WO2019216603A1 - B형 간염 바이러스 유래 폴리펩티드 및 이의 항바이러스 용도 - Google Patents

B형 간염 바이러스 유래 폴리펩티드 및 이의 항바이러스 용도 Download PDF

Info

Publication number
WO2019216603A1
WO2019216603A1 PCT/KR2019/005302 KR2019005302W WO2019216603A1 WO 2019216603 A1 WO2019216603 A1 WO 2019216603A1 KR 2019005302 W KR2019005302 W KR 2019005302W WO 2019216603 A1 WO2019216603 A1 WO 2019216603A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
polypeptide
pharmaceutical composition
hiv
hbv
Prior art date
Application number
PCT/KR2019/005302
Other languages
English (en)
French (fr)
Inventor
김범준
최유민
김홍
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to JP2020562636A priority Critical patent/JP7017012B2/ja
Priority to EP19800689.2A priority patent/EP3792354A4/en
Priority to CN201980030673.2A priority patent/CN112105727B/zh
Publication of WO2019216603A1 publication Critical patent/WO2019216603A1/ko
Priority to US17/090,485 priority patent/US11692011B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
    • A61K31/708—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid having oxo groups directly attached to the purine ring system, e.g. guanosine, guanylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/162—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1276—RNA-directed DNA polymerase (2.7.7.49), i.e. reverse transcriptase or telomerase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10132—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10133—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • HIV Human immunodeficiency virus
  • AIDS Acquired Immune Deficiency Syndrome
  • HAART Highly Active Antiretroviral Therapy
  • Raltegravir (ISENTRESS / MK-0518) is a prototypical integrase strand transfer inhibitor (INSTI) that has been strongly approved for clinical use by strongly reducing viral load.
  • INSTI prototypical integrase strand transfer inhibitor
  • HBV Hepatitis B virus
  • HBV Hepatitis B virus
  • Interferon- ⁇ which has been proven effective for the last decade, is expensive and has side effects, and is less effective in Asian patients whose infection is a problem immediately after birth.
  • Nucleoside analogue another therapeutic agent, has the advantage of oral administration, but because it acts on DNA polymerase and inhibits virus growth, it cannot directly act on non-proliferative viruses, making it difficult to completely remove HBV from the body. Such problems are known.
  • One aspect is to provide a polypeptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
  • Another aspect is to provide an antiviral pharmaceutical composition comprising the polypeptide.
  • Another aspect is to provide a pharmaceutical composition for preventing or treating Acquired Immune Deficiency Syndrome (AIDS) comprising the polypeptide.
  • AIDS Acquired Immune Deficiency Syndrome
  • Another aspect is to provide a pharmaceutical composition for preventing or treating liver disease comprising the polypeptide.
  • Another aspect is to provide an anti-viral dietary supplement comprising the polypeptide.
  • Another aspect is to provide a method of preventing or treating a viral infection and the symptoms associated with administering the pharmaceutical composition to a subject.
  • One aspect provides a polypeptide consisting of any one amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
  • polypeptide means a polymer consisting of two or more amino acids linked by amide bonds (or peptide bonds)
  • the polypeptide is any one selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. It may be composed of one amino acid sequence, specifically, the amino acid sequence of SEQ ID NO: 2.
  • the protecting group may be an acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group, or polyethylene glycol (PEG), but a component capable of improving the modification of the polypeptide, especially the polypeptide If it is, it can be included without limitation.
  • stability may mean not only in vivo stability that protects the polypeptide of the invention from attack by protein cleavage enzymes in vivo, but also storage stability (eg, room temperature storage stability).
  • polypeptide may further comprise amino acid sequences prepared for specific purposes for targeting sequences, tags, and labeled residues.
  • homology is intended to indicate a degree of similarity to wild-type amino acid sequences, and such homology comparisons can be performed using comparative programs well known in the art, and homology between two or more sequences. Can be calculated as a percentage.
  • the polypeptide may be derived from nature and may be obtained by various polypeptide synthesis methods well known in the art. As an example, it may be prepared using a polynucleotide recombination and protein expression system or by in vitro synthesis through chemical synthesis such as peptide synthesis, cell-free protein synthesis, and the like. Further, as an example, the polypeptide may be a product obtained by culturing peptides, extracts of plant-derived tissues or cells, microorganisms (for example bacteria or fungi, and especially yeasts), specifically, Hepatitis B virus (Hepatitis B virus, HBV) may be derived from the polymerase, and more specifically, may be derived from the preS1 region of the HBV polymerase.
  • Hepatitis B virus Hepatitis B virus
  • the polypeptide may have antiviral activity.
  • the virus may be adenovirus, smallpox virus, polio virus, measles virus, severe fever with Thrombocytopenia Syndrome virus, influenza virus, hepatitis C virus, human immunodeficiency virus -1 (Human Immunodeficiency Virus-1 (HIV-1) and Hepatitis B virus (HBV) may be at least one selected from the group consisting of, specifically human immunodeficiency virus-1 (Human Immunodeficiency Virus-1) 1: HIV-1) and Hepatitis B virus (HBV) may be at least one selected from the group consisting of.
  • Another aspect provides an antiviral pharmaceutical composition comprising the polypeptide.
  • polypeptide In the pharmaceutical composition, the “polypeptide” and the like are as described above.
  • composition may further comprise an antiviral agent.
  • the antiviral agent is, for example, acyclovir, famciclovir, valacyclovir, gancyclovir, amprenaver, abacarver, ansamycin, sipofober, darunaver, delaviridine, efavirens, ethavirin, palmci Clover, Hypericin, Indinaver, Lamivudine, Lobucarver, Nelfinaber, Nevirapine, NovaFren, Ritonaber, Saquinaber, Stavudine, Tipranaber, Virazole, Ribavirin, Jalcitabine, Zidobudine, Maravirok , Ralte grabber, elbitgrabber, didanosine, tenofober, emtricitabine, ropinaber, atazanaber, enfuverted, clevudine, entecabir, adefober, oseltamirber
  • the antiviral effect may be significantly increased to exhibit a synergistic effect.
  • the antiviral agent is entecavir
  • the anti-HBV effect and the effect on the expression of type I interferon may be significantly increased by a synergistic effect.
  • the virus may be adenovirus, smallpox virus, polio virus, measles virus, severe fever with Thrombocytopenia Syndrome virus, influenza virus, hepatitis C virus, human immunodeficiency virus-1 (Human Immunodeficiency Virus-1 (HIV-1) and Hepatitis B virus (HBV), etc. may be at least one selected from the group consisting of, specifically human immunodeficiency virus-1 (Human Immunodeficiency Virus-1) : HIV-1) and Hepatitis B virus (HBV) may be at least one selected from the group consisting of.
  • HCV-1 Human Immunodeficiency Virus-1
  • HBV Hepatitis B virus
  • the polypeptide may be one that inhibits the growth of the virus. Specifically, the polypeptide may inhibit the proliferation of HIV-1 by inhibiting the activity of the enzyme by inhibiting the acetylation of HIV-1 insertase. In addition, the polypeptide may increase the free radicals of mitochondria in the cell, and may increase the expression of IFN- ⁇ and IFN- ⁇ contained in type I interferon, through which HBcAg or Nucleocapsid of HBV is expressed. By inhibiting synthesis, the proliferation of HBV can be suppressed.
  • IFN-inducing proteins that play a role in the antiviral action of IFNs are RNA dependent protein kinases (PKR), 2 ', 5'- oligo adenylic acid synthase (OAS) and RNase L and Mx protein GTPases.
  • PPKR RNA dependent protein kinases
  • OFAS oligo adenylic acid synthase
  • RNase L and Mx protein GTPases Double stranded RNA mediates protein phosphorylation and RNA degradation catalyzed by IFN-induced PKR kinase and 2'-5'- oligo adenylate dependent RNase L, respectively, and also IFN-induced RNA specific adenosine deaminase ( RNA editing by ADAR1).
  • IFN also induces inducible nitric oxide synthase (iNOS2) and major histocompatibility complex (MHC) I and II proteins, all of which act as immune responses to infection (Clin Microbiol Rev. 2001 Oct; 14 ( 4): 778-809).
  • iNOS2 inducible nitric oxide synthase
  • MHC major histocompatibility complex
  • polypeptide according to one embodiment may have an anti-viral activity against all viruses by increasing the expression of IFN.
  • prevention may refer to any action that inhibits or delays the onset of a virus caused by a subject's virus by administration of a pharmaceutical composition according to one aspect.
  • treatment may mean any action that improves or advantageously changes the condition for a disease caused by a virus of an individual by administration of a pharmaceutical composition according to one aspect.
  • the polypeptide inhibits the proliferation of HIV-1 by inhibiting the acetylation of the insertase of HIV-1. As the proliferation of HIV-1 is suppressed, it may have an HIV treatment effect.
  • the polypeptide increases mitochondrial stress to increase intracellular free radicals, increase the expression of Type I interferon, inhibit the synthesis of nucleocapsids, thereby inhibiting the proliferation of HBV It can have a therapeutic effect on liver disease.
  • the pharmaceutical composition may be provided as a pharmaceutical composition including an active ingredient alone or one or more pharmaceutically acceptable carriers, excipients or diluents.
  • the carrier may be, for example, a colloidal suspension, powder, saline, lipids, liposomes, microspheres or nano spherical particles. They may be complexed with or related to the vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.
  • the pharmaceutical composition is a pharmaceutically acceptable carrier, i.e., when formulated, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, rubber, calcium phosphate, alginate, gelatin, calcium silicate which are commonly used , Microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.
  • a pharmaceutically acceptable carrier i.e., when formulated, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, rubber, calcium phosphate, alginate, gelatin, calcium silicate which are commonly used , Microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzo
  • diluents or excipients such as lubricants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used may be used.
  • Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, and the like, which may comprise at least one excipient such as starch, calcium carbonate, sucrose in the composition. ) Or lactose, gelatin and the like can be mixed.
  • lubricants such as magnesium stearate and talc may also be used.
  • Oral liquid preparations include suspensions, solvents, emulsions, syrups, and the like, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories.
  • the non-aqueous solvent and suspending agent propyleneglycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used.
  • witepsol macrogol, tween 61, cacao butter, laurin butter, glycero gelatin, and the like may be used, and a well-known diluent or excipient may be used when prepared in the form of eye drops. have.
  • pharmaceutically acceptable means to exhibit properties that are not toxic to cells or humans exposed to the composition.
  • the pharmaceutical composition may be provided in admixture with an antiviral composition known in the art.
  • the pharmaceutical composition may be administered in parallel with a known composition having a cataract antiviral effect.
  • administration means introducing a given substance into an individual in a suitable manner.
  • the term "individual” refers to a subject in need of treatment of a disease caused by a virus, and more specifically refers to a mammal, such as a primate, mouse, dog, cat, horse and cow, which is human or non-human. Can be.
  • the pharmaceutical composition may be administered orally or parenterally (eg, applied intramuscularly, intravenously, intraperitoneally, subcutaneously, intradermal, or topically) according to the desired method, and the dosage is determined by the condition of the patient and Depending on body weight, degree of disease, drug form, route of administration and time of day, it may be appropriately selected by those skilled in the art.
  • the pharmaceutical composition is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level refers to the type of disease, severity, activity of the drug, drug Sensitivity to, time of administration, route of administration and rate of administration, duration of treatment, factors including concurrent use of drugs, and other factors well known in the medical arts.
  • the pharmaceutical composition may be administered at 0.01 to 1000 mg / kg / day, more specifically 0.1 to 500 mg / kg / day.
  • the administration may be administered once a day, may be administered in several divided doses.
  • the pharmaceutical composition according to one aspect may be administered as a separate therapeutic agent or in combination with other anti-inflammatory agents and may be administered simultaneously, separately, or sequentially with conventional anti-inflammatory agents, and may be single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect with a minimum amount without side effects, which can be readily determined by one skilled in the art.
  • the effective amount of the pharmaceutical composition may vary depending on the age, sex, condition, weight of the patient, the absorption of the active ingredient in the body, the inactivation rate, the rate of excretion, the type of disease, the drug used in combination, the route of administration, obesity It may increase or decrease depending on the severity, sex, weight, age, and the like.
  • Another aspect provides a pharmaceutical composition for preventing or treating Acquired Immune Deficiency Syndrome (AIDS) comprising the polypeptide.
  • AIDS Acquired Immune Deficiency Syndrome
  • the acquired immune deficiency syndrome may be from HIV-1 infection.
  • Another aspect provides a pharmaceutical composition for preventing or treating liver disease comprising the polypeptide.
  • the liver disease may be from HBV infection, and specifically, may be at least one selected from the group consisting of hepatitis, cirrhosis and liver cancer, and more specifically, may be developed from hepatitis B.
  • Another aspect provides an antiviral dietary supplement comprising the polypeptide.
  • the term “improvement” may mean any action that at least reduces the parameters associated with the condition being treated, for example, the extent of symptoms.
  • the health functional food may be used simultaneously or separately with the medicament for treatment before or after the onset of the disease in order to prevent or improve AIDS or liver disease.
  • the active ingredient may be added to the food as it is or used with other foods or food ingredients, and may be appropriately used according to conventional methods.
  • the mixing amount of the active ingredient can be suitably determined according to the purpose of use (prevention or improvement).
  • the health functional food may be added in an amount of about 15% by weight or less, more specifically about 10% by weight or less based on the raw material in the manufacture of food or beverage.
  • the amount may be below the above range.
  • the dietary supplement further comprises one or more of a diluent, excipient, or additive such as a carrier, filler, extender, binder, wetting agent, disintegrant, surfactant, and the like, tablets, pills, powders, granules, powders, capsules and liquid formulations. It may be formulated as one selected from the group consisting of. Examples of the food that may be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, teas, vitamin complexes, and health functional foods.
  • the carriers, excipients, diluents and additives include lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose , Polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil It may be at least one selected from.
  • the health functional food may contain other ingredients as essential ingredients in addition to containing the active ingredient without particular limitation.
  • various flavors, natural carbohydrates, and the like may be contained as additional ingredients, such as a conventional beverage.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, erythritol.
  • natural flavoring agents such as tauumatin, stevia extract (e.g., rebaudioside A, glycyrginine, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • the proportion of the natural carbohydrate can be appropriately determined by the choice of those skilled in the art.
  • the health functional food is a variety of nutrients, vitamins, minerals (electrolytes), flavors such as synthetic and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof , Alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like.
  • nutrients vitamins, minerals (electrolytes), flavors such as synthetic and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof , Alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like.
  • Another aspect provides a method of preventing or treating a viral infection and symptoms associated with administering the pharmaceutical composition to a subject.
  • polypeptide "individual”, “administration”, “pharmaceutical composition”, “virus” and the like are as described above.
  • Polypeptides according to one aspect increases the expression of type I interferon not only shows antiviral effects on all viruses, but also anti-HIV-1 and anti-HBV, and has a synergistic effect by co-administration with existing antiviral agents. Or there is an effect that can be usefully used for the treatment of virus-related diseases such as liver disease.
  • Figure 1 A) is a schematic diagram of the position of hepatitis B virus-derived polypeptides (Poly 5, Poly6 and Poly7) according to one aspect
  • B) is a diagram showing the results of the anti-HIV-1 effect analysis.
  • 2A is a cytotoxicity assessment of a polypeptide according to one aspect
  • B) is an anti-HIV-1 activity assessment by a polypeptide according to one aspect
  • D) and E) is a diagram showing the evaluation of the cytopathic inhibitory effect of AZT and polypeptide according to one aspect.
  • A) is an evaluation of inhibition of HIV-1 GFP expression by a polypeptide and another anti-HIV-1 agent according to one aspect
  • B) is an evaluation of inhibition of p24 expression by a polypeptide and another anti-HIV-1 agent according to one aspect
  • C) is a diagram showing the evaluation of HIV-1 level inhibition by the polypeptide and other anti-HIV-1 agents according to one aspect.
  • 4A and 4B are diagrams illustrating the evaluation of HIV-1 level inhibition by time by polypeptides and other anti-HIV-1 agents according to one aspect.
  • 5A is comparative data for the amount of 2-LTR ring and cDNA inserted by a polypeptide and another anti-HIV-1 agent according to one aspect
  • B) is a polypeptide and another anti-HIV-1 agent according to one aspect P300 expression comparison data by
  • C) is a diagram showing the comparison data for acetylation of the insert enzyme by the polypeptide and other anti-HIV-1 preparation according to one aspect.
  • FIG. 6A and 6B are diagrams illustrating cell viability analysis by comparing antiviral effects and candidate treatments of polypeptide candidates Poly5, Poly6, Poly7 and each substance.
  • FIG. 6A is a hepatitis B virus-derived polypeptide (Poly6) and a candidate according to one aspect.
  • Figures comparing the s / e antigen reduction effect of the polypeptides (Poly5, Poly7), 6b is a diagram showing the results of cell viability analysis by the polypeptide according to one aspect.
  • FIG. 7 is a diagram showing inhibition of HBV replication by a polypeptide according to one aspect in the stage of chronic infection and evaluation of the anti-HBV effect by the polypeptide according to one aspect in HBV-sensitive cells, where A) is the level of HBsAg and B) is the level of HBeAg, C) is a virus titer, D) is a Southern blot results, E) is a diagram showing the relationship between (IC 50) of the polypeptide dose and HBV replication in accordance with an aspect.
  • FIG. 8F shows the results of confirming the formation of core protein and capsid after treatment of PBS, ETV and polypeptide according to one aspect, and G) infected HBV virion with each substance in HepG2-hNTCP-C4 according to dose.
  • H) is a diagram showing the results of viral DNA measurement to confirm the anti-HBV effect according to the dose of the polypeptide according to one aspect in the infection model.
  • 9A and 9B show HBV inhibitory effects by polypeptides according to one aspect of a mouse model, where 9a is PBS, Lamivudine (3TC) and HBsAg levels according to polypeptide treatment according to one aspect, and 9b is PBS, Lamivudine. (3TC) and the level of HBV DNA following polypeptide treatment according to one aspect.
  • FIG. 10 is a diagram showing the oxidative stress generation evaluation of mitochondria by the polypeptide according to one aspect
  • A) shows the mitochondrial reactive oxygen (mtROS) level (Rotenone is a positive control for mitochondrial oxidative stress) according to the treatment of each material
  • B) shows the mitochondrial reactive oxygen level of each concentration by the polypeptide according to one aspect
  • C) is a diagram showing the mitochondrial reactive oxygen level according to the treatment of the polypeptide and the oxidative stress inhibitor (MitoTempo) treatment according to one aspect.
  • mtROS mitochondrial reactive oxygen
  • MitoTempo oxidative stress inhibitor
  • 11A and 11B are diagrams showing an increase in type I IFN (Type 1 IFN) by a polypeptide according to one aspect, wherein 11a is mRNA levels of IFN- ⁇ , RIG-I and ISG15 following the polypeptide treatment, and 11B B) shows the luciferase expression level after treatment of each material-treated cell supernatant in hMH55-293-ISRE cells, and C) of 11b shows IFN- ⁇ mRNA according to each material treatment in a mouse model. Is a diagram evaluating expression levels.
  • FIG. 12 is a diagram showing the blocking of the anti-HBV effect of poly6 through the neutralizing type I interferon receptor
  • A) shows that e-antigen and extracellular HBV DNA levels, which were reduced by one aspect of treatment, are restored by neutralizing antibody treatment
  • B) is a diagram showing a decrease in the type I interferon mRNA level increased by one aspect of treatment.
  • A) is a synergistic anti-HBV DNA reduction width synergistic effect of the combination treatment
  • B) is a cytotoxicity test according to the combination treatment
  • C) is a diagram showing the s and e antigen reduction level according to the combination treatment.
  • IFN- ⁇ , IFN- ⁇ and TNF- ⁇ according to the combination treatment MRNA level of B B) is a diagram showing the expression level of luciferase after treatment of the cell supernatant treated in combination with hMH55-293-ISRE cells.
  • HBV polymerase-derived peptide has an anti-HIV-1 effect.
  • 15 nucleotide deletions of the preS1 start site may control the proliferation of the virus and contribute to disease progression.
  • Three kinds of peptide candidates were selected from polymerase regions corresponding to 18 and 21 nucleotide deleted sequences. These peptides were named Poly5 (GRLVF, SEQ ID NO: 1), Poly6 (GRLVFQ, SEQ ID NO: 2) or Poly7 (GRLVFQT, SEQ ID NO: 3) (FIG.
  • MT-4 cells (4 ⁇ 10 5 cell numbers) were infected with HIV-1 (4 ⁇ 10 5 CCID 50 ) for 1 hour.
  • the MT-4 cells were provided by the NIH / AIDS Research and Reference Reagent Program.
  • HIV-1 transfects 293FT cells for 48 hours using Lipofectamine 2000 reagent (Life Technologies) with a pBR_HIV-1_M_NL4-3_IRES_eGFP vector (DS441) coexpressing Nef and enhanced green fluorescent protein (eGFP) from a single bicistronic RNA in 293FT cells
  • a pBR_HIV-1_M_NL4-3_IRES_eGFP vector DS441
  • eGFP enhanced green fluorescent protein
  • MT-4 cells were infected for 72 hours with HIV-1, a viral precursor, at a concentration of 0.5, a multiple infection concentration (MOI). The collected supernatants were then centrifuged and filtered, and then p24 ELISA was used to measure the titer of infectious virus and stored at -70 ° C until just before use.
  • DMSO Dimethyl Sulfoxide
  • Azidothymidine AZT; 3-Azido-3-deoxythymidine
  • Poly5 to Poly7 DMSO (Dimethyl Sulfoxide)
  • DMSO and Azidothymidine 3-Azido-3-deoxythymidine, AZT
  • GFP images were confirmed using a fluorescence microscope. Relative GFP intensities were determined in pixels per area using the ImageJ software program (National Institutes of Health).
  • HSP90 Cell Signaling
  • DMSO 0.5%), AZT (5 nM) or 10 ⁇ M of three candidates were treated in HIV-1 infected MT-4 cells and 2 days later GFP imaging and p24 ELISA were performed to confirm the titer of HIV-1 As a result, the virus production was reduced by Poly5 and Poly7, in particular significantly reduced by Poly6 (Fig. 1B)).
  • the toxic effects of Poly6 on cells were measured to exclude the possibility of Poly6 affecting HIV-1 proliferation due to nonspecific cytotoxicity before investigating the effects of Poly6.
  • MT-4 cells were treated to 1 ⁇ 10 4 cells and treated with Poly6 by concentration, and cultured for 5 days, and cytotoxicity was measured using an MTT assay kit (Promega).
  • HIV-1 (1 ⁇ 10 4 CCID) on MT-4 cells (1 ⁇ 10 4 cells) to analyze the anticytotoxic effect by Poly6 when cytotoxicity is caused by HIV-1 infection 50 ) were infected and analyzed for cell viability after incubation for 5 days.
  • p24 ELISA was performed to evaluate HIV-1 titer in the supernatant.
  • PBR_HIV-1_M_NL4-3_IRES_eGFP vector was transfected to generate HIV-1 from 293FT cells, and anti-HIV-1 activity by Poly6 in MT-4 cells was assessed by p24 ELISA. HIV-1 proliferation was inhibited according to concentration by Poly6, with an average 50% inhibitory concentration (IC 50 ) of about 0.2664 ⁇ M (FIG. 2B). In addition, GFP expression according to the activity of HIV-1 LTR was also gradually decreased with concentration by Poly6 (Fig. 2C).
  • PBMCs human peripheral blood mononuclear cells
  • Human peripheral blood mononuclear cells PBMC
  • PHA phytohemagglutinin
  • IL-2 100 U / ml PEPROTECH
  • p24 ELISA (p24 ELISA, ABL, Rockville, MD) was performed according to the manufacturer's protocol to evaluate the titer of HIV-1 virus.
  • Cell supernatants and HIV-1 RNA of cells were purified using QIAamp UltraSens Virus kit (QIAGEN) and quantified by RTqPCR using primers specific for Gag region of HIV-1.
  • Glycerin aldehyde phosphate dehydrogenase (GAPDH) was used as a reference gene for standardization.
  • PBMC cells were incubated with DMSO (0.5%), AZT (5 nM), Raltegravir (10 nM) or Poly6 (10 ⁇ M) for 5 days after HIV-1 infection and then compared with DMSO. It was found that the expression of GFP and p24 proteins in PBMC cells was significantly reduced by Poly6 at comparable levels seen in AZT or Raltegravure (FIG. 3A) and 3B). It was also confirmed that HIV-1 proliferation in PBMC cells was significantly reduced by Poly6 to similar levels seen in AZT or raltegravure compared to DMSO (FIG. 3C). These results indicate that Poly6 can inhibit HIV-1 proliferation in MT-4 cells as well as in human PBMCs.
  • 2-LTR PCR was used to detect circular viral DNA which remained uninserted in the cytoplasm and Alu PCR was performed for amplification of the inserted viral DNA.
  • viral DNA was extracted from HIV-1 infected MT-4 cells using the QIAamp MinElute Virus Spin Kit (QIAGEN).
  • 2-LTR F (MH535), AACTAGGGAACCCACTGCTTAAG (Forward, SEQ ID NO: 8), 2-LTR R (MH536), TTCACAGATCAAGGATATCTTGTC (Reverse, SEQ ID NO: 9) and 2-LTR probe FAM-ACACTACTTGAAGCACTCAA-TAMRA (SEQ ID NO: 10) was used, Alu-1F, TCCCAGCTACTCGGGAGGCTGAGG (forward, SEQ ID NO: 11) and Alu-1R, CCCTAGTTAGCCAGAGCTCCCA (reverse, SEQ ID NO: 12) and secondary Alu PCR forward primer, Alu-2F FAM-AGCATGGGATGGAGGACCCG-TAMRA (SEQ ID NO: 15) was used as the ACAGCCTCCTAGCATTTCGT (Forward, SEQ ID NO: 13), Alu-2R, AGCGGAAAGTCCCTTGTAGA (Reverse, SEQ ID NO: 14)
  • HIV-1 when HIV-1 is infected to MT-4 cells, the proliferation of HIV-1 proceeds through several steps. Because there are several stages in the HIV-1 life cycle, such as virus attachment, insertion, transcription, or virus synthesis, there are various mechanisms of action for newly developed anti-HIV-1 reagents.
  • MT such as Poly6 and AZT (reverse transcriptase inhibition), raltegravir (insertase inhibition), ritonavir, T20 (inhibition of virus emergence), etc.
  • Time-of-addition (TOA) assays were performed using various anti-HIV-1 drugs that could inhibit various stages of the HIV-1 life cycle in -4 cells.
  • T-20, raltegravir and ritonavir were obtained from the NIH / AIDS Research and Reference Reagent Program (NIH).
  • TOA analysis confirmed well at the time when inhibition of HIV-1 proliferation by each representative drug corresponded to the proliferative stage targeted by each drug, and Poly6 began to lose its effectiveness between 6 and 8 hours.
  • FIG. 4A As can be seen from the TOA results of raltegravir, an insertase inhibitor with a similar inhibitory mechanism, the analysis of intracellular GFP also supports the TOA results (FIG. 4B), which, together, Poly6 inhibits the activity of viral insert enzymes. It can be seen that the anti-HIV-1 effect.
  • This experiment was performed to demonstrate TOA data on HIV-1 insertase inhibition by Poly6. Specifically, Alu PCR and 2-LTR PCR were used to detect the formation of the insertase ring in MT-4 cells infected with HIV-1. If insertion does not occur when the HIV-1 cDNA enters the intracellular nucleus, it is known to replicate itself and form a 2-LTR ring. Unlike lategavier, an insertase inhibitor, the level of 2-LTR ring was increased by Poly6, and the number of cDNA inserted was significantly reduced in HIV-1 infected MT-4 cells (FIG. 5A). These results indicate that Poly6 may be able to inhibit the proliferation of HIV-1 by blocking the integration of insert enzymes.
  • the antibody was isolated from infected MT-4 cells treated with DMSO, AZT, Raltegravure or Poly6. Applied to cells. Immunoblotting was then performed using antibodies specific for acetylated lysine (Cell Signaling). As a result, it was confirmed that Poly6 and raltegravure inhibit the acetylation of the insert enzyme (FIG. 5C).
  • HepG2 cells which are human-derived liver cancer cells, with HBV permanently inserted
  • oligonucleotides for quantitative real-time PCR and probes for TaqMan probe hybridization PCR are shown in Table 1 below.
  • HepG2, HepG2.2.15 and HepG2-hNTCP-C4 cells (expressing NTCP receptors in the cell membrane) were plated in 96 microplates (1 ⁇ 10 4 cells / well), ETV (30 nM) and Poly6 concentrations of 5 Incubation was made over days.
  • Cell-Titer 96 Aqueous One Solution was added directly to each well for MTS analysis and plates were incubated for 3 hours. Plates were read at 490 nm and each assay repeated three times.
  • supernatants of HepG2.2.15 cells containing 2% DMSO were collected every 3 days for 15 days, virion was precipitated for 1 hour on ice with 6% PEG8000 and 100,000 at 4 ° C.
  • HBV infection unlike acute infection, is known to cause serious liver disease such as cirrhosis and hepatocellular carcinoma. Therefore, it is important to develop drugs for anti-HBV to overcome chronic infections.
  • HBV genome is inserted into the host chromosome, complete removal of the virus from human liver and serum remains a difficult problem. Therefore, in the present experimental example, Poly6 was treated to HepG2.2.15 permanent cell line expressing HBV continuously in order to evaluate the antiviral effect by Poly6.
  • HepG2 cells were transiently transfected with pHBV-1.2X-WT.
  • HepG2 cells or HepG2-2.15 cells with pHBV-1.2X-WT were treated with PBS (0.5%), ETV (30 nM) or Poly6 (10 ⁇ M) for 24 or 48 hours and subjected to various assays using supernatants and pellets.
  • PBS 0.5%)
  • ETV 30 nM
  • Poly6 10 ⁇ M
  • HBsAg BIOKIT
  • HBeAg AccuDiag
  • 8-OHdG Assay Kit OxiSelect Oxidative DNA Damage ELISA kit, Cell Biolabs
  • ELISA ELISA
  • Type I interferon (IFN-I) is induced by host cells to regulate viral infection (Stetson & Medzhitov, 2006). Therefore, mRNA levels of IFN- ⁇ , RIG-I and ISG15 were examined to determine the effect of poly6 on IFN-I development in HepG2-2.15 cells and mouse liver.
  • HMH55-293-ISRE cells with interferon-sensitive response elements (ISRE) associated with the gene were used.
  • mice expressing HBV W4P mutations were generated in macrogens to build a transformed mouse model, and mice were randomly cross-cultured to keep germs free from macrogens. Experimental animals were stored in experimental animal centers free of specific pathogens.
  • PMSG 7.5 IU
  • hCG were injected intraperitoneally into C57BL / 6N female mice every 48 hours (5 IU) for 5-8 weeks for over ovulation. After injection, these female mice were crossed with C57BL / 6N male mice.
  • mice with virgin plugs were sacrificed, fertilized embryos were harvested, and HBV W4P complete genome was co-injected into one cell embryo using the standard micro-injection procedure (Macrogen) for the production of transgenic mice.
  • Microinjected embryos were directly injected with HBV DNA (4 ng / ⁇ l) for microinjection into the sperm nucleus using a microinjector and then cultured at 37 ° C. for 1-2 hours.
  • Fourteen to sixteen injected cell-stage embryos were surgically implanted into the fallopian tubes of pseudopregnant recipient mice (ICR). After F0 was born, genotyping was tested using tail cut samples for the presence of transgenes and genomic DNA PCR screening via phenol extraction was confirmed by PCR analysis.
  • HBV DNA and HBsAg levels were measured from mouse serum via orbital sinus blood collection at 4 and 8 weeks.
  • Poly6 affects the in vivo transgenic mouse model system in which HBsAg and HBV virion levels are reduced.
  • HBV polymerase activity in the nucleus and converting it into a phosphorylated form is shown by a combination of Poly6, which is found to increase entecavir and type I interferon (IFN-I), which is currently used as an HBV antiviral agent.
  • IFN-I type I interferon
  • HepG2-2.15 cells were incubated for 24 hours at 5 x 10 5 cells / well on 6-well culture plates and treated with PBS, ETV, Poly6 alone or in combination. After culturing the cells for 48 hours, the supernatant was collected and subjected to ELISA, qPCR, LDH assay.
  • mRNAs of the single treatment group and the combination treatment group were extracted and observed for IFN- ⁇ , IFN- ⁇ and TNF- ⁇ expression levels.
  • IFN levels were indirectly measured using the luciferase reporter gene of hMH55-293-ISRE cells, and consistent with the above results, statistically significant lucifer in ETV and Poly6 combination group compared to PBS and each substance alone group. An increase in the asease level was observed (FIG. 14B).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • AIDS & HIV (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Pyridine Compounds (AREA)
  • Pyrane Compounds (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)

Abstract

B형 간염 바이러스 유래 폴리펩티드 및 이의 용도에 관한 것으로, 일 양상에 따른 폴리펩티드는 제I형 인터페론의 발현을 증가시켜 항 HIV-1 및 항 HBV 뿐만 아니라 모든 바이러스에 대한 항 바이러스 효과를 나타낼 뿐만 아니라 기존의 항바이러스제와 병용 투여되어 상승적인 효과가 있어, 에이즈 또는 간질환 등 바이러스 관련 질환의 치료에 유용하게 사용할 수 있는 효과가 있다.

Description

B형 간염 바이러스 유래 폴리펩티드 및 이의 항바이러스 용도
B형 간염 바이러스 유래 폴리펩티드 및 이의 항바이러스 용도에 관한 것이다.
후천성면역결핍증(Acquired Immune Deficiency Syndrome: AIDS)을 유발하는 인간 면역 결핍 바이러스(human immunodeficiency virus: HIV)는 2015년 기준 3천 8만 명을 감염시키는 바 전세계적으로 관심이 필요한 감염원이다. HAART(Highly Active Antiretroviral Therapy)의 도입에도 불구하고, 완전한 치료가 어려운 실정이다.
전통적인 약제는 역전사효소(reverse transcriptase: RT), 단백질분해효소(protease)와 인테그라아제(integrase: IN) 등 바이러스 효소를 타겟으로 해왔다. 랄테그라비어(Raltegravir, ISENTRESS/MK-0518)는 viral load를 강하게 감소시켜 임상적 사용이 승인된 통합효소억제제(prototypical integrase strand transfer inhibitor: INSTI)이다. 하지만, 랄테그라비어에 대한 저항성이 임상뿐 아니라 최적화된 HAART 방법에서도 확인된 바 있다.
한편, B형 간염바이러스(Hepatitis B virus: HBV)는 전세계적으로 약 2억 4천만명에서 3억 5천만 명이 감염되어 있다 이는 무증상 감염, 만성 간염, 간경변, 간세포암으로 이행하는 다양한 임상경과를 보인다. 전체 간세포암 발생 원인의 53%를 차지하고 있는 HBV는 특히 아시아 에서 높은 감염을 보인다. 아시아 대부분의 국가에서 보균자의 비율이 5~35%에 이른다. HBV 감염으로 인한 임상 증상과 관련 있는 것으로 숙주 인자, 바이러스 인자 및 환경 인자 등이 있다.
현재 사용되는 만성 간염 치료제로는 면역조절제(immunomodulators)인 인터페론과 뉴클레오시드 유사체(nucleoside analogue)인 라미부딘 등이 있다. 이들 중 지난 십여년간 효과가 인정되었던 인터페론-α는 가격이 비싸며 부작용이 있고, 출생 직후 감염이 문제가 되는 아시아 지역 환자에게는 그 효과가 떨어지는 단점을 지닌다. 또 다른 치료제인 nucleoside analogue의 경우, 경구 투여할 수 있는 장점을 지니지만, DNA polymerase에 작용하여 바이러스 증식을 억제하기 때문에 비증식형 바이러스에는 직접 작용할 수 없어 체내에서 HBV를 완전히 제거하기 어렵고, 내성 발생 등의 문제점이 알려져 있다.
이러한 기술적 배경 하에서, 항-HIV-1 및 항-HBV 효과를 통해 에이즈 또는 간질환 등을 완화시킬 수 있는 새로운 치료제의 발굴이 필요한 실정이다.
일 양상은 서열번호 1, 서열번호 2 및 서열번호 3으로 이루어진 군에서 선택되는 어느 하나의 아미노산 서열로 이루어진 폴리펩티드를 제공하는 것이다.
다른 양상은 상기 폴리펩티드를 포함하는 항 바이러스용 약학적 조성물을 제공하는 것이다.
또 다른 양상은 상기 폴리펩티드를 포함하는 후천성면역결핍증(Acquired Immune Deficiency Syndrome: AIDS) 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또 다른 양상은 상기 폴리펩티드를 포함하는 간질환 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또 다른 양상은 상기 폴리펩티드를 폴리펩티드를 포함하는 항 바이러스용 건강기능식품을 제공하는 것이다.
또 다른 양상은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 바이러스 감염증 및 이와 연관된 증상을 예방 또는 치료하는 방법을 제공하는 것이다.
일 양상은 서열번호 1, 서열번호 2 및 서열번호 3으로 이루어진 군에서 선택되는 어느 하나의 아미노산 서열로 이루어진 폴리펩티드를 제공한다.
상기 용어 "폴리펩티드(Polypeptide)”는 아마이드 결합 (또는 펩티드 결합)으로 연결된 2개 이상의 아미노산으로 이루어진 폴리머를 의미한다. 상기 폴리펩티드는 서열번호 1, 서열번호 2 및 서열번호 3으로 이루어진 군에서 선택되는 어느 하나의 아미노산 서열로 이루어질 수 있고, 구체적으로 서열번호 2의 아미노산 서열로 이루어질 수 있다. 상기 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열과 각각 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 폴리펩티드를 포함할 수 있다.
또한, 보다 나은 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 상기 폴리펩티드의 N- 또는 C-말단에 보호기가 결합되어 있을 수 있다. 상기 보호기는 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 또는 폴리에틸렌글리콜(PEG)일 수 있으나, 폴리펩티드의 개질, 특히 폴리펩티드의 안정성 증진시킬 수 있는 성분이라면, 제한없이 포함할 수 있다.
상기 용어 "안정성"은 생체 내 단백질 절단효소의 공격으로부터 본 발명의 폴리펩티드를 보호하는 인 비보(in vivo) 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미하는 것일 수 있다.
아울러, 상기 폴리펩티드는 표적화 서열, 태그 (tag), 표지된 잔기를 위한 특정 목적으로 제조된 아미노산 서열도 추가적으로 포함할 수 있다.
상기 용어 "상동성(Homology)"은 야생형 아미노산 서열과의 유사한 정도를 나타내기 위한 것으로서, 이러한 상동성의 비교는 당업계에서 널리 알려진 비교 프로그램을 이용하여 수행할 수 있으며, 2개 이상의 서열간 상동성을 백분율(%)로 계산할 수 있다.
상기 폴리펩티드는 천연으로부터 유래될 수도 있고, 당해 분야에서 널리 공지된 다양한 폴리펩티드 합성 방법으로 획득할 수 있다. 일례로서, 폴리뉴클레오티드 재조합과 단백질 발현 시스템을 이용하여 제조하거나 펩티드 합성과 같은 화학적 합성을 통하여 시험관 내에서 합성하는 방법 및 무세포 단백질 합성법 등으로 제조될 수 있다. 또한, 일례로서, 상기 폴리펩티드는 펩티드, 식물 유래 조직이나 세포의 추출물, 미생물(예를 들어 세균류 또는 진균류, 그리고 특히 효모)의 배양으로 얻어진 생산물일 수 있고, 구체적으로는 B형 간염 바이러스(Hepatitis B virus, HBV) 중합효소로부터 유래되는 것일 수 있고, 보다 구체적으로 HBV 중합효소의 preS1 영역에서 유래되는 것일 수 있다.
상기 폴리펩티드는 항 바이러스 활성을 가질 수 있다. 예를 들어, 상기 바이러스는 아데노 바이러스, 천연두 바이러스, 소아마비 바이러스, 홍역 바이러스, 중증 열성 혈소판 감소 증후군 (Severe Fever with Thrombocytopenia Syndrome) 바이러스, 인플루엔자 바이러스, C형 간염 바이러스 (Hepatitis C virus), 인간면역결핍 바이러스-1 (Human Immunodeficiency Virus-1: HIV-1) 및 B형 간염 바이러스(Hepatitis B virus: HBV)으로 이루어진 군에서 선택되는 적어도 하나일 수 있고, 구체적으로 인간면역결핍 바이러스-1 (Human Immunodeficiency Virus-1: HIV-1) 및 B형 간염 바이러스(Hepatitis B virus: HBV)로 이루어진 군에서 선택되는 적어도 하나일 수 있다.
다른 양상은 상기 폴리펩티드를 포함하는 항 바이러스용 약학적 조성물을 제공한다.
상기 약학적 조성물에 있어서, 상기 “폴리펩티드” 등에 대해서는 상기한 기재된 바와 같다.
또한, 상기 조성물은 항 바이러스제를 더 포함할 수 있다.
상기 항 바이러스제는 예를 들어, 아시클로버, 팜시클로버, 발라시클로버, 간시클로버, 암프레나버, 아바카버, 안사마이신, 시도포버, 다루나버, 델라비리딘, 에파비렌즈, 에트라비린, 팜시클로버, 하이페리신, 인디나버, 라미부딘, 로부카버, 넬피나버, 네비라핀, 노바프렌, 리토나버, 사퀴나버, 스타부딘, 티프라나버, 비라졸, 리바비린, 잘시타빈, 지도부딘, 마라비록, 랄테그라버, 엘비테그라버, 디다노신, 테노포버, 엠트리시타빈, 로피나버, 아타자나버, 엔푸버티드, 클레부딘, 엔테카비르, 아데포버, 오셀타미버, 자나미버, 페라미버, 아만타딘 및 텔비부딘으로 이루어진 군에서 선택되는 적어도 하나일 수 있고, 구체적으로, 클레부딘, 엔테카비르 및 아데포버로 이루어진 군에서 선택되는 적어도 하나일 수 있고, 보다 구체적으로 엔테카비르일 수 있다.
상기 조성물이 상기 항 바이러스제를 더 포함함으로써, 항 바이러스 효과가 현저하게 증가하여 시너지 효과를 나타낼 수 있다. 예를 들어, 상기 항 바이러스제가 엔테카비르인 경우, 항 HBV 효과 및 제 I형 인터페론의 발현에 대한 효과가 시너지 효과로 현저하게 증가할 수 있다.
또한, 상기 바이러스는 아데노 바이러스, 천연두 바이러스, 소아마비 바이러스, 홍역 바이러스, 중증 열성 혈소판 감소 증후군 (Severe Fever with Thrombocytopenia Syndrome) 바이러스, 인플루엔자 바이러스, C형 간염 바이러스 (Hepatitis C virus), 인간면역결핍 바이러스-1 (Human Immunodeficiency Virus-1: HIV-1) 및 B형 간염 바이러스(Hepatitis B virus: HBV)등으로 이루어진 군에서 선택되는 적어도 하나일 수 있고, 구체적으로 인간면역결핍 바이러스-1 (Human Immunodeficiency Virus-1: HIV-1) 및 B형 간염 바이러스(Hepatitis B virus: HBV)로 이루어진 군에서 선택되는 적어도 하나일 수 있다.
상기 폴리펩티드는 바이러스의 증식을 억제하는 것일 수 있다. 구체적으로, 상기 폴리펩티드는 HIV-1 삽입효소의 아세틸화를 저해하여 상기 효소의 활성을 억제하여 HIV-1의 증식을 억제할 수 있다. 또한, 상기 폴리펩티드는 세포 내 미토콘드리아의 활성 산소를 증가시키며, 제I형 인터페론에 포함되는 IFN-α및 IFN-β의 발현을 증가시킬 수 있고, 이를 통해 HBV의 HBcAg 또는 뉴클레오캡시드(Nucleocapsid)의 합성을 억제함으로써 HBV의 증식을 억제할 수 있다.
특정 이론에 제한됨이 없이, IFN의 항 바이러스 작용의 역할을 하는 IFN 유도 단백질은 RNA 의존성 단백질 키나아제 (PKR), 2', 5'- 올리고 아데닐산 합성효소 (OAS) 및 RNase L 및 Mx 단백질 GTPase이다. 이중 가닥 RNA는 각각 IFN-유도성 PKR 키나아제 및 2'-5'- 올리고 아데닐산염 의존성 RNase L에 의해 촉매된 단백질 인산화 및 RNA 분해를 조정하고 또한 IFN-유도성 RNA 특이적 아데노신 디아미나아제 (ADAR1)에 의한 RNA 편집의 역할을 한다. IFN은 또한 유도성 산화 질소 합성 효소(iNOS2) 및 주요 조직 적합성 복합체(MHC) I 및 II 단백질을 유도하며, 이들 모두는 감염에 대한 면역 반응의 역할을 한다(Clin Microbiol Rev. 2001 Oct; 14(4): 778-809 참조). 상기 문헌은 그 전체가 참조로서 본 명세서에 포함된다.
따라서, 일 구체예에 따른 폴리펩티드는 IFN의 발현을 증가시켜 모든 바이러스에 대한 항-바이러스 활성을 가질 수 있다.
상기 용어 "예방"은 일 양상에 따른 약학적 조성물의 투여에 의해 개체의 바이러스로 인한 질병을 억제시키거나 발병을 지연시키는 모든 행위를 의미할 수 있다.
상기 용어 "치료"는 일 양상에 따른 약학적 조성물의 투여에 의해 개체의 바이러스로 인한 질병에 대한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미할 수 있다.
일 양상에 따르면, 상기 폴리펩티드는 HIV-1의 삽입효소의 아세틸화를 억제함으로써 HIV-1의 증식을 억제한다. HIV-1의 증식이 억제 됨에 따라 에이즈 치료 효과를 나타낼 수 있다.
또한, 일 양상에 따르면, 상기 폴리펩티드는 미토콘드리아 스트레스를 증가시켜 세포 내 활성 산소를 증가시키고 I형 인터페론(Type I interferon)의 발현을 증가시키고, 뉴클레오캡시드의 합성을 억제함으로써 HBV의 증식이 억제되며 간 질환 치료 효과를 나타낼 수 있다.
상기 약학적 조성물은 유효성분을 단독으로 포함하거나, 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 포함하여 약학적 조성물로 제공될 수 있다.
구체적으로, 상기 담체는 예를 들어, 콜로이드 현탁액, 분말, 식염수, 지질, 리포좀, 미소구체(microspheres) 또는 나노 구형입자일 수 있다. 이들은 운반 수단과 복합체를 형성하거나 관련될 수 있고, 지질, 리포좀, 미세입자, 금, 나노입자, 폴리머, 축합 반응제, 다당류, 폴리아미노산, 덴드리머, 사포닌, 흡착 증진 물질 또는 지방산과 같은 당업계에 공지된 운반 시스템을 사용하여 생체 내 운반될 수 있다.
상기 약학적 조성물은 약학적으로 허용되는 담체, 즉, 제제화될 경우, 통상적으로 이용되는 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아, 고무, 인산칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세 결정성 셀룰로스, 폴리비닐 피로리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필 히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함할 수 있다.
또한, 상기 약학적 조성물이 제제화될 경우에는 통상적으로 사용하는 윤활제, 감미제, 향미제, 유화제, 현탁제, 보존제, 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함될 수 있고, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calciumcarbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며, 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함될 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜 (propyleneglycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔 (witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로 제라틴 등이 사용될 수 있고, 점안제 형태로 제조 시 공지의 희석제 또는 부형제 등이 사용될 수 있다.
상기 용어 "약학적으로 허용되는"이란 상기 조성물에 노출되는 세포나 인간에게 독성이 없는 특성을 나타내는 것을 의미한다.
또한, 상기 약학적 조성물은 종래에 알려져 있는 항 바이러스용 조성물과 혼합하여 제공될 수도 있다. 즉, 본 상기 약학적 조성물은 백내장 항 바이러스 효과를 가지는 공지의 조성물과 병행하여 투여할 수 있다.
상기 용어 "투여"란 적절한 방법으로 개체에게 소정의 물질을 도입하는 것을 의미한다.
상기 용어 "개체"는 바이러스로 인한 질병의 치료를 필요로 하는 대상을 의미하며, 보다 구체적으로 인간 또는 비-인간인 영장류, 생쥐 (mouse), 개, 고양이, 말 및 소 등의 포유류를 의미할 수 있다.
상기 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구투여(예를 들어, 근육 내, 정맥 내, 복강 내, 피하, 피내, 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
상기 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 상기 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 구체적으로, 상기 약학적 조성물은 0.01 내지 1000 mg/kg/day로, 보다 구체적으로 0.1 내지 500 ㎎/kg/day로 투여될 수 있다. 상기 투여는 하루에 한 번 투여되는 것일 수도 있고, 수 회 나누어 투여되는 것일 수도 있다.
일 양상에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 항염증제와 병용하여 투여될 수 있고 종래의 항염증제와는 동시에, 별도로, 또는 순차적으로 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로, 상기 약학적 조성물의 유효량은 환자의 연령, 성별, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성율, 배설 속도, 질병 종류, 병용되는 약물에 따라 달라질 수 있으며, 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라 증감될 수 있다.
또 다른 양상은 상기 폴리펩티드를 포함하는 후천성면역결핍증(Acquired Immune Deficiency Syndrome: AIDS) 예방 또는 치료용 약학적 조성물을 제공한다.
상기 후천성면역결핍증(Acquired Immune Deficiency Syndrome: AIDS)은 HIV-1 감염으로부터 발병되는 것일 수 있다.
또 다른 양상은 상기 폴리펩티드를 포함하는 간질환 예방 또는 치료용 약학적 조성물을 제공한다.
상기 간질환은 HBV 감염으로부터 발병되는 것일 수 있고, 구체적으로, 간염, 간경변증 및 간암으로 이루어진 군으로부터 선택되는 적어도 하나일 수 있고, 보다 구체적으로는 B형 간염으로부터 발전되는 것일 수 있다.
또 다른 양상은 상기 폴리펩티드를 포함하는 항 바이러스용 건강기능식품을 제공한다.
상기 건강기능식품에 있어서, 상기 “폴리펩티드”, “에이즈” 및 “간질환”, "바이러스" 등에 대해서는 상기한 기재된 바와 같다.
상기 용어 "개선"이란 치료되는 상태와 관련된 파라미터, 예를 들어, 증상의 정도를 적어도 감소시키는 모든 행위를 의미할 수 있다. 이때, 상기 건강기능식품은 에이즈 또는 간질환의 예방 또는 개선을 위하여 해당 질환의 발병 단계 이전 또는 발병 후, 치료를 위한 약제와 동시에 또는 별개로서 사용될 수 있다.
상기 건강기능식품에서, 유효성분은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합량은 그의 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 상기 건강기능식품은 원료에 대하여 구체적으로 약 15 중량% 이하, 보다 구체적으로 약 10 중량% 이하의 양으로 첨가될 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있다.
상기 건강기능식품은 담체, 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제, 부형제 또는 첨가제 중 하나 이상을 더 포함하여 정제, 환제, 산제, 과립제, 분말제, 캡슐제 및 액제 제형으로 이루어진 군에서 선택된 하나로 제형될 수 있다. 상기 첨가될 수 있는 식품으로는, 각종 식품류, 분말, 과립, 정제, 캡슐, 시럽제, 음료, 껌, 차, 비타민 복합제, 건강기능성 식품류 등이 있다.
상기 담체, 부형제, 희석제 및 첨가제의 구체적인 예로는 락토즈, 덱스트로즈, 슈크로즈, 솔비톨, 만니톨, 에리스리톨, 전분, 아카시아 고무, 인산칼슘, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 미세결정성 셀룰로즈, 폴리비닐피롤리돈, 셀룰로즈, 폴리비닐피롤리돈, 메틸셀룰로즈, 물, 설탕시럽, 메틸셀룰로즈, 메틸 하이드록시 벤조에이트, 프로필하이드록시 벤조에이트, 활석, 스테아트산 마그네슘 및 미네랄 오일로 이루어진 군으로부터 선택되는 적어도 하나일 수 있다.
상기 건강기능식품은 상기 유효성분을 함유하는 것 외에 특별한 제한없이 다른 성분들을 필수 성분으로서 함유할 수 있다. 예를 들어, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당 알코올일 수 있다. 상술한 것 이외의 향미제로서 천연 향미제 (타우마틴, 스테비아 추출물 (예를 들어, 레바우디오시드 A, 글리시르히진 등)) 및 합성 향미제 (사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 당업자의 선택에 의해 적절하게 결정될 수 있다.
상기 외에도, 일 양상에 따른 건강기능식품은 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제 (치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있으며, 이러한 첨가제의 비율 또한 당업자에 의해 적절히 선택될 수 있다.
또 다른 양상은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 바이러스 감염증 및 이와 연관된 증상을 예방 또는 치료하는 방법을 제공한다.
상기 "폴리펩티드", "개체", "투여", "약학적 조성물", "바이러스" 등은 전술한 바와 같다.
일 양상에 따른 폴리펩티드는 제I형 인터페론의 발현을 증가시켜 항 HIV-1 및 항 HBV 뿐만 아니라 모든 바이러스에 대한 항 바이러스 효과를 나타낼 뿐만 아니라 기존의 항바이러스제와 병용 투여되어 상승적인 효과가 있어, 에이즈 또는 간질환 등 바이러스 관련 질환의 치료에 유용하게 사용할 수 있는 효과가 있다.
도 1의 A)는 일 양상에 따른 B형 간염 바이러스 유래 폴리펩티드(Poly 5, Poly6 및 Poly7)의 위치에 관한 모식도이고, B)는 항 HIV-1 효과 분석 결과를 나타낸 도이다.
도 2의 A)는 일 양상에 따른 폴리펩티드의 세포 독성 평가이고, B)는 일 양상에 따른 폴리펩티드에 의한 항 HIV-1 활성 평가이고, C)는 일 양상에 따른 폴리펩티드에 의한 HIV-1 GFP 발현 억제 평가이고, D) 및 E)는 AZT 및 일 양상에 따른 폴리펩티드의 세포 변성 억제 효과 평가를 나타낸 도이다.
도 3의 A)는 일 양상에 따른 폴리펩티드 및 다른 항 HIV-1 제제에 의한 HIV-1 GFP 발현 억제 평가이고, B)는 일 양상에 따른 폴리펩티드 및 다른 항 HIV-1 제제에 의한 p24 발현 억제 평가이고, C)는 일 양상에 따른 폴리펩티드 및 다른 항 HIV-1 제제에 의한 HIV-1 수준 억제 평가를 나타낸 도이다.
도 4a 및 4b는 일 양상에 따른 폴리펩티드 및 다른 항 HIV-1 제제에 의한 시간 별 HIV-1 level 억제 평가를 나타낸 도이다.
도 5의 A)는 일 양상에 따른 폴리펩티드 및 다른 항 HIV-1 제제에 의한 2-LTR 링 및 삽입된 cDNA 양에 대한 비교 데이터이고, B)는 일 양상에 따른 폴리펩티드 및 다른 항 HIV-1 제제에 의한 p300 발현 비교 데이터이고, C)는 일 양상에 따른 폴리펩티드 및 다른 항 HIV-1 제제에 의한 삽입효소의 아세틸화 여부 비교 데이터를 나타낸 도이다.
도 6a 및 6b는 폴리펩티드 후보 Poly5, Poly6, Poly7 및 각 물질의 항 바이러스 효과 비교와 후보 처리에 의한 세포 생존력 분석을 나타낸 도로서, 6a는 일 양상에 따른 B형 간염 바이러스 유래 폴리펩티드(Poly6) 및 후보 폴리펩티드(Poly5, Poly7)의 s/e 항원 감소 효과 비교한 도이고, 6b는 일 양상에 따른 폴리펩티드에 의한 세포 생존력 분석 결과를 나타낸 도이다.
도 7은 만성 감염 단계에서 일 양상에 따른 폴리펩티드에 의한 HBV 복제의 억제 및 HBV 감수성 세포에서 일 양상에 따른 폴리펩티드에 의한 Anti-HBV 효과 평가를 나타낸 도로서, A)는 HBsAg의 수준이고, B)는 HBeAg의 수준이고, C)는 바이러스 역가이고, D)는 서던 블롯 결과이고, E)는 일 양상에 따른 폴리펩티드의 투여량과 HBV 복제의 관계(IC50)를 나타낸 도이다.
도 8의 F)는 PBS, ETV 및 일 양상에 따른 폴리펩티드의 처리 후, 코어 단백질 및 캡시드 형성을 확인한 결과이고, G)는 HepG2-hNTCP-C4에서 각 물질과 함께 HBV 비리온을 용량에 따라 감염시킨 후, HBsAg를 측정한 결과이며, H)는 감염 모델에서 일 양상에 따른 폴리펩티드의 용량에 따른 항 HBV 효과를 확인하기 위해 바이러스 DNA를 측정한 결과를 나타낸 도이다.
도 9a 및 9b는 마우스 모델에 대한 일 양상에 따른 폴리펩티드에 의한 HBV 억제 효과를 나타낸 도로서, 9a는 PBS, Lamivudine (3TC) 및 일 양상에 따른 폴리펩티드 처리에 따른 HBsAg 수준이고, 9b는 PBS, Lamivudine (3TC) 및 일 양상에 따른 폴리펩티드 처리에 따른 HBV DNA의 수준을 나타낸 도이다.
도 10은 일 양상에 따른 폴리펩티드에 의한 미토콘드리아의 산화 스트레스 생성 평가를 나타낸 도로서, A)는 각 물질 처리에 따른 시간별 미토콘드리아 활성 산소(mtROS) 수준(Rotenone은 미토콘드리아 산화 스트레스에 대한 양성 대조군)을 나타내며, B)는 일 양상에 따른 폴리펩티드에 의한 농도별 미토콘드리아 활성 산소 수준을 나타내고, C)는 일 양상에 따른 폴리펩티드의 처리 및 산화 스트레스 저해제(MitoTempo) 처리에 따른 미토콘드리아 활성 산소 수준을 나타낸 도이다.
도 11a 및 11b는 일 양상에 따른 폴리펩티드에 의한 I형 인터페론 (Type 1 IFN)의 증가 양상을 확인한 도로서, 11a는 상기 폴리펩티드 처리에 따른 IFN-β, RIG-I 및 ISG15의 mRNA 수준이고, 11b의 B)는 hMH55-293-ISRE세포에 각 물질 처리를 한 세포 상청액을 처리 후 루시퍼라아제(luciferase)의 발현 수준을 나타내며, 11b의 C)는 마우스 모델에서 각 물질 처리에 따른 IFN-β mRNA 발현 수준을 평가한 도이다.
도 12는 중화 I 형 인터페론 수용체를 통한 poly6의 항 HBV 효과의 차단을 나타낸 도로서, A)는 일 양상의 처리로 감소되었던 e항원 및 세포 외 HBV DNA 수준이 중화 항체 처리에 따라 회복됨을 나타내고, B)는 일 양상의 처리로 증가하였던 I형 인터페론 mRNA 수준이 감소되는 것을 나타낸 도이다.
도 13은 일 양상에 따른 폴리펩티드와 엔테카비르(ETV)의 병용 처리에 의한 항바이러스 약제 상승 효과(synergistic antiviral effects)를 나타낸 도로서, A)는 병용 처리에 따른 세포 외 HBV DNA 감소 폭 상승 효과이며, B)는 병용 처리에 따른 세포 독성 테스트이고, C)는 병용 처리에 따른 s 및 e 항원 감소 수준을 나타낸 도이다.
도 14는 엔테카비르(ETV)와 일 양상에 따른 폴리펩티드의 병용 처리에 따른 I 인터페론의 증가 양상의 상승효과를 확인한 도로서, A)는 병용 처리에 따른 IFN-α, IFN-β 및 TNF-α의 mRNA 수준이며, B)는 hMH55-293-ISRE세포에 병용 처리를 한 세포 상청액을 처리 후 루시퍼라아제의 발현 수준을 나타낸 도이다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예
실시예 1. 항 HIV-1 효능의 확인
참조예. 통계 분석
대조군과 시험군 간의 통계적 비교는 일원 분산 분석(one-way ANOVA)을 사용하여 분석하였다. 통계적 유의성 p 값은 다음과 같이 설정되었다. p<0.05 (*), 0.01 (**) 또는 0.001 (***). 모든 실험은 독립적으로 3회 반복하였다.
실험예 1. 항 HIV-1 효과를 나타내는 HBV 중합효소 유래 펩티드의 확인
본 실험예에서는 HBV 중합효소 유래 펩티드가 항 HIV-1 효과를 갖는 지를 확인하고자 하였다. 구체적으로, 유전자형 C2 감염을 가진 만성 환자의 B형 간염 바이러스에서 preS1 시작 부위의 15, 18 및 21개의 뉴클레오타이드 결실이 바이러스의 증식을 조절하여 질병의 진행에 기여할 수 있어, 본 실험예에서 각각 15, 18 및 21개의 뉴클레오타이드 결실된 서열에 상응하는 중합효소 지역으로부터 3가지 종류의 펩티드 후보 물질을 선별하였다. 그리고, 이들 펩티드를 Poly5 (GRLVF, 서열번호 1), Poly6 (GRLVFQ, 서열번호 2) 또는 Poly7 (GRLVFQT, 서열번호 3)으로 명명하였고(도 1A)), 각 펩티드들은 Fmoc (9-fluorenylmethoxycarbonyl) 기반의 고체상 방법으로 Peptron Inc.에서 합성되었으며, 실시예에서 사용된 모든 펩티드들의 순도는 고성능 액체 크로마토그래피에 의해 측정된 바와 같이 95% 이상이었다. 상기 3개의 폴리펩티드들의 항 HIV-1 효과를 평가하기 위해 세포 기반 항 바이러스 효과를 분석하였다. MT-4 세포 (4×105 세포수)에 HIV-1 (4×105 CCID50)을 1시간 동안 감염시켰다. 상기 MT-4 세포는 NIH / AIDS Research and Reference Reagent Program에서 제공받았다. HIV-1은 293FT 세포에 단일 bicistronic RNA로부터 Nef와 강화된 녹색 형광 단백질 (eGFP)를 공발현하는 pBR_HIV-1_M_NL4-3_IRES_eGFP 벡터(DS441)를 Lipofectamine 2000 시약 (Life Technologies)을 사용하여 48시간 동안 형질감염시킨 후, 바이러스 전구체인 HIV-1을 함유하는 상청액을 수거하고 바이러스 역가를 p24 ELISA (ABI)로 측정하였다. 감염성 HIV-1을 증폭하기 위해, MT-4 세포에 바이러스 전구체인 HIV-1을 다수 감염 농도(MOI)인 0.5의 농도로 72시간 동안 감염시켰다. 이후 수집한 상청액을 원심 분리 및 여과한 후, 감염성 바이러스의 역가를 측정하기 위해 p24 ELISA를 사용하였고, 사용하기 직전까지 -70℃에서 보관하였다.
세포를 PBS로 세척 후, 감염된 세포에 DMSO(Dimethyl Sulfoxide), 아지도티미딘(Azidothymidine: AZT; 3-Azido-3-deoxythymidine) 및 Poly5 내지 Poly7을 처리하였다. 이 때, DMSO(Dimethyl Sulfoxide)와 Azidothymidine(3-Azido-3-deoxythymidine, AZT)은 Sigma-Aldrich에서 구입하였다. 2일 동안 배양한 후, 형광 현미경을 사용하여 GFP 이미지를 확인하였다. 상대적인 GFP 세기는 ImageJ 소프트웨어 프로그램 (National Institutes of Health)을 사용하여 면적당 픽셀 단위로 결정하였다. 상청액과 세포를 걷어 RNA를 추출한 후 RT-qPCR을 실시하여 바이러스 역가를 결정하였고, 상청액에 생성된 바이러스를 측정하기 위해서 p24 ELISA를 사용하였다. 처리한 시약에 대한 세포의 생존력은 MTT 분석을 이용하여 진행하였다.
Poly5 내지 Poly7의 항 바이러스 효과에서 HSP90(Cell Signaling)의 역할을 확인하기 위해 MT-4 세포를 HIV-1에 1시간 동안 감염시킨 다음 1시간 동안 HSP90 항체(1 ㎍/ml) 또는 17-AAG(Calbiochem, 1 μM)를 처리하여 HSP90의 활성을 차단하고, DMSO, AZT 또는 Poly6을 접종한 세포를 48시간 동안 접종하였다. HIV-LTR 의존적인 GFP 합성은 GFP 항체(Santa Cruz Biotechnology)를 사용하여 웨스턴 블롯 분석으로 확인하였다.
DMSO(0.5%), AZT (5 nM) 또는 3가지 후보 물질 10 μM을 HIV-1가 감염된 MT-4 세포에서 처리하고, 2일 후에 GFP 영상 및 p24 ELISA를 실시하여 HIV-1의 역가를 확인한 결과, 바이러스의 생산은 Poly5와 Poly7에 의해 감소되었고, 특히 Poly6에 의해 상당히 감소되었음을 확인할 수 있었다(도 1B)).
실험예 2. 세포 독성 분석
본 실험예에서는 Poly6의 효과를 조사하기 전에 비특이적으로 세포 독성으로 인해 Poly6가 HIV-1 증식에 영향을 끼칠 가능성을 배제하기 위하여 세포에 대한 Poly6의 독성 효과를 측정하였다. 구체적으로, MT-4 세포를 1×104 세포수가 되도록 하고 Poly6를 농도 별로 처리하여 5일 동안 배양하고, MTT 분석 키트 (Promega)를 사용하여 세포 독성 여부를 측정하였다. HIV-1 감염에 의해 세포 독성으로 인해 세포 사멸이 발생하는 경우에 Poly6에 의한 항 세포 독성 효과를 분석하기 위해 MT-4 세포 (1×104 세포수)에 HIV-1 (1×104 CCID50)를 감염시키고 5일 동안 배양 후 세포 생존 능력을 분석하였다. 이와 함께 상청액에서 HIV-1 역가를 평가하기 위해 p24 ELISA를 수행하였다. 그 결과, Poly6는 5일 동안 25 μM 농도까지 MT-4 세포에 유의한 세포 독성을 일으키지 않았다(도 2A)). 293FT 세포로부터 HIV-1을 생성하기 위하여 pBR_HIV-1_M_NL4-3_IRES_eGFP 벡터를 형질감염시켰고, MT-4 세포에서 Poly6에 의한 항 HIV-1 활성을 p24 ELISA로 평가하였다. HIV-1 증식은 Poly6에 의해 농도에 따라서 저해되었고, 평균 50% 억제 농도(IC50)는 약 0.2664 μM이었다(도 2B)). 또한, HIV-1 LTR의 활성에 따른 GFP 발현 역시 Poly6에 의해 농도에 따라 점차적으로 감소되었다(도 2C)). HIV-1이 감염된 MT-4 세포는 바이러스 증식으로 인해 세포 자멸 신호 전달 경로가 활성화되어 세포가 파괴된다. 따라서 AZT 처리 후, MT-4 세포는 AZT에 의한 항 바이러스 효과 때문에 궁극적으로 세포 보호 효과를 나타냈음을 알 수 있었다. AZT와 마찬가지로 HIV-1에 감염된 MT-4 세포에 대한 Poly6의 세포 변성 억제 효과를 분석한 결과, 도 2에서와 같이 AZT(도 2D)) 및 Poly6(도 2E))에서 농도에 따라서 유의한 세포 보호 효과를 확인하였다. 5 μM 농도의 Poly6은 HIV-1에 의해 유도되는 세포 사멸로부터 세포를 약 100% 건강하게 유지하는데 충분하였다. Poly6의 항 HIV-1 효과에 의한 세포 보호 능력의 증가에 따라서 세포의 상청액에서의 바이러스 p24의 양은 상대적으로 HIV-1의 억제로 인해 감소되었다(도 2E). 즉 이러한 실험 결과를 종합해보면, 본 실험예에서는 Poly6가 HIV-1의 증식을 억제하고, 세포 변성을 억제함으로써 MT-4 세포의 생존 능력을 보호하는 중추적인 역할을 하고 있음을 알 수 있었다.
실험예 3. 사람 말초 혈액 단핵 세포 (PBMC)에서의 HIV-1 증식 억제 효과의 확인
본 실험예에서는 Ex-vivo에서 Poly6의 항 HIV-1 효과를 확인하기 위해 수행되었다. 구체적으로, 인간 말초 혈액 단핵 세포 (PBMCs)에 HIV-1을 감염시켰다. Biocoll (BIOCHROME)을 사용하여 인간 말초 혈액 단핵 세포(PBMC)를 분리하고, 10% FBS와 1 ㎍/ml 피토헤마글루티닌(phytohemagglutinin: PHA; Sigma-Aldrich), IL-2 (100 U/ml; PEPROTECH)가 첨가된 RPMI1640 배지에서 3일간 배양하였다. PHA-자극 PBMC 세포를 0.1의 다수 감염 농도(multiplicity of infection; MOI)로 HIV-1에 감염시키고 시약을 처리한 후 5일 동안 배양하였다. PBMCs에서 바이러스의 역가를 결정하기 위해, 세포에서 바이러스 RNA를 분리하고 기술된 바와 같이 RT-qPCR에 의해 분석하였다. GFP 발현은 형광 현미경으로 관찰하였고, GFP 항체를 사용하여 웨스턴 블랏 분석을 실시하였다.
이 때, HIV-1 바이러스의 역가를 평가하기 위해 p24 ELISA (p24 ELISA, ABL, Rockville, MD)를 제조사의 프로토콜에 따라 수행하였다. 세포를 배양한 상청액과 세포의 HIV-1 RNA를 QIAamp UltraSens Virus kit (QIAGEN)를 사용하여 정제하였고, HIV-1의 Gag 지역에 특이적인 프라이머를 사용하여 RTqPCR로 정량하였다. 글리세린 알데히드 포스페이트 탈수소 효소(GAPDH)는 표준화를 위한 기준 유전자로 사용되었다. GagF, GCAGCCATGCAAATGTTAAAAGAG (정방향, 서열번호 4) 및 GagR, TCCCCTTGGTTCTCTCATCTGG (역방향, 서열번호 5) 및 GAPDH-F, AATCCCATCACCATCTTCCA (정방향, 서열번호 6) 및 GAPDH-R, TGGACTCCACGACGTACTCA (역방향, 서열번호 7)와 같은 프라이머 세트를 RTqPCR에 사용하였다. HIV-1 Genesig 표준 키트 (Primer design)를 사용하여 바이러스 역가를 표준화하였다.
PBMC 세포를 HIV-1에 감염시킨 후 5일 동안 DMSO(0.5%), AZT(5 nM), 랄테그라비어(Raltegravir, 10 nM) 또는 Poly6(10 μM)와 함께 배양한 다음, DMSO와 비교해 볼 때 AZT 또는 랄테그라비어 에서 볼 수 있는 비슷한 수준에서 PBMC 세포 내에서 GFP 및 p24 단백질의 발현이 Poly6에 의해 유의하게 감소한다는 것을 발견하였다(도 3A) 및 3B)). 또한 PBMC 세포에서의 HIV-1 증식이 DMSO와 비교하여 Poly6에 의해 AZT 또는 랄테그라비어에서 보이는 비슷한 수준으로 유의하게 감소함을 확인하였다(도 3C)). 이러한 결과는 Poly6가 MT-4 세포뿐만 아니라 인간 PBMC에서도 HIV-1 증식을 억제할 수 있음을 나타낸다.
실험예 4. HIV-1 삽입 억제 효과의 확인
본 실험예에서는 HIV-1 DNA의 숙주 유전체 내 삽입을 분석하기 위해 두 개의 긴 말단 반복 서열(2-LTR)과 Alu PCR이 수행되었다. 구체적으로, 2-LTR PCR은 세포질에서 삽입되지 못하고 남아서 발생하는 원형 바이러스 DNA를 검출하는데 사용되었고, Alu PCR은 삽입된 바이러스 DNA의 증폭을 위해 수행되었다. 48시간 동안 시약을 처리한 후, QIAamp MinElute Virus Spin Kit (QIAGEN)를 사용하여 HIV-1에 감염된 MT-4 세포에서 바이러스 DNA를 추출하였다. 2-LTR PCR 분석을 위한 프라이머 및 탐침은 2-LTR F (MH535), AACTAGGGAACCCACTGCTTAAG (정방향, 서열번호 8), 2-LTR R (MH536), TTCACAGATCAAGGATATCTTGTC (역방향, 서열번호 9) 및 2-LTR 탐침으로 FAM-ACACTACTTGAAGCACTCAA-TAMRA (서열번호 10)이 사용되었고, Alu-1F, TCCCAGCTACTCGGGAGGCTGAGG (정방향, 서열번호 11) 및 Alu-1R, CCCTAGTTAGCCAGAGAGCTCCCA (역방향, 서열번호 12) 및 2차 Alu PCR 포워드 프라이머, Alu-2F, ACAGCCTCCTAGCATTTCGT (정방향, 서열번호 13), Alu-2R, AGCGGAAAGTCCCTTGTAGA (역방향, 서열번호 14) 및 Alu PCR 탐침으로 FAM-AGCATGGGATGGAGGACCCG-TAMRA (서열번호 15)가 사용되었다.
또한, 본 실험예에서는 Poly6에 의한 삽입 억제의 기전을 밝히기 위해 삽입효소 및 p300 항체(Santa Cruz Biotechnology)를 사용하여 웨스턴 블랏 및 면역 침전 분석을 수행하였다. 면역 침전 분석을 위해 MT-4 세포를 HIV-1에 1시간 동안 감염시킨 다음 DMSO (0.5%), AZT (5 nM), 랄테그라비어 (10 nM) 또는 Poly6 (10 μM)으로 48시간 처리하였다. 세포에 RIPA (Abcam) 완충액을 처리하여 세포를 용해시킨 후, 전체 용해 액을 10 ㎕의 Protein A/G PLUS-Agarose (sc2003, Santa Cruz)로 미리 씻어 내고 상청액을 수집하였다. 상청액을 4℃에서 1시간 동안 20 ㎍의 항체와 함께 항온 배양한 후, 10 ㎕의 Protein A/G PLUS-Agarose를 첨가하고 4℃에서 360도 회전시키면서 밤새 배양하였다. 최종 세척 후 면역 침전물을 수집하고, 생성된 침전물을 웨스턴 블랏 분석을 위해 로딩하였다.
한편, MT-4 세포에 HIV-1가 감염되면 HIV-1의 증식은 여러 단계를 통해 진행된다. 바이러스의 부착, 삽입, 전사 또는 바이러스 합성과 같은 HIV-1 생명 주기에 몇 가지 단계가 있기 때문에 새로 개발되는 항 HIV-1 시약들의 다양한 작용 기전이 존재하고 있다. 이에, Poly6에 의한 HIV-1 억제의 기본 기전을 더 자세히 밝히기 위해, Poly6 및 AZT(역전사효소 억제), 랄테그라비어(삽입효소 억제), 리토나비르(ritonavir), T20(바이러스 출현 저해) 등 MT-4 세포에서 HIV-1 생명 주기의 다양한 단계를 억제할 수 있는 다양한 항 HIV-1 약물을 사용하여 TOA(time-of-addition) 분석을 실시하였다. 이 때, T-20, 랄테그라비어 및 리토나비르는 NIH / AIDS 연구 및 참조 시약 프로그램 (NIH)에서 얻었다. TOA 분석은 각각의 대표 약물에 의한 HIV-1 증식의 억제가 각 약물에 의해 표적화된 증식 단계에 대응하는 시점에서 잘 확인되었고, Poly6는 6시간 내지 8시간 사이에 약물의 효과가 없어지기 시작하였다(도 4a). 유사한 억제 기전을 가진 삽입효소 억제제인 raltegravir의 TOA 결과에서 볼 수 있듯이, 세포 내 GFP의 분석 또한 TOA 결과(도 4b)를 뒷받침하며, 이러한 결과들을 종합하면, Poly6는 바이러스 삽입효소의 활성을 억제함으로써 항 HIV-1 효과를 나타냄을 알 수 있었다.
실험예 5. Poly6의 HIV-1 활성 억제 기전의 구체적인 확인
본 실험예는 Poly6에 의한 HIV-1 삽입효소 억제에 관한 TOA 데이터를 증명하기 위해 수행되었다. 구체적으로, Alu PCR 및 2-LTR PCR을 사용하여 HIV-1에 감염된 MT-4 세포에서 삽입효소 링의 형성을 검출했다. HIV-1 cDNA가 세포 내 핵에 들어갔을 때 삽입이 일어나지 않으면, 그것은 스스로 복제하여 2-LTR 링을 형성한다고 알려져 있다. 삽입효소 억제제인 랄테그라비어와 달리 2-LTR 링의 수준은 Poly6에 의해 증가되었고, HIV-1이 감염된 MT-4 세포에서는 삽입된 cDNA의 수가 현저하게 감소하였다(도 5A)). 이 결과는 Poly6가 삽입효소의 통합과정을 차단함으로써 HIV-1의 증식을 억제하는 것일 수 있음을 나타낸다. 바이러스의 세포 내 삽입 단계에서, p300과 같은 세포 내 인자에 의해 삽입효소가 아세틸화되는 과정은 이미 알려져 있으며, Poly6 작용에 의한 통합 억제 활성에 관한 근본적인 기전을 확인하기 위해서 먼저 면역 블롯팅에 의해 Poly6가 감염되지 않은 MT-4 세포와 HIV-1에 감염된 MT-4 세포에서 p300 단백질 발현이 어떠한 영향을 받는지 조사한 결과, 감염되지 않은 MT-4 세포에서 Poly6가 DMSO, AZT 또는 랄테그라비어보다 더 효율적으로 p300 발현을 감소시킨다는 것을 발견하였다(도 5B)). 다음으로, 감소된 p300이 삽입효소에 의한 면역 침전 후 바이러스 삽입효소 아세틸화에 대한 억제 효과를 일으킬 수 있는지를 확인하기 위해 항체는 DMSO, AZT, 랄테그라비어 또는 Poly6로 처리된 감염된 MT-4 세포의 세포에 적용하였다. 이어서 아세틸화된 라이신(Cell Signaling)에 특이적인 항체를 사용하여 면역 블롯팅을 수행하였다. 그 결과, Poly6와 랄테그라비어가 삽입효소의 아세틸화를 억제하고 있음을 확인할 수 있었다(도 5C)).
이러한 결과들을 종합해보았을 때, Poly6는 HIV-1의 활성 억제는 p300에 의한 삽입효소의 아세틸화를 억제함으로써 이루어지는 것을 알 수 있었다.
실시예 2. 항 HBV 효능의 확인
실험예 1. 항 HBV 효과를 나타내는 HBV 중합효소 유래 펩티드의 확인 및 세포 생존력 분석
본 실험예에서는 항 HBV 효과를 나타내는 HBV 중합효소 유래 펩티드를 확인하고, 이의 처리 시 세포의 생존력을 분석하고자 하였다. 전술한 Poly5 (GRLVF, 서열번호 1), Poly6 (GRLVFQ, 서열번호 2) 또는 Poly7 (GRLVFQT, 서열번호 3, 도 1A)), 이 3개의 후보 펩티드에 의한 항 바이러스 효과를 평가하기 위하여, HepG2.2.15(인간 유래 간암세포인 HepG2 세포와 HBV가 영구적으로 삽입되어 있음)나 pHBV-1.2X-Wildtype (WT) (Genotype C)가 일시적으로 형질감염된 HepG2 세포에 (제조사의 프로토콜에 따라 Lipofectamine 2000 시약(Life Technologies)을 사용) PBS (0.5%), 엔테카비르 (Entecavir: ETV, Sigma-Aldrich, 30 nM) 또는 3개의 후보(10 μM)를 2일 간 처리한 후 정량적 PCR 및 ELISA를 실시하여 비리온 복제 및 간염 표면 항원(HBsAg)을 확인하였다. 이 때 각 펩티드들은 기반 고체상 방법으로 Peptron Inc.에서 합성되었고, 각 펩티드들의 순도는 고속 액체 크로마토그래피에 의해 측정된 바와 같이 95% 이상이었다. 또한, TaqMan probe hybridization PCR을 위한 정량적 실시간 PCR 및 프로브용 올리고 뉴클레오타이드를 하기 표 1에 나타내었다.
TaqMan Probe
Name Sequences (5'-FAM to TAMRA-3') Position 서열번호
cccProbe CCT AAT CAT CTC ATG TTC AT 1834-1853 16
3.5-pgProbe CCT TGG ACT CAT AAG G 2457-2472 17
GAPDHprobe CCT GGC CAA GGT CAT CCA TGA CAA CTT 18
그 결과, Poly5, Poly6 및 Poly7을 48시간 동안 처리한 모든 그룹에서 s 항원과 e 항원이 감소 하였으나 Poly6 군에서 여러 농도를 비교해 보았을 때 가장 두드러진 항원 감소효과를 보였으며 24시간 처리 시에서는 ETV와 비교해서도 Poly6 처리 군에서만 유의하게 외피 항원 감소효과를 확인할 수 있었다 (도 6a). 따라서 본 실험에서는 preS1 18개의 뉴클레오타이드 (nt) 결실과 중첩된 중합효소 영역에서 유래한 Poly6 펩티드를 선택하여 항 HBV 효과를 확인하였다.
Poly6에 의한 항 바이러스 효과를 조사하기 전에, 본 실험예에서는 Poly6가 비 특이적인 세포 독성으로 인해 HBV 증식에 영향을 미칠 가능성을 확인하기 위해 Poly6에 의한 세포 생존력을 관찰하였다.
구체적으로, HepG2, HepG2.2.15 및 HepG2-hNTCP-C4 세포(세포막에 NTCP 수용체를 발현함)를 96 마이크로 플레이트에 플레이팅하고 (1x104 세포/well), ETV (30 nM) 및 Poly6 농도를 5일 동안 증가시켜 배양하였다. MTS 분석을 위해 Cell-Titer 96 Aqueous One Solution을 각 well에 직접 첨가하고 플레이트를 3시간 동안 배양하였다. 플레이트를 490 nm에서 판독하고 각각의 분석은 3회 반복 수행하였다. 이 때, HBV 감염 분석을 위해, 2% DMSO를 함유한 HepG2.2.15 세포의 상청액을 3일마다 15일 동안 수집하고, 6% PEG8000으로 얼음에서 1시간 동안 비리온을 침전시키고, 4℃에서 100,000 g에서 3시간 동안 울트라 원심 분리기를 사용하여 농축시켰다. 펠릿을 10% FBS가 함유된 1X PBS로 재구성하고 사용하기 전까지 -80℃에서 보관하였다. 세포를 6-웰 플레이트에 파종하고 4% PEG8000의 존재 하에 8 x 104 GEq/세포로 밤새도록 접종하였다. 다음 날, 세포를 PBS로 3회 세척한 후, 분석이 수행될 때까지 PBS(0.5%), ETV(30 nM) 또는 Poly6(10 μM)을 5일 간 처리 하였다.
그 결과, 날짜의 경과에 따라 Poly6는 HepG2, HepG2.2.15 및 HepG2-hNTCP-C4 세포에 대해 10 μM까지 유의하게 세포 독성을 나타내지 않았고, 세포 생존력에도 영향을 미치지 않았다(도 6b).
실험예 2. In vitro 시스템에서 Poly6에 의한 항 바이러스 효능의 확인
만성 HBV 감염은 급성 감염과는 달리 간경화 및 간세포 암과 같은 심각한 간 질환을 유발한다고 알려져 있다. 따라서 만성 감염을 극복하는 항 HBV에 대한 약물을 개발하는 것이 중요하다. 그러나 HBV 게놈이 숙주 염색체에 삽입되어 있기 때문에 사람의 간과 혈청에서 바이러스의 완전한 제거가 어려운 문제로 남아 있다. 따라서 본 실험예에서는 Poly6에 의한 항 바이러스 효과를 평가하기 위해 HBV를 지속적으로 발현하는 HepG2.2.15 영구 세포주에 Poly6를 처리하였다. 또한, HepG2 세포를 6-웰 플레이트에 접종한 후, HepG2 세포를 pHBV-1.2X-WT로 일시적으로 형질 감염시켰다. pHBV-1.2X-WT을 갖는 HepG2 세포 또는 HepG2-2.15 세포를 24 시간 또는 48시간 동안 PBS(0.5%), ETV(30 nM) 또는 Poly6(10 μM)로 처리하고 상청액 및 펠릿을 사용하여 다양한 분석을 수행하였다. 분비된 HBsAg 및 HBeAg을 배양 상청액으로부터 측정하기 위해 제공된 실험 방법에 따라 HBsAg(BIOKIT) 및 HBeAg(AccuDiag) ELISA를 수행하였다. 8-하이드록시-2'-데옥시구아노신(8-OHdG) 활성의 검출을 위해, 8-OHdG 분석 키트(OxiSelect Oxidative DNA Damage ELISA kit, Cell Biolabs) 및 ELISA를 제조 프로토콜에 따라 수행하였다.
그 결과, PBS, ETV 및 Poly6를 2일 동안 처리한 후, 세포 외부로의 HBsAg 및 HBeAg의 수준이 Poly6 처리 군에서 통계적으로 유의하게 감소하였으며, 바이러스 증식 수준은 Poly6의 경우에서 더욱 현저하게 감소하였다. ETV에 의해서도 바이러스 증식이 감소되었지만, ETV와 PBS 사이에는 통계적 유의성은 없었다(도 7A) 내지 7C), 도 8G) 및 8H)).
또한, 세포 외부로 분비된 비리온의 양을 측정하기 위해 서던 블롯 분석을 수행하였고, 이는 구체적으로, 4℃에서 3시간 동안 24,000 rpm으로 초원심분리하기 전에, 세포 파편을 제거한 후 얼음에서 1시간 동안 8% PEG6000 (Sigma)을 사용하여 상청액으로부터의 비리온을 침전시켰다. 펠릿을 PBS로 수거하고, 제조사의 지시에 따라 QIAamp DNA 미니 키트(QIAGEN)를 사용하여 HBV DNA를 수집하였다. 바이러스성 DNA는 정량적 실시간 PCR(Q-PCR)을 사용하여 측정되었다. PCR 증폭은 a101-bp 생성물을 증폭하도록 고안된 작은 표면 유전자를 표적으로 하는 QPCR 프라이머 세트로 수행되었다(표 2). Q-PCR은 상업용 SensiFAST SYBR Lo-ROX 키트(BIOLINE)와 HBV Genesig 표준 키트(Primer design)를 사용하여 수행하여 바이러스 부하를 보정하였다. 또한, 세포 외 HBV DNA를 검출하기 위해, 상청액을 수집하고, HBV 입자를 전술한 바와 같이 6% PEG8000 (Sigma)을 사용하여 침전시켰다. 바이러스 펠릿을 PBS에서 수거하고 DNA를 용해 완충액(0.25% SDS, 250 mM Tris-HCl, pH 7.4 및 250 mM EDTA)으로 추출하였다. 정제된 HBV DNA를 1% 아가로오스 겔에서 분리하고, 서던 블롯팅에 의해 나일론 막(Hybond N +; Amersham)으로 옮기고, 32P-표지된 야생형, 전장 HBV DNA 프로브와 하이브리드화시켰다. 무작위 프라이머 DNA 라벨링 키트(TaKaRa)를 사용하여 분석하였다. 오토라디오그래피(Autoradiography)는 BAS 2500 이미지 분석기(Fuji Photo Film)를 이용하여 수행 및 분석되었다.
Primer
Name Sequences (5' to 3') Position 서열번호
Real-SF TTG ACA AGA ATC CTC ACA ATA CC 218-240 19
Real-SR GGA GGT TGG GGA CTG CGA AT 309-328 20
m18S-F CGC GGT TCT ATT TTG TTG GTT T 21
m18S-R TTC GCT CTG GTC CGT CTT G 22
hIFN-β-F TTG TGC TTC TCC ACT ACA GC 23
hIFN-β-R CTG TAA GTC TGT TAA TGA AG 24
hIFN-α-F GAC TCC ATC TTG GCT GTG A 25
hIFN-α-R TGA TTT CTG CTC TGA CAA CCT 26
hISG15-F AGC TCC ATG TCG GTG TCA G 27
hISG15-R GAA GGT CAG CCA GAA CAG GT 28
hRIG-I-F GGA CGT GGC AAA ACA AAT CAG 29
hRIG-I-R GCA ATG TCA ATG CCT TCA TCA 30
hTNF-α-F GGA GAA GGG TGA CCG ACT CA 31
hTNF-α-R CTG CCC AGA CTC GGC AA 32
mIFN-β-F CAC AGC CCT CTC CAT CAA CT 33
mIFN-β-R TCC CAC GTC AAT CTT TCC TC 34
m18S-F CGC GGT TCT ATT TTG TTG GTT T 35
m18S-R TTC GCT CTG GTC CGT CTT G 36
그 결과, 서던 블롯 분석에서 세포 외부로 분비된 비리온의 양은 PBS 조건과 비교하여 Poly6와 ETV에서 명확하게 감소하였다(도 7D)). 농도에 따른 변화를 확인한 결과, Poly6에 의한 HBV의 IC50은 약 2.468 μM 이었다(도 7E)).
실험예 3. Poly6의 HBV 억제 기전의 구체적인 확인
본 실험예에서는 뉴클레오캡시드(Nucleocapsid) 발현 분석, 미토콘드리아 활성 산소 측정 및 제 1형 인터페론에 대한 실험을 통하여 세포에서 Poly6의 항 바이러스 기전을 확인하였다.
구체적으로, 항 HBc 항체(Dako, Agilent Tech)로 웨스턴 블롯 분석을 수행한 결과, PBS 및 ETV에 대비하여 Poly6를 처리한 그룹에서 유의하게 HBcAg 및 캡시드가 줄어드는 것을 확인하였다. 이를 Image J 프로그램으로 수치화 시켜 보았을 때에도 통계적 유의성을 확인할 수 있었다(도 8F)).
시약이 세포 내로 흡수되어 산화 스트레스가 유도되면, I형 인터페론과 같은 세포 인자를 발현시킴으로써 증식, 세포 사멸 또는 항 바이러스 효과를 비롯한 다양한 반응을 일으킬 수 있다는 기전이 밝혀져 있다. 이에, Poly6의 산화 스트레스 매개 작용에 의한 항 바이러스 효과의 기전을 밝히기 위하여 pHBV-1.2X- 야생형 형질 감염된 HepG2 세포 또는 HepG2.2.15 세포로 6-웰 배양 플레이트 상에 4 x 105 세포 / 웰로 24시간 동안 접종하고 PBS, ETV 또는 Poly6로 처리 하였다. 적절한 시간 동안 세포를 배양한 후, 세포를 37℃에서 30분 동안 5 μM의 MitoSox (Molecular probes)와 함께 항온 처리하였다. 유동 세포 계측 분석을 위해, 세포 펠릿을 FACS 완충액(PBS 내 1% FBS 및 1 mM EDTA)에 재현탁시키고 4% 파라 포름 알데히드로 고정시켰다. 미토콘드리아 기능 장애를 예방하기 위해 10 μM의 MitoTempo(SigmaAldrich)를 12시간 동안 전처리하고 0.5 μM의 로테논(Rotenone; SigmaAldrich) 시약을 미토콘드리아 스트레스를 통한 ROS 유도에 대한 양성 대조군으로 사용하였다.
그 결과, HepG2 세포에서 미토콘드리아 스트레스에 의한 활성 산소 (mtROS)의 생산이 PBS에 비해 로테논과 Poly6 처리 군에서 2시간에서부터 24시간 동안 유의하게 증가하였다(도 10A)). Poly6 처리에 의한 미토콘드리아의 활성 산소 증가가 농도 의존성을 보임을 확인하였다(도 10B)). 반면 엔테카비르 처리 군에서는 미토콘드리아 활성 산소의 증가 양상이 관찰되지 않았다. 로테논과 Poly6의 처리로 증가된 미토콘드리아 활성 산소는 mtROS 특이적 항산화 물질인 MitoTEMPO의 처리로 다시 감소되었다(도 10C)).
제 I형 인터페론(Type I interferon: IFN-I)은 바이러스 감염을 조절하기 위해 숙주 세포에 의해 유도된다(Stetson & Medzhitov, 2006). 따라서, HepG2-2.15 세포 및 마우스 간에서 Poly6에 의한 IFN-I의 발생 영향을 확인하기 위해 IFN-β, RIG-I 및 ISG15의 mRNA 수준을 검사하였다.
그 결과, Poly6 처리 군에서 IFN-β, RIG-I, ISG15의 mRNA 수준이 PBS 군과 비교하여 유의하게 증가하는 것을 관찰하였고, 엔테카비르 처리 군에서는 통계적 유의성을 확인하지 못하였다(도 11a). 또한, I형 인터페론 생물 검정 및 중화 분석을 위해 간접적으로 루시퍼라아제 리포터 유전자를 사용하여 IFN의 수준을 측정하기 위해 5 ㎍의 푸로마이신(puromycin; SigmaAldrich)을 사용하여 3 '말단에 루시퍼라아제 리포터 유전자와 관련된 인터페론-민감 반응 요소(ISRE)를 삽입한 hMH55-293-ISRE 세포를 사용했다. 24시간 또는 48시간 동안 각 시약으로 처리 된 세포로부터 상청액을 수집한 후, 상청액을 hMH55-293-ISRE 세포에 6시간 동안 첨가하였다. 배양 후, 세포를 PBS로 세척하고, 리포터 용해 완충액(Reporter Lysis Buffer; E1500, Promega)에 의해 실온에서 30분 동안 용해시켰다. 루시퍼라아제 분석 시약 (E1500, Promega)을 첨가하고 발광을 TECAN m200 판독기(TECAN)를 사용하여 측정하였다. 다음 날, PBS (0.5%), ETV (30 nM) 및 Poly6 (10 μM)을 48시간 동안 세포에 첨가하였다. 이 결과, 루시퍼라아제 발현 수준이 Poly6 처리에 따라 24시간에서 유의하게 증가함을 확인하였다 (도 11b의 B)).
한편 중화 I형 인터페론 수용체를 통해 인터페론과 수용체 간의 상호 작용을 차단한 후 Poly6에 의한 항 HBV 효과의 변화를 조사하기 위해 PBS, ETV, Poly6를 처리하기 2시간 전 중화 항체를 처리하여 수용체의 활성화를 차단하고 배양하였다. 각 물질 처리 후 48시간 동안 배양 후 항 HBV 효과를 ELISA 및 qPCR로 평가하였다. 그 결과, GAPDH 항체 처리에서 Poly6에 의해 감소된 HBeAg의 수준은 IFN 수용체를 차단하자 다시 유의하게 증가하였음을 확인하였으며, HBV DNA 수준 역시 PBS 처리 군 수준으로 회수되었음을 확인하였다 (도 12A)). 이와 마찬가지로 Poly6의 처리로 증가되었던 IFN-β, RIG-I 및 ISG15의 mRNA 수준 역시 중화 항체의 처리로 다시 감소하는 것을 관찰함으로써(도 12B)) Poly6가 I형 IFN-I 의 발현에 직접/간접적인 영향을 끼친다는 것을 확인하였다.
결론적으로 위 결과들을 바탕으로 Poly6가 세포 내 미토콘드리아의 활성 산소를 증가시킴으로써 I형 인터페론(IFN-I) 경로를 통해 IFN-β를 자극하고 이에 따라 HBV 복제를 억제하는 한편 HBcAg 및 단백 외피를 억제 하는 기전을 갖는다는 것을 입증할 수 있었다.
실험예 4. In vivo 시스템에서 Poly6에 의한 항 바이러스 효능의 확인
마우스 모델(in vivo)에서 Poly6 효과를 확인하기 위해 본 실험예를 수행하였다. 먼저 형질 전환된 마우스 모델을 구축하기 위해 HBV W4P 돌연변이를 발현하는 트랜스제닉 마우스를 마크로젠에서 생성시키고, 마우스를 무작위적으로 상호 배양하여 마크로젠(Macrogen)에서 병균이 없는 상태로 유지시켰다. 실험 동물은 특정 병원균이 없는 실험 동물 센터에 보관되었다. 간단히 말해서, PMSG (7.5 IU)와 hCG는 과배란을 위해 5-8주 동안 C57BL/6N 암컷 마우스에게 48시간마다 간격 (5 IU)으로 복강 내 주사되었다. 주사 후, 이들 암컷 마우스를 C57BL/6N 수컷 마우스와 교배시켰다. 다음날, 처녀 플러그가 있는 암컷 마우스를 희생시키고 수정된 배아를 수확하고 HBV W4P 완전 게놈을 유전자 변형 마우스 생산을 위한 표준 마이크로 주입 절차(Macrogen)를 사용하여 하나의 세포 배아에 공동 미세 주입시켰다. 미세 주입기를 이용하여 정자 수핵에 미세 주입을 위한 HBV DNA (4 ng/㎕)를 직접 주사한 후 미세 주입된 배아를 1 내지 2시간 동안 37℃에서 배양하였다. 14개에서 16개의 주입된 한 세포 단계 배아를 외과적 방법으로 pseudopregnant recipient mice(ICR)의 난관으로 이식하였다. F0가 태어난 후, 이식 유전자(transgene)의 존재에 대한 꼬리 컷 샘플을 사용하여 테스트한 유전형 분석(genotyping)을 수행하고 페놀 추출 방법을 통한 유전체 DNA(genomic DNA) PCR 스크리닝을 PCR 분석으로 확인하였다.
이 후, preS1 영역 (Genotype A, pHY92-W4P)에서 W4P 돌연변이를 포함하는 HBV 비리온을 발현하는 형질 전환 마우스 모델에 Poly6 (50 ㎍/kg)과 3TC (Lamivudine, Sigma-Aldrich, 500 ㎍/kg)를 일주일에 두 번씩 정맥 내 투여를 실시하였다. HBV DNA와 HBsAg 수치는 4주와 8주에 안와 부비동 혈액 수집을 통해 마우스 혈청으로부터 측정되었다.
그 결과, Poly6 및 3TC를 주사한 마우스의 혈청으로부터의 HBsAg의 수준은 4주에 PBS를 주사한 마우스와 비교하여 유사했지만, 3TC와 비교하여 Poly6에 대한 HBsAg 수준은 8주에서 유의하게 감소하였다(도 9a). 또한, HBV DNA 수준은 8주 동안 PBS와 비교하여 Poly6 및 3TC에서 약 2배 감소 하였다(도 9b). 마지막으로, 마우스 모델의 간에서 IFN-β의 mRNA 수준을 평가하였다. IFN-β mRNA 수준은 3TC 및 Poly6를 처리한 군의 4주 및 8주째 간 조직에서 유의하게 증가하였으며 이는 poly6를 처리한 군에서 더욱 높게 발현되었음을 관찰하였다 (도 11b의 C)).
상기 결과를 종합하여 볼 때, Poly6가 HBsAg 및 HBV 비리온 수준이 감소하는 생체 내 형질 전환 마우스 모델 시스템에 영향을 미친다는 것을 알 수 있었다.
실험예 5. Poly6의 엔테카비르 병용 처리에 의한 제 1형 인터페론 증가 상승(시너지) 효과 및 이로 인한 항 HBV 효과
핵에서 HBV 중합효소의 활성을 억제하여 인산화 형태로 전환시키는 기전을 통해 현재 HBV 항 바이러스제로 상용되고 있는 엔테카비르와 제 I 형 인터페론(IFN-I)을 증가시키는 것으로 확인된 Poly6의 병용 처리에 의한 항 HBV 효과와 제 1형 인터페론 증가 상승(시너지) 효과를 확인하였다. HepG2-2.15 세포로 6웰 배양 플레이트 상에 5 x 105 세포/웰로 24시간 동안 배양하고 PBS, ETV, Poly6를 단독 처리 또는 두 물질을 병용하여 처리 하였다. 48시간 동안 세포를 배양한 후, 상청액을 수집하여 ELISA, qPCR, LDH assay를 진행하였다.
그 결과, ETV와 Poly6를 단독으로 처리하였을 때 세포 외 HBV DNA 수준이 PBS에 비해 통계적으로 유의하게 감소하였으나 두 물질을 병용 처리하였을 때 더욱 현저한 감소효과를 보였고 이는 각 단독 처리 군과 비교 시에도 유의한 차이를 확인하였다 (도 13A)). 세포 외 s항원 및 e항원 수준 측정 결과, ETV 처리 군에서는 PBS 군 대비 유의한 감소 효과를 보이지 못했으나, Poly6 단독 처리 군에서 통계적 유의성을 확인하였고, 두 물질을 병용 하였을 때 각 단독 처리 군에 대비하여 유의적인 감소 현상을 관찰하였다 (도 13C)).
한편 각 물질의 단독 및 병용 처리에 의한 비특이적 세포 독성 수준을 확인하기 위해 LDH 수준을 측정하였고 대조군에 비해 유의한 차이를 보이지 않음으로써 세포 독성의 부재를 확인하였다 (도 13B)).
한편 제 1형 인터페론의 증가 수준에 대해 두 물질의 병용으로 인한 상승 효과를 확인하기 위해 단독 처리 군 및 병용 처리 군의 mRNA를 추출하여 IFN-α, IFN-β 및 TNF-α 발현 수준을 관찰하였고 그 결과 단독 처리 군에서 보다 병용 처리 군에서 유의하게 제 1형 인터페론 관련 mRNA수준이 증가함을 확인하였다(도 14A)). 또한 hMH55-293-ISRE 세포의 루시퍼라아제 리포터 유전자를 사용하여 IFN 수준을 간접적으로 측정하였고, 위 결과와 일관되게 ETV와 Poly6 병용 처리 군에서 PBS 및 각 물질 단독 처리 군에 비해 통계적으로 유의한 루시퍼라아제 발현 수준의 증가를 확인하였다(도 14B)).
위의 결과들을 바탕으로 Poly6의 엔테카비르 병용 처리에 의한 제 1형 인터페론의 상승 및 이로 인한 HBV에 대한 항 바이러스 효과의 시너지 효과를 입증하였고 따라서 병용 투여 시 간 질환 억제 효과의 상승 작용을 기대할 수 있을 것으로 예상된다.

Claims (23)

  1. 서열번호 1, 서열번호 2 및 서열번호 3으로 이루어진 군에서 선택되는 어느 하나의 아미노산 서열로 이루어진 폴리펩티드.
  2. 청구항 1에 있어서, 상기 폴리펩티드는 서열번호 2의 아미노산 서열로 이루어진 폴리펩티드.
  3. 청구항 1에 있어서, 상기 폴리펩티드는 B형 간염 바이러스(Hepatitis B virus: HBV) 중합효소로부터 유래되는 것인 폴리펩티드.
  4. 청구항 1에 있어서, 상기 폴리펩티드는 항 바이러스 활성을 가지는 것인 폴리펩티드.
  5. 청구항 1의 폴리펩티드를 포함하는 항 바이러스용 약학적 조성물.
  6. 청구항 5에 있어서, 상기 바이러스는 아데노 바이러스, 천연두 바이러스, 소아마비 바이러스, 홍역 바이러스, 중증 열성 혈소판 감소 증후군 (Severe Fever with Thrombocytopenia Syndrome) 바이러스, 인플루엔자 바이러스, C형 간염 바이러스 (Hepatitis C virus), 인간면역결핍 바이러스-1 (Human Immunodeficiency Virus-1: HIV-1) 및 B형 간염 바이러스(Hepatitis B virus: HBV)으로 이루어진 군에서 선택되는 적어도 하나인 약학적 조성물.
  7. 청구항 5에 있어서, 상기 폴리펩티드는 항 바이러스 활성을 가지며, 상기 바이러스는 인간면역결핍 바이러스-1 (Human Immunodeficiency Virus-1: HIV-1) 및 B형 간염 바이러스(Hepatitis B virus: HBV)으로 이루어진 군에서 선택되는 적어도 하나인 약학적 조성물.
  8. 청구항 5에 있어서, 항 바이러스제를 더 포함하는 약학적 조성물.
  9. 청구항 8에 있어서, 상기 항 바이러스제는 아시클로버, 팜시클로버, 발라시클로버, 간시클로버, 암프레나버, 아바카버, 안사마이신, 시도포버, 다루나버, 델라비리딘, 에파비렌즈, 에트라비린, 팜시클로버, 하이페리신, 인디나버, 라미부딘, 로부카버, 넬피나버, 네비라핀, 노바프렌, 리토나버, 사퀴나버, 스타부딘, 티프라나버, 비라졸, 리바비린, 잘시타빈, 지도부딘, 마라비록, 랄테그라버, 엘비테그라버, 디다노신, 테노포버, 엠트리시타빈, 로피나버, 아타자나버, 엔푸버티드, 클레부딘, 엔테카비르 및 아데포버로 이루어진 군에서 선택되는 적어도 하나인, 약학적 조성물.
  10. 청구항 8에 있어서, 상기 항 바이러스제는 엔테카비르인 약학적 조성물.
  11. 청구항 5에 있어서, 상기 폴리펩티드는 바이러스의 증식을 억제하는 것인 약학적 조성물.
  12. 청구항 5에 있어서, 상기 폴리펩티드는 HIV-1 삽입효소의 아세틸화를 저해하여 상기 효소의 활성을 억제하는 것인 약학적 조성물.
  13. 청구항 5에 있어서, 상기 폴리펩티드는 세포 내 미토콘드리아의 활성 산소를 증가시키는 것인 약학적 조성물.
  14. 청구항 5에 있어서, 상기 폴리펩티드는 제I형 인터페론(IFN-I)의 발현을 증가시키는 것인 약학적 조성물.
  15. 청구항 5에 있어서, 상기 폴리펩티드는 HBV의 HBcAg 또는 뉴클레오캡시드(Nucleocapsid)의 합성을 억제하는 것인 약학적 조성물.
  16. 청구항 1의 폴리펩티드를 포함하는 후천성면역결핍증(Acquired Immune Deficiency Syndrome: AIDS) 예방 또는 치료용 약학적 조성물.
  17. 청구항 16에 있어서, 상기 후천성면역결핍증은 HIV-1 감염으로부터 발병되는 것인 약학적 조성물.
  18. 청구항 1의 폴리펩티드를 포함하는 간질환 예방 또는 치료용 약학적 조성물.
  19. 청구항 18에 있어서, 상기 간질환은 간염, 간경변증 및 간암으로 이루어진 군으로부터 선택되는 적어도 하나인 약학적 조성물.
  20. 청구항 18에 있어서, 상기 간질환은 B형 간염인 약학적 조성물.
  21. 청구항 18에 있어서, 상기 간질환은 HBV 감염으로부터 발병되는 것인 약학적 조성물.
  22. 청구항 1의 폴리펩티드를 포함하는 항 바이러스용 건강기능식품.
  23. 청구항 5의 약학적 조성물을 개체에 투여하는 단계를 포함하는 바이러스 감염증 및 이와 연관된 증상을 예방 또는 치료하는 방법.
PCT/KR2019/005302 2018-05-09 2019-05-03 B형 간염 바이러스 유래 폴리펩티드 및 이의 항바이러스 용도 WO2019216603A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2020562636A JP7017012B2 (ja) 2018-05-09 2019-05-03 Ｂ型肝炎ウイルス由来ポリペプチド及びその抗ウイルス用途
EP19800689.2A EP3792354A4 (en) 2018-05-09 2019-05-03 POLYPEPTIDE DERIVED FROM HEPATITIS B VIRUS AND ITS ANTIVIRAL USE
CN201980030673.2A CN112105727B (zh) 2018-05-09 2019-05-03 乙型肝炎病毒衍生多肽及其抗病毒用途
US17/090,485 US11692011B2 (en) 2018-05-09 2020-11-05 Hepatitis B virus-derived polypeptide and anti-viral use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20180053040 2018-05-09
KR10-2018-0053039 2018-05-09
KR20180053039 2018-05-09
KR10-2018-0053040 2018-05-09

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/090,485 Continuation-In-Part US11692011B2 (en) 2018-05-09 2020-11-05 Hepatitis B virus-derived polypeptide and anti-viral use thereof

Publications (1)

Publication Number Publication Date
WO2019216603A1 true WO2019216603A1 (ko) 2019-11-14

Family

ID=68468148

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/005302 WO2019216603A1 (ko) 2018-05-09 2019-05-03 B형 간염 바이러스 유래 폴리펩티드 및 이의 항바이러스 용도

Country Status (6)

Country Link
US (1) US11692011B2 (ko)
EP (1) EP3792354A4 (ko)
JP (1) JP7017012B2 (ko)
KR (1) KR102234027B1 (ko)
CN (1) CN112105727B (ko)
WO (1) WO2019216603A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114903891A (zh) * 2021-02-07 2022-08-16 中以海德人工智能药物研发股份有限公司 沙奎那韦在治疗或预防乙型肝炎中的应用

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220022021A (ko) * 2020-08-14 2022-02-23 서울대학교산학협력단 B형 간염 바이러스 유래 폴리펩티드를 포함하는 암의 예방 또는 치료용 약학적 조성물
KR20220021744A (ko) * 2020-08-14 2022-02-22 서울대학교산학협력단 B형 간염 바이러스 유래 폴리펩티드를 포함하는 면역 어쥬번트
KR102637692B1 (ko) 2020-12-29 2024-02-19 성균관대학교산학협력단 DEAD-box 단백질 억제제를 포함하는 B형 간염 바이러스에 대한 항 바이러스용 조성물
KR102625620B1 (ko) * 2020-12-30 2024-01-17 서울대학교산학협력단 B형 간염 바이러스 유래 폴리펩티드를 포함하는 항 코로나 바이러스용 약학적 조성물
CN113201051B (zh) * 2021-04-27 2022-08-02 复旦大学 一种乙肝病毒表面蛋白突变体及其在抗乙肝病毒中的应用
KR102460373B1 (ko) * 2022-04-04 2022-10-31 리니어(주) 포터블 튜브 반전 장치 및 이를 이용한 시공 공법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030171538A1 (en) * 1991-08-26 2003-09-11 The Scripps Research Institute Peptides for inducing cytotoxic T lymphocyte responses to hepatitis B virus
KR20100136960A (ko) * 2008-01-25 2010-12-29 루프레히트-칼스-유니페어지테트 하이델베르크 Ｂ형 간염 바이러스(ＨＢＶ)의 소수성 변형된 ｐｒｅＳ-유래 펩티드 및 이의 ＨＢＶ 및 ＨＤＶ 침입 억제제로서의 용도
KR20120052352A (ko) * 2009-08-07 2012-05-23 트랜스진 에스.에이. Ｈｂｖ 감염을 치료하는 조성물
KR20120085510A (ko) * 2011-01-24 2012-08-01 서울대학교산학협력단 Ｈｓｐ90 억제제를 포함하는 간질환 치료용 조성물 및 Ｈｓｐ90과 ＨＢＶ 코어 단백질간의 상호작용 억제를 통한 간질환 치료제 스크리닝 방법
EP3189850A1 (en) * 2015-12-16 2017-07-12 Ruprecht-Karls-Universität Heidelberg Liver targeting of cyclic pres-derived peptides of hbv

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4966848A (en) * 1988-02-08 1990-10-30 The General Hospital Corporation Isolation, purification, characterization, cloning and sequencing of N α-acetyltransferase
US5223421A (en) * 1989-10-25 1993-06-29 The General Hospital Corporation Identification of methionine Nα-acetyltransferase
JP3650110B2 (ja) * 1993-08-02 2005-05-18 ザ スクリップス リサーチ インスティテュート Ｂ型肝炎ウイルスに対する細胞毒性ｔリンパ球応答を誘発するためのペプチド
US5688489A (en) * 1995-09-15 1997-11-18 Resolution Pharmaceuticals, Inc. Non-receptor mediated imaging agents
US7384910B2 (en) * 1997-10-08 2008-06-10 Castillo Gerardo M Small peptides for the treatment of Alzheimer's disease and other beta-amyloid protein fibrillogenesis disorders
US7276483B1 (en) * 1997-10-08 2007-10-02 Castillo Gerardo M Small peptides for the treatment of Alzheimer's disease and other beta-amyloid protein fibrillogenesis disorders
WO2004058807A2 (en) * 2002-12-24 2004-07-15 Algonomics N.V. Mhc class i restricted t-cell stimulating peptides from hepatitis b virus
CA2614884A1 (en) * 2005-07-11 2007-01-18 Globeimmune, Inc Compositions and methods for eliciting an immune response to escape mutants of targeted therapies
EP2197908A2 (en) * 2007-09-27 2010-06-23 Dako Denmark A/S Mhc multimers in tuberculosis diagnostics, vaccine and therapeutics
BR112017022845A2 (pt) * 2015-04-23 2018-07-17 Nantomics, Llc neoepítopos de câncer

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030171538A1 (en) * 1991-08-26 2003-09-11 The Scripps Research Institute Peptides for inducing cytotoxic T lymphocyte responses to hepatitis B virus
KR20100136960A (ko) * 2008-01-25 2010-12-29 루프레히트-칼스-유니페어지테트 하이델베르크 Ｂ형 간염 바이러스(ＨＢＶ)의 소수성 변형된 ｐｒｅＳ-유래 펩티드 및 이의 ＨＢＶ 및 ＨＤＶ 침입 억제제로서의 용도
KR20120052352A (ko) * 2009-08-07 2012-05-23 트랜스진 에스.에이. Ｈｂｖ 감염을 치료하는 조성물
KR20120085510A (ko) * 2011-01-24 2012-08-01 서울대학교산학협력단 Ｈｓｐ90 억제제를 포함하는 간질환 치료용 조성물 및 Ｈｓｐ90과 ＨＢＶ 코어 단백질간의 상호작용 억제를 통한 간질환 치료제 스크리닝 방법
EP3189850A1 (en) * 2015-12-16 2017-07-12 Ruprecht-Karls-Universität Heidelberg Liver targeting of cyclic pres-derived peptides of hbv

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CLIN MICROBIOL REV, vol. 14, no. 4, October 2001 (2001-10-01), pages 778 - 809
See also references of EP3792354A4

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114903891A (zh) * 2021-02-07 2022-08-16 中以海德人工智能药物研发股份有限公司 沙奎那韦在治疗或预防乙型肝炎中的应用
CN114903891B (zh) * 2021-02-07 2023-12-12 中以海德人工智能药物研发股份有限公司 沙奎那韦在治疗或预防乙型肝炎中的应用

Also Published As

Publication number Publication date
EP3792354A4 (en) 2022-03-09
KR102234027B1 (ko) 2021-03-31
CN112105727A (zh) 2020-12-18
CN112105727B (zh) 2023-05-30
EP3792354A1 (en) 2021-03-17
JP2021522807A (ja) 2021-09-02
KR20190128999A (ko) 2019-11-19
JP7017012B2 (ja) 2022-02-08
US20210054029A1 (en) 2021-02-25
US11692011B2 (en) 2023-07-04

Similar Documents

Publication Publication Date Title
WO2019216603A1 (ko) B형 간염 바이러스 유래 폴리펩티드 및 이의 항바이러스 용도
US8822496B2 (en) Dosage regimens for HCV combination therapy
US11015179B2 (en) Peptide having anti-viral effect and composition containing same
WO2018045760A1 (zh) 罗汉果醇在制备抗病毒药物中的应用
CN113398219A (zh) 橘红痰咳浸膏在制备抑制人冠状病毒感染的药物中的用途
KR20160019834A (ko) 음양곽 추출물을 유효성분으로 함유하는 항 바이러스용 조성물
US11980632B2 (en) Antiviral composition containing fucosyllactose as active ingredient
KR102517456B1 (ko) 섬유아세포 성장인자 11을 유효성분으로 포함하는 항바이러스 조성물
WO2022146070A1 (ko) B형 간염 바이러스 유래 폴리펩티드를 포함하는 항 코로나 바이러스용 약학적 조성물
KR102311070B1 (ko) 퀘리세틴을 유효성분으로 포함하는 엡스타인 바 바이러스 연관 위암 예방 및 치료용 약학적 조성물
KR20170111274A (ko) 퀘리세틴을 유효성분으로 포함하는 엡스타인 바 바이러스 연관 위암 예방 및 치료용 약학적 조성물
WO2014051359A1 (ko) 네퍼린을 유효성분으로 포함하는 간암 예방 또는 치료용 약제학적 조성물
WO2021210852A1 (ko) 태반 유래 물질을 포함하는 항바이러스 조성물
KR102240693B1 (ko) 육산화사비소를 포함하는 코로나바이러스 감염증의 예방 또는 치료용 약학조성물
WO2023048334A1 (ko) 신규한 락토바실러스 플란타럼 probio 88, 이의 추출물 및 조성물
WO2022215827A1 (ko) Sars-cov-2 3cl 프로테아제와 rdrp활성을 억제하는 지유 추출 조성물
WO2016024810A1 (ko) 음양곽 추출물을 유효성분으로 함유하는 항 바이러스용 조성물
WO2021210851A1 (ko) 태반추출물을 포함하는 항바이러스 조성물
WO2021182897A1 (ko) 포스포디에스터레이즈 5 억제제를 포함하는, nk-t 세포 림프종 또는 nk 세포 백혈병 예방 또는 치료용 약학적 조성물
KR102096526B1 (ko) 식물 유래 ｄｎａ 탈메틸효소를 이용한 동물세포에서의 인터페론의 발현 수준의 증가용 조성물, 항바이러스용 조성물, 및 이를 이용한 방법
WO2017222252A1 (ko) 텔렉타디엄 동나이엔스 추출물을 유효성분으로 하는 대장암 예방 또는 치료용 약학 조성물
KR101674541B1 (ko) 췌장염 유발 콕사키바이러스 ｂ4 증식 억제제를 함유하는 췌장염 치료 및 예방용 약학 조성물
KR20240037390A (ko) 인삼류 추출물 및 스테로이드계 화합물을 유효 성분을 함유하는 항바이러스 조성물
CHEN et al. Comprehensive Transcriptome Analysis of Intestinal Epithelial Cells of Cyprinus carpio Exposed to Lipopolysaccharide
KR20220035675A (ko) 돌외 추출물을 유효성분으로 함유하는 항바이러스용 약학적 조성물 및 건강기능식품 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19800689

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020562636

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019800689

Country of ref document: EP

Effective date: 20201209