 경우, 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 등으로 당업계에 공지된 방법을 이용하여 제형화된 경구용 제제에 포함될 수 있다. 예를 들어, 경구용 제제는 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의 정제물을 수득할 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다.
상기 조성물은 인간 및 동물의 건강 증진을 위한 용도로 사용될 수 있다. 구체적으로 본 발명의 변이주는 지아잔틴 생산능이 높고, 루테인을 생산하지 않고 지아잔틴 만을 선택적으로 생산할 수 있어 지아잔틴이 유효성분으로 포함되는 식품, 건강기능식품, 사료 또는 의약품 등의 원료로서 이용될 수 있다.
이러한 측면에서 본 발명은 본 발명의 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 눈 건강 강화 또는 유지; 황반변성 예방 또는 개선; 눈의 기능 저하 예방 또는 개선; 망막의 손상 개선 또는 예방; 눈의 노화 억제; 망막 건강 유지; 황반변성 발병 위험 감소; 또는 시력감퇴 예방 또는 개선용 조성물에 관한 것이다.
또한, 상기 조성물은 식품 또는 사료에 특별한 목적 용도를 달성하기 위하여 첨가될 수 있으므로, 이러한 측면에서 식품 조성물, 식품첨가제용 조성물, 사료 조성물 또는 사료첨가제용 조성물일 수 있다. 상기 조성물이 사료 또는 식품에 사용되는 경우, 클라미도모나스 레인하드티아이 변이주에 의해 생산되고 세포에 축적된 지아잔틴에 의하여 체내 건강을 유지 또는 강화할 수 있다. 구체적으로, 상기 지아잔틴은 황반 색소로서 황반의 변성 등을 예방 또는 개선할 수 있어, 황반 변성과 관련된 눈 질환의 예방 또는 개선에 효과적이다. 더욱 구체적으로 상기 지아잔틴은 눈 건강 강화 또는 유지; 황반변성 예방 또는 개선; 눈의 기능 저하 예방 또는 개선; 망막의 손상 개선 또는 예방; 노화 억제; 망막 건강 유지; 황반변성 발병 위험 감소; 또는 시력감퇴 예방 또는 개선 효과가 있으므로, 상기 사료 또는 식품 조성물은 상기 증상의 예방 또는 개선, 또는 상기 효과를 위한 용도로 사용될 수 있다.
본 발명에서 "첨가제용"은 식품 또는 사료에 주원료가 외에 첨가되는 구성이라면 모두 포함되며, 구체적인 예로 식품 또는 사료에서 기능성을 갖는 유효 활성물질 또는 가공식품에서 착색, 보존 등을 위해 첨가되는 식품 의약품 안전처에서 정의하고 있는 식품첨가물일 수 있다. 상기 식품은 건강 기능성 식품일 수 있다. 보다 구체적으로, 눈 건강을 위한 건강 기능성 식품일 수 있다.
상기 식품용 또는 식품첨가제용 조서울이나 사료용 또는 사료첨가제용 조성물은 본 발명의 클라미도모나스 레인하드티아이 변이주, 상기 변이주의 배양물, 이의 건조물 및 이의 추출물의 활성을 해치지 않는 범위에서 다른 유효성분을 더 포함할 수 있다. 또한, 담체 등의 부가 성분을 더 포함할 수 있다.
본 발명에서 사료용 조성물은 발효사료, 배합사료, 펠렛형태 및 사일레지(silage) 등의 형태로 제조될 수 있다. 상기 발효사료는 본 발명의 클라미도모나스 레인하드티아이 변이주, 상기 변이주의 건조 균체, 상기 변이주의 배양물 및 이의 추출물을 포함하고, 추가적으로 여러 가지 미생물 균 또는 효소들을 포함하여 제조할 수 있다. 상기 배합사료는 여러 종류의 일반 사료와 본 발명의 변이주, 상기 변이주의 건조 균체, 상기 조류의 배양물 및 이의 추출물을 포함하여, 혼합하여 제조될 수 있다. 펠렛 형태의 사료는 상기 발효사료 또는 배합사료를 펠렛기로 제형화하여 제조될 수 있다. 사일레지는 청예사료와 클라미도모나스 레인하드티아이 변이주, 상기 변이주의 건조 균체, 상기 변이주의 배양물 및/또는 이의 추출물을 혼합하여 제조될 수 있으나, 본 발명의 조성물의 사용이 이에 제한되는 것은 아니다.
상기 조성물은 식품 또는 약제학적 분야에서 통상적으로 사용하는 담체 및 향료와 혼합하여 정제 (tablet), 트로키(troche), 캡슐(capsule), 엘릭실(elixir), 시럽(syrup), 산제 (powder), 현탁제(suspension) 또는 과립제(granule) 등의 형태로 제조 및 투여될 수 있다. 담체로는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제 등을 사용할 수 있다. 투여방식은 경구, 비경구 또는 도포법을 사용할 수 있으나, 바람직하게는 경구 투여하는 것이 바람직하다. 또한, 투여용량은 체내에서 활성성분의 흡수도, 불활성율 및 배설속도, 피투여자의 연령, 성별, 상태 등에 따라 적절히 선택할 수 있다. 상기 조성물의 pH는 조성물이 사용되는 약제, 식품 등의 제조조건 등에 따라서 용이하게 변경 가능하다.
상기 조성물은 조성물 총 중량에 대하여 클라미도모나스 레인하드티아이 변이주, 상기 변이주의 배양물, 상기 변이주 또는 배양물의 건조물 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 어느 하나를 0.001 내지 99.99 중량%, 바람직하게는 0.1 내지 99 중량%로 포함할 수 있고, 상기 조성물의 사용방법 및 사용목적에 따라 유효성분의 함량을 적절히 조절할 수 있다.
상기 클라미도모나스 레인하드티아이 변이주는 그 자체 또는 건조된 형태로 조성물에 포함될 수 있고, 상기 조류의 배양물은 농축 또는 건조된 형태로 조성물에 포함될 수 있다. 또한, 상기 건조물은 상기 조류 또는 그 배양물의 건조된 형태를 의미하는 것으로, 동결건조 등에 의해 제조된 분말 형태일 수 있다.
또한, 상기 추출물은 본 발명의 클라미도모나스 레인하드티아이 변이주, 이의 배양액 또는 이의 건조물로부터 추출하여 얻어진 것을 의미하는 것으로, 용매 등을 이용한 추출물, 본 발명의 클라미도모나스 레인하드티아이 변이주를 파쇄하여 얻어진 것을 포함한다. 구체적으로 본 발명의 클라미도모나스 레인하드티아이 변이주의 세포 내에 축적된 색소를 물리적 또는 화학적 방법으로 추출 및 분리한 것일 수 있다.
상기 추출과정은 통상의 방법에 의하여 수행될 수 있고, 일 예로 추출용매를 가하고 균질화한 후, 균체를 파쇄하여 목적 색소를 추출할 수 있다. 추출 후에는 원심분리하여 조류의 파쇄물을 제거하고, 추출용매는 감압증류 등의 방법으로 제거할 수 있다. 또한 통상의 정제공정을 더 포함할 수 있다. 상기 색소의 경우 물에 녹지않는 성질을 가지므로, 본 발명의 조류로부터 더욱 용이하게 추출될 수 있다.
본 발명의 클라미도모나스 레인하드티아이 변이주는 낮은 광도에서 잔토필, 특히 지아잔틴의 우수한 생산능을 가지므로, 상기 변이주 및 이의 부산물을 포함하는 조성물은 신체 활성 향상, 체기능성 유지 및 저하 예방 효과를 가진다. 구체적으로, 상기 잔토필 색소는 황반변성 억제 효과, 항산화, 항암 효과 등이 있는 것으로 알려져 있으므로, 본 발명의 조성물은 신체건강 유지용, 구체적으로 상기 잔토필 색소가 관여하는 신체 기능의 유지, 저하 예방 또는 향상을 용도로 식품, 건강 기능식품, 의약품 또는 사료 등에 포함되는 원료로 이용될 수 있다.
또한, 본 발명의 다른 목적은 본 발명의 클라미도모나스 레인하드티아이 변이주를 이용한 색소 생산방법을 제공하는 것이다. 상기 색소 생산방법은 본 발명의 클라미도모나스 레인하드티아이 변이주를 배양하는 것을 포함할 수 있다.
또한, 본 발명의 또 다른 목적은 본 발명의 클라미도모나스 레인하드티아이 변이주를 배양하는 것을 포함하는 식품 또는 사료의 원료 생산방법을 제공하는 것이다.
상기 색소는 지아잔틴 일 수 있다. 구체적으로, 본 발명의 변이주를 이용하는 경우 루테인을 생산하지 않으면서, 고함량의 지아잔틴을 생산할 수 있어, 지아잔틴의 선택적 생산에 효과적으로 활용할 수 있다는 점에서 매우 큰 장점이 있다.
본 발명의 클라미도모나스 레인하드티아이 변이주를 이용하는 경우 배양되는 상기 조류 내의 지아잔틴 축적량을 높일 수 있고, 루테인을 생산하지 않아, 지아잔틴만 분리/정제하기 위한 단계를 거치지 않아도 되므로, 산업적으로 사용되는 지아잔틴을 원료로 공급하는데 효과적으로 이용될 수 있다.
또한, 상기 생산방법은 상기 배양 단계 이후에, 배양물로부터 본 발명의 클라미도모나스 레인하드티아이 변이주를 분리하는 것;을 더 포함할 수 있다. 상기 분리된 조류는 건조를 포함한 가공 단계를 더 거칠 수 있다.
또한, 상기 생산방법은 본 발명의 클라미도모나스 레인하드티아이 변이주, 상기 변이주의 배양물, 상기 배양물의 농축물 또는 상기 배양물의 건조물로부터 색소를 추출하는 것;을 더 포함할 수 있다.
상기 배양은 pH 6.0 내지 8.0 조건의 배지에서 수행될 수 있다. 또한, 약광 조건, 구체적으로 10 내지 2,000 μmol photons/m2s 범위의 광도 조건 하에서 수행될 수 있다. 본 발명의 클라미도모나스 레인하드티아이 변이주의 경우 낮은 광도에서도 색소 생산능이 우수하여, 체내 지아잔틴 함량을 높일 수 있는 바, 고광도의 에너지를 투여하지 않고도 우수한 지아잔틴 축적을 달성할 수 있어, 산업적으로 효과적으로 이용될 수 있다.
상기 이러한 추출은 미생물로부터 색소를 추출하는 방법에 대한 통상적인 방법으로 수행할 수 있고, 일 예로 효소법, 초음파 추출법, 기계 추출법 등이 있으며 이에 한정되지 않는다.
상기 생산방법은 배양 단계 외에, 배양 후 조류의 함량을 높이는 농축 단계, 농축 단계를 거친 조류의 수분을 더욱 감소시킴으로써 건조시키는 건조 단계를 더 포함할 수 있다. 그러나 농축단계 또는 건조 단계가 반드시 필요한 것이 아니며, 일반적으로 본 발명이 속하는 분야에서 통상적으로 사용되는 농축 및 건조 방법, 기계를 사용하여 수행할 수 있다.
상기 생산방법은 상기 추출 단계 이후 정제단계를 더 포함하여 수행할 수 있고, 이는 본 발명이 속하는 기술분야에서 통상의 정제방법에 의하여 수행될 수 있다.
상기 농축 또는 건조 단계를 거쳐 제조된 잔토필은 식품, 건강기능성 식품, 화장품 또는 약제 등의 원료로 사용될 수 있다.
상기 잔토필 생산방법은 본 발명의 효과를 해치지 않는 범위 내에서 다른 방법을 채용하여 수행될 수 있다.
상기 변이주 및 조성물에 대한 내용은 본 발명의 생산방법에도 준용될 수 있다.
이하에서, 실시예에 따라 본 발명을 더욱 상세힌 설명하는바, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것으로 해석되지 않는다.
실시예 1. 균주의 배양
본 발명의 일 실시예에서 클로미도모나스 조류의 배양은 특별히 언급하지 않는 한, 다음의 배지 및 배양조건에 따라서 수행되었다.
1-1) 독립영양 배양
광합성만을 이용하여 외부의 탄소원 공급이 없는 상태로 배양하는 독립영양 배양(Autotrophic culture)을 하는 경우 최소 배지인 HS 배지에서 5% CO2를 공급하여 배양하였다. 하기 표 1과 같은 조성을 가진 배지를 만든 뒤 오토클레이브에서 고압살균하고, 활발한 성장기(growth stage)에 있는 세포를 이용하여 배양액에 106cell/mL의 농도가 되도록 만들어 성장을 시작하였다. 배양용기는 도 11과 같이 유리로 된 컬럼(column)을 사용하여 아래에서 공기(Bubble)를 공급하고 양 옆에서 200uE의 광도로 형광등을 이용해 빛을 주었다.
[규칙 제91조에 의한 정정 06.03.2019]　
Figure WO-DOC-TABLE-1
2) 혼합영양 배양
광합성과 탄소원을 같이 공급하여 배양하는 혼합영양 배양(Mixotrophic culture)의 경우는 TAP 배지에서 아세트산(acetic acid)을 첨가하여 배양하였다. 하기 표 2와 같은 조성을 가진 배지를 만든 뒤 오토클레이브로 고압/살균하고, 활발한 성장기(growth stage)에 있는 세포를 이용하여 배양액에 106cell/mL의 농도가 되도록 만들어 성장을 시작하였다. 배양용기는 도 12와 같이 유리로 된 플라스크 또는 병(bottle)을 사용하여 큰 부피(volume)로 배양하였으며 자성 막대(magnetic bar)를 이용하여 저어주었다. 70uE의 광도로 형광등을 이용해 빛을 함께 주었다.
[규칙 제91조에 의한 정정 06.03.2019]　
Figure WO-DOC-TABLE-2
실시예 2. 크리스퍼 유전자 가위 기술( CRISPR - Cas9 RNP )을 이용한 ZEP 유전자 녹아웃 클라미도모나스 변이주 제작
클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 ZEP 유전자(phytozome: Cre02.g082550 또는 NCBI: AY211267.1)[https://phytozome.jgi.doe.gov/pz/portal.html#!gene?search=1&detail=1&method=4614&searchText=transcriptid:30785220; 2번 염색체 중 1244277-1250969의 위치에 존재]를 표적하기 위해 sgRNA는 Cas-Designer (www.rgenome.net)을 이용하여 미세상동성-유도된(microhomology-driven) 구조 이동 돌연변이(frame shift mutation)를 유도하는 다섯 개의 sgRNA을 디자인하였으며, 이를 In vitro 전사(transcription) 방법을 통해 합성하였다. Cas-디자이너(www.rgenome.net/cas-designer/)를 사용하여 ZEP 유전자를 표적하기 위해 제작된 다섯 개의 sgRNA의 타켓 서열은 다음 표 3과 같다.
Figure PCTKR2018016518-appb-T000003
전체 게놈에서 3 뉴클레오타이드(nt)만큼 어떠한 다른 표적 부위들과 상이하고 66보다 더 높은 프레임-외 스코어를 가진 ZEP 유전자의 코딩 서열 영역의 절반 내에서 5개의 sgRNA를 신중하게 디자인하였다. 'CDS(코딩 서열) 위치'는 RNA 전사물에서 절단 지점의 상대적인 위치를 의미한다. Direction의 +는 타겟 서열과 동일한 방향, 즉 같은 시퀀스가 RGEN의 시퀀스이며, -는 타겟 서열과 역방향, 즉 표적 서열(target sequence)과 결합되어 있는 서열인 서로 상보적인(reverse complement)한 관계의 서열을 의미한다. '프레임-외 스코어(Out-of-frame Score)'는 깨진 이중-가닥 DNA가 미세 상동성-매개된 단부 연결(MMEJ) 경로에 의해 수선될 때 발생하는 프레임쉬프트-유도 결실의 가능성을 가리킨다. '표적-오프 부위의 #'은 전체 게놈을 통틀어 미스매치된 서열의 수를 의미한다. 타겟서열에 나머지 sgRNA 서열 (Gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc, 서열번호 18) 연결하면 전체 sgRNA를 나타낸다.
Cas9 단백질 경우 E. coli를 이용하여 재조합 Cas9 단백질(recombinant Cas9 protein)을 발현시켜 정제를 거쳐 준비하였다. 실험에 사용된 야생형 클라미도모나스 레인하드티아이 cw15 mt (CC-4349)은 Chlamydomonas Resource Center(www.chlamycollection.org)를 통해 확보하였다[http://www.chlamycollection.org/product/cc-4349-cw15-mt-goodenough-330a/].
클라미도모나스 세포는 표 2의 TAP 배지를 이용해 25℃에서 50ml 플라스크에 담아 70uE의 광도로 형광등을 이용해 빛을 제공하고, 90 rpm으로 흔들어 주면서(shaking) 배양하였다. 세포의 농도는 분광 광도계(spectrophotometer)를 이용하여 측정하며 OD750에서 0.3 ~ 0.5 정도의 활발히 배양 중인 시기의 세포를 사용하였다.
RNPs 복합체를 만들기 위해 200㎍의 Cas9 단백질(도 5, 서열번호 15)은 140㎍의 sgRNA(서열번호 16)와 뉴클레아제-프리(nuclease-free) 물에서 섞고, 10분간 상온에서 인큐베이션 하였다. 결합된 RNPs 복합체는 50x104개의 야생형 클라미도모나스 레인하드티아이 cw15 mt(CC-4349) 세포와 함께 4mm 전기천공(Electroporation) 큐벳(cuvette)에서 Biorad Gene Pulser XcellTM 전기천공 시스템(Electroporation System)을 이용하여(Voltage 600V, Capacity 50uF), 전기충격을 통해 형질 전환시킨 뒤, 12시간 동안 암조건에서 인큐베이션 한 후에 gDNA를 추출하여, 표적 심층 시퀀싱(targeted deep sequencing)으로 분석하였으며, 일부는 2000개의 세포로 희석(dilution)하여 TAP 한천 평판(agar plate)에 도말하여 단일 콜로니(single colony)를 얻었다.
도 3a 및 3b는 표적 심층 시퀀싱에 의해 RGEN-RNPs에 의해 유도된 ZEP 유전자의 돌연변이를 확인한 결과이다. 가장 형질전환 효율이 높은 세 번째 sgRNA(0.456%)에 의해 유도된 단일 콜로니(single colony)를 분리하여 표적 유전자(target gene)의 돌연변이를 확인하였다. 도 3b는 표적 심층 시퀀싱의 결과로, RNP를 이용한 형질전환 실험 후 전체 세포를 모으고 gDNA를 뽑아서 분석했을 때 전체 세포를 대상으로 표적 부위의 DNA 가닥에서 일어나는 모든 변이를 분석하여 그 패턴과 빈도(frequency)를 알 수 있다. 다만, 도 3b는 표적 심층 시퀀싱을 통해 표적 부위에서 실제로 확인된 변이의 패턴들을 나타내는데, 42bp 이상의 삽입(insertion)과 같은 큰 사이즈 변화는 표적 심층 시퀀싱의 원리로는 찾아내기 어려우므로, 실제로 얻어진 단일 콜로니(single colony)의 변이와 차이가 있을 수 있다.
이렇게 ZEP 유전자 특이적 녹아웃 돌연변이체를 DNA 없는 RGEN RNP를 사용하여 생성한 후에, 페트리 디쉬에서 모든 세포에 대해 Chl 형광을 측정하였고 여러 개의 추정되는 ZEP 녹아웃 세포주를 선별하였다.
도 6a에서 적색 원형은 약광(50 μmol photons/m2s) 조건 하에서 TAP 아가 배지 상에서 성장한 추정되는 ZEP 녹아웃 돌연변이체를 가리킨다. NPQ/4 영상은 Imaging PAM(Walz)으로 측정되었다. 야생형(WT) 및 ΔZEP 돌연변이주의 단일 세포 콜로니들이 약광(50 μmol photons/m2s) 조건 하에서 최소 한천 배지 상에서 성장하였다(도 6a 및 6b). 이렇게 확인된 콜로니 중 황반색소 함량이 증가된 변이주 3개(△Z1, △Z2, △Z3)를 선별하였으며, RGEN RNPs에 의해 발생된 세 개의 ZEP 돌연변이체에서 실제적인 ZEP 유전자 위치의 표적 DNA 서열 변화를 생어 염기서열 분석(Sanger sequencing)을 통해 확인하였다(도 2a, 2b 및 도 2c).
도 6b에 나타낸 바와 같이, 동일한 조건의 광도 하에서 TAP 한천 평판에서 야생형 클라미도모나스 레인하드티아이 cw15, 그리고 변이주 △Z1, △Z2, △Z3의 콜로니가 서로 유사한 형태와 크기로 자란 것을 확인할 수 있었다. 또한, HS 배지에서 광합성을 통해 액체 배양된 세포들 경우, 같은 세포수의 농도에서 야생형 클라미도모나스 레인하드티아이 조류는 녹색을 띄는 것에 비해 변이주 △Z1, △Z2, △Z3은 풀색 톤의 유사한 녹색을 띠는 것을 확인할 수 있다(도 6c).
선발된 변이주 중 변이주 Z1는 클라미도모나스 레인하드티아이 ZEP 변이 1 (△Z1)(Chlamydomonas reinhardtii ZEP mutant 1(△Z1))로 명명하였으며, 상기 변이주는 한국생명공학연구원 생명자원센터(KCTC)에 2017년 3월 22일자로 기탁되어, 수탁번호 KCTC 13230BP를 부여 받았다.
이후, 이중 유전자 교정을 위해 변이주 Z1을 이용하였다.
실시예 3. 클라미도모나스에서 크리스퍼 유전자 가위 기술( CRISPR - Cas9 RNP )을 이용한 LCYE ( Lycopene epsilon cyclase ) 유전자 녹아웃 클라미도모나스 변이주 제조
LCYE 유전자를 표적하기 위해 sgRNA는 Cas-Designer(www.rgenome.net)를 이용하여 미세상동성-유도된(microhomology-driven) 구조 이동 돌연변이(frame shift mutation)를 유도하는 네 개의 sgRNA를 제작하였다. LCYE 유전자를 표적하기 위해 제작된 네 개의 sgRNA는 다음 표 4와 같다(각 항목의 의미는 표 3 참조; 표 4에서 타겟 위치는 CDS 서열 기준으로 염기 위치를 기재함).
Figure PCTKR2018016518-appb-T000004
RNPs 복합체를 만들기 위해 200㎍의 Cas9 단백질(서열번호 15)과 140㎍의 sgRNA(서열번호 17)를 뉴클레아제-없는(nuclease-free) 물에서 섞고, 10분간 상온에서 인큐베이션하였다. 결합된 RNPs 복합체는 히그로마이신(hygromycin) 저항성 유전자 카세트 1㎍과 50x104개의 클라미도모나스(Chlamydomonas) 세포와 함께 4mm 전기천공 큐벳(cuvette)에서 Biorad Gene Pulser XcellTM 전기천공 시스템(Electroporation System)을 이용하여(Voltage 600V, Capacity 50uF) 형질전환 시킨 뒤, 12시간 동안 암조건 인큐베이션 한 후에 전부를 히그로마이신(hygromycin)이 첨가된 TAP 한천 평판(agar plate)에 도말하여, 단일 콜로니(single colony)를 얻었다.
도 7은 야생형 클라미도모나스 레인하드티아이 조류의 LCYE의 유전자 정보 및 타겟 서열을 나타내는 것으로, 상기 유전자 교정을 통해서 선별된 dZL1과 dZL2 변이주가 각각 도 8a 및 8b의 유전 정보를 가짐을 생어 서열분석법(Sanger sequencing)을 통해 확인하였다.
선발된 변이주 중 변이주 dZL1은 클라미도모나스 레인하드티아이 double ZEP/LCYE mutant 1(dZL1)으로 명명하였으며, 상기 변이주는 한국생명공학연구원 생명자원센터(KCTC)에 2018년 8월 21일자로 기탁되어, 수탁번호 KCTC 13626BP를 부여 받았다.
실시예 4. ZEP / LCYE 이중 유전자 녹아웃의 변이주의 세포적 특성 및 색소 함량 분석
상기에서 단일 콜로니로 분리된 ZEP 1 변이주와 두 개의 ZEP / LCYE 이중 녹아웃의 변이주의 세포적 특성을 확인하기 위해, 각 변이주를 계속 배양하고, 각 콜로니에 대한 HPLC를 이용해 색소 분석을 수행하였다.
분리된 단일 콜로니들을 TAP 배지에서 70 μmol photons/m2s 조건으로 3일 동안 배양하였고, 구체적인 배양 조건은 실시예 1의 배양 조건과 같이 수행하였다. 수확된 조류들을 80% 아세톤을 사용하여 색소를 추출하고 원심분리한 상층액을 다시 나일론 필터를 이용하여 여과한 후 HPLC에 주입하여 분석하였다.
구체적으로, 색소를 분리하기 위해 용매의 총 유속은 분당 1.2mL로 하였고, 제0분 내지 제15분까지 pH 8.0의 Tris는 14%, 아세토니트릴은 84%로부터 0%까지 각각 균일하게 감소시키고, 메탄올과 에틸아세테이트는 2%로 시작하여 제15분까지 각각 68%, 32%까지 증가시켰다. 이후 3분 동안(제15분 내지 제18분) 이 용매 비율을 그대로 유지시킨 다음, 1분 동안(제18분 내지 제19분) 각 용매의 비율을 시작할 때의 비율로 되돌린 다음 나머지 6분간 그대로 유지하며 포스트-런(postrun)을 하였다. 펌프는 Shimadzu사의 LC-20A Prominence를, 컬럼은 Watera Spherisorb TMS5(DS1 4.6 x 250 mm, 5μm Cartridge Column, USA)를 사용하였고, 컬럼의 온도는 40℃로 유지하였다. 검출기는 포토다이오드 어레이 검출기(photodiode array detector: SPD-M20A, Shimadzu)를 사용하여 데이터를 분석하였고, 지아잔틴을 비롯한 카로티노이드 색소들은 445nm에서, 엽록소 a는 670nm에서 검출된 결과를 DHL(Agern Alle, Horsholm, Denmark)에서 구입한 카로티노이드와 엽록소 a, b를 정량한 표준곡선을 스탠다드로 사용하여 농도를 구하였다.
도 9는 고체 TAP 배지에서 야생형 조류, Z1 변이주(ZEP Mutant 1), 그리고 dZL1 및 dZL2 변이주(CRISPR-Cas9 RNP에 의해 발생한 ZEP/LCYE 이중 녹아웃 변이주)를 비교한 사진이고, 도 10a 및 10b는 ZEP/LCYE 이중 유전자 녹아웃의 변이주(dZL1 및 dZL2)의 색소를 분석한 결과이다. 도 10a에서는 HPLC를 이용하여 세포의 색소 프로파일을 분석하였으며 도 10b에서는 엽록소 a(Chl a) 당 루테인과 지아잔틴의 양을 야생형과 비교하였다. 일반적인 성장조건에서 야생형에 거의 존재하지 않는 지아잔틴의 양이 모든 변이주에서 증가하였음을 확인하였고, 그 중 특히, ZEP/LCYE 이중 유전자 녹아웃의 변이주는 Z1 변이주와 달리 루테인 함량이 전혀 나타나지 않아, 하나의 변이만 포함하는 변이주와 매우 상이한 균학적 특성을 가짐을 알 수 있다.
[규칙 제91조에 의한 정정 06.03.2019]　
Figure WO-DOC-FIGURE-125

Claims (15)

  1. 서열번호 1로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 ZEP 유전자 서열에서 816번째 염기와 817번째 염기 사이에 아데닌(A); 서열번호 3으로 표시되는 염기서열; 또는 서열번호 5로 표시되는 염기서열이 삽입된 ZEP 유전자 변이; 및
    서열번호 2로 표시되는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 LCYE 유전자 서열에서 599번째 염기와 600번째 염기 사이에 서열번호 9로 표시되는 염기서열; 또는 서열번호 11로 표시되는 염기서열이 삽입된 LCYE 유전자 변이를 포함하는 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii) 변이주.
  2. 제1항에 있어서,
    서열번호 4, 서열번호 6, 또는 서열번호 8로 표시되는 ZEP 변이 유전자; 및
    서열번호 10; 또는 서열번호 12으로 표시되는 LCYE 변이 유전자를 포함하는 클라미도모나스 레인하드티아이 변이주.
  3. 제1항 또는 제2항에 있어서,
    상기 변이주는 지아잔틴(zeaxanthin) 생성능을 가지면서, 루테인(lutein)을 생산하지 않는 것을 특징으로하는, 클라미도모나스 레인하드티아이 변이주.
  4. 제1항에 있어서,
    서열번호 4로 표시되는 ZEP 변이 유전자; 및
    서열번호 10으로 표시되는 LCYE 변이 유전자를 포함하는 클라미도모나스 레인하드티아이 변이주.
  5. 제1항 내지 제4항 중 어느 한 항에 따른 변이주의 배양물,
  6. 제1항 내지 제4항 중 어느 한 항에 따른 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 색소 조성물.
  7. 제6항에 있어서,
    상기 색소는 지아잔틴(zeaxanthin)를 포함하는 것 인, 색소 조성물.
  8. 제1항 내지 제4항 중 어느 한 항에 따른 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 눈 건강 강화 또는 유지; 황반변성 예방 또는 개선; 눈의 기능 저하 예방 또는 개선; 망막의 손상 개선 또는 예방; 눈의 노화 억제; 망막 건강 유지; 황반변성 발병 위험 감소; 또는 시력감퇴 예방 또는 개선용 조성물.
  9. 제1항 내지 제4항 중 어느 한 항에 따른 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 식품용 또는 식품첨가제용 조성물.
  10. 제1항 내지 제4항 중 어느 한 항에 따른 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 사료용 또는 사료첨가제용 조성물.
  11. 제 1 항 내지 제4항 중 어느 한 항에 따른 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 포함하는 주사제용 조성물.
  12. 제1항 내지 제4항 중 어느 한 항에 따른 변이주; 이의 배양물; 상기 변이주 또는 배양물의 건조물; 및 상기 변이주 또는 배양물의 추출물로 이루어진 군에서 선택된 하나 이상을 눈 건강 강화 또는 유지; 황반변성 예방 또는 개선; 눈의 기능 저하 예방 또는 개선; 망막의 손상 개선 또는 예방; 눈의 노화 억제; 망막 건강 유지; 황반변성 발병 위험 감소; 또는 시력감퇴 예방 또는 개선을 위한 건강기능식품.
  13. 제1항 내지 제4항 중 어느 한 항에 따른 변이주를 배양하는 것을 포함하는 색소 생산방법.
  14. 제13항에 있어서,
    상기 변이주, 상기 변이주의 배양물, 상기 배양물의 농축물 또는 상기 배양물의 건조물로부터 색소를 분리하는 것;을 포함하는 색소 생산방법.
  15. 제 1 항 내지 제4항 중 어느 한 항에 따른 변이주를 배양하는 것;을 포함하는 식품 또는 사료의 원료 생산방법.
PCT/KR2018/016518 2018-08-29 2018-12-21 클라미도모나스 변이주 및 이의 제조방법 WO2020045765A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180102306A KR101981935B1 (ko) 2018-08-29 2018-08-29 클라미도모나스 변이주 및 이의 제조방법
KR10-2018-0102306 2018-08-29

Publications (1)

Publication Number Publication Date
WO2020045765A1 true WO2020045765A1 (ko) 2020-03-05

Family

ID=66656766

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/016518 WO2020045765A1 (ko) 2018-08-29 2018-12-21 클라미도모나스 변이주 및 이의 제조방법

Country Status (2)

Country Link
KR (1) KR101981935B1 (ko)
WO (1) WO2020045765A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102445369B1 (ko) * 2019-12-03 2022-09-21 한양대학교 산학협력단 미세조류로부터 기능성 오일을 추출하는 방법 및 기능성 오일을 포함하는 유화액
KR102442480B1 (ko) 2020-01-02 2022-09-13 한양대학교 산학협력단 클라미도모나스 변이주 배양용 조성물 및 이의 배양방법
KR102603612B1 (ko) 2023-07-14 2023-11-17 한국해양과학기술원 아스타잔틴 및 루테인 생산능을 가지는 클라미도모나스속 kiost-2 균주 및 이의 배양방법

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170121688A (ko) * 2016-04-22 2017-11-02 한양대학교 산학협력단 Ｒｇｅｎ ｒｎｐ를 이용하여 개발된 클라미도모나스 변이주 및 이를 이용한 색소 생산방법

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170121688A (ko) * 2016-04-22 2017-11-02 한양대학교 산학협력단 Ｒｇｅｎ ｒｎｐ를 이용하여 개발된 클라미도모나스 변이주 및 이를 이용한 색소 생산방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI, GenBank 24 May 2016 (2016-05-24), XP055695895, Database accession no. KX077950.1 *
DATABASE NCBI, GenBank 29 August 2000 (2000-08-29), XP055695899, Database accession no. AF295371.1 *
DATABASE NCBI, GenBank 29 August 2017 (2017-08-29), XP055695901, Database accession no. XM 001696477.1 *
DATABASE NCBI, GenBank 4 April 2003 (2003-04-04), XP055695886, Database accession no. AY211267.1 *

Also Published As

Publication number Publication date
KR101981935B1 (ko) 2019-05-28

Similar Documents

Publication Publication Date Title
US10973246B2 (en) Chlamydomonas mutants produced using RGEN RNP and method for preparing pigment using the same
WO2020045765A1 (ko) 클라미도모나스 변이주 및 이의 제조방법
US20210198680A1 (en) Heterotrophic Production Methods for Microbial Biomass and Bioproducts
KR102445369B1 (ko) 미세조류로부터 기능성 오일을 추출하는 방법 및 기능성 오일을 포함하는 유화액
WO2017209510A1 (ko) 두나리엘라 변이주 및 이를 이용한 색소 생산 방법
WO2022124590A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 다중불포화지방산 생산방법
US20130309719A1 (en) Heterotrophic microbial production of xanthophyll pigments
WO2020145685A1 (ko) 클라미도모나스 변이주 및 이의 용도
CN1880309A (zh) 新化合物、新菌株、及应用该菌株生产该新化合物的方法
WO2021019409A1 (en) Astaxanthin over-producing strains of phaffia rhodozyma
KR102163257B1 (ko) 비올라잔틴 생산성이 높은 신규 미세조류
WO2017183936A1 (ko) Ｒｇｅｎ ｒｎｐ를 이용한 미세조류의 교정 방법
WO2024039163A1 (ko) 고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도
WO2013151363A1 (ko) 신규 분리한 바실러스 리체니포미스 및 이를 이용한 프로바이오틱스
WO2022250389A1 (ko) 신규 두나리엘라 살리나 및 이의 용도
WO2022158814A1 (ko) 제아잔틴 및 루테인의 생산성이 높은 신규 미세조류
JP3320417B2 (ja) アスタキサンチン含有動物プランクトン
KR102603612B1 (ko) 아스타잔틴 및 루테인 생산능을 가지는 클라미도모나스속 kiost-2 균주 및 이의 배양방법
KR20090040122A (ko) 아스타잔틴 추출이 용이한 파피아 로도지마 돌연변이주 및그 추출법
WO2023038443A1 (ko) 장수풍뎅이 누디바이러스 배양용 배지 조성물 및 이를 이용한 장수풍뎅이 누디바이러스의 배양 방법
EP3839056A1 (en) Astaxanthin over-producing strains of phaffia rhodozyma
WO2019092421A1 (en) Microorganism
CN1544619A (zh) 利用三裂叶野葛毛状根生产葛根素的方法
JPS643878B2 (ko)
CN1007267B (zh) 抗生素6270的制备方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18932219

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18932219

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 15/03/2023)

122 Ep: pct application non-entry in european phase

Ref document number: 18932219

Country of ref document: EP

Kind code of ref document: A1