WO2020218823A1 - 클로토 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 조성물 - Google Patents

클로토 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 조성물 Download PDF

Info

Publication number
WO2020218823A1
WO2020218823A1 PCT/KR2020/005319 KR2020005319W WO2020218823A1 WO 2020218823 A1 WO2020218823 A1 WO 2020218823A1 KR 2020005319 W KR2020005319 W KR 2020005319W WO 2020218823 A1 WO2020218823 A1 WO 2020218823A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
gene encoding
present
hmgb1
ischemia
Prior art date
Application number
PCT/KR2020/005319
Other languages
English (en)
French (fr)
Inventor
유제성
정용은
범진호
오혜원
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2020218823A1 publication Critical patent/WO2020218823A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a composition for various uses comprising a Klotho protein or a gene encoding it as an active ingredient.
  • Heart disease caused by ischemia or reperfusion after ischemia in particular, heart disease events or cardiac death caused by acute vascular diseases such as myocardial infarction or angina pectoris are known, but there are many cases with poor prognosis.
  • heart disease events or cardiac death caused by acute vascular diseases such as myocardial infarction or angina pectoris
  • acute vascular diseases such as myocardial infarction or angina pectoris
  • the human body undergoes rapid metabolism so that it can return to its previous state in order to maintain homeostasis, which causes body temperature to rise rapidly, and accordingly, metabolism in various tissues increases.
  • serious tissue damage may be caused due to an increase in toxic metabolites, an increase in inflammatory response due to immunity, and the occurrence of edema.
  • the drug treatment for such a phenomenon is limited to the regulation of blood behavior such as blood pressure control and blood clot dissolution, or to secure it, and there is no fundamental therapeutic agent for protecting the heart or myocardium.
  • One object of the present invention is Klotho protein; Or it is to provide a composition for targeted temperature management comprising the gene encoding the same as an active ingredient.
  • Another object of the present invention is to provide a composition for suppressing tissue damage caused by an increase in body temperature, comprising as the active ingredient of the present invention.
  • Another object of the present invention is the prevention of inflammatory diseases comprising the active ingredient of the present invention; Improving; Or to provide a composition for treatment.
  • Another object of the present invention is to provide a method for screening a therapeutic agent for target-centered body temperature therapy.
  • for target-centered temperature management Or it provides a composition for inhibiting tissue damage caused by body temperature rise.
  • composition of the present invention comprises a pharmaceutical composition; Or it can be used as a food composition.
  • composition of the present invention is Klotho protein; Or, it includes a gene encoding it as an active ingredient.
  • the composition of the present invention may be to suppress tissue damage caused by an increase in body temperature that may occur in phenomena such as autocirculation recovery, for example, ischemia or reperfusion injury after ischemia.
  • the Kloto protein For the purposes of the present invention, the Kloto protein; Alternatively, when the gene encoding this is injected into an individual, the effect of target center body temperature therapy can be exerted by inhibiting the movement of HMGB1 (High Mobility Group Box 1) from the nucleus to the cytoplasm, as in the case of maintaining the body temperature at a constant temperature. Therefore, it is possible to very effectively suppress tissue damage caused by an increase in body temperature.
  • HMGB1 High Mobility Group Box 1
  • composition of the present invention may further include an HMGB1 (High Mobility Group Box 1) protein or a function or expression inhibitor of a gene encoding it as an active ingredient.
  • HMGB1 High Mobility Group Box 1
  • the "function or expression inhibitor" of the present invention means stopping or reducing the expression of HMGB1 protein or a gene encoding it, or inhibiting or reducing the activity of the expressed protein or gene.
  • the composition may be used for target center body temperature treatment.
  • the "target-centered body temperature treatment" of the present invention refers to a rapid increase in body temperature due to a rapid metabolic action that occurs to maintain homeostasis during self-circulation recovery by setting a target to the target body temperature and maintaining a constant time.
  • the target center body temperature may be preferably 30° C. or more to less than 38° C., 32° C. to 36° C., or 33° C. to 36° C., but is not limited thereto. .
  • the target center body temperature of the present invention is less than 30° C. and exceeds 38° C., the cells constituting the individual may not be able to maintain homeostasis, and furthermore, the cells may not be able to operate normally.
  • the composition may be used for suppressing tissue damage caused by an increase in body temperature.
  • the tissue damage of the present invention may be a disease induced by ischemia or reperfusion injury after ischemia, and preferably at least one selected from the group consisting of ischemic cerebrovascular disease, ischemic cardiovascular disease, and ischemic peripheral vascular disease. , But is not limited thereto.
  • the ischemic cardiovascular disease of the present invention may be myocardial infarction or angina, and the ischemic cerebrovascular disease may be at least one selected from the group consisting of ischemic stroke, moyamoya disease, cerebral thrombosis, and cerebral embolism, but is not limited thereto. .
  • the klotho protein of the present invention is a protein that can exist in two forms: Membrane Klotho and Secreted Klotho, and the membrane Klotho protein is excretion of phosphate and active vitamin D. It functions as a receptor for hormones that can control the synthesis of, and the secreted klothoprotein can perform functions such as inhibition of growth factor signaling and inhibition of oxidative stress.
  • the klotho protein of the present invention may be composed of an amino acid sequence represented by SEQ ID NO: 1, and preferably may be composed of an amino acid sequence represented by SEQ ID NO: 2, but is not limited thereto.
  • the klotho protein of the present invention can be prepared by a known protein synthesis method or by culturing a transformed host cell.
  • a recombinant expression vector containing a nucleotide sequence encoding the protein of the present invention is introduced into the host cell to prepare a transformant, and then any method known in the art is used.
  • the transformant can be cultured by appropriate use. Proteins from the transformants cultured in this way can be obtained by separation and purification through methods such as centrifugation, chromatography, and electrophoresis known in the art.
  • the amino acid sequence of the present invention may be easily modified by substitution, deletion, insertion or a combination of one or more amino acids. Therefore, even when the protein or polypeptide having high homology with the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, for example, homology is 80% or more, 90% or more, or 95% or more, the above-described effect of the present invention is As long as it can be exhibited, it is included in all of the proteins of the present invention.
  • the homology of the present invention is intended to indicate the degree of similarity with the amino acid sequence of a wild-type protein, and includes a sequence having the same sequence with the amino acid sequence of the present invention and more than the above-described sequence homology. Such homology can also be determined by visually comparing two sequences, but can be determined using a bioinformatic algorithm that analyzes the degree of homology by arranging the sequences to be compared side by side. Homology between the two amino acid sequences can be expressed as a percentage. Useful automated algorithms are available in the GAP, BESTFIT, FASTA and TFASTA computer software modules of the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, W, USA).
  • Alignment algorithms automated in the module include Needleman & Wunsch, Pearson & Lipman, and Smith & Waterman sequence alignment algorithms. Algorithms and homology determinations for other useful arrangements can be automated in software including FASTP, BLAST, BLAST2, PSIBLAST and CLUSTAL W.
  • the gene encoding the cloto protein of the present invention may be composed of a nucleotide sequence represented by SEQ ID NO: 3, but is not limited thereto.
  • the gene encoding the clotoprotein of the composition of the present invention may be included as a gene itself, or may preferably be included in a form inserted into a recombinant expression vector.
  • the recombinant expression vector containing the gene encoding the clotoprotein of the present invention is a recombinant expression vector capable of expressing a protein or peptide of interest in a host cell of interest, and contains essential regulatory elements operably linked to express the gene insert. It means a gene product containing.
  • the expression vector includes expression control elements such as a start codon, a stop codon, a promoter, and an operator, and the start and stop codons are generally considered to be part of the nucleotide sequence encoding the polypeptide, and when the gene construct is injected, in an individual It must exhibit action and must be in frame with the coding sequence.
  • the promoter of the vector may be a constitutive or inducible promoter.
  • the recombinant expression vector of the present invention may be one in which a promoter and a nucleotide sequence of a gene encoding the cloto protein of the present invention, that is, a polynucleotide are operably linked.
  • The'operably linked' of the present invention means a state in which a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or RNA of interest are functionally linked to perform a general function. .
  • a promoter and a polynucleotide encoding a protein or RNA can be operably linked to affect the expression of the coding sequence.
  • the operative linkage with the recombinant expression vector may be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage may be performed using enzymes generally known in the art. .
  • the vector that can be used as the backbone of the recombinant expression vector of the present invention is not particularly limited as long as it can produce the protein of the present invention, but, for example, plasmid DNA, phage DNA, commercially developed plasmid ( pGEM (R) T vector, pET22b, pUC18, pBAD, pIDTSAMRT-AMP, etc.), E.
  • coli-derived plasmids pYG601BR322, pGEX-4T-1, pET, pBR325, pUC118, pUC119, etc.
  • Bacillus subtilis-derived plasmids pUB110, pTP5, etc.
  • yeast-derived plasmids YEp13, YEp24, YCp50, etc.
  • phage DNA Charon4A, Charon21A, EMBL3, EMBL4, ⁇ gt10, AAAAA ⁇ gt11, ⁇ ZAP, etc.
  • animal virus vectors retrovirus, adenovirus, etc.
  • vaccinia virus etc.
  • insect virus vectors such as Baculovirus
  • the function or expression inhibitor of the present invention may be at least one selected from the group consisting of a compound, siRNA, shRNA, antisense oligonucleotide, and an antibody, and preferably glycyrrhizin, but is not limited thereto.
  • the siRNA of the present invention may be composed of 10 to 100 nucleotide sequences having a sequence capable of complementary binding to the mRNA of the HMGB1 gene.
  • the shRNA of the present invention can be expressed by introducing it into cells using an adenovirus, lentivirus, and plasmid expression vector system from the promoter of RNA polymerase III, and such shRNA is a siRNA processing enzyme (Dicer or Rnase) present in the cell. It means that it can induce the silencing of the HMGB1 gene by converting it to siRNA having the correct structure by III).
  • a siRNA processing enzyme Dier or Rnase
  • the antisense oligonucleotide of the present invention is of a nucleotide base in which the antisense oligomer hybridizes with the target sequence in RNA by Watson-Crick base pairing, allowing the formation of typically mRNA and RNA: oligomeric hetero duplexes within the target sequence. It means an oligomer having a backbone between sequence and subunit.
  • the antibody of the present invention refers to a protein molecule capable of specifically binding to an antigenic site of a protein or peptide molecule.
  • the form of the antibody is not particularly limited, and as long as it has a polyclonal antibody, a monoclonal antibody, or an antigen-binding property, it may be included even if it is a part of the antibody, and all kinds of immunoglobulin antibodies may be included.
  • special antibodies such as humanized antibodies may be included, and the antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of antibody molecules.
  • the functional fragment of an antibody molecule refers to a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab') 2, Fv, etc., but is not limited thereto.
  • siRNA, shRNA, and antisense oligonucleotide of the present invention can be easily prepared according to a known method by a person skilled in the art with reference to SEQ ID NO: 4, and the antibody of the present invention also has the nucleotide sequence of SEQ ID NO: 4
  • the protein (antigen) encoded by the gene by cloning the gene consisting of the gene according to a conventional method, it can be produced by a conventional method, and the aptamer can also be produced by referring to the base sequence in the art. It can be easily produced according to a known method by a person of ordinary skill in the.
  • the "prevention" of the present invention may be included without limitation as long as it blocks symptoms caused by a disease caused by tissue damage caused by an increase in body temperature using the composition of the present invention, or suppresses or delays the symptoms.
  • treatment of the present invention may be included without limitation, as long as the symptoms of the disease caused by tissue damage caused by the increase in body temperature are improved or benefited by using the composition of the present invention.
  • the "improvement" of the present invention may be included without limitation, as long as the symptoms of the disease caused by tissue damage caused by the increase in body temperature are improved or beneficially changed using the composition of the present invention.
  • the pharmaceutical composition of the present invention may be characterized in that it is in the form of capsules, tablets, granules, injections, ointments, powders, or beverages, and the pharmaceutical composition may be characterized for human.
  • the pharmaceutical composition of the present invention is not limited thereto, but is formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
  • the pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers can be used as binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, flavoring agents, etc. for oral administration, and buffers, preservatives, painlessness, etc. for injections.
  • An agent, a solubilizing agent, an isotonic agent, a stabilizer, and the like may be mixed and used, and in the case of topical administration, a base agent, an excipient, a lubricant, a preservative, and the like may be used.
  • the formulation of the pharmaceutical composition of the present invention can be variously prepared by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • it when administered orally, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc.In the case of injections, it can be prepared in unit dosage ampoules or multiple dosage forms. have. Others, solutions, suspensions, tablets, capsules, can be formulated as sustained-release preparations.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may additionally be included.
  • the route of administration of the pharmaceutical composition of the present invention is not limited thereto, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, Includes sublingual or rectal. Oral or parenteral administration is preferred.
  • the "parenteral" of the present invention includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention can also be administered in the form of suppositories for rectal administration.
  • the pharmaceutical composition of the present invention depends on a number of factors including the activity of the specific compound used, age, weight, general health, sex, formulation, time of administration, route of administration, excretion rate, drug formulation and the severity of the specific disease to be prevented or treated. It may vary in various ways, and the dosage of the pharmaceutical composition varies depending on the patient's condition, weight, degree of disease, drug form, route and duration of administration, but may be appropriately selected by those skilled in the art, and 0.0001 to 50 mg/kg per day Alternatively, it may be administered at 0.001 to 50 mg/kg. Administration may be administered once a day, or may be divided several times. The above dosage does not in any way limit the scope of the present invention.
  • the pharmaceutical composition according to the present invention may be formulated as a pill, dragee, capsule, liquid, gel, syrup, slurry, or suspension.
  • the food composition of the present invention may be prepared in the form of various foods, for example, beverages, gums, teas, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, and bread.
  • the amount may be added in a proportion of 0.1 to 50% of the total weight, but is not limited thereto.
  • the food composition of the present invention is prepared in the form of a beverage
  • various flavoring agents or natural carbohydrates, etc. as an additional component like a normal beverage.
  • natural carbohydrates monosaccharides such as glucose, disaccharides such as fructose, and common sugars such as sucrose and polysaccharides, dextrins, cyclodextrins, and sugar alcohols such as xylitol, sorbitol, and erythritol are used.
  • natural carbohydrates monosaccharides such as glucose, disaccharides such as fructose, and common sugars such as sucrose and polysaccharides, dextrins, cyclodextrins, and sugar alcohols such as xylitol, sorbitol, and erythritol are used.
  • sugar alcohols such as xylitol, sorbitol, and erythritol
  • the flavoring agent may be a natural flavoring agent (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and a synthetic flavoring agent (saccharin, aspartame, etc.).
  • a natural flavoring agent for example, rebaudioside A, glycyrrhizin, etc.
  • a synthetic flavoring agent sacharin, aspartame, etc.
  • the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavors and natural flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, A pH adjuster, a stabilizer, a preservative, a glycerin, an alcohol, a carbonation agent used in carbonated beverages, and the like may be further included.
  • the ingredients included in the food composition of the present invention may be used independently or in combination. Although the ratio of the additive does not correspond to the core element of the present invention, it may be selected from 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention, but is not limited thereto.
  • prevention of inflammatory diseases It provides a composition for treatment or improvement.
  • composition of the present invention can be used as a pharmaceutical composition or a food composition.
  • composition of the present invention is a Klotto protein; Or, it includes a gene encoding it as an active ingredient.
  • composition of the present invention may further include an HMGB1 (High Mobility Group Box 1) protein or a function or expression inhibitor of a gene encoding it as an active ingredient.
  • HMGB1 High Mobility Group Box 1
  • the description of the cloto protein, gene, HMGB1 protein, or inhibitor of function or expression of the gene encoding the same, the pharmaceutical composition, and the food composition is the same as described in the composition for target center body temperature therapy, Omitted to avoid excessive complexity of the specification.
  • the klotho protein of the present invention can prevent, ameliorate or treat inflammatory diseases induced by a phenomenon in which the expression level of HMGB1 is increased in the cytoplasm by inhibiting the movement of HMGB1 protein from the nucleus to the cytoplasm.
  • the inflammatory disease of the present invention may be included as long as it is induced by a phenomenon in which the expression level of HMGB1 is elevated in the cytoplasm, for example, hemorrhagic shock, pancreatitis, arthritis, pulmonary thromboembolism ( Pulmonary thromboembolism) and acute lung injury may be at least one selected from the group consisting of, but is not limited thereto.
  • the hemorrhagic shock of the present invention is a major cause of death that accounts for 30 to 40% of trauma-related deaths, and patients recovered from hemorrhagic shock often cause systemic inflammatory reactions, resulting in death due to multiple organ failure.
  • mice that mimic such hemorrhagic shock patients when tissue ischemia is induced, the expression level of HMGB1 protein may increase (Journal of Inflammation, 11(30) (2014)), so HMGB1 protein migrates to the cytoplasm. ;
  • injecting the composition according to the present invention capable of suppressing the expression level it is possible to suppress an inflammatory response that may be induced due to hemorrhagic shock.
  • the cytoplasmic HMGB1 protein is a positive regulator that binds to Beclin-1 protein, which contributes to the initiation of the autophagosome mechanism, and the serum concentration of HMGB1 protein is increased in patients with severe acute pancreatitis. And, inhibiting the activity of HMGB1 protein can prevent acute pancreatitis (Austin J Surg, 1(9), (2014)).
  • the klotho protein according to the present invention moves the HMGB1 protein from the nucleus to the cytoplasm at the same level as glycyrrhizin; Alternatively, since the expression level thereof can be suppressed, the effect of preventing or treating acute pancreatitis in which HMGB1 protein is remarkably increased can be exhibited.
  • arthritis is a chronic inflammatory disease characterized by inflammation of synovial fluid and structural damage to the joint, and transduction such as TNF (Tumor necrosis factor) and interleukin-1 (IL-1) caused by macrophages in the joint. Development and progression can be determined by excessive production of inflammatory cytokines.
  • TNF Tumor necrosis factor
  • IL-1 interleukin-1
  • a pulmonary artery branch is blocked by a thrombus, and in such pulmonary thromboembolism, platelet release by HMGB1 protein can increase microvascular complications, and neutrophils mediated by platelet HMGB1 protein Because the release of Neutrophil extracellular traps (NET) regulates deep venous thrombosis (DVT) (Sci Rep., 8(1):2068 (2018)), the level of the HMGB1 protein present; Alternatively, when the migration from the nucleus to the cytoplasm is inhibited or its function is inhibited, symptoms caused by pulmonary thromboembolism can be alleviated or ameliorated (Cell Physiol Biochem., 47(4), p.1319-1337 (2016) )).
  • NET Neutrophil extracellular traps
  • DVT deep venous thrombosis
  • the acute lung injury of the present invention is also referred to as acute respiratory distress syndrome, and when the permeability of the alveolar-capillary barrier is increased, the protein-rich osmotic fluid escapes into the alveoli, and the alveoli is normally filled with water. It is a type of pulmonary edema caused by cold.
  • the acute lung injury is classified into acute phase, proliferative phase, and fibrotic phase according to time. In the acute phase, the inflammatory response is the main change, and in the proliferative phase, the proliferation of alveolar epithelial cells occurs. This is the time when gas exchange in the alveoli is difficult even with mechanical breathing.
  • the acute lung injury may be caused by infection, aspiration of gastric contents, sepsis, mass transfusion due to traumatic shock, disseminated intravascular coagulation, etc., but is not limited thereto.
  • the infection may be a viral infection.
  • the viruses include adenovirus, coronavirus, dengue fever virus, hepatitis B virus (HBV), hepatitis C virus (HCV), human immunodeficiency virus (HIV), human papilloma virus.
  • HBV hepatitis B virus
  • HCV hepatitis C virus
  • HSV human immunodeficiency virus
  • human papilloma virus Human papillomavirus
  • cytomegalovirus may be at least one selected from the group consisting of, but is not limited thereto.
  • the coronavirus of the present invention is SARS virus (Severe acute respiratory syndrome coronavirus; SARS-CoV-1), Middle east respiratory syndrome virus (MERS virus, MERS virus) and Corona-19 virus (COVID-19 , SARS-CoV-2) may be at least one selected from the group consisting of, but is not limited thereto.
  • SARS virus severe acute respiratory syndrome coronavirus
  • MERS virus Middle east respiratory syndrome virus
  • Corona-19 virus Corona-19 virus
  • the acute lung injury is accompanied by a cytokine storm.
  • the HMGB1 of the present invention is overexpressed in the cytoplasm and extracellularly, the level at which the HMGB1 is present;
  • symptoms caused by the cytokine storm can be alleviated or improved (Liu Q, Zhou Y, Yang Z (2016) The cytokine storm of severe influenza and development of immunomodulatory therapy.Cell Mol Immunol 13:3-10.).
  • cytokine storm is also known as “cytokine cascade” or “cytokine hypersecretion", resulting in very increased levels of various cytokines, It refers to an immune response consisting of a positive feedback loop between cytokines and cells secreting mediators.
  • the serum and/or intratracheal levels of one or more cytokines can be increased at least 5 times higher, for example at least 10 times higher or 100 times higher than the levels observed in healthy individuals or healthy populations. have.
  • target-centered body temperature therapy Inflammatory disease; And a method for screening a therapeutic agent for the treatment of ischemia or reperfusion injury after ischemia.
  • the screening method of the present invention comprises the steps of treating a target candidate substance on a biological sample isolated from a target individual; And HMGB1 protein in the biological sample; Or it includes the step of determining the level at which the gene encoding it is present.
  • the step of confirming the present invention is the protein of HMGB1 in the cytoplasm; Alternatively, it may be to check the level at which the gene encoding it is present.
  • the screening method of the present invention comprises a protein of HMGB1 in the cytoplasm; Alternatively, when the level of the gene encoding the same is decreased compared to prior to treatment of the candidate substance, target-centered body temperature treatment of the candidate substance; Inflammatory disease; And selecting a therapeutic agent for the treatment of ischemia or reperfusion injury after ischemia.
  • the biological sample of the present invention is any substance derived from a target individual, in which tissue damage is suspected or tissue damage has occurred due to an increase in body temperature that may occur in phenomena such as autocirculation recovery, for example, reperfusion after ischemia, Means a biological body fluid, tissue, or cell, for example, whole blood, leukocytes, peripheral blood mononuclear cells, white blood cell soft coat, plasma, serum (serum), sputum, tears, mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva (saliva), peritoneal washings, pelvic fluids, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid ), lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions , Cells, cell extracts, or cerebrospinal fluid may be included, but are not limited thereto.
  • the HMGB1 protein of the present invention is a Western blot assay, ELISA (Enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunoassay using an agent capable of measuring the expression level of the protein.
  • ELISA Enzyme linked immunosorbent assay
  • RIA radioimmunoassay using an agent capable of measuring the expression level of the protein.
  • Radioimmunodiffusion Ouchterlony immune diffusion method
  • Rocket immunoelectrophoresis Immunohistochemical staining, Immunoprecipitation Assay, Complement Fixation Assay, It can be measured by methods such as immunofluorescence, immunochromatography, fluorescence activated cell sorter analysis (FACS), and protein chip technology assay.
  • the agent capable of measuring the expression level of the protein of the present invention is an agent for confirming the expression level of the protein to be measured contained in a sample, and may be an antibody or an aptamer.
  • the antibody of the present invention refers to a protein molecule capable of specifically binding to an antigenic site of a protein or peptide molecule.
  • the form of the antibody is not particularly limited, and as long as it has a polyclonal antibody, a monoclonal antibody, or an antigen-binding property, it may be included even if it is a part of the antibody, and all kinds of immunoglobulin antibodies may be included.
  • special antibodies such as humanized antibodies may be included, and the antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of antibody molecules.
  • the functional fragment of an antibody molecule refers to a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab') 2, Fv, etc., but is not limited thereto.
  • the aptamer of the present invention refers to a single-stranded oligonucleotide, and refers to a nucleic acid molecule having binding activity to a predetermined target molecule.
  • the aptamer may have various three-dimensional structures according to its base sequence, and may have high affinity for a specific substance such as an antigen-antibody reaction.
  • the aptamer can inhibit the activity of a given target molecule by binding to a given target molecule.
  • the aptamer may be RNA, DNA, a modified nucleic acid, or a mixture thereof, and the form may be linear or cyclic.
  • a gene consisting of the nucleotide sequence of the gene preferably the nucleotide sequence represented by SEQ ID NO: 5 is cloned into an expression vector according to a conventional method to obtain a protein (antigen) encoded by the gene.
  • the aptamer may be prepared by a method, and the aptamer may be easily prepared according to a method known by a person skilled in the art by referring to each nucleotide sequence.
  • the gene encoding the HMGB1 protein of the present invention uses an agent capable of measuring the expression level of the gene, RT-PCR, quantitative real time PCR, competitive RT-PCR, It can be measured through methods such as real time quantitative RT-PCR (real time quantitative RT-PCR), RNase protection assay (RPA), Northern blot assay, and DNA chip assay.
  • the agent capable of measuring the expression level of the gene of the present invention measures the level of mRNA transcribed from the gene to be measured in order to check the expression level of the gene to be measured contained in the biological sample.
  • an agent that can be used in the method it may include a primer pair or a probe capable of specifically binding to the gene, but is not limited thereto.
  • the primer of the present invention can form a base pair with a complementary template strand with a base sequence having a short free 3'hydroxyl group, and as a starting point for template strand copying It refers to a short, functional, nucleotide sequence.
  • the primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer solution and temperature.
  • the probe of the present invention refers to a nucleic acid fragment such as RNA or DNA corresponding to a base capable of specifically binding to the mRNA, and such a probe determines the presence or absence of a specific mRNA and the level of expression (expression amount). It may be labeled for identification.
  • the probe may be manufactured in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, an RNA probe, etc., but is not limited thereto.
  • the primer or probe of the present invention can be easily prepared by a method known by a person of ordinary skill in the art with reference to the nucleotide sequence of the gene, preferably the nucleotide sequence represented by SEQ ID NO: 5.
  • Klotho protein in another embodiment, relates to a method for suppressing tissue damage caused by increased body temperature or targeted temperature management, comprising administering to the individual a gene encoding the same in a pharmaceutically effective amount.
  • the term "individual” is an individual who needs target-centered body temperature treatment, an individual whose tissue damage is expected or occurred due to an increase in body temperature, or an individual who needs to prevent or treat a disease caused by ischemia or reperfusion after ischemia, such as primates. It may include not only humans but also mammals such as cows, horses, sheep, pigs, goats, camels, antelopes, dogs, and cats, but is not limited thereto.
  • a function or expression inhibitor of a high mobility group box 1 (HMGB1) protein or a gene encoding the protein may be further administered to the individual.
  • HMGB1 high mobility group box 1
  • the tissue damage of the present invention may be a disease induced by ischemia or reperfusion injury after ischemia, and preferably at least one selected from the group consisting of ischemic cerebrovascular disease, ischemic cardiovascular disease, and ischemic peripheral vascular disease. , But is not limited thereto.
  • the ischemic cardiovascular disease of the present invention may be myocardial infarction or angina, and the ischemic cerebrovascular disease may be at least one selected from the group consisting of ischemic stroke, moyamoya disease, cerebral thrombosis, and cerebral embolism, but is not limited thereto. .
  • the "administration" of the present invention refers to a process of introducing the active ingredient of the present invention to an individual by any appropriate method, and the administration method in the treatment method of the present invention is through various routes such as oral or parenteral Can be administered.
  • a specific pharmaceutically effective amount for a specific patient is a composition containing the specific active ingredient, including the type and degree of the reaction to be achieved, whether other agents are used in some cases, the patient's age, and weight , General health status, sex and diet, administration time, route of administration, and secretion rate of a composition containing the active ingredient, treatment period, a variety of factors including drugs used or concurrently used with a specific composition and similar well-known in the field of medicine It is desirable to apply differently depending on factors.
  • Targeted temperature management of the present invention may be a combination therapy further comprising administering a compound or substance having therapeutic activity against one or more diseases, but is not limited thereto.
  • the "combination" should be understood to represent simultaneous, individual or sequential administration.
  • the interval between administrations of the second component should be such that the beneficial effects of the combination are not lost.
  • Targeted temperature management of the present invention Alternatively, in the method for inhibiting tissue damage caused by an increase in body temperature, the contents related to the klotho protein, the ischemia or post-ischemia reperfusion injury, and the like are duplicated as previously described, and the following description is omitted to avoid excessive complexity of the specification.
  • Klotho protein In another embodiment of the present invention, Klotho protein; Or prevention of inflammatory diseases, comprising administering to the individual a gene encoding the same in a pharmaceutically effective amount; It relates to a method of treatment or improvement.
  • the "individual” refers to an individual in need of prevention or treatment of inflammatory diseases, as well as primates such as humans, as well as mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, cats, etc. It may include all, but is not limited thereto.
  • a function or expression inhibitor of a high mobility group box 1 (HMGB1) protein or a gene encoding the protein may be further administered to the individual.
  • the klotho protein of the present invention can prevent, ameliorate or treat inflammatory diseases induced by a phenomenon in which the expression level of HMGB1 is increased in the cytoplasm by inhibiting the movement of HMGB1 protein from the nucleus to the cytoplasm.
  • the inflammatory disease of the present invention may be included as long as it is induced by a phenomenon in which the expression level of HMGB1 is elevated in the cytoplasm, for example, hemorrhagic shock, pancreatitis, arthritis, pulmonary thromboembolism ( Pulmonary thromboembolism) and acute lung injury may be at least one selected from the group consisting of, but is not limited thereto.
  • the treatment or improvement method may be a combination therapy further including administering a compound or substance having therapeutic activity against one or more diseases, but is not limited thereto.
  • the composition according to the present invention not only exhibits the target center body temperature treatment effect by inhibiting the movement of HMGB1 (High Mobility Group Box 1) protein from the nucleus to the cytoplasm, but also exerts a tissue damage that may occur due to a rapid rise in body temperature. For example, it is possible to prevent or treat tissue damage caused by ischemia or reperfusion after ischemia. Furthermore, it is possible to effectively prevent or treat inflammatory diseases that may be caused by the HMGB1 protein being transferred to the cytoplasm.
  • HMGB1 High Mobility Group Box 1
  • FIG. 1 shows a picture of a heart tissue extracted from an animal model in which tissue damage is induced by ischemia or reperfusion after ischemia according to an embodiment of the present invention.
  • FIG. 2 is a graph showing a tissue damage area extracted from an animal model in which tissue damage is induced by ischemia or reperfusion after ischemia according to an embodiment of the present invention.
  • FIG. 3 shows the results of performing immunohistochemical staining on heart tissues extracted from an animal model in which tissue damage due to ischemia or reperfusion after ischemia is induced according to an embodiment of the present invention.
  • FIG. 4 shows the results of performing immunohistochemical staining on cardiac tissues extracted from an animal model in which tissue damage due to ischemia or reperfusion after ischemia is induced according to an embodiment of the present invention.
  • FIG. 5 shows a picture of a heart tissue extracted from an animal model in which tissue damage due to ischemia or reperfusion after ischemia is induced according to an embodiment of the present invention.
  • FIG. 6 shows the results of performing immunohistochemical staining on cardiac tissues extracted from an animal model in which tissue damage due to ischemia or reperfusion after ischemia is induced according to an embodiment of the present invention.
  • FIG. 7 shows a picture of a heart tissue extracted from an animal model in which tissue damage is induced by ischemia or reperfusion after ischemia according to an embodiment of the present invention.
  • FIG. 8 is a graph showing a tissue damage area extracted from an animal model in which tissue damage is induced by ischemia or reperfusion after ischemia according to an embodiment of the present invention.
  • FIG. 9 shows the results of performing immunohistochemical staining on heart tissues extracted from an animal model in which tissue damage due to ischemia or reperfusion after ischemia is induced according to an embodiment of the present invention.
  • FIG. 10 is a graph showing the results of performing immunohistochemical staining on cardiac tissues extracted from an animal model in which tissue damage is induced by ischemia or reperfusion after ischemia according to an embodiment of the present invention.
  • FIG. 11 shows a photograph of a heart tissue extracted from an animal model in which tissue damage due to ischemia or reperfusion after ischemia was administered in combination with a klotho protein and glycyrrhizin according to an embodiment of the present invention.
  • FIG. 12 shows the results of performing immunohistochemical staining on cardiac tissues extracted from an animal model in which tissue damage due to ischemia or reperfusion after ischemia was induced in combination with a clotoprotein and glycyrrhizin according to an embodiment of the present invention. Is shown.
  • Klotho protein Or for targeted temperature management comprising the gene encoding the same as an active ingredient; And it provides a composition for inhibiting tissue damage caused by body temperature rise.
  • composition of the present invention may further include an HMGB1 (High Mobility Group Box 1) protein or a function or expression inhibitor of a gene encoding it as an active ingredient.
  • HMGB1 High Mobility Group Box 1
  • an animal model in which acute myocardial infraction is induced was prepared in the following manner.
  • the animal models prepared in Preparation Example were targeted at 33° C. and 36° C. and subjected to target-centered body temperature treatment to maintain the temperature for 4 hours, and then the heart of the animal models was excised and reperfused after ischemia or ischemia. Tissue damage was observed, and the results are shown in FIGS. 1 and 2. At this time, the experiment was repeatedly performed in 4 experimental animals under the same conditions.
  • tissue damage that may occur due to a rapid increase in body temperature such as tissue damage due to reperfusion after ischemia, can be significantly reduced by target center body temperature therapy.
  • the heart extracted from each animal model was 4% paraformaldehyde ( paraformaldehyde) for 72 hours and incubated overnight at 4°C to dehydrate.
  • the dehydrated heart was inserted into paraffin, cut into a 4 ⁇ m cross section, and then attached to a slide glass frame. Then, the slide glass was reacted with an antibody specific to the HMGB1 (High Mobility Group Box 1) protein in which red fluorescence is bound, and then visualized using a fluorescence microscope.
  • HMGB1 High Mobility Group Box 1
  • the nuclei of the cells were stained using DAPI (4′,6-diamidino-2-phenylindole) dye.
  • the visualized image was captured using a digital camera, quantified using an image analysis program, and the results are shown in FIGS. 3 and 4.
  • tissue damage that may occur due to a rapid increase in body temperature such as tissue damage due to reperfusion after ischemia can be treated. You can see that there is.
  • the HMGB1 protein was present at a high level in the cytoplasm, whereas when the Klotto recombinant protein was injected, it was confirmed that the HMGB1 protein was present at a higher level in the nucleus than in the cytoplasm.
  • the Kloto protein according to the present invention targets by inhibiting the movement of HMGB1 protein from the nucleus to the cytoplasm in tissue damage that may occur due to a rapid increase in body temperature, such as tissue damage due to reperfusion after ischemia. It can be seen that the central body temperature treatment effect can be exerted.
  • HMGB1 protein is present at a high level in the cytoplasm, whereas when glycyrrhizin is injected, the HMGB1 protein is at a higher level in the nucleus than in the cytoplasm. It was confirmed that it exists.
  • the Klotho protein according to the present invention inhibits the HMGB1 protein from being transferred to the cytoplasm, such as glycyrrhizin, an HMGB1 inhibitor, so that body temperature may be rapidly increased, such as tissue damage due to reperfusion after ischemia. It can be seen that the effect of target-centered body temperature therapy can be exerted in tissue damage. Furthermore, it can be seen that the clotoprotein can be used by exerting the same effect as glycyrrhizin in the prevention or treatment of inflammatory diseases that may be caused by the HMGB1 protein being transferred to the cytoplasm.
  • the tissue damage area was 11.3% and 10.5%, respectively, whereas when the klotho protein and glycyrrhizin were administered together, the tissue damaged area was 6.3%. It has been reduced even more significantly.
  • the HMGB1 protein is present at a higher level in the nucleus compared to the cytoplasm even when the cloto protein and glycyrrhizin are administered in combination. And, it was confirmed that it did not migrate to the cytoplasm (MI+klotho+Gly in FIG. 12).
  • the present invention relates to a composition for various uses comprising a Klotho protein or a gene encoding it as an active ingredient.
  • SEQ ID NO: 1 Klotto protein amino acid sequence
  • SEQ ID NO: 2 Klotto recombinant protein amino acid sequence
  • SEQ ID NO: 3 Base sequence of Kloto gene
  • SEQ ID NO: 4 HMGB1 amino acid sequence
  • SEQ ID NO: 5 Base sequence of HMGB1 gene

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pathology (AREA)
  • Vascular Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Cardiology (AREA)
  • Biomedical Technology (AREA)
  • Food Science & Technology (AREA)
  • Mycology (AREA)

Abstract

클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 조성물에 관한 것으로서, 본 발명에 따른 조성물은 HMGB1(High mobility group box 1) 단백질이 핵에서 세포질로 이동되는 것을 억제함으로써, 목표중심체온치료 효과를 발휘할 뿐만 아니라, 체온이 급격하게 상승되어 발생될 수 있는 조직 손상, 예를 들어 허혈 또는 허혈 후 재관류에 의한 조직 손상 등을 예방 또는 치료할 수 있다. 나아가, HMGB1 단백질이 세포질로 이동됨으로써 유발될 수 있는 염증성 질환을 효과적으로 예방 또는 치료할 수 있다. 나아가, 목적하는 생물학적 시료에서 HMGB1 단백질이 존재하는 수준을 감소시킬 수 있는 후보물질을 선별함으로써, 고가의 설비 및 유지 비용이 드는 시설 없이도 환자에게 목표중심체온치료나, 체온의 급격한 상승으로 인해 유발되는 조직 손상 또는 염증성 질환의 치료가 가능하도록 하는 치료제를 선별해낼 수 있다.

Description

클로토 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 조성물
본 발명은 클로토(Klotho) 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 다양한 용도의 조성물에 관한 것이다.
심장혈관 질환의 증가에 따라 심근경색 등에 의한 심정지, 특히 급성 심정지의 발생 가능성이 급격하게 높아지고 있다. 급성 심정지의 발생 가능성의 경우 30대에서는 인구 10만명당 30명에 불과하지만, 50대의 경우에는 인구 10만명당 100명으로 급증하고, 60대 및 70대에서는 더욱 급격하게 증가하는 것으로 보고되어 있다. 급성 심정지에 의한 환자의 생존율이 선진국의 경우 15 ~ 18%인 반면, 대한민국의 경우 3.0 ~ 4.0%로 현저하게 낮은 실정이다.
한편, 심폐소생술의 발견, 약물치료, 전기적 제세동 치료의 확대와 인식의 개선 등으로 인해 순환 회복률이 증가되었다. 그럼에도 불구하고, 뇌출혈, 뇌경색 또는 심정지 이후에 발생될 수 있는 허혈 또는 허혈후 재관류 손상에 의해 결국 환자가 사망하게 되기 때문에, 심정지에 의한 사망률이 감소되지 못하고 있는 실정이다.
상기 허혈 또는 허혈후 재관류에 의해 유발되는 심장질환, 특히 심근경색이나 협심증 등의 급성 혈관질환에 의해 발생되는 심장질환 이벤트나 심장사가 알려져 있지만, 그 예후가 좋지 않은 경우가 적지 않다. 특히, 심정지 후 자가순환회복이 되면, 인간의 몸은 항상성을 유지하기 위해 이전 상태로 돌아갈 수 있도록 빠른 대사 작용을 하게 되는데, 이로 인해 체온이 급격하게 상승되게 되고 그에 따라 다양한 조직에서 대사 작용이 증가됨에 따라 독성 대사 물질 증가, 면역에 의한 염증 반응 증가 및 부종 발생 등으로 심각한 조직의 손상이 유발될 수 있다. 이에, 이와 같은 현상에 대한 약물 치료는, 혈압 조절, 혈전 용해 등 혈행 동태의 조절이나 그 확보에 한정되고, 심장 혹은 심근을 보호하기 위한 근본적인 치료약이 없는 것이 현실이다.
이러한 한계점에 따라 다양한 방법으로 허혈 또는 허혈후 재관류에 의한 조직 손상을 감소시킬 수 있는 다양한 치료법들이 시도되어 왔다. 그 중 일정 온도로 환자의 체온이 상승되는 것을 억제할 수 있는 효과적인 치료제는 아직까지 개발되지 않은 실정이다.
본 발명의 일 목적은 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 목표중심체온치료(Targeted temperature management)용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 본 발명의 상기 유효성분으로 포함하는 체온 상승에 의한 조직 손상의 억제용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 본 발명의 상기 유효성분을 포함하는 염증성 질환의 예방; 개선; 또는 치료용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 목표중심체온치료를 위한 치료제의 스크리닝 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명의 일 구현 예에서는 목표중심체온치료(Targeted temperature management)용; 또는 체온 상승에 의한 조직 손상 억제용 조성물을 제공한다.
본 발명의 상기 조성물은 약학 조성물; 또는 식품 조성물로 사용될 수 있다.
본 발명의 상기 조성물은 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함한다.
본 발명의 상기 조성물은 자가순환회복, 예를 들면 허혈 또는 허혈후 재관류 손상 등과 같은 현상에서 발생될 수 있는 체온 상승에 의한 조직 손상을 억제하는 것일 수 있다. 본 발명의 목적상 상기 클로토 단백질; 또는 이를 암호화하는 유전자가 개체에 주입되는 경우 일정한 온도로 체온을 유지하는 경우와 마찬가지로 HMGB1(High mobility group box 1)이 핵에서 세포질로 이동되는 것을 억제함으로써 목표중심체온치료 효과가 발휘될 수 있도록 할 수 있으므로, 체온 상승에 의한 조직 손상을 매우 효과적으로 억제할 수 있다.
본 발명의 상기 조성물은 HMGB1(High mobility group box 1) 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 유효성분으로 더 포함할 수 있다.
본 발명의 상기 "기능 또는 발현 억제제"는 HMGB1 단백질 또는 이를 암호화하는 유전자의 발현을 중단 또는 감소시키거나, 발현된 단백질 또는 유전자의 활성을 억제 또는 감소시키는 것을 의미한다.
본 발명의 일 구체 예에서는 상기 조성물은 목표중심체온치료 용도로 사용될 수 있다.
본 발명의 상기 "목표중심체온치료"란, 목적하는 개체의 중심체온에 목표를 정해서 일정한 시간을 유지함으로써, 자가순환회복시에 항상성을 유지하기 위해 일어나는 빠른 대사 작용에 따른 체온의 급격한 상승에 의한 조직의 손상을 억제하기 위한 것으로서, 본 발명의 목적상 상기 목표중심체온은 바람직하게는 30℃이상 내지 38℃미만, 32℃내지 36℃또는 33℃내지 36℃일 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 상기 목표중심체온이 30℃미만, 및 38℃초과인 경우에는 개체를 구성하고 있는 세포가 오히려 항상성을 유지할 수 없고, 나아가 세포가 정상적으로 작동할 수 없을 수 있다.
본 발명의 다른 구체 예에서는 상기 조성물은 체온 상승에 의한 조직 손상을 억제하기 위한 용도로 사용될 수 있다.
본 발명의 상기 조직 손상은 허혈 또는 허혈후 재관류 손상에 의해 유도되는 질환일 수 있고, 바람직하게는 허혈성 뇌혈관 질환, 허혈성 심혈관 질환 및 허혈성 말초혈관 질환으로 구성된 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 허혈성 심혈관 질환은 심근경색 또는 협심증일 수 있고, 상기 허혈성 뇌혈관 질환은 허혈성 뇌졸중, 모야모야 질환, 뇌혈전증 및 뇌색전증으로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 클로토 단백질은 막 클로토(Membrane Klotho) 및 분비된 클로토(Secreted Klotho) 두개의 형태로 존재할 수 있는 단백질로서, 상기 막 클로토 단백질은 인산염의 배설(Excretion) 및 활성 비타민 D의 합성을 통제할 수 있는 호르몬의 수용체로서 기능하고, 상기 분비된 클로토 단백질은 성장인자신호전달 억제, 산화스트레스 억제 등과 같은 기능을 수행할 수 있다. 본 발명의 상기 클로토 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어진 것일 수 있고, 바람직하게는 서열번호 2로 표시되는 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 클로토 단백질은 공지의 단백질 합성법 또는 형질전환된 숙주세포를 배양함으로써 제조될 수 있다. 상기 단백질로 형질전환된 숙주세포를 이용하는 경우, 본 발명의 단백질을 암호화하는 염기 서열을 포함하는 재조합 발현 벡터를 숙주 세포에 도입하여 형질전환체를 제조한 뒤, 당업계에 공지된 임의의 방법을 적절하게 사용하여 상기 형질전환체를 배양할 수 있다. 이렇게 배양된 상기 형질전환체로부터 단백질은 당업계에서 공지된 원심분리, 크로마토그래피, 전기 영동 등의 방법을 통해 분리 및 정제함으로써 얻을 수 있다.
본 발명의 상기 아미노산 서열은 하나 이상의 아미노산이 치환, 결실, 삽입 또는 이들 조합에 의해 용이하게 변형될 수 있다. 따라서, 서열번호 1 또는 서열번호 2로 표시되는 아미노산 서열과 높은 상동성을 갖는 단백질 또는 폴리펩티드, 예를 들면 상동성이 80% 이상, 90% 이상 또는 95% 이상인 경우도 본 발명의 상기 기재된 효과가 발휘될 수 있도록 하는 한, 본 발명의 상기 단백질에 모두 포함된다.
본 발명의 상기 상동성이란, 야생형(Wild type) 단백질의 아미노산 서열과의 유사한 정도를 나타내기 위한 것으로서, 본 발명의 아미노산 서열과 상기와 같은 서열 상동성 이상의 동일한 서열을 가지는 서열을 포함한다. 이러한 상동성은 두 서열을 육안으로 비교하여 결정할 수도 있으나, 비교대상이 되는 서열을 나란히 배열하여 상동성 정도를 분석해 주는 생물정보 알고리즘(bioinformatic algorithm)을 사용하여 결정할 수 있다. 상기 두 개의 아미노산 서열 사이의 상동성은 백분율로 표시될 수 있다. 유용한 자동화된 알고리즘은 Wisconsin Genetics Software Package(Genetics Computer Group, Madison, W, USA)의 GAP, BESTFIT, FASTA와 TFASTA 컴퓨터 소프트웨어 모듈에서 이용가능 하다. 상기 모듈에서 자동화된 배열 알고리즘은 Needleman & Wunsch와 Pearson & Lipman과 Smith & Waterman 서열 배열 알고리즘을 포함한다. 다른 유용한 배열에 대한 알고리즘과 상동성 결정은 FASTP, BLAST, BLAST2, PSIBLAST와 CLUSTAL W를 포함하는 소프트웨어에서 자동화될 수 있다.
본 발명의 상기 클로토 단백질을 암호화하는 유전자는 서열번호 3으로 표시되는 염기 서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 조성물의 클로토 단백질을 암호화하는 유전자는 유전자 그 자체로서 포함될 수도 있고, 바람직하게는 재조합 발현 벡터에 삽입된 형태로 포함될 수 있다.
본 발명의 상기 클로토 단백질을 암호화하는 유전자가 포함된 재조합 발현 벡터는 목적하는 숙주세포에서 목적하는 단백질 또는 펩타이드를 발현할 수 있는 재조합 발현 벡터로서, 유전자 삽입물이 발현되도록 작동하게 연결된 필수적인 조절 요소를 포함하는 유전자 제작물을 의미한다. 상기 발현 벡터는 개시 코돈, 종결 코돈, 프로모터, 오퍼레이터 등의 발현조절 요소들을 포함하는데, 상기 개시 코돈 및 종결 코돈은 일반적으로 폴리펩티드를 암호화하는 뉴클레오티드 서열의 일부로 간주되며, 유전자 제작물이 주입되었을 때 개체에서 반드시 작용을 나타내야 하며 코딩 서열과 인프레임(In frame)에 있어야 한다. 벡터의 프로모터는 구성적 또는 유도성 프로모터일 수 있다.
본 발명의 상기 재조합 발현 벡터는 프로모터와 본 발명의 상기 클로토 단백질을 암호화하는 유전자의 염기 서열, 즉 폴리뉴클레오티드가 작동 가능하게 연결되어 있는 것일 수 있다. 본 발명의 상기 '작동 가능하게 연결(Operably linked)'이란, 일반적 기능을 수행하도록 핵산 발현 조절 서열과 목적하는 단백질 또는 RNA를 코딩하는 핵산 서열이 기능적으로 연결(Functional linkage)되어 있는 상태를 의미다. 예를 들어 프로모터와 단백질 또는 RNA를 코딩하는 폴리뉴클레오티드가 작동 가능하게 연결되어 코딩 서열의 발현에 영향을 미칠 수 있다. 재조합 발현 벡터와의 작동 가능하게 연결되는 것은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등이 사용될 수 있다.
본 발명의 상기 재조합 발현 벡터의 백본(Backbone) 으로 사용할 수 있는 벡터는 본 발명의 상기 단백질을 생산할 수 있는 한 특별히 제한되지는 않으나, 예를 들면, 플라스미드 DNA, 파아지 DNA, 상업적으로 개발된 플라스미드(pGEM(R) T 벡터, pET22b, pUC18, pBAD, pIDTSAMRT-AMP 등), 대장균 유래 플라스미드(pYG601BR322, pGEX-4T-1, pET, pBR325, pUC118, pUC119 등), 바실러스 서브틸리스 유래 플라스미드(pUB110, pTP5 등), 효모-유래 플라스미드(YEp13, YEp24, YCp50 등), 파아지 DNA(Charon4A, Charon21A, EMBL3, EMBL4, λgt10, AAAAAλgt11, λZAP 등), 동물 바이러스 벡터(레트로바이러스(Retrovirus), 아데노바이러스(Adenovirus), 백시니아 바이러스(Vaccinia virus) 등), 곤충 바이러스 벡터(배큘로바이러스(Baculovirus) 등)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 기능 또는 발현 억제제는 화합물, siRNA, shRNA, 안티센스 올리고뉴클레오티드, 및 항체로 구성된 군으로부터 선택되는 적어도 하나일 수 있고, 바람직하게는 글리시리진(glycyrrhizin)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 siRNA는 HMGB1 유전자의 mRNA와 상보적으로 결합할 수 있는 서열을 갖는 10개 내지 100개의 염기 서열로 이루어진 것일 수 있다.
본 발명의 상기 shRNA는 RNA 중합효소 Ⅲ의 프로모터로부터 아데노바이러스, 렌티 바이러스 및 플라스미드 발현 벡터 시스템을 이용하여 이를 세포 내로 도입하여 발현시킬 수 있으며, 이러한 shRNA는 세포 내에 존재하는 siRNA 프로세싱 효소(Dicer or Rnase Ⅲ)에 의해 정확한 구조를 갖는 siRNA로 전환되어 HMGB1 유전자의 침묵을 유도할 수 있는 것을 의미한다.
본 발명의 상기 안티센스 올리고뉴클레오티드는 안티센스 올리고머가 왓슨-크릭 염기쌍 형성에 의해 RNA 내의 표적 서열과 혼성화되어, 표적 서열 내에서, 전형적으로 mRNA와 RNA:올리고머 헤테로 이중체의 형성을 허용하는, 뉴클레오티드 염기의 서열 및 서브유닛간 백본을 갖는 올리고머를 의미한다.
본 발명의 상기 항체는 단백질 또는 펩티드 분자의 항원성 부위에 특이적으로 결합할 수 있는 단백질 분자를 의미한다. 상기 항체의 형태는 특별히 제한되지 않으며 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이라면, 항체의 일부인 경우라도 포함될 수 있고, 모든 종류의 면역 글로불린 항체가 포함될 수 있다. 또한, 인간화 항체 등의 특수 항체가 포함될 수 있고, 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며 Fab, F(ab'), F(ab') 2, Fv 등이 될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 siRNA, shRNA 및 안티센스 올리고뉴클레오티드는 서열번호 4를 참조하여 당해 기술분야에서 통상의 지식을 가진 자가 공지의 방법에 따라 쉽게 제작할 수 있고, 본 발명의 상기 항체 역시 서열번호 4의 염기 서열로 이루어진 유전자를 통상적인 방법에 따라 발현 벡터에 클로닝하여 상기 유전자에 의해 암호화되는 단백질(항원)을 얻은 뒤에 통상적인 방법에 의해 제작될 수 있고, 상기 앱타머 역시 상기 염기 서열을 참조하여 당해 기술 분야에서 통상의 지식을 가진 자가 공지의 방법에 따라 쉽게 제작될 수 있다.
본 발명의 상기 "예방"은 본 발명의 조성물을 이용하여 체온 상승에 의한 조직 손상에 의해 유발되는 질환에 의한 증상을 차단하거나, 그 증상을 억제 또는 지연시키는 모든 행위라면 제한없이 포함될 수 있다.
본 발명의 상기 "치료"는 본 발명의 조성물을 이용하여 체온 상승에 의한 조직 손상에 의해 유발되는 질환에 의한 증상이 호전되거나 이롭게 되는 행위라면 제한없이 포함될 수 있다.
본 발명의 상기 "개선"은 본 발명의 조성물을 이용하여 체온 상승에 의한 조직 손상에 의해 유발되는 질환에 의한 증상이 호전 또는 이롭게 변경되는 행위라면 제한없이 포함될 수 있다.
본 발명의 상기 약학 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명의 상기 약학 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사 용액의 형태로 제형화되어 사용될 수 있다. 본 발명의 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등이 사용될 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등이 혼합되어 사용될 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등이 사용될 수 있다. 본 발명의 약학 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(Elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항 응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명의 상기 약학 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
본 발명의 상기 "비경구"란, 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명의 상기 약학 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형화될 수 있다.
본 발명의 상기 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다.
본 발명의 상기 유효성분이 식품 조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 50%의 비율로 첨가할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 포함하는 것 외에 특별한 제한점은 없으며, 통상의 음료와 같이 다양한 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 구체적으로, 천연 탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등) 등일 수 있다.
본 발명의 상기 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등이 더 포함될 수 있다.
본 발명의 상기 식품 조성물에 포함되는 성분들은 독립적으로 또는 조합하여 사용될 수 있다. 상기 첨가제의 비율은 본 발명의 핵심적인 요소에 해당하지 아니하지만, 본 발명의 식품 조성물 100 중량부 당 0.1 내지 약 50 중량부의 범위에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현 예에서는 염증성 질환의 예방; 치료 또는 개선용 조성물을 제공한다.
본 발명의 상기 조성물은 약학 조성물 또는 식품 조성물로 사용될 수 있다.
본 발명의 상기 조성물은 클로토 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함한다.
본 발명의 상기 조성물은 HMGB1(High mobility group box 1) 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 유효성분으로 더 포함할 수 있다.
본 발명의 상기 염증성 질환의 예방; 치료 또는 개선용 조성물에서, 클로토 단백질, 유전자, HMGB1 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제, 약학 조성물 및 식품 조성물에 대한 기재는 상기 목표중심체온치료용 조성물에 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위해 생략한다.
본 발명의 상기 클로토 단백질은 HMGB1 단백질이 핵으로부터 세포질로 이동하는 것을 억제함으로써 HMGB1의 발현 수준이 세포질에서 높아지는 현상에 의해 유도되는 염증성 질환을 예방, 개선 또는 치료할 수 있다.
본 발명의 상기 염증성 질환은 HMGB1의 발현 수준이 세포질에서 높아지는 현상에 의해 유도되는 것이라면 모두 포함될 수 있고, 예를 들면 출혈성 쇼크(Hemorrhagic shock), 췌장염(Pancreatitis), 관절염(Arthritis), 폐 혈전 색전증(Pulmonary thromboembolism) 및 급성 폐 손상으로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 출혈성 쇼크는 외상 관련 사망의 30 ~ 40 %를 차지하는 주요한 사망 원인으로서, 출혈성 쇼크로 회복된 환자는 종종 전신 염증 반응을 일으켜 다발성 장기 부전 등으로 인해 결국 사망에 이르게 될 수 있다. 이와 같은 출혈성 쇼크 환자를 모방한 마우스에서, 조직의 허혈이 유도되는 경우에는 HMGB1 단백질의 발현 수준이 증가될 수 있으므로(Journal of Inflammation, 11(30) (2014)), HMGB1 단백질이 세포질로의 이동; 또는 그 발현 수준을 억제할 수 있는 본 발명에 따른 조성물을 주입하는 경우에는 출혈성 쇼크로 인해 유도될 수 있는 염증 반응을 억제할 수 있다.
본 발명의 상기 췌장염에서, 세포질의 HMGB1 단백질은 자가포식소체(autophagosome) 기전의 개시에 기여하는 Beclin-1 단백질에 결합하는 양성 조절자로서, 중증 급성 췌장염 환자에서 HMGB1 단백질의 혈청 내 농도가 증가되어 있으며, HMGB1 단백질의 활성을 억제하는 경우에는 급성 췌장염을 예방할 수 있다(Austin J Surg, 1(9), (2014)). 이에, 본 발명에 따른 클로토 단백질은 HMGB1 단백질을 글리시리진과 같은 수준으로 핵에서 세포질로의 이동; 또는 그 발현 수준을 억제할 수 있기 때문에, HMGB1 단백질이 현저하게 증가되어 있는 급성 췌장염의 예방 또는 치료 효과를 발휘할 수 있다.
본 발명의 상기 관절염에서, 관절염은 활액의 염증과 관절의 구조적 손상을 특징으로 하는 만성 염증성 질환으로서, 관절 내 대식세포에 의한 TNF(Tumor necrosis factor) 및 인터루킨-1(IL-1)과 같은 전 염증성 사이토카인의 과도한 생성에 의해 발달 및 진행이 결정될 수 있다. 이와 같은 관절염에서 본 발명의 상기 HMGB1이 세포질 및 세포 외로 과발현되기 때문에, HMGB1이 존재하는 수준; 또는 핵에서 세포질로 이동하는 것을 억제하거나, 그 기능을 억제하는 경우에는 관절염으로 인한 증상을 완화시키거나 개선시킬 수 있다(J Intern Med., 255(3), p. 344-50 (2004)).
본 발명의 상기 폐 혈전 색전증에서, 폐동맥 혈관 가지가 혈전에 의해 막히는 현상으로서, 이와 같은 폐 혈전 색전증에서 HMGB1 단백질에 의한 혈소판 방출은 미세 혈관 합병증을 증가시킬 수 있고, 혈소판 HMGB1 단백질에 의해 매개되는 호중구 세포외 트랩(Neutrophil extracellular traps; NET) 방출이 깊은 정맥 혈전증(Deep venous thrombosis; DVT)을 조절하기 때문에(Sci Rep., 8(1):2068 (2018)), HMGB1 단백질이 존재하는 수준; 또는 핵에서 세포질로 이동하는 것을 억제하거나, 그 기능을 억제하는 경우에는 폐 혈전 색전증으로 인한 증상을 완화시키거나 개선시킬 수 있다(Cell Physiol Biochem., 47(4), p.1319-1337 (2018)).
본 발명의 상기 급성 폐 손상은 급성호흡곤란증후군(acute respiratory distress syndrome)이라고도 하며, 폐포-모세혈관 장벽의 투과성이 증가될 경우, 단백질이 풍부한 삼투액이 폐포 안으로 빠져나와, 정상적으로는 폐포가 물로 가득차게 되어 발생하는 폐부종의 한 종류이다. 상기 급성 폐 손상은 시간 경과에 따라 급성기, 증식기, 섬유화기로 분류되는데, 급성기에는 염증반응이 주된 변화이고, 증식기에는 폐포상피세포의 증식이 일어나는 시기이며, 섬유화기는 폐포에 섬유화가 발생하는 최종단계로서 기계호흡으로도 폐포에서의 가스교환이 잘 안되는 시기이다.
상기 급성 폐 손상은 감염, 위 내용물의 흡인, 패혈증, 외상성 쇼크에 따른 대량 수혈, 파종성 혈관내응고 등이 원인일 수 있으나 이에 제한되지 않는다.
본 발명에서 상기 감염은 바이러스 감염일 수 있다. 상기 바이러스는 아데노바이러스, 코로나바이러스, 뎅기열 바이러스, B형 간염 바이러스(Hepatitis B virus; HBV), C형 간염 바이러스(Hepatitis C virus; HCV), 인체면역결핍바이러스(human immunodeficiency virus; HIV), 인유두종 바이러스(Human papillomavirus; HPV) 및 거대세포바이러스로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되지는 않는다.
본 발명의 상기 코로나바이러스는 사스 바이러스(Severe acute respiratory syndrome coronavirus; SARS-CoV-1), 중동 호흡기 증후군 바이러스(메르스 바이러스, Middle east respiratory syndrome virus; MERS virus) 및 코로나-19 바이러스(COVID-19, SARS-CoV-2)로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 급성 폐 손상은 사이토카인 폭풍(cytokine storm)을 동반하는데, 본 발명의 상기 HMGB1이 세포질 및 세포 외로 과발현되기 때문에, 상기 HMGB1이 존재하는 수준; 또는 핵에서 세포질로 이동하는 것을 억제하거나, 그 기능을 억제하는 경우에는 상기 사이토카인 폭풍으로 인한 증상을 완화시키거나 개선시킬 수 있다(Liu Q, Zhou Y, Yang Z (2016) The cytokine storm of severe influenza and development of immunomodulatory therapy. Cell Mol Immunol 13:3-10.).
본 발명에서, 상기 용어 "사이토카인 폭풍(cytokine storm)"은 "사이토카인 캐스케이드(cytokine cascade)" 또는 "사이토카인 과분비(hypercytokinemia)"로도 알려져 있으며, 다양한 사이토카인의 매우 증가된 수준을 초래하는, 사이토카인과 매개 물질 분비 세포들 간의 양성 피드백 루프(positive feedback loop)로 이루어진 면역 반응을 의미한다. 상기 사이토카인 폭풍 동안에, 1종 이상의 사이토카인의 혈청 및/또는 기관 내 수준은, 건강한 개체 또는 건강한 집단에서 관찰되는 수준보다 적어도 5배 높게, 예를 들면 적어도 10배 높게 또는 100배 높게 증가될 수 있다.
본 발명의 또 다른 구현 예에서는 목표중심체온치료; 염증성 질환; 및 허혈 또는 허혈 후 재관류 손상의 치료를 위한 치료제의 스크리닝 방법을 제공한다.
본 발명의 상기 스크리닝 방법은 목적하는 개체로부터 분리된 생물학적 시료에, 목적하는 후보물질을 처리하는 단계; 및 상기 생물학적 시료에서 HMGB1 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준을 확인하는 단계를 포함한다.
본 발명의 상기 확인하는 단계는 세포질에서 HMGB1의 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준을 확인하는 것일 수 있다.
본 발명의 상기 스크리닝 방법은 상기 세포질에서 HMGB1의 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준이 후보물질을 처리하기 이전에 비하여 감소되는 경우, 상기 후보물질을 목표중심체온치료; 염증성 질환; 및 허혈 또는 허혈 후 재관류 손상의 치료를 위한 치료제로 선별하는 단계를 더 포함할 수 있다.
본 발명의 상기 스크리닝 방법에서 클로토 단백질, 유전자, 약학 조성물 및 식품 조성물에 대한 기재는 상기 목표중심체온치료용 조성물에 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위해 생략한다.
본 발명의 상기 생물학적 시료는 자가순환회복, 예를 들면 허혈후 재관류 등과 같은 현상에서 발생될 수 있는 체온 상승에 의한 조직 손상이 의심되거나, 조직 손상이 발생한, 목적하는 개체로부터 유래된 임의의 물질, 생물학적 체액, 조직 또는 세포를 의미하는 것으로, 예를 들면, 전혈(whole blood), 백혈구(leukocytes), 말초혈액 단핵 세포(peripheral blood mononuclear cells), 백혈구 연층(buffy coat), 혈장(plasma), 혈청(serum), 객담(sputum), 눈물(tears), 점액(mucus), 세비액(nasal washes), 비강 흡인물(nasal aspirate), 호흡(breath), 소변(urine), 정액(semen), 침(saliva), 복강 세척액(peritoneal washings), 골반 내 유체액(pelvic fluids), 낭종액(cystic fluid), 뇌척수막 액(meningeal fluid), 양수(amniotic fluid), 선액(glandular fluid), 췌장액(pancreatic fluid), 림프액(lymph fluid), 흉수(pleural fluid), 유두 흡인물(nipple aspirate), 기관지 흡인물(bronchial aspirate), 활액(synovial fluid), 관절 흡인물(joint aspirate), 기관 분비물(organ secretions), 세포(cell), 세포 추출물(cell extract) 또는 뇌척수액(cerebrospinal fluid)을 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 HMGB1 단백질은 상기 단백질의 발현 수준을 측정할 수 있는 제제를 이용하여 웨스턴 블럿 분석(Western blot assay), ELISA(Enzyme linked immunosorbent assay), 방사선면역분석 (RIA: Radioimmunoassay), 방사 면역 확산법(Radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트 면역전기영동(Rocket immunoelectrophoresis), 면역조직화학염색법(Immunohistochemical staining), 면 역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), 면역형광법 (Immunofluorescence), 면역크로마토그래피법(Immunochromatography), FACS(Fluorescenceactivated cell sorter analysis) 및 단백질 칩 분석법(protein chip technology assay) 등의 방법을 통해 측정될 수 있다.
본 발명의 상기 단백질의 발현 수준을 측정할 수 있는 제제는 시료에 포함된 측정 대상이 되는 상기 단백질의 발현 수준을 확인하기 위한 제제로서, 항체 또는 앱타머일 수 있다.
본 발명의 상기 항체는 단백질 또는 펩티드 분자의 항원성 부위에 특이적으로 결합할 수 있는 단백질 분자를 의미한다. 상기 항체의 형태는 특별히 제한되지 않으며 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이라면, 항체의 일부인 경우라도 포함될 수 있고, 모든 종류의 면역 글로불린 항체가 포함될 수 있다. 또한, 인간화 항체 등의 특수 항체가 포함될 수 있고, 상기 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며 Fab, F(ab'), F(ab') 2, Fv 등이 될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 앱타머는 단일 가닥 올리고 뉴클레오티드를 의미하는 것으로, 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 말한다. 상기 앱타머는 그 염기 서열에 따라 다양한 3차원 구조를 가질 수 있으며, 항원-항체 반응과 같이 특정 물질에 대하여 높은 친화력을 가질 수 있다. 앱타머는 소정의 표적 분자에 결합함으로써 소정의 표적 분자의 활성을 저해할 수 있다. 상기 앱타머는 RNA, DNA, 변형된(modified) 핵산 또는 이들의 혼합물일 수 있으며, 그 형태가 직쇄상 또는 환상일 수 있다.
본 발명의 상기 항체는 유전자의 염기 서열, 바람직하게 서열번호 5로 표시되는 염기 서열로 이루어진 유전자를 통상적인 방법에 따라 발현 벡터에 클로닝하여 상기 유전자에 의해 암호화되는 단백질(항원)을 얻은 뒤에 통상적인 방법에 의해 제작될 수 있고, 상기 앱타머는 각각의 염기 서열을 참조하여 당해 기술 분야에서 통상의 지식을 가진 자가 공지의 방법에 따라 쉽게 제작될 수 있다.
본 발명의 상기 HMGB1 단백질을 암호화하는 유전자는 상기 유전자의 발현 수준을 측정할 수 있는 제제를 이용하여 RT-PCR, 정량 실시간 PCR(quantified real time PCR), 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(real time quantitative RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블럿 분석(Northern blot assay), DNA 칩 분석법 등의 방법을 통해 측정될 수 있다.
본 발명의 상기 유전자의 발현 수준을 측정할 수 있는 제제는 상기 생물학적 시료에 포함된 측정의 대상이 되는 유전자의 발현 수준을 확인하기 위하여, 상기 측정 대상이 되는 유전자로부터 전사된 mRNA의 수준을 측정하는 방법에 사용될 수 있는 제제로서, 상기 유전자에 특이적으로 결합할 수 있는 프라이머 쌍 또는 프로브를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 프라이머는 짧은 자유 3말단 수산화기(free 3'hydroxyl group)를 가지는 염기 서열로 상보적인 주형 가닥(template)와 염기쌍(base pair)을 형성할 수 있고, 주형 가닥 복사를 위한 시작 지점으로서 기능을 하는 짧은 염기 서열을 의미한다. 상기 프라이머는 적절한 완충 용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재 하에서 DNA 합성이 개시될 수 있다.
본 발명의 상기 프로브는 상기 mRNA와 특이적으로 결합을 이룰 수 있는 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하고, 이와 같은 프로브는 특정 mRNA의 존재 유무, 발현되는 수준(발현량)을 확인할 수 있도록 라벨링되어 있을 수 있다. 상기 프로브는 올리고뉴클레오타이드(oligonucleotide) 프로브, 단쇄 DNA(single strand DNA) 프로브, 이중쇄 DNA(double strand DNA)프로브, RNA 프로브 등의 형태로 제작될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 프라이머 또는 프로브는 유전자의 염기 서열, 바람직하게는 서열번호 5로 표시되는 염기 서열을 참조하여 당해 기술 분야에서 통상이 지식을 가진 자가 공지된 방법에 의해 쉽게 제작될 수 있다.
본 발명의 또 다른 구현 예에서는 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 약학적 유효량으로 개체에 투여하는 단계를 포함하는, 목표중심체온치료(Targeted temperature management) 또는 체온 상승에 의한 조직 손상의 억제 방법에 관한 것이다.
본 발명에서 상기 "개체"란, 목표중심체온치료가 필요한 개체, 체온 상승으로 조직 손상이 예상되거나 일어난 개체, 또는 허혈 또는 허혈후 재관류에 의한 질환의 예방 또는 치료가 필요한 개체로서, 영장류 예를 들면 인간뿐만 아니라, 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물을 모두 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 투여하는 단계 시 상기 개체에 HMGB1(High mobility group box 1) 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 추가로 더 투여할 수 있다.
본 발명의 상기 조직 손상은 허혈 또는 허혈후 재관류 손상에 의해 유도되는 질환일 수 있고, 바람직하게는 허혈성 뇌혈관 질환, 허혈성 심혈관 질환 및 허혈성 말초혈관 질환으로 구성된 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 허혈성 심혈관 질환은 심근경색 또는 협심증일 수 있고, 상기 허혈성 뇌혈관 질환은 허혈성 뇌졸중, 모야모야 질환, 뇌혈전증 및 뇌색전증으로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 "투여"란, 임의의 적절한 방법으로 개체에게 본 발명의 유효성분을 도입하는 과정을 의미하는 것으로서, 본 발명의 상기 치료 방법에서 투여 방법은 경구 또는 비경구 등의 다양한 경로를 통해 투여될 수 있다.
본 발명의 목적상, 특정 환자에 대한 구체적인 약학적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 상기 유효성분을 포함하는 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 상기 유효성분을 포함하는 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다.
본 발명의 목표중심체온치료(Targeted temperature management); 또는 체온 상승에 의한 조직 손상 억제 방법은 하나 이상의 질환에 대한 치료적 활성을 가지는 화합물 또는 물질을 투여하는 것을 더 포함하는 병용 요법일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 "병용"은 동시, 개별 또는 순차 투여를 나타내는 것으로 이해되어야 한다. 상기 투여가 순차 또는 개별적인 경우, 2차 성분 투여의 간격은 상기 병용의 이로운 효과를 잃지 않도록 하는 것이어야 한다.
본 발명의 상기 목표중심체온치료(Targeted temperature management); 또는 체온 상승에 의한 조직 손상 억제 방법에서, 상기 클로토 단백질, 상기 허혈 또는 허혈후 재관류 손상, 등과 관련된 내용은 앞서 기재한 바와 중복되어 명세서의 과도한 복잡성을 피하기 위하여 이하의 기재를 생략한다.
본 발명의 다른 구현 예에서는 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 약학적 유효량으로 개체에 투여하는 단계를 포함하는, 염증성 질환의 예방; 치료 또는 개선 방법에 관한 것이다.
본 발명에서 상기 "개체"란, 염증성 질환의 예방 또는 치료가 필요한 개체로서, 영장류 예를 들면 인간뿐만 아니라, 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물을 모두 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 투여하는 단계 시 상기 개체에 HMGB1(High mobility group box 1) 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 추가로 더 투여할 수 있다. 본 발명의 상기 클로토 단백질은 HMGB1 단백질이 핵으로부터 세포질로 이동하는 것을 억제함으로써 HMGB1의 발현 수준이 세포질에서 높아지는 현상에 의해 유도되는 염증성 질환을 예방, 개선 또는 치료할 수 있다.
본 발명의 상기 염증성 질환은 HMGB1의 발현 수준이 세포질에서 높아지는 현상에 의해 유도되는 것이라면 모두 포함될 수 있고, 예를 들면 출혈성 쇼크(Hemorrhagic shock), 췌장염(Pancreatitis), 관절염(Arthritis), 폐 혈전 색전증(Pulmonary thromboembolism) 및 급성 폐 손상으로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 염증성 질환의 예방; 치료 또는 개선 방법은 하나 이상의 질환에 대한 치료적 활성을 가지는 화합물 또는 물질을 투여하는 것을 더 포함하는 병용 요법일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 염증성 질환의 예방; 치료 또는 개선 방법에서, 상기 염증성 질환, 상기 투여, 상기 클로토 단백질, 상기 HMGB1 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제등과 관련된 내용은 앞서 기재한 바와 중복되어 명세서의 과도한 복잡성을 피하기 위하여 이하의 기재를 생략한다.
본 발명에 따른 조성물은 HMGB1(High mobility group box 1) 단백질이 핵에서 세포질로 이동되는 것을 억제함으로써, 목표중심체온치료 효과를 발휘할 뿐만 아니라, 체온이 급격하게 상승되어 발생될 수 있는 조직 손상으로 예를 들어 허혈 또는 허혈후 재관류에 의한 조직 손상 등을 예방 또는 치료할 수 있다. 나아가, HMGB1 단백질이 세포질로 이동됨으로써 유발될 수 있는 염증성 질환을 효과적으로 예방 또는 치료할 수 있다.
나아가, 목적하는 생물학적 시료에서 HMGB1 단백질이 존재하는 수준을 감소시킬 수 있는 후보물질을 선별함으로써, 고가의 설비 및 유지 비용이 드는 시설 없이도 환자에게 목표중심체온치료나, 체온의 급격한 상승으로 인해 유발되는 조직 손상 또는 염증성 질환의 치료가 가능하도록 하는 치료제를 선별해낼 수 있다.
도 1은 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직의 사진을 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 조직 손상 지역을 그래프로 나타낸 것이다.
도 3은 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직에서 면역조직화학염색(Immunohistochemical)을 수행한 결과를 나타낸 것이다.
도 4는 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직에서 면역조직화학염색(Immunohistochemical)을 수행한 결과를 나타낸 것이다.
도 5는 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직의 사진을 나타낸 것이다.
도 6은 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직에서 면역조직화학염색을 수행한 결과를 나타낸 것이다.
도 7은 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직의 사진을 나타낸 것이다.
도 8은 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 조직 손상 지역을 그래프로 나타낸 것이다.
도 9는 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직에서 면역조직화학염색을 수행한 결과를 나타낸 것이다.
도 10은 본 발명의 일 실시예에 따른 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직에서 면역조직화학염색을 수행한 결과를 그래프로 나타낸 것이다.
도 11은 본 발명의 일 실시예에 따른 클로토 단백질 및 글리시리진이 병용하여 투여된 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직의 사진을 나타낸 것이다.
도 12는 본 발명의 일 실시예에 따른 클로토 단백질 및 글리시리진이 병용하여 투여된 허혈 또는 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델로부터 적출된 심장 조직에서 면역조직화학염색을 수행한 결과를 나타낸 것이다.
본 발명의 일 구현 예에서는 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 목표중심체온치료(Targeted temperature management)용; 및 체온 상승에 의한 조직 손상 억제용 조성물을 제공한다.
본 발명의 상기 조성물은 HMGB1(High mobility group box 1) 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 유효성분으로 더 포함할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예
[준비예] 허혈 또는 허혈후 재관류 손상이 유도된 동물 모델 제조
허혈 또는 허혈후 재관류에 의한 조직의 손상이 유도된 동물 모델을 제조하기 위하여, 급성 심근 경색(Acute Myocardial infraction)이 유도된 동물 델을 아래와 같은 방식으로 제조하였다.
실험 동물 쥐를 대상으로 5% 아이소플루란(0.7 L/min 아산화질소(nitrous oxide) 및 0.3 L/min 산소(oxygen) 혼합)을 이용하여 마취를 유도하고, 2% 아이소플루란을 이용하여 마취를 유지하였다. 개흉(thoracotomy) 시 나타나는 호흡곤란을 방지하기 위하여 기관절개술(tracheostomy)을 통해 인공호흡기를 사용하였다. 가슴 앞쪽의 가운데 피부를 절개한 뒤 왼쪽 제 4 및 제 5 갈비뼈를 잘라내어 심장이 잘 보이도록 하였다. 이렇게 노출된 심장의 심낭을 출혈이 없도록 자르고 좌전하행동맥을 주위의 신경을 손상시키지 않도록 조심하면서 주위 조직으로부터 좌전하관상동맥(left anterior descending coronary artery, LAD)을 분리하였다. 그런 다음, 좌전하행동맥에 6-0 실크로 약하게 묶은 후, 그 곳에 PE-10 튜브를 넣었다. 이후, 상기 실크를 다시 강하게 묶고 30분간 이와 같은 상태를 유지한 뒤에 PE-10 튜브를 제거하여 재관류 시킴으로써 허혈후 재관류에 의한 조직 손상이 유도된 동물 모델(이하, 'MI' 동물 모델이라 함)을 제조하였다. 이때, 재관류를 시키지 않은 동물 모델(이하, 'Sham' 동물 모델이라 함)을 대조군으로 사용하였다.
[실시예 1] 목표중심체온치료(Targeted temperature management)에 따른 조직 손상 감소 확인
상기 제조예에서 제조된 동물 모델들을 33℃ 및 36℃를 목표로 정하여 4시간 동안 상기 온도를 유지하는 목표중심체온치료를 수행한 뒤, 상기 동물 모델들의 심장을 적출하여 허혈 또는 허혈후 재관류에 의한 조직 손상을 관찰하고, 그 결과를 도 1 및 2에 나타내었다. 이때, 4마리의 실험 동물에서 동일한 조건으로 실험을 반복적으로 수행하였다.
도 1 및 2에서 보는 바와 같이, Sham 동물 모델(Sham)과 비교하여, MI 동물 모델(MI)의 경우에는 허혈후 재관류에 의한 조직 손상이 발생된 지역(Area)이 25% 증가되어 있는 반면, 33℃ 및 36℃를 목표로 정하여 4시간 동안 온도를 유지하는 목표중심체온치료를 수행한 경우에는 허혈후 재관류에 의한 조직 손상이 10%로, 15% 정도 감소되어 있는 것을 확인하였다.
상기 결과를 통해, 허혈후 재관류에 의한 조직 손상과 같이, 체온이 급격히 상승되어 발생될 수 있는 조직 손상은 목표중심체온치료에 의해 현저하게 감소될 수 있음을 알 수 있다.
[실시예 2] 목표중심체온치료(Targeted temperature management)에 따른 단백질의 이동 확인
상기 실시예 1과 동일한 조건으로 33℃ 및 36℃를 목표로 정하여 4시간 동안 상기 온도를 유지하는 목표중심체온치료를 수행한 뒤, 각각의 동물 모델들로부터 적출된 심장을 4% 파라포름알데히드(paraformaldehyde)를 이용하여 72시간 동안 고정시키고, 4℃에서 밤새도록 배양하여 탈수시켰다. 상기 탈수된 심장을 파라핀에 끼우고 4㎛ 단면으로 자른 뒤에 슬라이드 글라스테 부착하였다. 그런 다음, 상기 슬라이드 글라스와 붉은색 형광이 결합되어 있는 HMGB1(High mobility group box 1) 단백질에 특이적인 항체와 반응시킨 뒤, 형광현미경을 이용하여 시각화 하였다. 여기서, DAPI(4′,6-diamidino-2-phenylindole) 염색약을 이용하여 세포의 핵을 염색하였다. 상기 시각화된 이미지는 디지털 카메라를 이용하여 캡처하고, 이미지 분석 프로그램을 사용하여 정량화 한 뒤에, 그 결과를 도 3 및 4에 나타내었다.
도 3 및 4에서 보는 바와 같이, Sham 동물 모델의 경우 HMGB1 단백질이 대부분 핵에 위치화되어 90%의 형광 세기가 핵에서 관찰되는 반면, MI 동물 모델의 경우에는 HMGB1 단백질이 대부분 세포질로 이동되어, 20%의 형광 세기만이 핵에서 관찰되었다. HMGB1 단백질이 대부분 세포질로 이동된 MI 동물 모델에, 33℃ 및 36℃의 목표중심체온치료를 수행한 경우에는 HMGB1 단백질이 대부분 핵에 위치화되어, 핵에서 약 80% 내외의 형광세기가 관찰되었다.
상기 결과를 통해, 목표중심체온치료를 수행하는 경우 HMGB1 단백질이 핵에서 세포질로 이동되는 것을 억제함으로써, 허혈후 재관류에 의한 조직 손상과 같이 체온이 급격히 상승되어 발생될 수 있는 조직 손상이 치료될 수 있는 것임을 알 수 있다.
[실시예 3] 클로토(Klotho) 단백질 주입에 의한 목표중심체온치료 효과 확인
상기 제조예의 MI 동물 모델에 서열번호 2로 표시되는 아미노산 서열로 이루어진 클로토 단백질(이하, '클로토 재조합 단백질'이라 함)을 0㎍, 10㎍, 20㎍ 및 30㎍을 각각 상기 MI 동물 모델의 재관류 직전에 복강내 주입한 뒤, 상기 MI 동물 모델의 심장을 적출하여, 허혈후 재관류에 의한 조직 손상을 관찰하고, 그 결과를 도 5에 나타내었다.
도 5에서 보는 바와 같이, 클로토 재조합 단백질을 주입하지 않은 경우(0㎍)에서는 흰색으로 확인되는 허혈후 재관류에 의한 조직 손상이 넓은 지역에서 관찰되는 반면, 클로토 재조합 단백질을 주입한 경우에는 농도에 의존적으로 허혈후 재관류에 의한 조직 손상의 지역이 현저하게 감소되는 것을 확인하였다.
상기 결과를 통해, 본 발명에 따른 클로토 단백질의 경우에는 33℃ 및 36℃를 목표로 정하여 4시간 동안 상기 온도를 유지하는 목표중심체온치료를 수행한 경우와 같이, 개체의 체온을 유지시킴으로써 허혈 또는 허혈후 재관류와 같이 개체의 체온이 상승되었을 때 발생될 수 있는 조직 손상을 현저하게 억제하는 효과가 발휘되도록 할 수 있음을 알 수 있다.
[실시예 4] 클로토 단백질 주입에 의한 단백질의 세포 내 이동 확인
상기 실시예 3과 동일한 조건으로 상기 제조예에서 제작된 동물 모델에, 클로토 재조합 단백질을 주입한 뒤, 상기 실시예 2와 동일한 방법을 통해 각각의 동물 모델로부터 적출된 심장에서 면역조직화학염색을 수행하여, 그 결과를 도 6에 나타내었다. 여기서, 클로토 재조합 단백질을 20㎍의 농도로 주입하였으며, 각 실험은 2번 반복하여 수행하였다(도 6의 Klotho 1 및 Klotho 2).
도 6에서 보는 바와 같이, MI 동물 모델에서는 HMGB1 단백질이 세포질에 높은 수준으로 존재하는 반면, 클로토 재조합 단백질이 주입된 경우에는 HMGB1 단백질이 세포질에 비하여 핵에 높은 수준으로 존재하는 것을 확인하였다.
상기 결과를 통해, 본 발명에 따른 클로토 단백질은 허혈후 재관류에 의한 조직 손상과 같이, 체온이 급격하게 상승되어 발생될 수 있는 조직 손상에서, HMGB1 단백질이 핵에서 세포질로 이동되는 것을 억제함으로써 목표중심체온치료 효과가 발휘되도록 할 수 있음을 알 수 있다.
[실시예 5] HMGB1 억제제 주입에 의한 목표중심체온치료 효과 확인
상기 실시예 3과 동일한 조건으로 상기 제조예에서 동물 모델의 재관류 손상 유도 전에, HMGB1 억제제인 100 mg/kg의 글리시리진(glycyrrhizin)을 피하에 주입한 뒤, 상기 실시예 2와 동일한 방법을 통해 각각의 동물 모델로부터 적출된 심장을 관찰하고, 상기 심장에서 면역조직화학염색을 수행하여, 그 결과를 도 7 내지 10에 나타내었다.
도 7 및 8에서 보는 바와 같이, 글리시리진을 주입하지 않은 경우와 비교하여, MI 동물 모델에 글리시리진이 주입된 경우, 허혈후 재관류에 의한 조직 손상이 발생된 지역이 10% 감소한 것이 관찰되었다.
또한, 도 9 및 10에서 보는 바와 같이, 면역조직화학염색 수행 결과, MI 동물 모델에서는 HMGB1 단백질이 세포질에 높은 수준으로 존재하는 반면, 글리시리진이 주입된 경우에는 HMGB1 단백질이 세포질에 비하여 핵에 높은 수준으로 존재하는 것을 확인하였다.
상기 결과를 통해, 본 발명에 따른 클로토 단백질은 HMGB1 억제제인 글리시리진과 같이 HMGB1 단백질이 세포질로 이동되는 것을 억제함으로써, 허혈후 재관류에 의한 조직 손상과 같이, 체온이 급격하게 상승되어 발생될 수 있는 조직 손상에서 목표중심체온치료 효과가 발휘되도록 할 수 있음을 알 수 있다. 나아가, HMGB1 단백질이 세포질로 이동됨으로써 유발될 수 있는 염증성 질환의 예방 또는 치료에 클로토 단백질이 글리시리진과 동등한 효과를 발휘함으로써 사용될 수 있음을 알 수 있다.
[실시예 6] HMGB1 억제제 및 클로토 단백질 주입에 의한 목표중심체온치료 효과 확인
상기 실시예 3 및 5와 동일한 조건으로 상기 제조예에서 제작된 동물 모델에, 10 ㎍의 클로토 재조합 단백질과 50 mg/kg의 글리시리진을 주입한 뒤, 상기 실시예 2와 동일한 방법을 통해 각각의 동물 모델로부터 적출된 심장을 관찰하여, 그 결과를 도 11에 나타내었다.
도 11에서 보는 바와 같이, 클로토 재조합 단백질 및 글리시리진이 각각 단독으로 투여된 경우 각각 조직 손상 지역이 11.3%와 10.5%인 반면, 클로토 단백질과 글리시리진이 병용 투여된 경우 조직의 손상 지역이 6.3%로 더욱 현저하게 감소되었다.
상기 결과를 통해 본 발명에 따른 클로토 단백질과 글리시리진이 각각 단독으로 사용되는 경우에 비와 비교하여 병용으로 사용되는 경우에는 허혈 또는 허혈후 재관류에 의한 조직 손상과 같이, 체온이 급격하게 상승되어 발생될 수 있는 조직 손상에서 목표중심체온치료 및 염증성 질환의 예방 또는 치료에 현저한 효과를 유도할 수 있음을 알 수 있다.
[실시예 7] HMGB1 억제제 및 클로토 단백질 주입에 의한 목표중심체온치료 효과 확인
마찬가지로, 상기 실시예 3 및 5와 동일한 조건으로 상기 제조예에서 제작된 동물 모델에, 10 ㎍의 클로토 재조합 단백질과 50 mg/kg의 글리시리진을 주입한 뒤, 상기 실시예 2와 동일한 방법을 통해 각각의 동물 모델로부터 적출된 심장에서 면역조직화학염색을 수행하여, 그 결과를 도 12에 나타내었다.
도 12에서 보는 바와 같이, 클로토 단백질 단독으로 투여된 경우(도 12의 MI+klotho1)와 비교하여, 클로토 단백질과 글리시리진이 병용 투여된 경우에서도 HMGB1 단백질이 세포질에 비하여 핵에 높은 수준으로 존재하고, 세포질로 이동되지 않는 것을 확인하였다(도 12의 MI+klotho+Gly).
상기 결과를 통해 본 발명에 따른 클로토 단백질과 글리시리진이 각각 단독으로 사용되는 경우와 마찬가지로 병용으로 사용되는 경우에도 HMGB1 단백질이 세포질로 이동되는 것을 매우 효과적으로 억제할 수 있는 것을 알 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 클로토(Klotho) 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 다양한 용도의 조성물에 관한 것이다.
서열번호 1: 클로토 단백질 아미노산 서열
1 mpasapprrp rppppslsll lvllglggrr lraepgdgaq twarfsrppa peaaglfqgt
61 fpdgflwavg saayqteggw qqhgkgasiw dtfthhplap pgdsrnaslp lgapsplqpa
121 tgdvasdsyn nvfrdtealr elgvthyrfs iswarvlpng sagvpnregl ryyrrllerl
181 relgvqpvvt lyhwdlpqrl qdayggwanr aladhfrdya elcfrhfggq vkywitidnp
241 yvvawhgyat grlapgirgs prlgylvahn lllahakvwh lyntsfrptq ggqvsialss
301 hwinprrmtd hsikecqksl dfvlgwfakp vfidgdypes mknnlssilp dftesekkfi
361 kgtadffalc fgptlsfqll dphmkfrqle spnlrqllsw idlefnhpqi fivengwfvs
421 gttkrddaky myylkkfime tlkaikldgv dvigytawsl mdgfewhrgy sirrglfyvd
481 flsqdkmllp kssalfyqkl iekngfpplp enqplegtfp cdfawgvvdn yiqvdttlsq
541 ftdlnvylwd vhhskrlikv dgvvtkkrks ycvdfaaiqp qiallqemhv thfrfsldwa
601 lilplgnqsq vnhtilqyyr cmaselvrvn itpvvalwqp mapnqglprl larqgawenp
661 ytalafaeya rlcfqelghh vklwitmnep ytrnmtysag hnllkahala whvynekfrh
721 aqngkisial qadwiepacp fsqkdkevae rvlefdigwl aepifgsgdy pwvmrdwlnq
781 rnnfllpyft edekkliqgt fdflalshyt tilvdseked pikyndylev qemtditwln
841 spsqvavvpw glrkvlnwlk fkygdlpmyi isngiddglh aeddqlrvyy mqnyinealk
901 ahildginlc gyfaysfndr taprfglyry aadqfepkas mkhyrkiids ngfpgpetle
961 rfcpeeftvc tecsffhtrk sllafiaflf fasiislsli fyyskkgrrs yk
서열번호 2: 클로토 재조합 단백질 아미노산 서열
pgdgaq twarfsrppa peaaglfqgt fpdgflwavg saayqteggw qqhgkgasiw dtfthhplap pgdsrnaslp lgapsplqpa tgdvasdsyn nvfrdtealr elgvthyrfs iswarvlpng sagvpnregl ryyrrllerl relgvqpvvt lyhwdlpqrl qdayggwanr aladhfrdya elcfrhfggq vkywitidnp yvvawhgyat grlapgirgs prlgylvahn lllahakvwh lyntsfrptq ggqvsialss hwinprrmtd hsikecqksl dfvlgwfakp vfidgdypes mknnlssilp dftesekkfi kgtadffalc fgptlsfqll dphmkfrqle spnlrqllsw idlefnhpqi fivengwfvs gttkrddaky myylkkfime tlkaikldgv dvigytawsl mdgfewhrgy sirrglfyvd flsqdkmllp kssalfyqkl iekngfpplp enqplegtfp cdfawgvvdn yiqvdttlsq ftdlnvylwd vhhskrlikv dgvvtkkrks ycvdfaaiqp qiallqemhv thfrfsldwa lilplgnqsq vnhtilqyyr cmaselvrvn itpvvalwqp mapnqglprl larqgawenp ytalafaeya rlcfqelghh vklwitmnep ytrnmtysag hnllkahala whvynekfrh qngkisial qadwiepacp fsqkdkevae rvlefdigwl aepifgsgdy pwvmrdwlnq rnnfllpyft edekkliqgt fdflalshyt tilvdseked pikyndylev qemtditwln spsqvavvpw glrkvlnwlk fkygdlpmyi isngiddglh aeddqlrvyy mqnyinealk ahildginlc gyfaysfndr taprfglyry aadqfepkas mkhyrkiids ngfpgpetle rfcpeeftvc tecsffhtrk sllafiaflf f
서열번호 3: 클로토 유전자의 염기 서열
1 gcctggctcc cgcgcagcat gcccgccagc gccccgccgc gccgcccgcg gccgccgccg
61 ccgtcgctgt cgctgctgct ggtgctgctg ggcctgggcg gccgccgcct gcgtgcggag
121 ccgggcgacg gcgcgcagac ctgggcccgt ttctcgcggc ctcctgcccc cgaggccgcg
181 ggcctcttcc agggcacctt ccccgacggc ttcctctggg ccgtgggcag cgccgcctac
241 cagaccgagg gcggctggca gcagcacggc aagggtgcgt ccatctggga tacgttcacc
301 caccaccccc tggcaccccc gggagactcc cggaacgcca gtctgccgtt gggcgccccg
361 tcgccgctgc agcccgccac cggggacgta gccagcgaca gctacaacaa cgtcttccgc
421 gacacggagg cgctgcgcga gctcggggtc actcactacc gcttctccat ctcgtgggcg
481 cgagtgctcc ccaatggcag cgcgggcgtc cccaaccgcg aggggctgcg ctactaccgg
541 cgcctgctgg agcggctgcg ggagctgggc gtgcagcccg tggtcaccct gtaccactgg
601 gacctgcccc agcgcctgca ggacgcctac ggcggctggg ccaaccgcgc cctggccgac
661 cacttcaggg attacgcgga gctctgcttc cgccacttcg gcggtcaggt caagtactgg
721 atcaccatcg acaaccccta cgtggtggcc tggcacggct acgccaccgg gcgcctggcc
781 cccggcatcc ggggcagccc gcggctcggg tacctggtgg cgcacaacct cctcctggct
841 catgccaaag tctggcatct ctacaatact tctttccgtc ccactcaggg aggtcaggtg
901 tccattgccc taagctctca ctggatcaat cctcgaagaa tgaccgacca cagcatcaaa
961 gaatgtcaaa aatctctgga ctttgtacta ggttggtttg ccaaacccgt atttattgat
1021 ggtgactatc ccgagagcat gaagaataac ctttcatcta ttctgcctga ttttactgaa
1081 tctgagaaaa agttcatcaa aggaactgct gacttttttg ctctttgctt tggacccacc
1141 ttgagttttc aacttttgga ccctcacatg aagttccgcc aattggaatc tcccaacctg
1201 aggcaactgc tttcctggat tgaccttgaa tttaaccatc ctcaaatatt tattgtggaa
1261 aatggctggt ttgtctcagg gaccaccaag agagatgatg ccaaatatat gtattacctc
1321 aaaaagttca tcatggaaac cttaaaagcc atcaagctgg atggggtgga tgtcatcggg
1381 tataccgcat ggtccctcat ggatggtttc gagtggcaca gaggttacag catcaggcgt
1441 ggactcttct atgttgactt tctaagccag gacaagatgt tgttgccaaa gtcttcagcc
1501 ttgttctacc aaaagctgat agagaaaaat ggcttccctc ctttacctga aaatcagccc
1561 ctagaaggga catttccctg tgactttgct tggggagttg ttgacaacta cattcaagta
1621 gataccactc tgtctcagtt taccgacctg aatgtttacc tgtgggatgt ccaccacagt
1681 aaaaggctta ttaaagtgga tggggttgtg accaagaaga ggaaatccta ctgtgttgac
1741 tttgctgcca tccagcccca gatcgcttta ctccaggaaa tgcacgttac acattttcgc
1801 ttctccctgg actgggccct gattctccct ctgggtaacc agtcccaggt gaaccacacc
1861 atcctgcagt actatcgctg catggccagc gagcttgtcc gtgtcaacat caccccagtg
1921 gtggccctgt ggcagcctat ggccccgaac caaggactgc cgcgcctcct ggccaggcag
1981 ggcgcctggg agaaccccta cactgccctg gcctttgcag agtatgcccg actgtgcttt
2041 caagagctcg gccatcacgt caagctttgg ataacgatga atgagccgta tacaaggaat
2101 atgacataca gtgctggcca caaccttctg aaggcccatg ccctggcttg gcatgtgtac
2161 aatgaaaagt ttaggcatgc tcagaatggg aaaatatcca tagccttgca ggctgattgg
2221 atagaacctg cctgcccttt ctcccaaaag gacaaagagg tggctgagag agttttggaa
2281 tttgacattg gctggctggc tgagcccatt ttcggctctg gagattatcc atgggtgatg
2341 agggactggc tgaaccaaag aaacaatttt cttcttcctt atttcactga agatgaaaaa
2401 aagctaatcc agggtacctt tgactttttg gctttaagcc attataccac catccttgta
2461 gactcagaaa aagaagatcc aataaaatac aatgattacc tagaagtgca agaaatgacc
2521 gacatcacgt ggctcaactc ccccagtcag gtggcggtag tgccctgggg gttgcgcaaa
2581 gtgctgaact ggctgaagtt caagtacgga gacctcccca tgtacataat atccaatgga
2641 atcgatgacg ggctgcatgc tgaggacgac cagctgaggg tgtattatat gcagaattac
2701 ataaacgaag ctctcaaagc ccacatactg gatggtatca atctttgcgg atactttgct
2761 tattcgttta acgaccgcac agctccgagg tttggcctct atcgttatgc tgcagatcag
2821 tttgagccca aggcatccat gaaacattac aggaaaatta ttgacagcaa tggtttcccg
2881 ggcccagaaa ctctggaaag attttgtcca gaagaattca ccgtgtgtac tgagtgcagt
2941 ttttttcaca cccgaaagtc tttactggct ttcatagctt ttctattttt tgcttctatt
3001 atttctctct cccttatatt ttactactcg aagaaaggca gaagaagtta caaatagttc
3061 tgaacatttt tctattcatt cattttgaaa taattatgca gacacatcag ctgttaacca
3121 tttgcacctc taagtgttgt gaaactgtaa atttcataca tttgacttct agaaaacatt
3181 tttgtggctt atgacagagg ttttgaaatg ggcataggtg atcgtaaaat attgaataat
3241 gcgaatagtg cctgaatttg ttctcttttt gggtgattaa aaaactgaca ggcactataa
3301 tttctgtaac acactaacaa aagcatgaaa aataggaacc acaccaatgc aacatttgtg
3361 cagaaatttg aatgacaaga ttaggaatat tttcttctgc acccacttct aaatttaatg
3421 tttttctgga agtagtaatt gcaagagttc gaatagaaag ttatgtacca agtaaccatt
3481 tctcagctgc cataataatg cctagtggct tcccctctgt caaatctagt ttcctatgga
3541 aaagaagatg gcagatacag gagagacgac agagggtcct aggctggaat gttcctttcg
3601 aaagcaatgc ttctatcaaa tactagtatt aatttatgta tctggttaat gacatacttg
3661 gagagcaaat tatggaaatg tgtattttat atgatttttg aggtcctgtc taaaccctgt
3721 gtccctgagg gatctgtctc actggcatct tgttgagggc cttgcacata ggaaactttt
3781 gataagtatc tgcggaaaaa caaacatgaa tcctgtgata ttgggctctt caggaagcat
3841 aaagcaattg tgaaatacag tataccgcag tggctctagg tggaggaaag gaggaaaaag
3901 tgcttattat gtgcaacatt atgattaatc tgattataca ccatttttga gcagatcttg
3961 gaatgaatga catgaccttt ccctagagaa taaggatgaa ataatcactc attctatgaa
4021 cagtgacact actttctatt ctttagctgt actgtaattt ctttgagttg atagttttac
4081 aaattcttaa taggttcaaa agcaatctgg tctgaataac actggatttg tttctgtgat
4141 ctctgaggtc tattttatgt ttttgctgct acttctgtgg aagtagcttt gaactagttt
4201 tactttgaac tttcacgctg aaacatgcta gtgatatcta gaaagggcta attaggtctc
4261atcctttaat gccccttaaa taagtcttgc tgattttcag acagggaagt cctctctatta
4321 cactggagct gttttataga taagtcaata ttgtatcagg caagataaac caatgtcata
4381 acaggcattg ccaacctcac tgacacaggg tcatagtgta taataatata ctgtactata
4441 taatatatca tctttagagg tatgattttt tcatgaaaga taagcttttg gtaatattca
4501 ttttaaagtg gacttattaa aattggatgc tagagaatca agtttatttt atgtatatat
4561 ttttctgatt ataagagtaa tatatgttca ttgtaaaaat ttttaaaaca cagaaactat
4621 atgcaaagaa aaaataaaaa ttatctataa tctcagaacc cagaaatagc cactattaac
4681 atttcctacg tattttattt tacatagatc atattgtata tagttagtat ctttattaat
4741 ttttattatg aaactttcct ttgtcattat tagtcttcaa aagcatgatt tttaatagtt
4801 gttgagtatt ccaccacagg aatgtatcac aacttaaccg ttcccgtttg ttagactagt
4861 ttcttattaa tgttgatgaa tgttgtttaa agataatttt gttgctacat ttactttaat
4921 ttccttgact ttctcttgc tccttgataa agtattatat taataataaa
4981 tctgcctgca actttttgcc ttctttcata atca
서열번호 4: HMGB1 아미노산 서열
10 20 30 40 50
MGKGDPKKPR GKMSSYAFFV QTCREEHKKK HPDASVNFSE FSKKCSERWK
60 70 80 90 100
TMSAKEKGKF EDMAKADKAR YEREMKTYIP PKGETKKKFK DPNAPKRPPS
110 120 130 140 150
AFFLFCSEYR PKIKGEHPGL SIGDVAKKLG EMWNNTAADD KQPYEKKAAK
160 170 180 190 200
LKEKYEKDIA AYRAKGKPDA AKKGVVKAEK SKKKKEEEED EEDEEDEEEE
210
EDEEDEDEEE DDDDE
서열번호 5: HMGB1 유전자의 염기서열
CGAGAGCCGGACGGGCACTGGGCGACTCTGTGCCTCGCGGAGGAAAATCAACTAAACATGGGCAAAGGAG
ATCCTAAGAAGCCGAGAGGCAAAATGTCCTCATATGCATTCTTTGTGCAAACCTGCCGGGAGGAGCACAA
GAAGAAGCACCCGGATGCTTCTGTCAACTTCTCAGAGTTCTCCAAGAAGTGCTCAGAGAGGTGGAAGACC
ATGTCTGCTAAAGAAAAGGGGAAATTTGAAGATATGGCAAAGGCTGACAAGGCTCGTTATGAAAGAGAAA
TGAAAACCTACATCCCCCCCAAAGGGGAGACCAAAAAGAAGTTCAAGGACCCCAATGCCCCCAAGAGGCC
TCCTTCGGCCTTCTTCTTGTTCTGTTCTGAGTACCGCCCAAAAATCAAAGGCGAGCATCCTGGCTTATCC
ATTGGTGATGTTGCGAAGAAACTAGGAGAGATGTGGAACAACACTGCTGCGGATGACAAGCAGCCCTATG
AAAAGAAGGCCGCCAAGCTGAAGGAGAAGTATGAGAAGGATATTGCTGCCTACAGAGCTAAAGGAAAACC
TGATGCAGCGAAAAAGGGGGTGGTCAAGGCTGAGAAGAGCAAGAAAAAGAAGGAAGAGGAAGACGACGAG
GAGGATGAAGAGGATGAGGAAGAGGAGGAAGAGGAGGAAGACGAAGATGAAGAAGAAGATGATGATGATG
AATAAGTTGGTTCTAGCGCAGTTTTTTTTTCTTGTCTATAAAGCATTTAACCCCCCTGTACACAACTCAC
TCCTTTTAAAGAAAAAAATTGAAATGTAAGGCTGTGTAAGATTTGTTTTTAAACTGTACAGTGTCTTTTT
TTGTATAGTTAACACACTACCGAATGTGTCTTTAGCTAGCCCTGTCCTGGTGGTATTTTCAATAGCCACT
AACCTTGCCTGGTACAGTCTGGGGGTTGTAAATTGGCATGGAAATTAAAGCAGGTTCTTGTTGGTGCACA
GCACAAATTAGTTATATATGGGGACAGTAGTTTGGTTTTTGGTTTCTTTTTTTTTTTTTTTTTGGTTTTG
TTTTTTTTCCTTTTGTTTTTTTTTTCCATCTTCAGTTGTCTCTGATGCAGCTTATACGAAGGTAATTGTT
GTTCTGTTAACTGAATACCACTCTGTAATTGCAAAAAAATGGCGGCTGTTTTGTTGACATTCTGAATGCT
TCTAAGTAAATACAATTTTTTTTATTAGTACTGTTGTCCTTTTCATAGGTCTGAAAGTTTTCTTCTCAAG
GGGAAGCTAGTCTTTTGCTTTTGCCCATTTTGGGTCACATGGATTATTAGTGTGTATCTTCATATAGTTG
GAAAAATCTTTTGTCCACACACCCTGCATATTGTGGTAGGGGTAACATTTTCATCTACAGTTGAAGAATT
CTCCAAAATTGTGATCAGTTGGATAAGAGATACTCTACTTAGCAAAGCAAGGAGTGATCAATTCTGTCAC
ACCATGGGATTATTAGATCAAACAGTCTGAAAGTCTGTCCTTGAAGGACTAATAGAAAAGTATGTTCTGC
TCCTTACCTGAGGACTCCTTTAACTGCCATTACTGTGTAATGACAGTTATATTTTGCAGTTTCCCCTACT
AAAGACCTGAGAATGTATCCCCAAAAGCGTGAGCTTAAAATACAAGATTGCTGTACTATTTGTTGACCTT
AGTCCCAGCGAAGGCTATCATGAGAAGCTGGCTGTAATGCCTTTGCCCTTCTATCTAAATACGGATTGCT
CAGGAAACTTGACTGTTTAAAGGTATATTTAATTAGTTGAGCCAGCTTTTAAAATTATGCCACATTTAAA
ATGAAGGGTATATTTTCCTATATTGTGGTTTGTCCCTTTATAAATCAGATACAAGGAAAGCGGATAAACT
TTGCATATTAGTACCAGTTGTCCAAGCCATTTGCTTTTTCTTTATAAAGCCCGAACTCATTCATTAATCA
TGTTTAATCTGCTTAGTTTAGGGAACAATTTGGCAATTTTGTGGGTTTTCTTTTTTTCTTTTTCTTTTTT
TTTTTTTTTTGAGATTATCATTCTCTTAAAGTGCCAGTGTTTTAAAATAGCGTTCTTGTAATTTTCCGCG
CTTTTGTGATGGAGTGCTGTTATATCATTTTGACTTGGGTTCTTTACAGTTGCCTTTGTTCTGTAATTTG
AGGAGGAATACTGAACATGAGTCCTGGATGATACTAATAAACTAATAATTGCAGAGGTTTTAAAAAAAAAAAAAAAAAAAAAAAAA

Claims (29)

  1. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 목표중심체온치료(Targeted temperature management)용 약학 조성물.
  2. 제 1항에 있어서,
    상기 클로토 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어진 것인, 약학 조성물.
  3. 제 2항에 있어서,
    상기 클로토 단백질은 서열번호 2로 표시되는 아미노산 서열로 이루어진 것인, 약학 조성물.
  4. 제 1항에 있어서,
    상기 약학 조성물은 HMGB1(High mobility group box 1) 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 유효성분으로 더 포함하는 것인, 약학 조성물.
  5. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 체온 상승에 의한 조직 손상의 억제용 약학 조성물.
  6. 제 5항에 있어서,
    상기 약학 조성물은 HMGB1 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 유효성분으로 더 포함하는 것인, 약학 조성물.
  7. 제 5항에 있어서,
    상기 조직 손상은 허혈 또는 허혈후 재관류 손상에 의해 유도되는 것인, 약학 조성물.
  8. 제 7항에 있어서,
    상기 허혈 또는 허혈후 재관류 손상에 의해 유도되는 질환은 허혈성 뇌혈관 질환, 허혈성 심혈관 질환 및 허혈성 말초혈관 질환으로 구성된 군으로부터 선택되는 적어도 하나인 것인, 약학 조성물.
  9. 제 8항에 있어서,
    상기 허혈성 심혈관 질환은 심근경색 또는 협심증인 것인, 약학 조성물.
  10. 제 8항에 있어서,
    상기 허혈성 뇌혈관 질환은 허혈성 뇌졸중, 모야모야 질환, 뇌혈전증 및 뇌색전증으로 이루어진 군으로부터 선택되는 적어도 하나인 것인, 약학 조성물.
  11. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 목표중심체온치료(Targeted temperature management)용 식품 조성물.
  12. 제 11항에 있어서,
    상기 식품 조성물은 HMGB1 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 더 포함하는 것인, 식품 조성물.
  13. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 체온 상승에 의한 조직 손상의 억제용 약학 조성물.
  14. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 염증성 질환의 예방 또는 치료용 약학 조성물.
  15. 제 14항에 있어서,
    상기 클로토 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어진 것인, 약학 조성물.
  16. 제 14항에 있어서,
    상기 약학 조성물은 HMGB1 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 유효성분으로 더 포함하는 것인, 약학 조성물.
  17. 제 14항에 있어서,
    상기 염증성 질환은 출혈성 쇼크, 췌장염, 관절염, 폐 혈전 색전증 및 급성 폐 손상으로 이루어진 군으로부터 선택되는 적어도 하나인 것인, 약학 조성물.
  18. 제 17항에 있어서,
    상기 급성 폐 손상은 아데노바이러스, 코로나바이러스, 뎅기열 바이러스, B형 간염 바이러스(Hepatitis B virus; HBV), C형 간염 바이러스(Hepatitis C virus; HCV), 인체면역결핍바이러스(Human immunodeficiency virus; HIV), 인유두종 바이러스(Human papillomavirus; HPV) 및 거대세포바이러스로 이루어진 군으로부터 선택되는 적어도 하나의 감염이 원인인, 약학 조성물.
  19. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 염증성 질환의 예방 또는 개선용 식품 조성물.
  20. 제 19항에 있어서,
    상기 식품 조성물은 HMGB1 단백질 또는 이를 암호화하는 유전자의 기능 또는 발현 억제제를 더 포함하는 것인, 식품 조성물.
  21. 목적하는 개체로부터 분리된 생물학적 시료에, 목적하는 후보물질을 처리하는 단계; 및
    상기 생물학적 시료의 세포질에서 HMGB1 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준을 확인하는 단계를 포함하는, 목표중심체온치료를 위한 치료제의 스크리닝 방법.
  22. 제 21항에 있어서,
    상기 세포질에서 HMGB1의 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준이 후보물질을 처리하기 이전에 비하여 감소되는 경우, 상기 후보물질을 목표중심체온치료를 위한 치료제로 선별하는 단계를 더 포함하는 것인, 스크리닝 방법.
  23. 목적하는 개체로부터 분리된 생물학적 시료에, 목적하는 후보물질을 처리하는 단계; 및
    상기 생물학적 시료의 세포질에서 HMGB1 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준을 확인하는 단계를 포함하는, 염증성 질환의 치료를 위한 치료제의 스크리닝 방법.
  24. 제 23항에 있어서,
    상기 세포질에서 HMGB1의 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준이 후보물질을 처리하기 이전에 비하여 감소되는 경우, 상기 후보물질을 염증성 질환의 치료를 위한 치료제로 선별하는 단계를 더 포함하는 것인, 스크리닝 방법.
  25. 목적하는 개체로부터 분리된 생물학적 시료에, 목적하는 후보물질을 처리하는 단계; 및
    상기 생물학적 시료의 세포질에서 HMGB1 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준을 확인하는 단계를 포함하는, 허혈 또는 허혈후 재관류 손상의 치료를 위한 치료제의 스크리닝 방법.
  26. 제 25항에 있어서,
    상기 세포질에서 HMGB1의 단백질; 또는 이를 암호화하는 유전자가 존재하는 수준이 후보물질을 처리하기 이전에 비하여 감소되는 경우, 상기 후보물질을 허혈 또는 허혈후 재관류 손상의 치료를 위한 치료제로 선별하는 단계를 더 포함하는 것인, 스크리닝 방법.
  27. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 약학적 유효량으로 개체에 투여하는 단계를 포함하는, 목표중심체온치료(Targeted temperature management) 방법.
  28. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 약학적 유효량으로 개체에 투여하는 단계를 포함하는, 체온 상승에 의한 조직 손상의 억제 방법.
  29. 클로토(Klotho) 단백질; 또는 이를 암호화하는 유전자를 약학적 유효량으로 개체에 투여하는 단계를 포함하는, 염증성 질환의 예방 또는 치료 방법.
PCT/KR2020/005319 2019-04-22 2020-04-22 클로토 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 조성물 WO2020218823A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20190046600 2019-04-22
KR10-2019-0046600 2019-04-22

Publications (1)

Publication Number Publication Date
WO2020218823A1 true WO2020218823A1 (ko) 2020-10-29

Family

ID=72941471

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/005319 WO2020218823A1 (ko) 2019-04-22 2020-04-22 클로토 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 조성물

Country Status (2)

Country Link
KR (2) KR20200123754A (ko)
WO (1) WO2020218823A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016135295A1 (en) * 2015-02-27 2016-09-01 Apceth Gmbh & Co. Kg Genetically modified mesenchymal stem cell expressing klotho
KR20160125381A (ko) * 2014-01-24 2016-10-31 엔지엠 바이오파마슈티컬스, 아이엔씨. 결합 단백질 및 그의 사용 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160125381A (ko) * 2014-01-24 2016-10-31 엔지엠 바이오파마슈티컬스, 아이엔씨. 결합 단백질 및 그의 사용 방법
WO2016135295A1 (en) * 2015-02-27 2016-09-01 Apceth Gmbh & Co. Kg Genetically modified mesenchymal stem cell expressing klotho

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein NCBI; 23 March 2015 (2015-03-23), "klotho, isoform CRA_b [Homo sapiens]", XP055758482, retrieved from NCBI Database accession no. EAX08526.1 *
HUI, HAIPENG, ZHAI YUFENG, AO LIHUA, CLEVELAND JOSEPH C., LIU HONGBIN, FULLERTON DAVID A., MENG XIANZHONG: "Klotho suppresses the inflammatory responses and ameliorates cardiac dysfunction in aging endotoxemic mice", ONCOTARGET, vol. 8, no. 9, 1 February 2017 (2017-02-01), pages 15663 - 15676, XP055758477, DOI: 10.18632/oncotarget.14933 *
RAZZAQUE, M. SHAWKAT: "The role of Klotho in energy metabolism", NATURE REVIEWS ENDOCRINOLOGY, vol. 8, no. 10, 29 May 2012 (2012-05-29), pages 579 - 587, XP055758479, DOI: 10.1038/nrendo.2012.75 *

Also Published As

Publication number Publication date
KR20230008663A (ko) 2023-01-16
KR20200123754A (ko) 2020-10-30

Similar Documents

Publication Publication Date Title
WO2017023138A1 (ko) 키메라 항원 수용체 및 키메라 항원 수용체가 발현된 t 세포
WO2010087594A9 (ko) 시디９３ 또는 이의 가용성 단편의 용도
WO2011142514A1 (ko) Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물
WO2011052883A9 (ko) Ｓｏｃｓ２ 유전자의 발현을 조절하여 자연 살해 세포를 활성화시키는 방법
WO2018208011A2 (ko) β-아밀로이드 단백질의 응집을 억제하는 생체친화적 펩타이드
WO2011115456A2 (ko) 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＴＷＥＡＫ 이중 길항제
WO2017003267A1 (ko) 항바이러스 활성 효능을 가지는 펩티드 및 이를 포함하는 조성물
WO2020218823A1 (ko) 클로토 단백질 또는 이를 암호화하는 유전자를 유효성분으로 포함하는 조성물
WO2019182417A1 (ko) 황열 바이러스 유래 ns1 단백질, 이에 특이적으로 결합하는 단일클론항체 및 이의 용도
WO2019194586A1 (en) Novel target for anti-cancer and immune-enhancing
WO2019216623A1 (ko) 당뇨병 및 비만 치료용 면역관용 세포 백신 및 인슐린 분비 세포의 제조 방법
WO2019045182A1 (ko) 비멘틴 유래 펩타이드에 특이적으로 결합하는 물질을 포함하는 피부질환 예방 및 치료용 조성물
WO2020017788A1 (ko) Cd9를 이용한 당뇨병의 예방 또는 치료용 조성물과 당뇨병 치료제 스크리닝 방법
WO2017213435A1 (ko) Slit-robo 시스템을 이용한 근감소증 예방 또는 치료용 조성물
WO2018236194A1 (ko) Gas6 단백질 또는 이의 수용체 활성화제를 포함하는 섬유증의 예방 또는 치료용 조성물
WO2020130467A2 (ko) Cd8+ 메모리 t 세포 매개성 질환의 예방 또는 치료용 약학 조성물
WO2020117019A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2020071641A1 (ko) Tsp1 단백질 억제제를 유효성분으로 함유하는 파브리 병의 예방 또는 치료용 약학적 조성물
WO2021034101A1 (ko) 신규 인터페론 람다 변이체 및 이의 제조방법
WO2011115458A2 (ko) 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＩＬ－２１ 이중 길항제
WO2021235685A1 (ko) 암 예방 또는 치료용 약학적 조성물
WO2015147369A1 (ko) Sirt2 억제제를 포함하는 약학적 조성물
WO2017164486A1 (ko) Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법
WO2018135738A1 (ko) 매트릭스 gla 단백질을 유효성분으로 함유하는 미오스타틴 활성 저해용 조성물
WO2018038539A2 (ko) Eprs 단백질 또는 이의 단편을 포함하는 항rna-바이러스용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20794760

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20794760

Country of ref document: EP

Kind code of ref document: A1