WO2020067599A1 - 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법 - Google Patents
형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법 Download PDFInfo
- Publication number
- WO2020067599A1 WO2020067599A1 PCT/KR2018/012308 KR2018012308W WO2020067599A1 WO 2020067599 A1 WO2020067599 A1 WO 2020067599A1 KR 2018012308 W KR2018012308 W KR 2018012308W WO 2020067599 A1 WO2020067599 A1 WO 2020067599A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polymerase
- analysis
- fmma
- probe
- fluorescence
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/10—Nucleotidyl transfering
- C12Q2521/101—DNA polymerase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/10—Nucleotidyl transfering
- C12Q2521/119—RNA polymerase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/204—Modifications characterised by specific length of the oligonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/107—Temperature of melting, i.e. Tm
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention relates to a method for multiplex analysis of amplification products using fluorescence-based multiple fusion analysis, and more specifically, to analyze multiple target nucleic acids simultaneously using a single fluorescence channel through fusion temperature analysis using fluorescence. It relates to a method for multiplex analysis of a polymerase chain reaction product.
- Real-time polymerase chain reaction is a technique of molecular biology that amplifies a specific gene fragment that knows the nucleotide sequence of all genes by DNA polymerase to examine and isolate the gene.
- Real-time PCR measures amplification products in real time, reduces cross-contamination, and enables more accurate quantitative analysis.
- This real-time polymerase chain reaction has become one of the essential technologies in research and examination in the fields of biochemistry, molecular biology, medicine and clinical pathology.
- the real-time polymerase chain reaction has the same basic principle as the general polymerase chain reaction, but differs in that it can quantitatively observe the product of the chain polymerization reaction in real time.
- Real-time PCR can be divided into an intercalator method (e.g., SYBR Green) where a fluorescent substance is inserted into an amplification product to display fluorescence, and a probe method (e.g., Taqman), which shows fluorescence by reacting only with a specific amplification product.
- an intercalator method e.g., SYBR Green
- a probe method e.g., Taqman
- a melting temperature analysis method is used as an auxiliary method.
- the amplification product is selectively detected, the accuracy is relatively high, and the advantage of being able to detect 4 to 6 target nucleic acids at the same time by different types of fluorescence is that it is widely used in diagnostic methods in clinical pathology. have.
- Probe-based diagnostics capable of multi-analysis are becoming mainstream because the genotypes to be analyzed at the same time are increasing.
- the most frequently used TaqMan method is a method using the probe cleavage by 5'-3 'nuclease activity of DNA polymerase using a probe labeled with a fluorescent substance and a quencher at both ends. This is the mainstream method (US Patent No. 5,210,015).
- the method using a labeled primer includes a method using molecular beacon (Tyagi & Kramer, Nature Biotechnology, 1996), a sunrise primer method (US Pat. No. 6,117,635), and a scorpion primer method (US Pat. No. 6,326,145).
- molecular beacon Tyagi & Kramer, Nature Biotechnology, 1996)
- sunrise primer method US Pat. No. 6,117,635
- scorpion primer method US Pat. No. 6,326,145
- a disadvantage of the real-time PCR currently in use is the limited multi-analysis potential.
- Current real-time PCR technology uses fluorescent dyes as a means to detect amplification reactions.
- the type of fluorescent dye that can be used is limited due to the overlap of wavelengths, that is, only one target nucleic acid can be analyzed in one fluorescent channel, and the number of samples that can be simultaneously analyzed is limited to 4 to 6 (6-plex). have.
- genotypes that need to be analyzed at the same time such as the development of customized medicines according to genotypes such as companion diagnosis, and the determination of the presence or absence of multiple allele markers, are increasing, and the need to simultaneously diagnose as many pathogens as possible in the diagnosis of infectious diseases is increasing. have. Therefore, it is urgently needed to develop a method for multiplex analysis of a new nucleic acid amplification product in which a single reaction can simultaneously amplify and detect more DNA and amplify and design a simple primer.
- the present invention is intended to meet the above-mentioned technical needs, and one object of the present invention is to include a fluorescent material and a quencher on a complementary primer for a target nucleic acid gene and include a melting temperature control sequence to induce various melting temperatures. It is to provide a method for multiplex analysis of amplification products using fluorescence-based multiple fusion analysis, which can simultaneously detect multiple targets using a single fluorescence channel.
- Another object of the present invention is to provide a method for designing a primer and a method for analyzing a melting temperature required for multiplex analysis of nucleic acid amplification products.
- Another object of the present invention is to provide a multi-analysis kit of nucleic acid amplification products capable of simultaneously detecting multiple targets using one fluorescent channel.
- Another object of the present invention is to provide a genotyping method using fluorescence-based multiple lysis analysis, which provides a quick, simple, and automated identification method capable of simultaneously analyzing varieties with a plurality of markers.
- a fluorescence-based multiple melting temperature analysis method (FMMA method) was developed. That is, it was possible to simultaneously analyze a plurality of different melting temperatures in one fluorescent channel.
- FMMA probe a new type of “FMMA probe” was developed, which is designed to be used for the analysis of the melting temperature of the amplified product and directly involved in nucleic acid amplification, unlike the conventional probe, which is not involved in the formation of the amplified product. .
- a melting temperature control sequence that induces a melting temperature Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe-primer is designed to generate amplification products having different melting temperatures. ;
- a method for multiplex analysis of amplification products using fluorescence-based multiple fusion analysis comprising performing a melting temperature analysis on the amplification products.
- each melting temperature control in the target-specific FMMA probe-primer set may be designed to distinguish melting points by adjusting the length and GC content of the amplification product and the length and GC content of the melting temperature control sequence.
- the FMMA probe-primers may be designed such that adjacent melting temperatures between amplification products differ by 2 ° C or more, preferably 4 ° C or more.
- the length of the melting temperature control sequence (T) is 10-30 bp, and the length of the amplification product is 50-300bp.
- the melting temperature analysis step includes the steps of obtaining a melting curve by measuring fluorescence by melting the amplification product while increasing the temperature; And obtaining a melting peak curve from the melting curve.
- Another aspect of the present invention for genotyping, a) preparing an allele-specific FMMA probe-primer set comprising a 5'-RTQC-3 'structured FMMA probe and an unlabeled primer, wherein R is fluorescent A label, T is a melting temperature control sequence that induces various melting temperatures of different amplification products, Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe-primer is different from each other. Designing to produce an amplification product having a temperature;
- a genotyping method using fluorescence-based multiple fusion analysis comprising the step of detecting alleles in a sample by performing melting temperature analysis on amplification products.
- the present invention provides a plurality of target nucleic acids in a single real-time PCR reaction using a single fluorescent channel using a target-specific FMMA probe-primer set composed of a plurality of FMMA probe-primers containing different melting temperature control sequences. It offers the possibility of multiplexing for amplification and analysis.
- multiple target nucleic acids can be analyzed simultaneously, thereby reducing time and cost for performing real-time PCR.
- a PCR process for discriminating rice varieties is simplified, saving time and labor required for inspection, thereby enabling more efficient and economical inspection. Do.
- FIGS 1A-B are schematic diagrams for explaining the principle of the fluorescence-based multiple melting temperature analysis method (FMMA) of the present invention.
- FIG. 2 is a schematic diagram illustrating an allele-specific FMMA for discriminating rice varieties performed in Examples.
- FIG. 4 is a graph showing results of rice variety discrimination (A set) using allele-specific FMMA performed in an embodiment of the present invention.
- FIG. 5 is a graph showing results of rice variety discrimination (B set) using allele-specific FMMA performed in an embodiment of the present invention.
- Example 6 is a result of analyzing the distribution of melting temperature according to the length of the nucleic acid amplification product performed in Example 4.
- T 7 is a graph showing a correlation between the GC content of the melting temperature control sequence (T) and the melting temperature indicated by the entire PCR product.
- target nucleic acid or “target nucleic acid gene” means a nucleic acid sequence to be finally detected.
- the target nucleic acid gene may be a portion of a gene, regulatory sequences, genomic DNA, cDNA, mRNA, RNA including microRNA and rRNA, or another.
- the nucleic acid molecule that is the target nucleic acid gene may be double or single chain, preferably double chain.
- the nucleic acid as a starting material is a double chain, it is preferable to make the two chains into a single chain or a partial single chain.
- mRNA is used as a starting material, a reverse transcription step is required before amplification.
- primer refers to an oligonucleotide, a condition in which the synthesis of a primer extension product complementary to a nucleic acid chain as a template is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, and suitable It can serve as a starting point for synthesis under conditions of temperature and pH.
- the primer is deoxyribonucleotide and is single chain.
- Primers used in the present invention may include natural dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides.
- the primer may also include ribonucleotides.
- FMMA probe refers to an oligonucleotide, its complement, or a fragment thereof, which is used to detect identical, allelic or related nucleic acid sequences.
- FMMA probes can include oligonucleotides attached to a detectable label or fluorescent label molecule. Unlike conventional probes that are not involved in the formation of amplification products, FMMA probes are directly involved in nucleic acid amplification and are used in the analysis of melting temperature.
- melting temperature is defined as the temperature at which half of the double-stranded DNA in a population dissociates into single-stranded DNA, which has various values depending on the content and length of the DNA GC, thermodynamic factors, salt concentration, and the like. It is determined by analysis.
- melting analysis is a process of analyzing the numerical change of fluorescence that appears by raising the temperature at a low temperature after completion of the PCR reaction to determine the melting temperature through this process.
- melting curve or “melting peak curve” is a graph of changes in fluorescence (RFU) according to temperature (T) obtained during the melting analysis process, and is generally represented by x-axis temperature (T) and y-axis fluorescence.
- the “melting peak curve” is a curve represented by a negative value (-d (RFU) / dT) of the first differential value of the melting curve obtained primarily, and the temperature at the peak is the melting temperature.
- the present invention has developed a method of inducing various melting temperatures by adjusting the GC content and the length of the amplification product of the melting temperature control sequence of the primer of real-time PCR.
- a conventional amplification curve analysis method using real-time PCR uses a fluorescent substance in detecting the target nucleic acid in a sample, so only one fluorescent substance is labeled for one nucleic acid to be detected.
- the equipment for detecting a fluorescent substance is limited to 4-6 types of fluorescence channels capable of simultaneous analysis at a time, but multiple detection is limited, but multiple of amplification products using the fluorescence-based melting temperature analysis of the present invention
- multiple targets can be detected using a single fluorescence channel by including a fluorescent label and a quencher on a primer complementary to the target nucleic acid and including a melting temperature control sequence to induce various melting temperatures of amplification products. It is characterized by.
- the method of the present invention can be used to analyze the presence or absence of multiple nucleic acids, alleles, or specific sequences in a sample.
- a melting temperature control sequence that induces a melting temperature Q is a quencher, C is a sequence complementary to a target nucleic acid sequence, and each FMMA probe-primer is designed to generate amplification products having different melting temperatures. ;
- a method for multiplex analysis of amplification products using fluorescence-based multiple fusion analysis comprising performing a melting temperature analysis on the amplification products.
- FIGS. 1A-1B are schematic diagrams for explaining the principle of the fluorescence-based multiple melting temperature analysis method (FMMA) of the present invention. 1A and 1B, each step of the method of the present invention will be described in more detail.
- FMMA fluorescence-based multiple melting temperature analysis method
- a target-specific FMMA probe-primer set comprising a 5'-R-T-Q-C-3 'structured FMMA probe and an unlabeled primer is prepared.
- R is a fluorescent label
- T is a melting temperature control sequence that induces various melting temperatures of different amplification products
- Q is a quencher
- C is a sequence complementary to a target nucleic acid sequence
- the target-specific FMMA probe-primer having a 5'-RTQC-3 'structure thus designed does not generate a fluorescent signal when the target nucleic acid is not present, and amplification occurs because the target nucleic acid is present in the reaction solution.
- fluorescence is generated as shown in C of FIG. 1B.
- this amplification curve is caused by a single target, but in the present invention, amplification curves of all targets labeled with the same fluorescence appear as one amplification curve.
- the melting temperature analysis is performed to determine whether or not the multiple targets are amplified, analysis of a plurality of targets having different melting temperature (T m ) values as shown in D of FIG. 1B is possible.
- T m melting temperature
- the melting temperature of the amplification product has various values depending on the GC content of the melting temperature control sequence and the length of the amplification product.
- Each melting temperature control sequence (T) in the target-specific FMMA probe-primer set is designed to distinguish melting points by adjusting the length and GC content of the amplification product and the length and GC content of the melting temperature control sequence.
- the target-specific FMMA probe-primers are preferably configured such that the adjacent melting temperature differs by 2 ° C or more for differentiation between amplification products, and more preferably 4 ° C or more.
- Target-specific FMMA probe-primers having the same fluorescent label have adjacent melting temperatures between amplification products of 2 ° C or higher, 3 ° C or higher, 4 ° C or higher, 5 ° C or higher, 6 ° C or higher, 7 ° C or higher, 8 ° C or higher , It can be configured to differ by more than 9 °C or 10 °C.
- the size of the melting temperature control sequence (T) in the present invention is 10-30 bp.
- the GC content of the target-specific FMMA probe-primer containing the melting temperature control sequence is 0 to 100%, more preferably 20 to 90%.
- a fluorescent label is used as a signal generating means used to generate a signal indicating the presence of a target nucleic acid.
- Fluorescent labels usable in the present invention include FAM, TET, JOE, VIC, HEX, ROX, TAMRA, CyDye TM (Cy2 TM, Cy3 TM, CY3.5, and Cy5 TM, CY5.5 TM) Oregon Green (Oregon Green TM 488, Oregon Green TM 500, Oregon Green TM 514), CAL Red, Red 640, and Texas Red TM may be used, but are not limited to these.
- fluorescent labels include quantum dots, Alexa Fluor TM dyes, AMCA, BODIPY 630/650, BODIPY TM 650/665, BODIPY TM -FL, BODIPY TM -R6G, BODIPY TM -TMR, BODIPY TM -TRX , CascadeBlue TM, Fluorescein, 6-JOE, Oregon Green TM 488, Oregon Green TM 500, Oregon Green TM 514, Pacific Blue TM, REG, phycobilliprotein (phycoerythrin and allophycosy Non- (allophycocyanin), Rhodamine Green TM, Rhodamine Red TM, ROX TM, TAMRA TM, TET TM, and tetramethylrodamine. Fluorescent materials have different excitation and emission wavelengths depending on the type, and the method of use is also different. The characteristics of the target fluorescent material are briefly shown in Table 1 below.
- the quencher refers to a material that absorbs the light generated by the fluorescent label to reduce the fluorescence intensity, TAMRA, DABCYL, ECLIPSE, NFQ, black hole capture TM (BHQ), DDQ, QSY, blackberry Any one selected from the group consisting of Blackberry Quencher, Qxl, Iowa black FQ, Iowa Black RQ, and IRDye QC-1 can be used, but is not limited to these. The range of decreasing the fluorescence intensity varies depending on the type, so it can be used considering this.
- target-specific FMMA probe-primer set obtained in the previous step multiple target nucleic acids in a sample containing one or more target nucleic acids are amplified by nucleic acid polymerase reaction.
- the amplification reaction of the target nucleic acid-FMMA probe complex is a reagent that requires amplification in addition to the primer set of the present invention, for example, an appropriate amount of DNA polymerase, DNA polymerase factor (Mg 2+ ), buffer solution, dNTPs ( dATP, dCTP, dGTP and dTTP) and water (dH 2 O).
- the buffer solution is not limited thereto, but an appropriate amount of Triton X-100, dimethyl sulfoxide (DMSO), Tween20, nonidet P40, PEG 6000, formamide and bovine serum albumin (BSA) is additionally added. It can contain.
- the reaction vessel When carrying out the polymerization reaction, it is preferable to provide the reaction vessel in excess of the components necessary for the reaction.
- the excess amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components. It is preferred to provide cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP to the reaction mixture to the extent that the desired degree of amplification can be achieved.
- the nucleic acid polymerase usable in the present invention may be an RNA-dependent RNA-polymerase, an RNA-dependent DNA-polymerase, a DNA-polymerase, or an RNA-polymerase.
- Non-limiting examples of the nucleic acid polymerase include Taq polymerase, Tth polymerase, Tli polymerase, VENT polymerase, Pfu polymerase, DEEPVENT polymerase, Pwo polymerase, Bst polymerase, Sac polymerase, Tac polymerase, Tfl / Tub polymerase, Tru polymerase, DYNAZYME polymerase, Tne polymerase, Tma polymerase, Tsp polymerase, Mth polymerase, Phi29 polymerase, Klenow polymerase, T7 polymerase or KOD DNA polymerase have.
- a preferred example of the nucleic acid polymerase is Taq polymerase.
- thermocycling amplification reaction can consist of 10 to 100 "cycles" of denaturation and synthesis of DNA molecules.
- the temperature at which denaturation is performed by a thermocycling amplification reaction is about 90 ° C to more than 95 ° C, more preferably 92 ° C to 94 ° C.
- Preferred thermocycle amplification methods are about 10 to about 100 cycles, more preferably about 25 to about 50 cycles, and a maximum temperature of greater than about 90 ° C to 95 ° C, more preferably 92 ° C to 94 ° C. Containing polymerase chain reaction.
- the target-specific FMMA probe-primer set is annealed to the complementary strand of the target nucleic acid, and when the target DNA is amplified in the amplification process An amplification curve signal (fluorescence) is generated.
- the FMMA probe of the present invention is a primer that is directly involved in nucleic acid amplification, and thus has a different mechanism of action from other types of probes that bind to the target DNA and display fluorescence. That is, the FMMA probe of the present invention becomes a part of the amplification product and exhibits fluorescence.
- the FMMA probe of the present invention amplifies Make up part of the product.
- the melting temperature analysis is performed on the amplification products.
- the amplification product is melted while increasing the temperature to measure fluorescence to obtain a melting curve, and then obtaining a melting peak curve from the melting curve.
- Each target-specific FMMA probe is specific to the target nucleic acid sequence, and there are two or more probes bearing the same label in each set.
- the amplification products of target-specific FMMA probe-primer sets bearing the same label are distinguished from each other because they have a melting temperature (T m ) of which the melting temperature differs by 2 ° C or more, more preferably 2 ° C or more. Therefore, it is possible to distinguish products amplified by different target-specific FMMA probe-primers having the same label through melting temperature analysis.
- Another aspect of the present invention relates to a genotype analysis method using fluorescence-based multiple fusion analysis.
- Detectable fluorescent label T is a melting temperature control sequence that induces various melting temperatures of different amplification products
- Q is a quencher
- C is a sequence complementary to a target nucleic acid sequence
- each FMMA probe- Primers are designed to produce amplification products with different melting temperatures.
- a number of target nucleic acids in a sample comprising one or more target nucleic acids are amplified by nucleic acid polymerase reaction using the target-specific FMMA probe-primer set obtained in the previous step.
- melting temperature analysis is performed on the amplification products to detect alleles in the sample.
- the built-in analysis software is used to draw a graph indicating the temperature on the horizontal axis and the magnitude of the fluorescence signal on the vertical axis.
- the analysis software differentiates the size of the fluorescent signal displayed on the vertical axis with respect to temperature for easy visual judgment, and forms a graph with a negative value, that is, a horizontal axis with a temperature and a vertical axis with a -d (RFU) / dT value. Is done.
- the genotype is typed according to the presence or absence of a peak representing each genotype.
- FIG. 2 is a schematic diagram illustrating an allele-specific FMMA for discriminating rice varieties.
- an allele-specific SNP marker is used.
- the SNP marker is a marker that is matched with a 3 'terminal base exactly to any allele, but is replaced with a base that is mismatched with other alleles.
- the length of the amplification product and the melting temperature control sequence are changed to have two or three different melting temperatures. do.
- the target-specific FMMA probe according to the marker for identifying rice varieties according to the present invention-the FMMA probe of the primer set is consistent with a specific allele representing SNP.
- the FMMA probe specifically hybridizes to the template DNA for the complementary alleles, but the FMMA probe does not hybridize to the non-specific allele.
- the FMMA probe is labeled with a detectable means such as a fluorescent label, the SNP type of the product amplified by PCR can be confirmed.
- the presence or absence of a product amplified by PCR using the allele-specific marker for identifying such rice varieties can be easily analyzed using a melting curve analysis.
- the melting temperature (T m ) measured in the melting curve is amplified when the FMMA probe of each target-specific FMMA probe-primer set matches the base of each SNP position of the target gene, resulting in a melting peak. . Therefore, by comparing the T m value, it is possible to detect a nucleotide variation in the SNP position.
- nucleotide variation refers to various alleles occurring in the same gene. In other words, the term “nucleotide variation” encompasses both wild and mutants. Thus, detection of nucleotide variation can be expressed by genotyping or allelic detection.
- the genetic variation refers to a phenomenon caused by an allele, single nucleotide polymorphism (SNP), mutation, or a combination thereof.
- the allele refers to a gene having different nucleotide sequences located at the same gene position on a homologous chromosome or a gene showing different traits while being at the same position (locus) on a chromosome.
- Another aspect of the present invention relates to a target nucleic acid multiplex detection kit using fluorescence-based multiple fusion assays comprising the target-specific FMMA probe-primer set of the present invention.
- the kit of the present invention is a) a target-specific FMMA probe-primer set consisting of an FMMA probe of 5'-RTQC-3 'structure and an unlabeled primer, wherein the R sequence is a fluorescent label and T is a different amplification product from each other.
- the melting temperature control sequence to induce various melting temperatures of the cells Q is a quencher, C is a sequence complementary to the target nucleic acid sequence, and each FMMA probe-primer is designed to generate amplification products having different melting temperatures from each other. do.
- the kit is optionally a reagent for nucleic acid amplification, such as buffer, DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus or Thermococcus thermostable DNA polymerase obtained from literalis), DNA polymerase joiner and dNTP.
- DNA polymerase e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus or Thermococcus thermostable DNA polymerase obtained from literalis
- DNA polymerase joiner e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus or Thermococcus thermostable DNA polymerase obtained from literalis
- DNA polymerase joiner e.g., Thermus aquaticus (
- kit of the present invention can be produced in a number of separate configurations that include the reagent components described above.
- the kit of the present invention may further include a user guide describing optimal conditions for performing the reaction.
- the present invention provides an allele-specific rice variety discrimination kit comprising the allele-specific FMMA probe-primer set of the present invention described above.
- the allele-specific rice variety discrimination kit of the present invention can discriminate rice varieties using multiple allele-specific multiple polymerase chain reactions.
- the allele-specific rice variety discrimination kit of the present invention establishes a real-time PCR method using 15 or more types of marker sets for identifying rice varieties at the same time, significantly simplifying the PCR process, minimizing required inspection time and labor It is very advantageous in that it can be done.
- SNPs Single Nucleotide Polymorphism
- Primers used in the analysis of rice varieties were designed based on genetic markers and sequence information for determining rice varieties provided by the Agricultural Quality Management Service. That is, it is designed to determine whether or not the SNP corresponding to the genetic marker is amplified. It was designed to change the length of the amplification product and the melting temperature control sequence to have two or three different melting temperatures so that multiple target markers can be analyzed with a single fluorescent label.
- the sequence of the primer used in this example, the size of the amplification product, GC content, and melting temperature are shown in Table 2.
- Real-time PCR reactions were performed using genome DNA of each rice variety using the designed primers as a template.
- PCR amplification was performed using 10-50 ng genomic DNA as a template for the fragment on the genome containing the discriminant target nucleic acid SNP.
- 7.5 ⁇ l of 2x PCR premix for determining rice varieties 1 ⁇ l of template DNA (5-10 ng / ⁇ l), 1 ⁇ l of FMMA probe (0.1-1.0 pmole / ⁇ l) for identifying rice varieties, primer (0.5-4.0 pmole / ⁇ l) 1
- the reaction solution is mixed in a total volume of 15 ⁇ l, including 4 ⁇ l, finally 4 ⁇ l of sterile water.
- Allele-specific FMMAs for 20 gene markers used for rice variety determination were designed, and a determination test was performed for four rice varieties.
- Four fluorescence channels (FAM, HEX, Texas Red, Cy5) were used to allow 10 markers to be analyzed for each test set, and melting temperatures were distributed to allow analysis of 2 or 3 markers for each fluorescence channel.
- 20 genetic markers were analyzed using two sets of 10 genetic markers that can be analyzed, and the results are shown in FIGS. 4 and 5.
- DNA extracted from sample rice was specifically amplified in a set of markers for identifying rice varieties, confirming that the sample rice was correctly determined in accordance with the species determination criteria. From these results, it was confirmed that it is possible to analyze multiple alleles in one reaction using two or three different amplification product melting temperatures for each fluorescence channel.
- Example 4 Analysis of melting temperature distribution according to length and GC content of nucleic acid amplification products
- the positions of the 5 'and 3' primers on the target nucleic acid gene for the three rice varieties gene markers (BR12, BR16, BR20) are fixed, and the GC content of the 5 'primer melting temperature control sequence is two types (high & low). The results were analyzed using GC%) and are shown in FIG. 7. Table 4 shows the primers used in this analysis.
- the melting temperature (T m ) of the amplification product is increased compared to the melting temperature control sequence having a low GC content, even if a primer at the same position is used. That is, as the GC content of the melting temperature control sequence increased, the tendency to increase the melting temperature of the entire product was confirmed.
- the melting temperature of the entire product was influenced by the length of the product and the GC content of the used melting temperature control sequence.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 다수의 타겟 핵산 서열을 실시간으로 동시에 분석할 수 있는, 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법 및 이를 수행하기 위한 키트에 관한 것으로, 본 발명에 의하면 하나의 형광 채널을 이용하는 한 번의 중합효소 증폭 반응으로 다수의 타겟 핵산 서열을 검출할 수 있어, 핵산 다중 검출 시간 및 비용을 획기적으로 줄일 수 있다. 따라서 본 발명은 여러 개의 대상 유전자의 분석이 필요한 동반 진단 분야, 여러 개의 대립유전자를 분석해야 하는 농림축산분야, 다수 개의 감염체를 동시에 분석해야 하는 임상병리분야에 광범위하게 이용될 수 있다.
Description
본 발명은 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법에 관한 것으로, 더욱 상세하게는 형광을 이용한 융해온도 분석을 통하여 하나의 형광 채널을 이용하여 다수의 타겟 핵산을 동시에 분석할 수 있는 중합효소 연쇄반응 산물의 다중 분석 방법에 관한 것이다.
실시간 중합효소 연쇄반응 (Real-time Polymerase Chain Reaction)은 전체 유전자 중 염기서열을 알고 있는 특정한 하나의 유전자 절편을 DNA 중합효소에 의해 증폭하여 유전자를 검사하고 분리하는 분자생물학의 기법이다. 실시간 PCR은 실시간으로 증폭산물을 측정하고 상호-오염을 감소시키며, 더욱 정확한 정량적 분석을 가능하게 한다. 이러한 실시간 중합효소 연쇄반응은 생화학, 분자생물학, 의학 및 임상 병리 분야의 연구 및 검사에 있어서 필수 기술의 하나가 되어 있다.
실시간 중합효소 연쇄반응(PCR)은 일반적인 중합효소 연쇄반응과 기본적인 원리는 같지만, 연쇄중합반응 산물을 실시간으로 정량적으로 관찰할 수 있다는 점에서 차이가 있다. 실시간 PCR은 형광 물질이 증폭 산물에 삽입되어 형광을 나타내는 인터칼레이터 방식(예컨대, SYBR Green)과 형광물질이 특이적인 증폭 산물에만 반응하여 형광을 나타내는 프로브 방식(예컨대, Taqman)으로 나눌 수 있다. 전자의 경우 비특이적인 증폭 산물을 구분할 수 없어 산물의 융해온도를 분석하는 방법 (Melting temperature analysis)을 보조적으로 사용한다. 프로브 방식의 경우는 증폭산물을 선택적으로 검출하므로 정확도가 비교적 높은 장점이 있으며 형광의 종류를 달리하여 4 내지 6개의 타겟 핵산을 동시에 검출할 수 있는 장점이 있어 임상 병리 분야의 진단법에 많이 사용이 되고 있다.
다중 분석이 가능한 프로브 방식의 진단법이 주류를 이루고 있는 이유는 최근 동시에 분석해야 하는 유전자형이 갈수록 늘어나는 추세에 있기 때문이다. 가장 많이 이용되는 TaqMan 방법은 양쪽 말단에 형광 물질과 소광 물질(quencher)을 표지한 프로브를 사용하여 DNA 중합효소의 5'-3' 뉴클레아제 활성에 의한 상기 프로브의 절단을 이용하는 방법으로 현재 가장 주류를 이루고 있는 방법이다 (미국 특허 제5,210,015호).
이외에도 표지된 프라이머를 이용하는 방법은, molecular beacon을 이용하는 방법 (Tyagi & Kramer, Nature Biotechnology, 1996), sunrise primer 방법(미국 특허 제6,117,635호), scorpion primer 방법 (미국 특허 제6,326,145호) 등이 있다. 이들 방법은 프라이머에 stem-loop 구조를 이용하여 타겟이 증폭이 되는 경우 구조의 변화가 일어나 형광물질과 소광자가 분리되어 형광이 발생하는 방식이다.
현재 이용되고 있는 실시간 PCR의 단점은 제한된 다중 분석 가능성이다. 현재의 실시간 PCR 기술은 증폭 반응 검출 수단으로 형광 염료를 이용한다. 사용 가능한 형광 염료의 종류가 파장의 중첩으로 인해 제한되어 즉, 하나의 형광 채널에서 하나의 타겟 핵산만 분석 가능하여, 동시분석 가능한 시료의 수가 4 내지 6개(6-plex)로 제한되는 한계가 있다.
국제특허공개 WO2013133561호에서는 타겟 핵산 DNA에 선택적으로 결합하는 프로브와 융해 곡선 분석방법을 동시에 적용한 PTOCE (Probing & Tagging Oligonucleotide Cleavage and Extension) 방법을 이용하여 단일 형광채널에서 2-3개의 타겟 핵산을 동시에 분석할 수 있는 실시간 중합효소 연쇄반응 방법을 기술하고 있다. 이 방법은 기존에 하나의 형광으로 하나의 타겟 핵산을 분석하던 방법에 비해 분석 가능한 타겟 핵산의 숫자를 현격히 늘린 장점이 있으나, 분석에 사용하는 프라이머 및 올리고뉴클레오타이드의 숫자가 수십여 개에 이르고 이들의 간섭을 최소화하여야 하므로 프라이머의 설계에 많은 어려움이 있다.
최근 동반진단과 같은 유전자형에 따른 맞춤형 의약품 개발이나 다수의 대립유전자 마커의 유무 판정 등 동시에 분석해야 하는 유전자형이 갈수록 늘어나는 추세이고, 감염성 질환의 진단에서도 가능한 많은 병원체에 대한 진단을 동시에 진행할 필요성이 증가하고 있다. 따라서 한 번의 반응으로 동시에 더 많은 DNA를 증폭 검출할 수 있는 다중 분석이 가능하며 프라이머의 설계가 비교적 간단한 새로운 핵산 증폭 산물의 다중 분석 방법의 개발이 절실하게 요구되고 있다.
본 발명은 상술한 기술적 요구에 부응하기 위한 것으로, 본 발명의 하나의 목적은 타겟 핵산 유전자에 대한 상보적인 프라이머에 형광물질과 소광자를 표지하고 다양한 융해온도를 유도하기 위한 융해온도 조절서열을 포함시켜 하나의 형광채널을 이용하여 다수의 타겟을 동시에 검출할 수 있는, 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법을 제공하는 것이다.
본 발명의 다른 목적은 핵산 증폭 산물의 다중 분석에 필요한 프라이머의 설계 방법과 융해온도 분석방법을 제공하는 것이다.
본 발명의 또 다른 목적은 하나의 형광 채널을 이용하여 다수의 타겟을 동시에 검출할 수 있는 핵산 증폭 산물의 다중 분석 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 품종을 복수 개의 마커로 동시에 분석할 수 있는, 신속하고 간단하며, 자동화된 식별 방법을 제공하는 형광기반의 다중 용해 분석을 이용한 유전자형 분석방법을 제공하는 것이다.
본 발명에서 상기한 과제를 해결하기 위해 형광기반의 다중용해온도 분석 방법 (Fluorescence-based Multiple Melting Analysis; FMMA 방법)을 개발 하였다. 즉, 하나의 형광 채널에서 다수의 서로 다른 융해온도를 동시 분석 가능하도록 하였다. 이를 위해 본 발명에서는 새로운 방식의 “FMMA 프로브”를 개발하였는데 이는 기존의 일반적인 프로브가 증폭산물의 형성에 관여하지 않는 것과 달리 핵산증폭에 직접적으로 관여하며 증폭된 산물의 융해온도 분석에도 사용되도록 고안되었다.
본 발명의 하나의 양상은,
a) 5'-R-T-Q-C-3' 구조의 FMMA 프로브와 비표지 프라이머로 구성되는 타겟-특이적 FMMA 프로브-프라이머 세트를 준비하는 단계로서, 여기서 R 은 형광표지이고, T는 서로 상이한 증폭 산물들의 다양한 융해온도를 유도하는 융해온도 조절서열이고, Q는 소광자이고, C는 타겟 핵산 서열에 대해 상보적인 서열이며, 각각의 FMMA 프로브-프라이머는 서로 상이한 융해온도를 갖는 증폭산물을 생성하도록 설계하는 단계;
b) 전 단계에서 수득된 타겟-특이적 FMMA 프로브-프라이머 세트를 이용하여 하나 이상의 타겟 핵산을 포함하는 시료 내의 다수의 타겟 핵산들을 핵산 중합효소 연쇄반응에 의해 증폭시키는 단계;
c) 증폭 산물들에 대하여 융해온도 분석을 수행하는 단계를 포함하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법에 관한 것이다.
본 발명에서 상기 타겟-특이적 FMMA 프로브-프라이머 세트 내의 각각의 융해온도 조절은, 증폭산물의 길이와 GC 함량 그리고 융해온도 조절서열의 길이와 GC 함량을 조정하여 융점이 구별되도록 설계될 수 있다.
본 발명에서 상기 FMMA 프로브-프라이머들은 증폭 산물들 사이의 인접한 융해온도가 2℃ 이상, 바람직하게는 4℃ 이상 차이 나도록 설계될 수 있다.
본 발명에서 상기 융해온도 조절서열(T)의 길이는 10-30 bp이고, 증폭 산물의 길이는 50 - 300bp이다.
상기 융해온도 분석 단계는, 증폭산물을 온도를 증가시키면서 융해시켜 형광을 측정하여 융해곡선을 얻는 단계; 및 상기 융해곡선으로부터 융해 피크 곡선을 얻는 단계를 포함한다.
본 발명의 다른 양상은 유전자형 분석을 위해서, a) 5'-R-T-Q-C-3' 구조의 FMMA 프로브와 비표지 프라이머로 구성되는 대립유전자 특이적 FMMA 프로브-프라이머 세트를 준비하는 단계로서, 여기서 R 은 형광표지이고, T는 서로 상이한 증폭 산물들의 다양한 융해온도를 유도하는 융해온도 조절서열이고, Q는 소광자이고, C는 타겟 핵산 서열에 대해 상보적인 서열이며, 각각의 FMMA 프로브-프라이머는 서로 상이한 융해온도를 갖는 증폭산물을 생성하도록 설계하는 단계;
b) 전 단계에서 수득된 대립유전자 특이적 FMMA 프로브-프라이머 세트를 이용하여 하나 이상의 타겟 핵산을 포함하는 시료 내의 다수의 타겟 핵산들을 핵산 중합효소 반응에 의해 증폭시키는 단계;
c) 증폭 산물들에 대하여 융해온도 분석을 수행하여 시료 내의 대립형질을 검출하는 단계를 포함하는 형광기반의 다중 융해 분석을 이용한 유전자형 분석방법에 관한 것이다.
본 발명은 서로 상이한 융해온도 조절서열을 포함하는 복수의 FMMA 프로브-프라이머로 구성되는 타겟-특이적 FMMA 프로브-프라이머 세트를 이용하여 하나의 형광채널을 이용하는 단일의 실시간 PCR 반응에서 복수의 타겟 핵산을 증폭 및 분석하도록 다중화(multiplexing) 가능성을 제공한다.
본 발명의 FMMA 방법에 의하면, 다중 타겟 핵산을 동시에 분석할 수 있어, 실시간 PCR을 수행하기 위한 시간 및 비용을 절감할 수 있다.
본 발명의 다른 양상의 형광기반의 다중 용해 분석을 이용한 유전자형 분석방법에 의하면 벼 품종을 판별하기 위한 PCR 과정을 간소화하여, 검사에 소요되는 시간과 노동력을 절약함으로써, 보다 효율적이고 경제적인 검사가 가능하다.
도 1a-b는 본 발명의 형광기반 다중 융해온도 분석법(FMMA)의 원리를 설명하기 위한 모식도이다.
도 2는 실시예에서 수행된 벼 품종 판별을 위한 대립유전자-특이적 FMMA를 설명하는 모식도이다.
도 3는 실시예에서 수행된 대립유전자-특이적 FMMA를 이용한 벼 품종 판별 실험 결과이다.
도 4은 본 발명의 실시예에서 수행된 대립유전자-특이적 FMMA를 이용한 벼 품종 판별 (A set) 결과를 나타내는 그래프이다.
도 5는 본 발명의 실시예에서 수행된 대립유전자-특이적 FMMA를 이용한 벼 품종 판별 (B set) 결과를 나타내는 그래프이다.
도 6은 실시예 4에서 수행된 핵산 증폭 산물의 길이에 따른 융해온도 분포 분석 결과이다.
도 7은 융해온도 조절서열(T)의 GC 함량과 전체 PCR 산물이 나타내는 융해온도와의 상관관계를 보여주는 그래프이다.
이하, 실시예를 들어 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 단지 예시를 위한 것으로, 본 발명의 보호범위를 제한하고자 하는 것은 아니다.
본 명세서에서 용어 “타겟 핵산” 또는 “타겟 핵산 유전자”는 최종적으로 검출하고자 하는 핵산 서열을 의미한다. 타겟 핵산 유전자는 유전자의 일부분, 조절서열, 게놈 DNA, cDNA, mRNA, 마이크로RNA 및 rRNA을 포함하는 RNA, 또는 또 다른 것일 수 있다. 타겟 핵산 유전자인 핵산 분자는 이중쇄 또는 단일쇄일 수 있고, 바람직하게는 이중쇄이다. 출발물질로서 핵산이 이중쇄인 경우, 두 쇄를 단일쇄로, 또는 부분적인 단일쇄 형태로 만드는 것이 바람직하다. mRNA가 출발물질로 이용되는 경우, 역전사 단계가 증폭 전에 필요로 하다.
본 명세서에서 사용되는 용어 “프라이머”는 올리고뉴클레오타이드를 의미하는 것으로, 주형인 핵산쇄에 상보적인 프라이머 연장 산물의 합성이 유도되는 조건, 즉, 뉴클레오타이드와 DNA 중합효소와 같은 중합제의 존재, 그리고 적합한 온도와 pH의 조건에서 합성의 개시점으로 작용할 수 있다. 바람직하게는, 프라이머는 디옥시리보뉴클레오타이드이며 단일쇄이다. 본 발명에서 이용되는 프라이머는 천연의 dNMP(즉, dAMP, dGMP, dCMP 및 dTMP), 변형 뉴클레오타이드 또는 비-자연 뉴클레오타이드를 포함할 수 있다. 또한, 프라이머는 리보뉴클레오타이드도 포함할 수 있다.
본 명세서에서 사용된 용어 “FMMA 프로브”는 올리고뉴클레오티드, 이의 상보체, 또는 이의 단편을 의미하는데, 이는 동일한, 대립의 또는 관련된 핵산 서열을 검출하는데 사용된다. FMMA 프로브는 검출 가능한 라벨 또는 형광표지 분자에 부착되는 올리고뉴클레오티드를 포함할 수 있다. 기존의 프로브가 증폭산물의 형성에 관여하지 않는 것과 달리 FMMA 프로브는 핵산증폭에 직접적으로 관여하며 융해온도 분석에도 사용되는 형태이다.
본원 명세서에서 “융해온도”는, 집단 내의 이중가닥 DNA의 절반이 단일가닥 DNA로 해리되는 온도로 정의되는데, DNA의 GC의 함량과 길이, 열역학적 요소들, 염의 농도 등에 의해 다양한 값을 갖게 되며 융해 분석에 의해 결정된다.
본 명세서에서 용어 “융해 분석”은 PCR 반응 종료 후에 낮은 온도에서 온도를 상승시켜 나타나는 형광의 수치변화를 분석하는 과정으로 이 과정을 통해 융해 온도를 결정하게 된다.
본 명세서에 사용된 용어 “융해 곡선”또는 “융해 피크 곡선”은 융해 분석 과정 중에 얻어진 온도(T)에 따른 형광(RFU)의 변화 그래프이며 일반적으로 x축 온도(T), y축 형광으로 나타낸다. “융해 피크 곡선”은 1차적으로 얻어진 융해곡선을 1차 미분한 값 의 음의 값(-d(RFU)/dT)으로 나타내어진 곡선이며 피크부분의 온도가 융해온도가 된다.
본 발명은 실시간 PCR의 프라이머의 융해온도 조절서열의 GC 함량과 증폭산물의 길이를 조정하여 다양한 융해온도를 유도하는 방법을 개발하였다.
일반적으로, 복수의 타겟핵산을 동시에 검출하기 위해서 종래의 실시간 PCR을 이용한 증폭곡선 분석 방법은 시료 내 타겟핵산을 검출함에 있어서 형광물질을 사용하기 때문에, 검출하고자 하는 핵산 하나에 하나의 형광물질만 표지가 가능하고, 현재 형광물질을 검출하는 장비는 한 번에 동시 분석이 가능한 형광 채널 수가 4-6 종류로 제한되어 다중 검출이 제한적이지만, 본 발명의 형광기반의 융해온도 분석을 이용한 증폭 산물의 다중 분석방법은, 타겟 핵산에 대해서 상보적인 프라이머에 형광표지와 소광자를 표지하고 증폭산물의 다양한 융해 온도를 유도하기 위한 융해온도 조절서열을 포함시켜, 하나의 형광채널을 이용하여 다중 타겟의 검출이 가능한 것을 특징으로 한다. 본 발명의 방법은 시료내의 다수의 핵산, 대립유전자, 또는 특정 염기서열의 유무를 분석하는데 이용될 수 있다.
본 발명의 하나의 양상은,
a) 5'-R-T-Q-C-3' 구조의 FMMA 프로브와 비표지 프라이머로 구성되는 타겟-특이적 FMMA 프로브-프라이머 세트를 준비하는 단계로서, 여기서 R 은 형광표지이고, T는 서로 상이한 증폭 산물들의 다양한 융해온도를 유도하는 융해온도 조절서열이고, Q는 소광자이고, C는 타겟 핵산 서열에 대해 상보적인 서열이며, 각각의 FMMA 프로브-프라이머는 서로 상이한 융해온도를 갖는 증폭산물을 생성하도록 설계하는 단계;
b) 전 단계에서 수득된 타겟-특이적 FMMA 프로브-프라이머 세트를 이용하여 하나 이상의 타겟 핵산을 포함하는 시료 내의 다수의 타겟 핵산들을 핵산 중합효소 반응에 의해 증폭시키는 단계;
c) 증폭 산물들에 대하여 융해온도 분석을 수행하는 단계를 포함하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법에 관한 것이다.
도 1a-1b는 본 발명의 형광기반 다중 융해온도 분석법(FMMA)의 원리를 설명하기 위한 모식도이다. 도 1a 및 도 1b를 참조하여 본 발명의 방법의 각 단계에 대해서 보다 상세하게 설명한다.
a) 다양한 융해 온도를 유도하는 FMMA 프로브-프라이머 세트 설계 단계
도 1a를 참조하면, 먼저 본 발명의 방법에 의해서 다중 분석을 실시하기 위해서는 5'-R-T-Q-C-3' 구조의 FMMA 프로브와 비표지 프라이머로 구성되는 타겟-특이적 FMMA 프로브-프라이머 세트를 준비한다. 여기서 R 은 형광표지이고, T는 서로 상이한 증폭 산물들의 다양한 융해온도를 유도하는 융해온도 조절서열이고, Q는 소광자이고, C는 타겟 핵산 서열에 대해 상보적인 서열이며, 각각의 FMMA 프로브-프라이머는 서로 상이한 융해온도를 갖는 증폭산물을 생성하도록 설계한다.
도 1b를 참조하면, 이렇게 설계되는 5'-R-T-Q-C-3' 구조의 타겟-특이적 FMMA 프로브-프라이머는 타겟 핵산이 없는 경우 형광 신호가 발생하지 않으며, 타겟 핵산이 반응액 내에 존재하여 증폭이 일어나는 경우에는 도 1b의 C와 같이 형광을 발생하게 된다. 일반적인 실시간 PCR 과정에서는 이 증폭 곡선이 단일 타겟에 의해 유발된 것이나 본 발명에서는 같은 형광으로 표지된 모든 타겟의 증폭 곡선이 하나의 증폭곡선으로 나타나게 된다.
이러한 다중 타겟의 증폭여부를 판단하기 위해 융해온도 분석을 수행하면, 도 1b의 D와 같이 서로 상이한 융해온도(Tm) 값을 갖는 다수의 타겟의 분석이 가능하다. 이 때 증폭 산물의 융해온도는 융해온도 조절서열의 GC함량과 증폭 산물의 길이에 의해 다양한 값을 갖게 된다.
상기 타겟-특이적 FMMA 프로브-프라이머 세트 내의 각각의 융해온도 조절 서열(T)은, 증폭산물의 길이와 GC 함량 및 융해온도 조절서열의 길이와 GC 함량을 조정하여 융점이 구별되도록 설계된다. 상기 타겟-특이적 FMMA 프로브-프라이머들은 증폭 산물들 사이의 구분을 위해 인접한 융해온도가 2℃ 이상 차이 나도록 구성되는 것이 좋고, 더욱 바람직하게는 4℃ 이상 차이가 나도록 구성되는 것이 좋다. 동일한 형광 표지를 갖는 타겟-특이적 FMMA 프로브-프라이머는 증폭 산물들 사이의 인접한 융해온도가 2℃ 이상, 3℃ 이상, 4℃ 이상, 5℃ 이상, 6℃ 이상, 7℃ 이상, 8℃ 이상, 9℃ 이상 또는 10℃ 이상 만큼 차이가 나도록 구성될 수 있다.
본 발명에서 상기 융해온도 조절서열(T)의 크기는 10-30 bp이다. 융해온도 조절서열을 포함하는 타겟-특이적 FMMA 프로브-프라이머의 GC 함량은 0 내지 100%이며 더욱 바람직하게는 20 내지 90%이다.
본 발명에서는 타겟 핵산의 존재를 나타내는 신호의 생성에 사용되는 신호 발생 수단으로 형광표지(R)를 사용한다. 본 발명에서 사용 가능한 형광 표지는 FAM, TET, JOE, VIC, HEX, ROX, TAMRA, CyDye™(Cy2™, Cy3™, CY3.5, 및 Cy5™, CY5.5™) Oregon Green(Oregon Green™ 488, Oregon Green™ 500, Oregon Green™ 514), CAL Red, Red 640, 및 Texas Red™로 구성되는 군에서 선택되는 것을 사용할 수 있으나, 반드시 이들로 제한되는 것은 아니다.
형광표지의 부가적인 비-제한적인 예에는 양자점, Alexa Fluor™ 염료, AMCA, BODIPY 630/650, BODIPY™ 650/665, BODIPY™-FL, BODIPY™-R6G, BODIPY™-TMR, BODIPY™-TRX, CascadeBlue™, 플루오레세인, 6-JOE, Oregon Green™ 488, Oregon Green™ 500, Oregon Green™ 514, Pacific Blue™, REG, 피코빌리단백질(phycobilliprotein)(피코에리트린(phycoerythrin) 및 알로피코시아닌 (allophycocyanin)을 포함하나 이에 제한되지 않음), Rhodamine Green™, Rhodamine Red™, ROX™, TAMRA™, TET™, 테트라메틸로다민를 포함할 수 있다. 형광물질은 종류에 따라 여기 및 방사 파장이 다르면 사용방법 또한 상이하다. 타겟인 형광물질의 특징은 아래 표 1에 간략하게 나타내었다.
필터 | 여기 파장 | 방사 파장 | 형광물질 |
1 | 490 | 520 | FAM, SYBR Green |
2 | 520 | 550 | JOE, VIC, HEX, TET |
3 | 550 | 580 | NED, TAMRA, CY3 |
4 | 580 | 610 | Taxas Red, ROX, RED610 |
5 | 640 | 670 | CY5, RED670 |
본 발명에서 소광자(Quencher)는, 형광표지가 발생시킨 빛을 흡수하여 형광 세기를 감소시키는 물질을 의미하며, TAMRA, DABCYL, ECLIPSE, NFQ, 블랙홀 퀜처TM(BHQ), DDQ, QSY, 블랙베리 퀸처(Blackberry Quencher), Qxl, 아이오와 블랙(Iowa black) FQ, 아이오와 블랙 RQ, IRDye QC-1로 구성되는 군으로부터 선택되는 것을 사용할 수 있으나 반드시 이들로 제한되는 것은 아니다. 소광자는 종류에 따라 형광세기를 감소하는 범위가 다르므로 이를 고려하여 사용할 수 있다.적합한 형광표지-소광자 쌍은 다음과 같은 다양한 문헌에 개시되어 있다: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Aalysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd EDITION (Academic Press, New York, 1971); Griffiths, Color AND Constitution OF Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); 미국특허 제3,996,345호 및 제4,351,760호.
b) 다수의 타겟 핵산의 PCR 증폭
전 단계에서 수득된 타겟-특이적 FMMA 프로브-프라이머 세트를 이용하여 하나 이상의 타겟 핵산을 포함하는 시료 내의 다수의 타겟 핵산들을 핵산 중합효소 반응에 의해 증폭시킨다.
본 발명에 있어서, 상기 타겟 핵산- FMMA 프로브 복합체의 증폭반응은 본 발명의 프라이머 세트 이외에 증폭이 필요한 시약, 예컨대, 적당량의 DNA 중합효소, DNA 중합효소 인자(Mg2+), 완충용액, dNTPs(dATP, dCTP, dGTP 및 dTTP) 및 물(dH2O)을 포함할 수 있다. 상기 완충용액은 이에 제한되지는 않으나 적당량의 트리톤 X-100(Triton X-100), 디메틸설폭사이드(DMSO), Tween20, nonidet P40, PEG 6000, 포름아마이드 및 소혈청 알부민(BSA) 등을 추가로 포함할 수 있다.
중합 반응을 실시할 때, 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반응에 필요한 성분들의 과량은, 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양을 의미한다. Mg2+와 같은 조인자, dATP, dCTP, dGTP 및 dTTP를 원하는 증폭 정도가 달성될 수 있을 정도로 반응 혼합물에 제공하는 것이 바람직하다.
본 발명에서 사용가능한 핵산 중합효소는 RNA-의존성 RNA-중합효소, RNA-의존성 DNA-중합효소, DNA-중합효소, 또는 RNA-중합효소일 수 있다.
상기 핵산 중합효소의 비제한적인 예들은 Taq 중합효소, Tth 중합효소, Tli 중합효소, VENT 중합효소, Pfu 중합효소, DEEPVENT 중합효소, Pwo 중합효소, Bst 중합효소, Sac 중합효소, Tac 중합효소, Tfl/Tub 중합효소, Tru 중합효소, DYNAZYME 중합효소, Tne 중합효소, Tma 중합효소, Tsp 중합효소, Mth 중합효소, Phi29 중합효소, Klenow 중합효소, T7 중합효소 또는 KOD DNA 중합효소를 포함할 수 있다. 상기 핵산 중합효소의 바람직한 예는 Taq 중합효소이다.
PCR 반응은 DNA 분자의 변성 및 합성의 10 내지 100회 "주기"로 이루어질 수 있다. 바람직한 실시양태에서, 열순환(thermocycling) 증폭 반응으로 변성이 행해지는 온도는 약 90℃ 내지 95℃ 초과, 보다 바람직하게는 92℃ 내지 94℃이다. 바람직한 열순환 증폭 방법은 약 10회 내지 약 100회 주기, 보다 바람직하게는 약 25회 내지 약 50회 주기, 및 약 90℃ 내지 95℃ 초과, 보다 바람직하게는 92℃ 내지 94℃의 최고 온도를 포함하는 중합효소 연쇄반응을 포함한다.
타겟-특이적 FMMA 프로브-프라이머 세트를 이용한 타겟 DNA의 증폭과정의 어닐링 단계에서는 타겟-특이적 FMMA 프로브-프라이머 세트가 타겟 핵산의 상보적인 가닥에 어닐링하게 되고, 증폭과정에서 타겟 DNA가 증폭되게 되면 증폭곡선 신호(형광)를 생성한다. 일반적인 프로브와 달리 본 발명의 FMMA 프로브는 핵산 증폭에 직접적으로 관여하는 프라이머이므로 타겟 DNA에 결합하여 형광을 나타내는 다른 방식의 프로브와는 작용 기작이 상이하다. 즉, 본 발명의 FMMA 프로브는 증폭산물의 일부가 되어 형광을 나타낸다. 융해온도 분석과정에서 이중가닥이 단일 가닥으로 분리되게 되면 형광이 감소하여 융해온도 분석이 가능해지는데, 프로브 단독으로 타겟 핵산과 분리되어 융해온도 분석이 되는 기존의 방식과 달리 본 발명의 FMMA 프로브는 증폭산물의 일부를 구성한다.
c) 증폭산물의 융해온도 분석
증폭 산물들에 대하여 융해온도 분석을 수행한다. 상기 융해온도 분석 단계에서는 증폭산물을 온도를 증가시키면서 융해시켜 형광을 측정하여 융해곡선을 얻은 다음, 상기 융해곡선으로부터 융해 피크 곡선을 얻는 단계를 포함한다.
각각의 타겟-특이적 FMMA 프로브는 타겟 핵산 서열에 특이적이고, 각각의 세트 내에 동일한 표지를 보유하는 프로브가 2개 이상 존재한다. 동일한 표지를 보유하는 타겟-특이적 FMMA 프로브-프라이머 세트들의 증폭 산물은 서로 융해온도가 2℃ 이상, 더욱 바람직하게 2℃ 이상만큼 차이 나는 융해온도(Tm)를 갖고 있어 서로 구분이 된다. 따라서 융해온도 분석을 통해 동일한 표지를 보유하는 서로 다른 타겟-특이적 FMMA 프로브-프라이머들에 의해 증폭된 산물들을 구분할 수 있게 된다.
본 발명의 다른 양상은 형광기반의 다중 융해 분석을 이용한 유전자형 (genotype) 분석방법에 관한 것이다. 본 발명의 방법에서는 우선 a) 5'-R-T-Q-C-3' 구조의 다수의 FMMA 프로브-프라이머로 구성되는 대립유전자 특이적 FMMA 프로브-프라이머 세트를 준비하는 단계로서, 여기서 R 은 대립유전자의 증폭 유무를 검출할 수 있는 형광표지이고, T는 서로 상이한 증폭 산물들의 다양한 융해온도를 유도하는 융해온도 조절서열이고, Q는 소광자이고, C는 타겟 핵산 서열에 대해 상보적인 서열이며, 각각의 FMMA 프로브-프라이머는 서로 상이한 융해온도를 갖는 증폭산물을 생성하도록 설계한다. 이어서 b) 전 단계에서 수득된 타겟-특이적 FMMA 프로브-프라이머 세트를 이용하여 하나 이상의 타겟 핵산을 포함하는 시료 내의 다수의 타겟 핵산들을 핵산 중합효소 반응에 의해 증폭시킨다. 증폭이 완료되면, 증폭 산물들에 대하여 융해온도 분석을 수행하여 시료 내의 대립형질을 검출한다.
이때, Biorad CFX96과 같은 실시간 PCR 기기에서는 내장된 분석 소프트웨어를 이용하여 가로축에 온도를 그리고 세로축에 형광신호의 크기를 표시한 그래프를 그리게 된다. 이후, 분석 소프트웨어는 시각적으로 판단이 용이하도록 세로축에 표시된 형광신호 크기를 온도에 대해 미분한 후 음수 값을 취한 그래프, 즉 가로축은 온도, 세로축은 -d(RFU)/dT 값을 갖는 그래프를 형성하게 된다. 이와 같이 융해온도(Tm)의 변화에 따른 형광 레벨의 변화곡선의 미분곡선을 얻은 뒤, 각 유전자형을 대표하는 피크의 존재 유무에 따라 유전자형을 타이핑한다.
도 2는 벼 품종 판별을 위한 대립유전자-특이적 FMMA를 설명하는 모식도이다. 본 발명에서는 대립유전자-특이적 SNP 마커를 이용하는데, SNP 마커는 어느 하나의 대립유전자에 3'말단 염기가 정확하게 매치되지만, 이와는 다른 특정 대립유전자에는 미스매치되는 염기로 치환되어 있는 마커이다. 본 발명에서는 하나의 형광표지로 여러 개의 대상 대립유전자-특이적 SNP 마커를 동시에 분석할 수 있도록 하기 위해서, 2개 혹은 3개의 다른 융해 온도를 갖도록 증폭 산물의 길이와 융해온도 조절서열을 변화시켜 설계한다.
도 2를 참조하면, 본 발명에 따른 벼 품종 식별용 마커에 따른 타겟-특이적 FMMA 프로브-프라이머 세트의 FMMA 프로브는 SNP를 나타내는 특정 대립유전자와 일치한다. 따라서 상보적으로 일치하는 대립유전자형에 대해서는 FMMA 프로브가 특이적으로 주형 DNA에 혼성화하지만, 비특이적 대립유전자에 대해서는 FMMA 프로브가 혼성화하지 않는다. 이때 FMMA 프로브는 형광표지와 같은 검출가능한 수단으로 표지되므로 PCR로 증폭된 산물의 SNP 타입을 확인할 수 있다. 이러한 벼 품종 식별용 대립유전자-특이적 마커를 이용하여 PCR로 증폭된 산물의 유무는 융해곡선 분석을 이용하여 쉽게 분석될 수 있다.
융해곡선에서 측정된 융해온도(melting temperature, Tm)는 상기 각각의 타겟-특이적 FMMA 프로브-프라이머 세트의 FMMA 프로브와 타겟 유전자 각각의 SNP 위치의 염기가 일치하면 증폭이 일어나 융해피크가 나타나게 된다. 따라서 Tm 값을 비교하면 SNP 위치의 뉴클레오타이드 변이를 검출할 수 있다.
본 명세서에서 용어 “뉴클레오타이드 변이(nucleotide variation)”는 동일 유전자에서 나타나는 다양한 대립유전자형(allele)을 의미한다. 즉, 용어 “뉴클레오타이드 변이”는 야생형(wild) 및 변이형 (mutants)을 모두 포괄한다. 따라서 뉴클레오타이드 변이의 검출은, 지노타이핑 또는 대립유전자형의 검출로 표현될 수 있다.
본 발명에 있어서, 상기 유전적 변이는 대립유전자(allele), 단일염기다형성(SNP), 돌연변이, 또는 이들의 조합에 의해 일어나는 현상을 말한다. 이때, 상기 대립유전자는 염색체에서 같은 위치(locus)에 존재하면서 서로 다른 형질을 나타내는 유전자나 상동 염색체에서 같은 유전자 위치에 위치하는 다른 염기서열을 갖는 유전자를 말한다.
본 발명의 또 다른 양상은 본 발명의 타겟-특이적 FMMA 프로브-프라이머 세트를 포함하는 형광기반의 다중 융해 분석을 이용한 타겟핵산 다중 검출용 키트에 관한 것이다.
본 발명의 키트는 a) 5'-R-T-Q-C-3' 구조의 FMMA 프로브와 비표지 프라이머로 구성되는 타겟-특이적 FMMA 프로브-프라이머 세트로서, 여기서 R 서열은 형광표지이고, T는 서로 상이한 증폭 산물들의 다양한 융해온도를 유도하는 융해온도 조절서열이고, Q는 소광자이고, C는 타겟 핵산 서열에 대해 상보적인 서열이며, 각각의 FMMA 프로브-프라이머는 서로 상이한 융해온도를 갖는 증폭산물을 생성하도록 설계된다.
본 발명의 다른 바람직한 구현예에 따르면, 상기 키트는 선택적으로 핵산 증폭에 필요한 시약, 예컨대, 완충액, DNA 중합효소 (예컨대, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus 또는 Thermococcus literalis로부터 수득한 열안정성 DNA 중합효소), DNA 중합 효소 조인자 및 dNTP를 포함할 수 있다.
본 발명의 키트는 상기한 시약 성분을 포함하는 다수의 별도 구성으로 제작될 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다.
본 발명은 위에서 설명한 본 발명의 대립유전자 특이적 FMMA 프로브-프라이머 세트를 포함하는 대립유전자-특이적 벼 품종 판별용 키트를 제공한다. 본 발명의 대립유전자-특이적 벼 품종 판별용 키트는 다중 대립유전자-특이적 다중 중합효소연쇄반응을 이용하여 벼 품종을 판별할 수 있다. 본 발명의 대립유전자-특이적 벼 품종 판별용 키트는 벼 품종 식별용 마커 세트 15종 이상을 동시에 사용한 실시간 PCR 방법을 확립한 것으로, PCR 과정을 현저하게 간소화시켜, 소요되는 검사시간과 노동력을 최소화시킬 수 있다는 점에서 매우 유리하다.
이하에서 실시예를 들어 본 발명을 더욱 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예로 한정되는 것은 아니다.
실시예 1. 대립유전자-특이적 FMMA 벼 품종 판정
1-1. FMMA용 프라이머 설계
본 발명의 특징인 다중 타겟의 분석을 위해 여러 개의 대립유전자 상의 SNP (Single Nucleotide Polymorphism)를 분석하여야 하는 벼 품종 판정에 적용하였다. 벼 품종의 판정은 약 20여 가지의 SNP 마커의 존재 유무를 조사하여 그 패턴으로 종을 판정한다.
도 2와 같이 각 마커 유전자의 SNP 부위에 타입 특이적인 FMMA용 프라이머를 이용하여 해당 유전자형을 갖는 경우, 특정 온도에서 융해 피크(melting peak)가 나타나도록 설계하였다.
벼 품종 분석에 사용한 프라이머는 농업품질관리원에서 제공하는 벼 품종 판정용 유전자 마커와 염기서열 정보를 바탕으로 설계되었다. 즉, 유전자 마커에 해당하는 SNP의 유무를 증폭여부로 판단할 수 있도록 설계되었다. 하나의 형광표지로 여러 개의 대상 마커를 분석 가능하도록 2개 혹은 3개의 다른 융해 온도를 갖도록 증폭 산물의 길이와 융해온도 조절서열에 변화가 생기도록 설계하였다. 본 실시예에서 사용한 프라이머의 서열과 증폭산물의 크기, GC 함량, 융해온도는 표 2와 같다.
형광표지 | 대립유전자 | 명칭 | 염기서열 | PCR산물크기(bp) | PCR산물GC(%) | PCR산물Tm(℃) |
FAM | BR09 | BRa09-F3(T-In)-3[FAM] | [FAM]TAGCGTAAAATAGAGGAGG[BHQ1]ACATGAtAAG | 52 | 36.5 | 72.5 |
BR09-(T)R2 | GAGGAAAAAACATAGCATGTTTC | |||||
FAM | BR06 | BR06-F(FAM) | [FAM]GCGCTGGATACCCTGGACGAG[BHQ1]ATCTTACATTTGGTTTCACTGTTA | 239 | 33.5 | 80.0 |
BRq06-R | CAGTATGCTAATAACTCACTAATT | |||||
FAM | BR01 | BR01-F(FAM) | [FAM]CGCGCCGCGCCCCGGCCGCGC[BHQ1]AAGCAGCCTCATGGAGGTAG | 308 | 42.2 | 87.0 |
BRq01-R | CAACTTGATTTCCTGCTGCTAT | |||||
HEX | BR02 | BRc02-F | GTAGTTATAATTATTGGGTTCACC | 134 | 31.3 | 78.5 |
BRa02-RL1(HEX) | [HEX]CGTCAGGTAAGCGTGACGACT[BHQ1]CACTCCTAAGATGCCACATAtCG | |||||
HEX | BR04 | BRq04-F | GAACTCTCACATTAGCTAGAAAT | 305 | 32.5 | 84.0 |
BRa04-R(HEX) | [HEX]CGCCCGGCGGGCGCGGCGCAG[BHQ1]TGTTGGTTGTGAGTTGATACTG | |||||
BRa07-R3 (Cy5) | [Cy5]CCGCGGGGCCCGCCCGGCGAC[BHQ2]AGCCGATCAGATAGATCCCT |
1-2. 실시간
PCR
반응
설계된 프라이머들을 이용하여 각각의 벼 품종 지놈 DNA를 주형으로 실시간 PCR 반응을 수행하였다.
판별 타겟 핵산 SNP를 포함하는 유전체상의 단편을 10~50 ng의 유전체 DNA를 주형으로 사용하여 PCR 증폭을 수행하였다. 쌀품종 판정용 2x PCR 프리믹스 7.5 ㎕, 주형 DNA(5~10 ng/㎕) 1 ㎕, 벼 품종 식별용 FMMA 프로브 (0.1 - 1.0 pmole/㎕) 1 ㎕, 프라이머(0.5 - 4.0 pmole/㎕) 1 ㎕, 최종적으로 4 ㎕의 멸균수를 포함하여 총 15 ㎕ 부피로 반응액을 혼합한다.
이 반응액을 95℃에서 15분간 활성화시킨 후, 95℃에서 20초, 65℃에서 10초, 61℃에서 30초를 기본으로 하여 5회 반복하고, 95℃에서 20초, 63℃에서 30초 초간 진행하는 반복주기를 30회 반복하여 수행하였다.
실시간 PCR 기기는 Biorad의 CFX96과 Bio Molecular System의 MIC qPCR cycler 장비를 사용하였다. 실시간으로 형광을 측정하였다. 융해곡선 분석은 95℃에서 20초간 변성 단계를 거친 다음, 45℃에서 30초간 혼성화시킨 후, 65℃에서 99℃까지 1초당 0.4℃씩 상승시키며 형광을 측정하는 융해곡선 분석을 수행하였다.
1-3. 실시간 PCR을 이용한 PCR 산물의 분석 및 최종 판정
간척, 남강, 대야, 신운봉 등의 벼 품종을 대상으로 대립유전자-특이적 FMMA을 수행한 결과, 총 5개의 마커 (BR01, BR02, BR04, BR06, BR09)를 두 가지 (FAM, HEX) 형광표지를 이용하여 한번의 반응으로 5개의 유전자 마커의 존재 여부를 확인하였다. 그 결과 도 3와 같이 각 벼 품종에 부합하는 유전형 분석(genotyping) 결과를 얻을 수 있었다. 하나의 형광채널마다 두 개 혹은 세 개의 상이한 증폭산물 융해온도를 이용하여 하나의 반응으로 다수의 대립유전자 분석이 가능함을 확인하였다.
실시예 2. 대립유전자-특이적 FMMA 벼 품종 판정
벼 품종 판정에 사용되는 20가지 유전자 마커에 대한 대립유전자-특이적 FMMA를 설계하였고, 4가지 벼 품종에 대한 판정 테스트를 수행하였다. 각각의 테스트 세트당 10개의 마커를 분석가능하도록 하기 위해 4가지 형광채널 (FAM, HEX, Texas Red, Cy5)을 사용하였고 각 형광 채널마다 2개 혹은 3개의 마커 분석이 가능하도록 융해온도를 분배하였다. 각 10개씩의 유전자 마커가 분석 가능한 두 개의 세트를 이용해 20개의 유전자 마커를 분석하여, 결과를 도 4 및 도 5에 나타내었다.
도 4 및 도 5의 결과에 따르면, 시료 벼로부터 추출한 DNA는 벼 품종 식별용 마커 세트에서 특이적으로 증폭되어, 시료 벼가 종 판정기준에 부합하게 바르게 판정되었음을 확인하였다. 이러한 결과로부터 하나의 형광채널마다 두 개 혹은 세 개의 상이한 증폭산물 융해온도를 이용하여 하나의 반응으로 다수의 대립유전자 분석이 가능함을 확인하였다.
결론적으로 본 발명에서 제시된 FMMA 방법을 이용하면 한번의 반응으로 10개 이상의 시료를 동시 분석할 수 있음을 확인하였다. 이러한 방법은 실시예에서 실시한 대립유전자 마커의 유무 판정뿐만 아니라 다수의 타겟 핵산 유전자의 존재 유무판정에도 적용할 수 있고, 그 방법상에서 큰 차이는 없어 다양한 병원균에 대한 감염 여부의 동시 진단 등 다중 검출방법에 적용할 수 있다.
실시예 3. 핵산 증폭 산물의 길이에 따른 융해온도 분포 분석
실시예 1에서와 같은 하나의 형광채널에서 여러 개의 마커 분석을 위해 마커 간의 적절한 융해온도 분배가 필요하다. 이러한 융해온도 결정에 영향을 주는 요인들을 파악하고자 그 요인들 중 증폭산물의 길이와 융해온도와의 상관관계를 알아보았다. 형광표지가 된 프라이머는 고정하고, 리버스 프라이머의 위치를 바꾸어 산물의 길이를 조정하고 융해온도를 분석하였다. 즉, 5’쪽의 형광 프라이머는 동일한 것을 사용하고, 3’쪽의 프라이머는 증폭 산물의 길이가 50~350 bp 사이에서 달라지도록 거리를 조정한 프라이머를 사용하였다. 사용된 프라이머는 하기 표 3에 나타내었다.
명칭 | 염기서열 | PCR산물크기(bp) | PCR산물Tm(℃) | |
BR05 | BRq05-F2 | CAATGTGGATTGTGAAGGTGA | 102 | 79 |
BRq05-F1 | GTTCAAGAATTTGGAGAATCAAT | 121 | 79.5 | |
BRq05-F | GCAACATCGGACTGAAAGGT | 170 | 81 | |
BRm05-F(200) | CTGTAAAGATTGAACTGCCAAAT | 220 | 77/82 | |
BRc05-F | GGAACCACCACCGTTTAAATAA | 278 | 82 | |
BRm05-F(341) | TGGTATGTCACATTCTGTACGA | 362 | 82 | |
BRa05-R(Cy5) | [Cy5]GGAGACATCAGATACAGAGTG[BHQ2]TCGGTTATTGCAGGTGATaTTT | |||
BR13 | BRa13-F(Texasred) | [TexasRed]CCGTACCTTAGAGACAGCGTG[BHQ2]GATGCTTGCAAGAGGGGATaTT | ||
BRm13-R(70) | TCTTGATATGGCACCCATCCA | 91 | 83.5 | |
BRm13-R(122) | CAGTCATTGGGGTCAATGCCA | 143 | 85 | |
BRq13-R | GCAAGAACCAGGACCATGTGCT | 208 | 85.5 | |
BRm13-R(247) | TGTCAGTCATGATAATCCAAGG | 268 | 85.5 | |
BRm13-R(309) | CATGTTTAGAAACTGCAATGGC | 330 | 85.5 | |
BR15 | BRa15-F2-1 (HEX) | [HEX]CGTCAGGTAAGCGTGACGACT[BHQ1]GACGTCATAGCAACAACtaCG | ||
BRm15-R(51) | CACCAACTCATCTTACCTTTAAC | 72 | 80.5 | |
BRm15-R(102) | CAGAAGGTGCCCATCCATGTT | 123 | 84.5 | |
BRm15-R(151) | CTACACCTACTTTCTTCGTCAA | 172 | 84 | |
BRm15-R(204) | TAAGGGACATGACGGGTCAG | 225 | 85.5 | |
BRq15-R | TGTCTGCACTGACTTCTTCATC | 275 | 85.5 | |
BRm15-R(302) | ATCCATCATCCGAAGGATGTG | 324 | 85.5 | |
BR20 | BRa20-F (Cy5) | [Cy5]GGAGACATCAGATACAGAGTG[BHQ2]ACTAGAATATGGAACCCTaGAG | ||
BRm20-R(52) | TGCTAGTACAGATGAGGAGGT | 73 | 77.5 | |
BRq20-R1 | TTCAACATGCATGATGCAAAGC | 144 | 80 | |
BRm20-R(183) | CGACATTCTTGTTTGATATTTCTT | 204 | 80.5 | |
BRq20-R | GATGAAGGATCTTGGTGTTGCT | 260 | 81 | |
BRm20-R(313) | GATGATATGCTGATTGCTGCC | 334 | 81 |
벼 품종 유전자 마커 중 4종(BR05, BR13, BR15, BR20)에 대하여 증폭산물의 길이에 따른 융해온도 변화를 시험하여 그 결과를 도 6에 나타내었다. 도 6을 참조하면, PCR 산물의 길이가 길어질수록 증폭산물의 융해온도가 상승하는 것을 관찰하였다. 그러나 산물의 길이가 200 혹은 250 bp를 넘어가는 경우 융해온도의 상승효과가 미미함을 알 수 있었다. 결론적으로 증폭 산물의 길이를 50 - 250 bp 사이에서 조절하여 융해온도의 변화를 유도할 수 있음을 확인하였다.
실시예 4. 핵산 증폭 산물의 길이와 GC 함량에 따른 융해온도 분포 분석
융해온도의 미치는 요인 중 사용하는 융해온도 조절서열의 GC함량과 전체 산물의 융해온도와의 상관관계를 분석하였다.
3종의 벼 품종 유전자 마커 (BR12, BR16, BR20)에 대하여 5’과 3’ 프라이머의 타겟 핵산 유전자 상의 위치는 고정하고, 5’프라이머의 융해온도 조절서열의 GC함량을 두 종류(high & low GC %)를 사용하여 그 결과를 분석하여 도 7에 나타내었다. 본 분석에 사용한 프라이머의 정보는 표 4와 같다.
마커 | 프라이머 | 염기서열 | Tm 조절 서열의 GC% |
BR12 | BRa12-F2_Hi(Texasred) | [TexasRed]GCGGGCCGCGGGCGCCGCCAC[BHQ2]TCGACGGCGACCTGACtTGT | 95.238 |
BRa12-F2_Lo(Texasred) | [TexasRed]GGAGACATCAGATACAGAGTG[BHQ2]TCGACGGCGACCTGACtTGT | 47.619 | |
BR12-R | GCATTGGAGACGAACTGACG | ||
BR16 | BR16-F | TGGCGGGCGGGAGACGTTC | |
BRa16-R3_Lo [HEX] | [HEX]GGAGACATTAGATATAGAGTG[BHQ1]ACTGGCTTGCTGCCGTAtCCA | 38.095 | |
BRa16-R3_Hi [HEX] | [HEX]CGCCCGGCGGGCGCGGCGCAG[BHQ1]ACTGGCTTGCTGCCGTAtCCA | 92.238 | |
BR20 | BRa20-F_Hi (Cy5) | [Cy5]GCGGGCCGCGGGCGCCGCCAC[BHQ2]ACTAGAATATGGAACCCTaGAG | 47.619 |
BRa20-F_Lo (Cy5) | [Cy5]GGAGACATCAGATACAGAGTG[BHQ2]ACTAGAATATGGAACCCTaGAG | 95.238 | |
BRm20-R | TGCTAGTACAGATGAGGAGGT |
도 7을 참조하면, 융해온도 조절서열의 GC함량이 높은 경우 동일한 위치의 프라이머를 사용하더라도 GC함량이 낮은 융해온도 조절서열에 비해 증폭산물의 융해온도(Tm)가 증가함을 확인하였다. 즉, 융해온도 조절서열의 GC함량이 증가할수록 전체 산물의 융해온도가 증가하는 경향성을 확인할 수 있었다. 실시예 3 와 3의 결과를 종합하여 볼 때, 전체 산물의 융해온도는 산물의 길이 및 사용한 융해온도 조절서열의 GC 함량에 의해 복합적으로 영향을 받는 것을 확인하였다.
본 발명의 FMMA 방법을 사용하면 하나의 반응으로 다수의 타겟의 동시 검출이 가능하므로, 여러 개의 타겟 핵산 유전자의 분석이 필요한 동반 진단 분야, 여러 개의 대립유전자를 분석해야 하는 농림축산 분야, 다수의 감염체를 동시에 분석해야 하는 임상 병리분야에 광범위하게 이용될 수 있다.
이상에서 본 발명을 실시예를 들어 구체적으로 설명하였으나, 이러한 실시예들은 단지 설명의 목적을 위한 것으로, 본 발명의 범위가 제한되는 것이 아니다. 통상의 기술자라면 본 발명의 취지 및 범위를 벗어나지 않고 수정, 변경을 할 수 있으며 이러한 수정과 변경 또한 본 발명에 속하는 것임을 알 수 있을 것이다. 따라서 본 발명의 진정한 보호 범위는 첨부된 청구항과 그의 균등물에 의하여 정의된다고 할 것이다.
Claims (14)
- a) 5'-R-T-Q-C-3' 구조의 FMMA 프로브와 비표지 프라이머로 구성되는 타겟-특이적 FMMA 프로브-프라이머 세트를 준비하는 단계로서, 여기서 R은 형광표지이고, T는 서로 상이한 증폭 산물들의 다양한 융해온도를 유도하는 융해온도 조절서열이고, Q는 소광자이고, C는 타겟 핵산 서열에 대해 상보적인 서열이며, 각각의 FMMA 프로브-프라이머는 서로 상이한 융해온도를 갖는 증폭산물을 생성하도록 설계하는 단계;b) 전 단계에서 수득된 타겟-특이적 FMMA 프로브-프라이머 세트를 이용하여 하나 이상의 타겟 핵산을 포함하는 시료 내의 다수의 타겟 핵산들을 핵산 중합효소 반응에 의해 증폭시키는 단계;c) 증폭 산물들에 대하여 융해온도 분석을 수행하는 단계를 포함하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 상기 타겟-특이적 FMMA 프로브-프라이머 세트 내의 각각의 FMMA 프로브-프라이머의 융해온도 조절은, 증폭산물의 길이와 GC 함량 및 융해온도 조절서열의 길이와 GC 함량을 조정하여 증폭산물의 융점이 구별되도록 설계된 것임을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 상기 FMMA 프로브-프라이머들은 증폭 산물들 사이의 인접한 융해온도가 2℃ 이상 차이 나도록 구성되는 것을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제3항에 있어서, 상기 FMMA 프로브-프라이머들은 증폭 산물들 사이의 인접한 융해온도가 4℃ 이상 차이 나도록 구성되는 것을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 상기 융해온도 조절서열의 길이는 10-30 bp이고, 증폭 산물의 길이는 50 - 300bp인 것을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 상기 형광 표지는 FAM, TET, JOE, VIC, HEX, ROX, TAMRA, CY3, CY3.5, CY5, CY5.5, Oregon Green, CAL Red, Red 640, 및 Texas Red로 구성되는 군에서 선택되는 것임을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 상기 소광자(Quencher)는 TAMRA, DABCYL, ECLIPSE, NFQ, 블랙홀 퀜처TM(BHQ), DDQ, QSY, 블랙베리 퀸처(Blackberry Quencher), Qxl, 아이오와 블랙(Iowa black) FQ, 아이오와 블랙 RQ, 및 IRDye QC-1로 구성되는 군으로부터 선택되는 것임을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 상기 융해온도 분석 단계는,증폭산물을 온도를 증가시키면서 융해시켜 형광을 측정하여 융해곡선을 얻는 단계; 및상기 융해곡선으로부터 융해 피크 곡선을 얻는 단계를 포함하는 것을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 상기 핵산 중합효소는 RNA-의존성 RNA-중합효소, RNA-의존성 DNA-중합효소, DNA-중합효소, 또는 RNA-중합효소인 것임을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제9항에 있어서, 상기 DNA 중합효소는 Taq 중합효소, Tth 중합효소, Tli 중합효소, VENT 중합효소, Pfu 중합효소, DEEPVENT 중합효소, Pwo 중합효소, Bst 중합효소, Sac 중합효소, Tac 중합효소, Tfl/Tub 중합효소, Tru 중합효소, DYNAZYME 중합효소, Tne 중합효소, Tma 중합효소, Tsp 중합효소, Mth 중합효소, Phi29 중합효소, Klenow 중합효소, T7 중합효소 및 KOD DNA 중합효소로 구성되는 군으로부터 선택되는 것임을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항에 있어서, 증폭 산물의 융해온도는 50℃ 내지 100℃인 것을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제11항에 있어서, 증폭 산물의 융해온도는 60℃ 내지 95℃인 것을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법.
- 제1항의 방법을 이용하고, 제1항의 타겟-특이적 FMMA 프로브-프라이머 세트를 포함하는 것을 특징으로 하는 형광기반의 다중 융해 분석을 이용한 타겟 핵산 다중 검출용 키트.
- 제1항의 방법을 이용하고, 제1항의 타겟-특이적 FMMA 프로브-프라이머 세트를 포함하는 것을 특징으로 하는 대립유전자-특이적 벼 품종 판별용 키트.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE112018008028.5T DE112018008028B4 (de) | 2018-09-28 | 2018-10-18 | Verfahren zur mehrfachanalyse von amplikon unter verwendung der fluoreszenzbasierten mehrfachschmelzanalyse |
US17/182,705 US20210180115A1 (en) | 2018-09-28 | 2021-02-23 | Multiple analysis method for amplicon by using fluorescence-based multiple melting analysis |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2018-0116472 | 2018-09-28 | ||
KR1020180116472A KR102220701B1 (ko) | 2018-09-28 | 2018-09-28 | 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US17/182,705 Continuation US20210180115A1 (en) | 2018-09-28 | 2021-02-23 | Multiple analysis method for amplicon by using fluorescence-based multiple melting analysis |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2020067599A1 true WO2020067599A1 (ko) | 2020-04-02 |
Family
ID=69952926
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2018/012308 WO2020067599A1 (ko) | 2018-09-28 | 2018-10-18 | 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법 |
Country Status (4)
Country | Link |
---|---|
US (1) | US20210180115A1 (ko) |
KR (1) | KR102220701B1 (ko) |
DE (1) | DE112018008028B4 (ko) |
WO (1) | WO2020067599A1 (ko) |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20090035303A (ko) * | 2007-10-05 | 2009-04-09 | 대한민국(국립농산물품질관리원장) | 벼 품종을 식별하기 위한 다중 실시간 pcr 방법 |
KR20120078193A (ko) * | 2010-12-31 | 2012-07-10 | 주식회사 코젠바이오텍 | 벼 품종을 식별하기 위한 다중 실시간 pcr 방법 |
KR20160036906A (ko) * | 2014-09-26 | 2016-04-05 | 주식회사 파나진 | 프로브 혼합체의 반응성을 높일 수 있는 프라이머 및 그의 용도 |
KR20160055055A (ko) * | 2014-11-07 | 2016-05-17 | 주식회사 파나진 | 인유두종바이러스의 유전자형 검출을 위한 ρνα 프로브, 키트 및 방법 |
KR20160097193A (ko) * | 2013-10-09 | 2016-08-17 | 플루어레센트릭 인코포레이티드 | 다중 프로브 |
KR20160134982A (ko) * | 2015-05-14 | 2016-11-24 | (주) 하임바이오텍 | Tm 값 분석을 이용한 동시다중 실시간 PCR 산물 분석 방법 |
KR20170048092A (ko) * | 2015-10-26 | 2017-05-08 | 바이오코아 주식회사 | 표적 핵산에 대한 검출 정확도를 높이기 위한 프로브 세트 및 상기 프로브 세트를 이용하여 표적 핵산을 검출하는 방법 |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
US4351760A (en) | 1979-09-07 | 1982-09-28 | Syva Company | Novel alkyl substituted fluorescent compounds and polyamino acid conjugates |
US6117635A (en) | 1996-07-16 | 2000-09-12 | Intergen Company | Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon |
GB9812768D0 (en) | 1998-06-13 | 1998-08-12 | Zeneca Ltd | Methods |
ES2669244T3 (es) | 2012-03-05 | 2018-05-24 | Seegene, Inc. | Detección de variación de nucleótidos en una secuencia de ácido nucleico diana mediante escisión CTO y ensayo de extensión |
EP3760736A3 (en) * | 2013-11-19 | 2021-04-14 | Brandeis University | Multiplex target detection assay |
KR101756875B1 (ko) * | 2015-05-28 | 2017-07-11 | 에스디 바이오센서 주식회사 | 상보적 염기서열과 미스-매치된 염기서열 그리고 reporter와 quencher를 포함하는 이중 기능성 올리고뉴클레오타이드 및 이를 이용한 핵산 증폭 및 측정 방법 |
-
2018
- 2018-09-28 KR KR1020180116472A patent/KR102220701B1/ko active IP Right Grant
- 2018-10-18 DE DE112018008028.5T patent/DE112018008028B4/de active Active
- 2018-10-18 WO PCT/KR2018/012308 patent/WO2020067599A1/ko active Application Filing
-
2021
- 2021-02-23 US US17/182,705 patent/US20210180115A1/en active Pending
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20090035303A (ko) * | 2007-10-05 | 2009-04-09 | 대한민국(국립농산물품질관리원장) | 벼 품종을 식별하기 위한 다중 실시간 pcr 방법 |
KR20120078193A (ko) * | 2010-12-31 | 2012-07-10 | 주식회사 코젠바이오텍 | 벼 품종을 식별하기 위한 다중 실시간 pcr 방법 |
KR20160097193A (ko) * | 2013-10-09 | 2016-08-17 | 플루어레센트릭 인코포레이티드 | 다중 프로브 |
KR20160036906A (ko) * | 2014-09-26 | 2016-04-05 | 주식회사 파나진 | 프로브 혼합체의 반응성을 높일 수 있는 프라이머 및 그의 용도 |
KR20160055055A (ko) * | 2014-11-07 | 2016-05-17 | 주식회사 파나진 | 인유두종바이러스의 유전자형 검출을 위한 ρνα 프로브, 키트 및 방법 |
KR20160134982A (ko) * | 2015-05-14 | 2016-11-24 | (주) 하임바이오텍 | Tm 값 분석을 이용한 동시다중 실시간 PCR 산물 분석 방법 |
KR20170048092A (ko) * | 2015-10-26 | 2017-05-08 | 바이오코아 주식회사 | 표적 핵산에 대한 검출 정확도를 높이기 위한 프로브 세트 및 상기 프로브 세트를 이용하여 표적 핵산을 검출하는 방법 |
Also Published As
Publication number | Publication date |
---|---|
US20210180115A1 (en) | 2021-06-17 |
KR20200037020A (ko) | 2020-04-08 |
DE112018008028T5 (de) | 2021-07-08 |
KR102220701B1 (ko) | 2021-03-03 |
DE112018008028B4 (de) | 2023-12-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Chehab et al. | Detection of specific DNA sequences by fluorescence amplification: a color complementation assay. | |
JP5424903B2 (ja) | 融解解析のためのプライマー | |
US7090975B2 (en) | Pyrophosphorolysis and incorporation of nucleotide method for nucleic acid detection | |
EP1453978B9 (en) | Analysis and detection of multiple target sequences using circular probes | |
US11795514B2 (en) | Isothermal based-dual functional oligonucleotide including reporter dye, and quencher for isothermal nucleic acid amplification and measurement methods using | |
KR100808312B1 (ko) | 인위적 에스엔피 서열의 동시증폭을 이용한 염색체,유전자, 혹은 특정 뉴클레오티드 서열의 카피 수 측정방법 | |
WO2017099445A1 (ko) | 어류 에드와드 감염증과 연쇄구균 감염증 원인세균의 판별 및 검출용 유전자 마커, 및 이를 이용한 원인세균의 판별 및 검출 방법 | |
CN104164478A (zh) | 一种基因单碱基变异的cras-pcr检测方法 | |
WO2022010238A1 (ko) | 특정 인공 뉴클레오타이드 서열을 이용한 위양성 판단용 조성물 및 이를 이용한 위양성 판단 방법 | |
WO2013122319A1 (ko) | 리가제 반응과 절단효소 증폭반응을 이용한 표적 유전자 또는 이의 돌연변이 검출방법 | |
WO2018194437A2 (ko) | 표적 점 돌연변이 유전자 검출을 위한 핵산 분자 템플레이트 및 이를 이용한 유전자 검사방법 | |
US6753141B2 (en) | Simultaneous screening and identification of sequence alterations from amplified target | |
Blömeke et al. | Identification of N-acetyltransferase 2 genotypes by continuous monitoring of fluorogenic hybridization probes | |
WO2020067599A1 (ko) | 형광기반의 다중 융해 분석을 이용한 증폭 산물의 다중 분석방법 | |
WO2018016683A1 (ko) | 다중 증폭 이중 시그널 증폭에 의한 타겟 핵산 서열의 검출 방법 | |
WO2018048021A1 (ko) | Pna 프로브 및 융해곡선분석을 이용한 미토콘드리아 dna의 snp 분석방법 | |
JP4336877B2 (ja) | β3アドレナリン受容体変異遺伝子の検出法ならびにそのための核酸プローブおよびキット | |
KR101919896B1 (ko) | 단일 형광 채널 유전자증폭기기를 이용한 다중 핵산 검출 방법 | |
CN111909990A (zh) | 单管同时检测基因的缺失突变和点突变的荧光pcr检测方法 | |
US7282126B2 (en) | System and method for determining known DNA variants with temperature gradient electrophoresis | |
Kratzer et al. | Swiss Population Data for 3 STR-Systems (SE33, HUMTHO1, D21S11), HLA DQα and D1S80 | |
WO2022139121A1 (ko) | 중합효소연쇄반응을 기반으로 한 표적 점 돌연변이의 검출 방법 | |
WO2024014734A1 (ko) | 특이도 및 민감도가 향상된 qpcr 방법 및 킷트 | |
WO2018026039A1 (ko) | 단일염기다형 검출용 키트 및 방법 | |
KR20160047302A (ko) | 리포터 및 소광자가 포함된 내부 정량 컨트롤 프로브를 이용한 새로운 정량 분석 방법 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18935419 Country of ref document: EP Kind code of ref document: A1 |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 18935419 Country of ref document: EP Kind code of ref document: A1 |