WO2019006418A2 - ADENO-ASSOCIATED VIRAL VECTORS FOR GENE THERAPY - Google Patents

ADENO-ASSOCIATED VIRAL VECTORS FOR GENE THERAPY Download PDF

Info

Publication number
WO2019006418A2
WO2019006418A2 PCT/US2018/040480 US2018040480W WO2019006418A2 WO 2019006418 A2 WO2019006418 A2 WO 2019006418A2 US 2018040480 W US2018040480 W US 2018040480W WO 2019006418 A2 WO2019006418 A2 WO 2019006418A2
Authority
WO
WIPO (PCT)
Prior art keywords
aav
mutation
nucleic acid
sequence
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/040480
Other languages
English (en)
French (fr)
Other versions
WO2019006418A3 (en
Inventor
Thomas Henley
Mavis Agbandje-Mckenna
Tilmann BUERCKSTUEMMER
Lydia VINEY
Modassir CHOUDHRY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intima Bioscience Inc
Original Assignee
Intima Bioscience Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Intima Bioscience Inc filed Critical Intima Bioscience Inc
Priority to CN201880056905.7A priority Critical patent/CN111511375A/zh
Priority to JP2020521488A priority patent/JP2020530307A/ja
Priority to EP18825318.1A priority patent/EP3645021A4/en
Publication of WO2019006418A2 publication Critical patent/WO2019006418A2/en
Publication of WO2019006418A3 publication Critical patent/WO2019006418A3/en
Priority to US16/718,400 priority patent/US11098325B2/en
Anticipated expiration legal-status Critical
Priority to US17/385,513 priority patent/US20230018860A1/en
Priority to US17/385,507 priority patent/US20230015722A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/32T-cell receptors [TCR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/46Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145Special targeting system for viral vectors

Definitions

  • compositions and methods herein provide modified adeno-associated viral vectors as well as methods for the identification of modified adeno-associated viral vectors that enhance cellular therapy. Insertion of transgenes into primary cells using modified adeno-associated viral methods are innovative approaches that open new opportunities for extending and improving immunotherapy for various conditions, such as cancer.
  • an isolated non-naturally occurring nucleic acid comprising an adeno- associated virus (AAV) nucleotide sequence that comprises a first mutation in a VP1 region and a second mutation in a VP3 region as compared to a wild-type AAV nucleotide sequence, wherein the isolated non-naturally occurring nucleic acid, upon contacting with a plurality of cells, has increased expression of a transgene post transfection or transduction in the plurality of cells as compared to a wild-type AAV nucleic acid or an AAV nucleotide sequence with a single mutation in a VP region of the capsid protein in a comparable plurality of cells.
  • AAV adeno- associated virus
  • an isolated non-naturally occurring nucleic acid comprising an adeno- associated virus (AAV) nucleotide sequence that comprises a first mutation in a VPl region and a second mutation in a VP2 region as compared to a wild-type AAV nucleotide sequence, wherein the isolated non-naturally occurring nucleic acid, upon contacting with a plurality of cells, has increased expression of a transgene post transfection or transduction in said plurality of cells as compared to a wild-type AAV nucleic acid or an AAV nucleotide sequence with a single mutation in a VP region of the capsid protein in a comparable plurality of cells.
  • AAV adeno- associated virus
  • the AAV nucleotide sequence is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, and any combination thereof.
  • the AAV nucleotide sequence can be of an AAV6 serotype.
  • the isolated non-naturally occurring nucleic acid can be at least one of DNA or R A.
  • the isolated non-naturally occurring nucleic acid can be DNA.
  • the first mutation and the second mutation comprise at least one of a point mutation, missense mutation, nonsense mutation, insertion, deletion, duplication, frameshift, or repeat expansion.
  • the first mutation and the second mutation can be point mutations.
  • the first mutation can be a mutation of a phenylalanine (F) encoding sequence in the VPl region.
  • the first mutation can be in an F encoding sequence at position 129 of the VPl region of a polypeptide encoded by the nucleic acid.
  • the mutation encodes a mutation from an F at position 129 of the polypeptide to a nonpolar aliphatic amino acid.
  • the nonpolar aliphatic amino acid can be selected from: leucine (L), isoleucine (I), and valine (V).
  • the nonpolar aliphatic amino acid is an L.
  • the second mutation is in a leucine (L) encoding sequence in the polypeptide.
  • the second mutation is in an L encoding sequence at position 584 of the polypeptide encoded by the nucleic acid.
  • the second mutation encodes a mutation from an L at position 584 of the polypeptide to a polar amino acid.
  • the polar amino acid can be selected from: asparagine (N) and glutamine (Q).
  • the polar amino acid can be an N.
  • the second mutation encodes a mutation from an L at position 584 to a positively charged amino acid.
  • the positively charged amino acid can be histidine (H).
  • the second mutation can encode a mutation from an L at position 584 of the polypeptide to a negatively charged amino acid.
  • the negatively charged amino acid is selected from: aspartate (D) and glutamate (E).
  • the negatively charged amino acid is a D.
  • the second mutation is in a valine (V) encoding sequence in the polypeptide.
  • the second mutation is in a V encoding sequence at position 598 of the polypeptide encoded by the nucleic acid.
  • the second mutation encodes a mutation from a V at position 598 of the polypeptide to a nonpolar aliphatic amino acid.
  • a nonpolar aliphatic amino acid is selected from: leucine (L), isoleucine (I), and valine (V).
  • a nonpolar aliphatic amino acid can be an
  • a nonpolar aliphatic amino acid can be an I.
  • a second mutation is in a histidine (H) encoding region in the polypeptide.
  • the second mutation can be in an H encoding region at position 642 in the polypeptide.
  • the second mutation encodes a mutation from an H at position 642 of said polypeptide to a polar amino acid.
  • a polar amino acid is selected from: asparagine (N) and glutamine (Q).
  • a polar amino acid is an N.
  • a first mutation can be in an aromatic amino acid encoding sequence in a nucleic acid prior to a second mutation, a second mutation encoding a nonpolar aliphatic amino acid in a polypeptide encoded by a nucleic acid.
  • an aromatic amino acid can be at position 129 of a VP1 polypeptide encoded by a VP1 region.
  • a first mutation is in a sequence encoding a more hydrophobic amino acid than an amino acid encoded at a position of a sequence prior to a second mutation.
  • a second mutation encodes at least one mutation selected from the group consisting of: a positively charged amino acid to a polar amino acid, a negatively charged amino acid to a polar amino acid.
  • a second mutation encodes a conservative mutation.
  • a conservative mutation can be selected from the group consisting of: a nonpolar aliphatic amino acid to a nonpolar aliphatic amino acid, a polar amino acid to a polar amino acid, a positively charged amino acid to a positively charged amino acid, a negatively charged amino acid to a negatively charged amino acid, and an aromatic amino acid to an aromatic amino acid.
  • a first mutation is in a sequence encoding a less hydrophobic amino acid than the amino acid encoded at a position of said sequence prior to the second mutation.
  • a second mutation is in a VP3 region, and a second mutation can encode at least one mutation selected from the group consisting of an: H to N, D to N, D to N, V to L, and V to I.
  • a second mutation in a VP3 region occurs at position 418, 462, 584, 598, or 642 of an AAV polypeptide sequence encoded by an AAV nucleotide sequence.
  • an isolated non-naturally occurring nucleic acid comprises at least one of F129L, H642N, and D418N mutations.
  • an isolated non-naturally occurring nucleic acid encodes at least one of F129L, H642N, and L584N mutations. In some cases, an isolated non-naturally occurring nucleic acid comprises at least one of F129L, H462N, and V598L mutations. In some cases, an isolated non-naturally occurring nucleic acid comprises at least one of F129L, H462N, and V598I mutations. In some cases, a plurality of cells can be a plurality of primary cells. In some cases, an isolated non-naturally occurring nucleic acid encodes at least a portion of an exogenous receptor sequence. In some cases, an isolated non-naturally occurring nucleic acid can be formulated into a pharmaceutical composition. In some cases, a wild-type AAV nucleic acid comprises at least 60% sequence identity to SEQ ID NO: 55.
  • AAV adeno-associated virus
  • capsid nucleotide sequence that encodes at least two mutations selected from the group consisting of: F129L, H642N, and D418N.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus nucleic acid sequence
  • a sequence identity can be from about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and up to about 100%.
  • an isolated non-naturally occurring nucleic acid that comprises an adeno- associated virus (AAV) nucleotide sequence that comprises VP1, VP2, and VP3 sequences, wherein two of the VP1, VP2, and VP3 sequences are from a first AAV serotype, and one of the VP1, VP2, and VP3 sequences is from a second AAV serotype, wherein the isolated non-naturally occurring nucleic acid upon introduction into a plurality of cells confers an increased expression of a transgene after transfection or transduction as compared to a wild-type AAV nucleic acid.
  • AAV adeno- associated virus
  • a first AAV serotype and a second AAV serotype are selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, or any combination thereof.
  • a first AAV serotype and a second AAV serotype are selected from the group consisting of: AAV4 and AAV6, AAV5 and AAV6, AAV11 and AAV6, AAV 12 and AAV6, and any combination thereof.
  • an isolated non-naturally occurring nucleic acid can be at least one of DNA or RNA. In some cases, an isolated non-naturally occurring nucleic acid can be DNA.
  • cells are primary cells, immortalized cells, or recombinant cells.
  • a transgene encodes at least a portion of an exogenous receptor sequence.
  • an isolated non-naturally occurring nucleic acid can be formulated into a pharmaceutical composition.
  • VP1, VP2, and VP3 regions are comprised within at least a portion of a capsid.
  • AAV adeno-associated virus nucleic acid sequence
  • a sequence identity can be from about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and up to about 100%.
  • AAV nucleic acid sequence [0017] Disclosed herein is a plurality of adeno-associated viral (AAV) particles isolated from an engineered cell.
  • AAV adeno-associated viral
  • composition comprising adeno-associated viral particles in unit dosage form.
  • a composition can be cryopreserved.
  • a container comprising a composition.
  • a method of making engineered cells comprising contacting a plurality of cells with a plurality of adeno-associated viral (AAV) particles.
  • AAV adeno-associated viral
  • a plurality of cells are mammalian cells.
  • mammalian cells are human cells.
  • human cells are lymphocytes.
  • cells can be stimulated prior to contacting with a plurality of AAV particles.
  • stimulation can be performed with at least one of: anti-CD3, anti-CD28, and an interleukin.
  • contacting can be performed before, after, or concurrent with stimulation.
  • contacting of a plurality of cells with a plurality of AAV particles is performed after stimulation.
  • Stimulation can be performed from 4 days before to 24 hours before contacting of a plurality of cells with a plurality of AAV particles. Stimulation can be performed 3 days before contacting of a plurality of cells with a plurality of AAV particles.
  • a method can further comprise introducing a genomic disruption in a genome of a plurality of cells.
  • a genomic disruption can comprise a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • a genomic disruption can be performed prior to contacting of a plurality of cells with a plurality of AAV particles.
  • a method can further comprise expanding engineered cells.
  • a method can further comprise administering engineered cells in unit dosage form to a subject in need thereof. In some cases, administering is an infusion.
  • administering of engineered cells at least partially ameliorates a disease or condition in a subject in need thereof.
  • a disease or condition comprises a cancer.
  • amelioration comprises a reduction in a cancer by at least about 30% as measured by computerized tomography (CT) scan.
  • amelioration comprises stabilizing tumor size as measured by a less than 10% change in a baseline measurement of a diameter of a tumor lesion as measured by computerized tomography (CT) scan.
  • AAV engineered adeno associated viral
  • a mutation comprises at least one of a point mutation, missense mutation, nonsense mutation, insertion, deletion, duplication, frameshift, or repeat expansion.
  • a mutation comprises a point mutation.
  • a genome of an adeno-associated virus (AAV) nucleotide sequence is of serotype AAV6.
  • An exogenous AAV genome can be of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, or
  • An exogenous AAV genome can be AAV4.
  • An exogenous AAV genome can be AAV5.
  • An exogenous AAV genome can be AAV11.
  • An exogenous AAV genome can be AAV 12.
  • a plurality of cellular genomes can be from primary cells, immortalized cells, or recombinant cells. In some cases, quantifying a level of expression can be determined by flow cytometry, western blot, or PCR. In some cases, engineered AAV particles when introduced to a plurality of cellular genomes confer increased expression of a transgene post transduction as compared to non-engineered AAV particles.
  • Increased expression can be from about 30%, 40%, 50%, 60%, and up to about 100% as compared to the second level of expression obtained from a second AAV particle introduced a different mutation or exogenous AAV genome from a.
  • Quantifying can be measured by flow cytometry, western blot, or PCR.
  • a method of making engineered cells comprising contacting a plurality of cells with an effective amount of adeno-associated viral (AAV) particles comprising a first mutation in a VP1 region and a second mutation in a VP3 region in a capsid protein thereby generating a plurality of engineered cells, wherein an expression of a transgene after transduction of the engineered cells is increased as compared to a comparable plurality of cells contacted with wild type AAV particles or AAV particles comprising a single mutation in a VP region of the capsid protein.
  • AAV adeno-associated viral
  • a method of making engineered cells comprising contacting a plurality of cells with an effective amount of adeno-associated viral (AAV) particles comprising a first mutation in a VP1 region and a second mutation in a VP3 region in a capsid protein thereby generating a plurality of engineered cells, wherein an expression of a transgene after transduction of the plurality of cells is increased between about lOx to 300x at a mean of infectivity (MOI) of 200,000 GC/mL as compared to a comparable plurality of cells contacted with wild type AAV particles or AAV particles comprising a single mutation in a VP region of the capsid protein at the MOI.
  • AAV adeno-associated viral
  • a method of making engineered cells comprising contacting a plurality of cells with an effective amount of adeno-associated viral (AAV) particles encoding a transgene and comprising a first mutation in a VP 1 region and a second mutation in a VP3 region in a capsid protein thereby generating a plurality of engineered cells, wherein expression of said transgene in said plurality of cells is increased as compared to cells contacted with wild type AAV particles or AAV particles comprising a single mutation in a VP region of said capsid protein, wherein said wild type AAV particles or AAV particles comprising the single mutation in the VP region of said capsid protein also encode said transgene.
  • AAV adeno-associated viral
  • a transgene encodes a cellular receptor or a portion thereof.
  • a cellular receptor or portion thereof can be a T cell receptor.
  • a cellular receptor or portion thereof can be a chimeric antigen receptor (CAR).
  • a first mutation is in an F encoding sequence at position 129 of the VP1 region of a polypeptide encoded by the method.
  • a first mutation encodes a mutation from an F at position 129 of the polypeptide to a nonpolar aliphatic amino acid.
  • a nonpolar aliphatic amino acid can be selected from: leucine (L), isoleucine (I), and valine (V).
  • a nonpolar aliphatic amino acid can be an
  • a first mutation is in a leucine (L) encoding sequence in a polypeptide. In some cases, a first mutation is in an L encoding sequence at position 584 of a polypeptide encoded by a nucleic acid. In some cases, a first mutation encodes a mutation from an L at position 584 of a polypeptide to a polar amino acid.
  • a polar amino acid can be selected from: asparagine (N) and glutamine (Q). A polar amino acid can be N.
  • a first mutation encodes a mutation from an L at position 584 to a positively charged amino acid. A positively charged amino acid can be histidine (H).
  • a first mutation can encode a mutation from an L at position 584 of a polypeptide to a negatively charged amino acid.
  • a negatively charged amino acid can be selected from: aspartate (D) and glutamate (E).
  • a negatively charged amino acid can be D.
  • a first mutation can be in a valine (V) encoding sequence in a polypeptide.
  • a first mutation can be in a V encoding sequence at position 598 of a polypeptide encoded by a nucleic acid.
  • a first mutation can encode a mutation from a V at position 598 of a polypeptide to a nonpolar aliphatic amino acid.
  • a nonpolar aliphatic amino acid can be selected from: leucine (L), isoleucine (I), and valine (V).
  • a nonpolar aliphatic amino acid can be an L.
  • a nonpolar aliphatic amino acid can be an I.
  • a second mutation can be in a histidine (H) encoding region in a polypeptide.
  • a second mutation can be in an H encoding region at position 642 in a polypeptide.
  • a second mutation can encode a mutation from an H at position 642 of a polypeptide to a polar amino acid.
  • a polar amino acid can be selected from: asparagine (N) and glutamine (Q).
  • a polar amino acid can be an N.
  • a first mutation can be in an aromatic amino acid encoding sequence in a nucleic acid prior to said second mutation, said second mutation encoding nonpolar aliphatic amino acid in a polypeptide encoded by a nucleic acid.
  • an aromatic amino acid can be at position 129 of a VP1 polypeptide encoded by a VP1 region.
  • a first mutation can be in a sequence encoding a more hydrophobic amino acid than the amino acid encoded at a position of the sequence prior to the second mutation.
  • a second mutation encodes at least one mutation selected from the group consisting of an: a positively charged amino acid to a polar amino acid, a negatively charged amino acid to a polar amino acid.
  • a second mutation can encode a conservative mutation.
  • a conservative mutation can be selected from the group consisting of: a nonpolar aliphatic amino acid to a nonpolar aliphatic amino acid, a polar amino acid to a polar amino acid, a positively charged amino acid to a positively charged amino acid, a negatively charged amino acid to a negatively charged amino acid, and an aromatic amino acid to an aromatic amino acid.
  • a first mutation can be in a sequence encoding a less hydrophobic amino acid than the amino acid encoded at a position of said sequence prior to the second mutation.
  • a first mutation in a VP region of a capsid protein can be a single mutation in a VP1 or a VP3 region of the capsid protein.
  • a first mutation in a VP1 region comprises an F to L mutation. In some cases, a first mutation in a VP1 region occurs at position 129 of an AAV polypeptide sequence encoded by the AAV nucleotide sequence.
  • a second mutation is in a VP3 region and the second mutation comprises at least one mutation selected from the group consisting of an: H to N, D to N, D to N, V to L, and V to I. In some cases, the second mutation in a VP3 region can occur at position 418, 462, 584, 598, or 642 of an AAV polypeptide sequence encoded by an AAV nucleotide sequence.
  • a second mutation in a VP3 region can comprise at least one of F129L, H642N, D418N, L584N, V598L, V598I.
  • a method can further comprise contacting a plurality of cells with a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, thereby generating a plurality of engineered cells comprising a genomic disruption.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • contacting can be before, concurrent, or after contacting with AAV particles.
  • An endonuclease can be Cas.
  • a Cas can be selected from the group consisting of: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl or Csxl2), CaslO, Csyl , Csy2, Csy3, Cse l, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, CsxlS, Csfl, Csf2, CsO, Csf4, Cpfl, c2cl, c2c3, Cas9HiFi, homologues thereof, and modified versions thereof.
  • a CRISPR system can be electroporated or nucleofected into a plurality of cells.
  • a CRISPR system can be encoded by DNA, RNA, or a combination hereof.
  • a CRISPR system can be encoded by RNA.
  • a method can further comprise expanding engineered cells. In some cases, engineered cells are expanded to at least about lxlO 8 cells.
  • An AAV can be AAV6.
  • Disclosed herein is a method of making engineered cells comprising contacting a plurality of cells with a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, thereby generating a plurality of engineered cells comprising a genomic disruption; and contacting engineered cells with an effective amount of adeno-associated viral (AAV) particles encoding a cellular receptor and comprising a first mutation in a VPl region and a second mutation in a VP3 region in a capsid protein, thereby generating a plurality of engineered transduced cells, wherein expression of the cellular receptor is increased in the engineered transduced cells between about lOx to 300x at a mean of infectivity (MOI) of 200,000 GC/mL as compared to comparable cells contacted with wild type AAV particles or AAV particles comprising a single mutation in a VPl region of said capsid protein at the MOI, wherein the wild type AAV particles or AAV particles comprising the
  • the plurality of cells can be a plurality of primary cells.
  • primary cells are lymphocytes.
  • AAV particles can be AAV6.
  • a first mutation can be in an F encoding sequence at position 129 of a VPl region of a polypeptide encoded by the nucleic acid.
  • a first mutation encodes a mutation from an F at position 129 of the polypeptide to a nonpolar aliphatic amino acid.
  • a nonpolar aliphatic amino acid can be selected from: leucine (L), isoleucine (I), and valine (V).
  • a nonpolar aliphatic amino acid can be an L.
  • a second mutation can be in a leucine (L) encoding sequence in a polypeptide.
  • a second mutation can be in an L encoding sequence at position 584 of a polypeptide encoded by a nucleic acid.
  • a second mutation can encode a mutation from an L at position 584 of a polypeptide to a polar amino acid.
  • a polar amino acid can be selected from: asparagine (N) and glutamine (Q).
  • a polar amino acid can be an N.
  • a second mutation encodes a mutation from an L at position
  • a mutation encodes a mutation from an L at position 584 of the polypeptide to a negatively charged amino acid.
  • a negatively charged amino acid can be selected from: aspartate (D) and glutamate (E).
  • a negatively charged amino acid can be a D.
  • a second mutation can be in a valine (V) encoding sequence in the polypeptide.
  • a second mutation is in a V encoding sequence at position 598 of the polypeptide encoded by the nucleic acid.
  • a mutation can encode a V at position 598 of a polypeptide to a nonpolar aliphatic amino acid.
  • a nonpolar aliphatic amino acid can be selected from: leucine (L), isoleucine (I), and valine (V).
  • a nonpolar aliphatic amino acid can be an L.
  • a nonpolar aliphatic amino acid can be an I.
  • a second mutation can be in a histidine (H) encoding region in a polypeptide.
  • a second mutation can be in an H encoding region at position 642 in a polypeptide.
  • a second mutation encodes a mutation from an H at position 642 of a polypeptide to a polar amino acid.
  • a polar amino acid can be selected from: asparagine (N) and glutamine (Q).
  • a polar amino acid can be an N.
  • a first mutation can be in an aromatic amino acid encoding sequence in a nucleic acid prior to a second mutation, and a second mutation can encode a nonpolar aliphatic amino acid in a polypeptide encoded by a nucleic acid.
  • An aromatic amino acid can be at position 129 of a VP1 polypeptide encoded by a VP1 region.
  • a first mutation can be in a sequence encoding a more hydrophobic amino acid than the amino acid encoded at a position of a sequence prior to a second mutation.
  • a second mutation can encode at least one mutation selected from the group consisting of an: a positively charged amino acid to a polar amino acid, a negatively charged amino acid to a polar amino acid.
  • a second mutation encodes a conservative mutation.
  • a conservative mutation can be selected from the group consisting of: a nonpolar aliphatic amino acid to a nonpolar aliphatic amino acid, a polar amino acid to a polar amino acid, a positively charged amino acid to a positively charged amino acid, a negatively charged amino acid to a negatively charged amino acid, and an aromatic amino acid to an aromatic amino acid.
  • a first mutation can be in a sequence encoding a less hydrophobic amino acid than the amino acid encoded at a position of the sequence prior to the second mutation.
  • a first mutation and a second mutation can be selected from the group consisting: F129L, H642N, and D418N; F129L, H642N, and L584N; F129L, H462N, and V598L; F129L, H462N, and V598I.
  • a cellular receptor can be a T cell receptor.
  • a method can further comprise expanding engineered cells.
  • a method can further comprise administering engineered cells to a subject in need thereof.
  • a subject can have a cancer.
  • a cancer can be a solid cancer.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • a cell comprising an isolated and purified polynucleic acid.
  • Disclosed herein is a method of making an engineered cell comprising introducing to a cell a sequence a guiding nucleic acid.
  • AAV adeno-associated viral
  • VP2 sequence and a VP3 sequence, wherein two of the VP1 sequence, VP2 sequence, and VP3 sequence are from a first AAV serotype, and one of said VP1 sequence, VP2 sequence, and VP3 sequence are from a second AAV serotype, thereby generating a plurality of engineered cells, wherein expression of a transgene after transduction or transfection of the engineered cells is increased as compared to a comparable plurality of cells contacted with wild type AAV particles or
  • AAV particles comprising wild-type VPl, VP2, or VP3 sequences.
  • a method of making engineered cells comprising contacting a plurality of cells with an effective amount of adeno-associated viral (AAV) particles comprising a VPl sequence, a VP2 sequence, and a VP3 sequence, wherein two of the VPl sequence, VP2 sequence, and VP3 sequence are from a first AAV serotype, and one of the VPl sequence, VP2 sequence, and VP3 sequence are from a second AAV serotype, thereby generating a plurality of engineered cells, wherein expression of a transgene after transduction or transfection of said plurality of cells is increased between about lOx to 300x at a mean of infectivity (MOI) of 200,000 GC/mL as compared to a comparable plurality of cells contacted with wild type AAV particles or AAV particles comprising wild-type VPl, VP2, or VP3 sequences, at the MOI.
  • AAV adeno-associated viral
  • a method of making engineered cells comprising contacting a plurality of cells with an effective amount of adeno-associated viral (AAV) particles encoding a transgene and comprising a VPl sequence, a VP2 sequence, and a VP3 sequence, wherein two of the VPl sequence, VP2 sequence, and VP3 sequence are from a first AAV serotype, and one of the VPl sequence, VP2 sequence, and VP3 sequence are from a second AAV serotype, thereby generating a plurality of engineered cells, wherein expression of the transgene in the plurality of cells is increased as compared to cells contacted with wild type AAV particles or AAV particles comprising a wild- type VP sequence, wherein the wild type AAV particles or AAV particles comprising the wild-type VP sequence of the capsid protein also encode the transgene.
  • AAV adeno-associated viral
  • a transgene encodes a cellular receptor or a portion thereof.
  • a cellular receptor or portion thereof is a T cell receptor.
  • a cellular receptor or portion thereof is a chimeric antigen receptor.
  • AAV particles comprise an AAV5 VPlu nucleotide sequence and AAV6 VP2 and VP3 nucleotide sequences.
  • AAV particles comprise AAV4 VPl and VP2 nucleotide sequences and an AAV6 VP3 nucleotide sequence.
  • AAV particles comprise AAV5 VPl and VP2 nucleotide sequences and an AAV6 VP2 and VP3 nucleotide sequence.
  • AAV particles comprise AAVl 1 VPl and VP2 nucleotide sequences and an AAV6 VP3 nucleotide sequence. In some cases, AAV particles comprise AAV 12 VPl and VP2 nucleotide sequences and AAV6 VP3 nucleotide sequences. In some cases, AAV particles comprise an AAVl VPlu nucleotide sequence and AAV6 VP2 and VP3 nucleotide sequences. In some cases, AAV particles comprise an AAV12 VPlu nucleotide sequence and AAV6 VP2 and VP3 nucleotide sequences.
  • AAV particles comprise an AAV5 VPlu sequence and AAV6 VP2 and VP3 sequences. In some cases, AAV particles comprise AAV4 VPl and VP2 sequences and an AAV6 VP3 sequence. In some cases, AAV particles comprise AAV5 VPl and VP2 sequences and AAV6 VP2 and VP3 sequences. In some cases, AAV particles comprise AAVl 1 VPl and VP2 sequences and an AAV6 VP3 sequence. In some cases, AAV particles comprise AAV12 VPl and VP2 sequences and an AAV6 VP3 sequence. In some cases, AAV particles comprise an AAVl VPlu sequence and AAV6 VP2 and VP3 sequences.
  • AAV particles comprise an AAV12 VPlu sequence and AAV6 VP2 and VP3 sequences.
  • a method further comprises contacting a plurality of cells with a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, thereby generating a plurality of engineered cells comprising a genomic disruption.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • a contacting is before, concurrent, or after said contacting with said AAV particles.
  • Disclosed herein is a method of making engineered transduced cells comprising contacting a plurality of cells with a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, thereby generating a plurality of engineered cells comprising a genomic disruption; and contacting the engineered cells with an effective amount of adeno-associated viral (AAV) particles encoding a cellular receptor and comprising a VP1 sequence, a VP2 sequence, and a VP3 sequence, wherein two of the VP1 sequence, VP2 sequence, and VP3 sequence are from a first AAV serotype, and one of the VP1 sequence, VP2 sequence, and VP3 sequence are from a second AAV serotype, thereby generating a plurality of engineered transduced cells, wherein expression of the cellular receptor is increased in said engineered transduced cells between about lOx to 300x at a mean of infectivity (MOI) of 200,000 GC/mL as
  • a plurality of cells can be a plurality of primary cells.
  • a method can further comprise administering engineered cells to a subject in need thereof.
  • a subject has a cancer.
  • AAV particles comprise an AAV5 VPlu nucleotide sequence and AAV6 VP2 and VP3 nucleotide sequences.
  • AAV particles comprise AAV4 VP1 and VP2 nucleotide sequences and an AAV6 VP3 nucleotide sequence.
  • AAV particles comprise AAV5 VP1 and VP2 nucleotide sequences and an AAV6 VP2 and VP3 nucleotide sequence.
  • AAV particles comprise AAV 11 VP1 and VP2 nucleotide sequences and an AAV6 VP3 nucleotide sequence. In some cases, AAV particles comprise AAV12 VP1 and VP2 nucleotide sequences and AAV6 VP3 nucleotide sequences. In some cases, AAV particles comprise an AAV1 VPlu nucleotide sequence and AAV6 VP2 and VP3 nucleotide sequences. In some cases, AAV particles comprise an AAV12 VPlu nucleotide sequence and AAV6 VP2 and VP3 nucleotide sequences.
  • AAV particles comprise an AAV5 VPlu sequence and AAV6 VP2 and VP3 sequences. In some cases, AAV particles comprise AAV4 VP1 and VP2 sequences and an AAV6 VP3 sequence. In some cases, AAV particles comprise AAV5 VP1 and VP2 sequences and AAV6 VP2 and VP3 sequences. In some cases, AAV particles comprise AAV11 VP1 and VP2 sequences and an AAV6 VP3 sequence. In some cases, AAV particles comprise AAV12 VP1 and VP2 sequences and an AAV6 VP3 sequence. IN some cases, AAV particles comprise an AAV1 VPlu sequence and AAV6 VP2 and VP3 sequences.
  • AAV particles comprise an AAV12 VPlu sequence and AAV6 VP2 and VP3 sequences. In some cases, AAV particles can comprise AAV6 particles. In some cases, contacting can be before, concurrent, or after contacting with AAV particles.
  • a CRISPR system comprises a guide R A (gRNA) and an endonuclease. An endonuclease can be CAS.
  • Cas can be selected from the group consisting of: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl or Csxl2), CaslO, Csyl , Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, CsxlS, Csfl, Csf2, CsO, Csf4, Cpfl, c2cl, c2c3, Cas9HiFi, homologues thereof, and modified versions thereof.
  • a CRISPR system can be electroporated or nucleofected into a plurality of cells.
  • a CRISPR system can be encoded by DNA, RNA, or a combination hereof.
  • a CRISPR system can be encoded by RNA.
  • a method can further comprise expanding engineered cells. Engineered cells can be expanded to at least about lxl0 8 cells.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV deno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated viral
  • a container comprising a plurality of adeno-associated viral (AAV) particles.
  • AAV adeno-associated viral
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • the AAV1 VP1 nucleotide sequence is an AAV1 VPlu nucleotide sequence.
  • AAV adeno-associated virus
  • the AAV1 VP1 nucleotide sequence is an AAV1 VPlu nucleotide sequence.
  • AAV nucleotide sequence that comprises an AAV5 VP1 sequence and AAV6 VP2 and VP3 sequences.
  • AAV1 VP1 nucleotide sequence is an AAV1 VPlu nucleotide sequence.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV nucleotide sequence that comprises an AAV1 VP1 sequence and AAV6 VP2 and VP3 sequences.
  • the AAV1 VP1 nucleotide sequence is an AAV1 VPlu nucleotide sequence.
  • AAV nucleotide sequence that comprises an AAV12 VP1 sequence and AAV6 VP2 and VP3 sequences.
  • the AAV1 VP1 nucleotide sequence is an AAV1 VPlu nucleotide sequence.
  • Disclosed herein is an engineered cell generated by transfecting a cell with an isolated and
  • AAV adeno-associated viral
  • a container comprising a plurality of adeno-associated viral (AAV) particles.
  • AAV adeno-associated viral
  • an isolated non-naturally occurring nucleic acid that comprises an adeno- associated virus (AAV) nucleotide sequence that comprises a first mutation in a VP1 region and a second mutation in a VP3 region as compared to a wild-type AAV nucleotide sequence, wherein the isolated non-naturally occurring nucleic acid upon introduction into a plurality of cells confers increased AAV transduction efficiency in the plurality of cells as compared to a wild-type AAV nucleic acid.
  • AAV adeno- associated virus
  • an AAV can be of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, and any combination thereof.
  • an AAV can be AAV6.
  • a nucleic acid can be at least one of DNA or RNA.
  • a nucleic acid can be DNA.
  • a mutation can comprise at least one of a point mutation, missense mutation, nonsense mutation, insertion, deletion, duplication, frameshift, or repeat expansion.
  • a mutation can be a point mutation.
  • first mutation in a VP1 region comprises an F to L mutation.
  • a first mutation in a VP1 region can occur at position 129 of an AAV nucleotide sequence.
  • a second mutation in a VP3 region can comprise at least one mutation selected from the group consisting of an: H to N, D to N, D to N, V to L, and V to I.
  • a second mutation in a VP3 region can occur at position 418, 462, 584, 598, or 642 of an AAV polypeptide sequence encoded by said AAV nucleotide sequence.
  • a nucleic acid can comprise at least one of F129L, H642N, and D418N.
  • a nucleic acid can comprise at least one of F129L, H642N, and L584N. In some cases, a nucleic acid can comprise at least one of F129L, H462N, or V598L. In some cases, a nucleic acid can comprise at least one of F129L, H462N, or V598I. In some cases, a plurality of cells can be primary cells. An AAV nucleotide sequence can encode at least a portion of an exogenous receptor sequence. In some cases, a nucleic acid can be formulated into a pharmaceutical composition. In some cases, a wild- type AAV nucleic acid can comprise at least 60% sequence identity to SEQ ID NO: 55.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus nucleic acid sequence
  • a sequence identity can be from about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and up to about 100%.
  • an isolated non-naturally occurring nucleic acid that comprises an adeno- associated virus (AAV) nucleotide sequence that comprises VP1, VP2, and VP3 sequences, wherein two of the VP1, VP2, and VP3 sequences are from a first AAV serotype, and one of the VP1, VP2, and VP3 sequences are from a second AAV serotype, wherein the isolated non-naturally occurring nucleic acid upon introduction into a plurality of cells confers increased AAV transduction efficiency as compared to a wild-type AAV nucleic acid.
  • AAV adeno- associated virus
  • AAV serotype can be selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, or any combination thereof.
  • a first AAV serotype and a second AAV serotype can be selected from a group consisting of: AAV4 and AAV6, AAV5 and AAV6, AAV11 and AAV6, AAV 12 and AAV6, and any combination thereof.
  • a nucleic acid can be at least one of DNA or R A.
  • a nucleic acid can be DNA.
  • Transduction efficiency can comprise an expression of a transgene encoded by a nucleic acid on a plurality of cells. In some cases, cells can be primary cells.
  • a transgene can encode at least a portion of an exogenous receptor sequence.
  • an isolated non-naturally occurring nucleic acid can be formulated into a pharmaceutical composition.
  • a VPl, VP2, and VP3 regions can comprise at least a portion of a capsid.
  • AAV adeno-associated virus nucleic acid sequence
  • a sequence identity can be from about 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and up to about 100%.
  • AAV particles that comprise at least one of: a first mutation in a first VPl region and a second mutation in a firstVP3 region; and a second VPl, a first VP2, and a second VP3 sequence, wherein two of the second VPl, first VP2, and second VP3 sequences are from a first AAV serotype, and one of the second VPl, first VP2, and second VP3 sequences are from a second AAV serotype, wherein when the AAV particles transduce cells the AAV particles confer increased transduction efficiency as compared to a plurality of wild-type AAV particles.
  • AAV adeno-associated viral
  • a first and a second AAV serotype can be selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, and any combination thereof.
  • a first AAV serotype and a second AAV serotype can be selected from a group consisting of: AAV4 and AAV6, AAV5 and AAV6, AAV11 and AAV6, AAV 12 and AAV6, and any combination thereof.
  • a first AAV serotype and a second AAV serotype can be AAV4 and AAV6.
  • a first AAV serotype and a second AAV serotype can be AAV5 and AAV6.
  • a first AAV serotype and a second AAV serotype can be AAV11 and AAV6.
  • a first AAV serotype and a second AAV serotype can be AAV 12 and AAV6.
  • a first and a second mutation can be selected from the group consisting of a point mutation, missense mutation, nonsense mutation, insertion, deletion, duplication, frameshift, or repeat expansion.
  • a first mutation and second mutation are point mutations.
  • a point mutation can be selected from the group consisting of F to L, H to N, D to N, D to N, V to L, and V to I.
  • a first mutation in a first VP 1 region can occur at position 129 of an AAV polypeptide sequence encoded by said AAV nucleotide sequence.
  • a second mutation in a first VP3 region can occur at a position selected from a group consisting of: 418, 462, 584, 598, and 642 of an AAV polypeptide sequence encoded by said AAV nucleotide sequence.
  • a first mutation and a second mutation can be at least two mutations selected from a group consisting of: F129L, H642N, and D418N; F129L, H642N, and L584N;
  • a first mutation in a first VP1 region and a second mutation in a first VP3 region can be at least two mutations selected from F129L, H642N, and D418N.
  • a first mutation in a first VP1 region and a second mutation in a first VP3 region can be at least two mutations selected from F129L, H642N, and L584N.
  • a first mutation in a first VP 1 region and a second mutation in a first VP3 region can be at least two mutations selected from L584N, F129L, and H462N.
  • a first mutation in a first VP1 region and a second mutation in a first VP3 region can be at least two mutations selected from F129L, H642N, and V598I.
  • a first mutation in a first VP1 region and a second mutation in a first VP3 region can occur on at least a portion of a viral capsid sequence.
  • a first mutation in a first VP1 region and a second mutation in a first VP3 region occur on an N-terminus or C-terminus of an AAV nucleotide sequence.
  • cells can be mammalian cells. Mammalian cells can be human cells. In some cases, human cells can be primary cells.
  • AAV particles can be introduced to a cell at a multiplicity of infection (MOI) from about 200 GC/mL up to about lxl0 8 GC/mL In some cases, a MOI can be lxl0 6 GC/mL. In some cases, an MOI can be from about 2.77xl0 12 GC/ml to 2.80xl0 14 GC/ml. In some cases, a transduction percentage can be from about 30%, 40%, 50%, 60%, and up to 100% of cells. A transduction percentage can be measured by flow cytometry. In some cases, AAV particles can encode at least a portion of an exogenous receptor. AAV particles can be cryopreserved. In some cases, AAV particles can be thawed prior to introduction to cells. AAV particles can be good manufacturing practices (GMP) compatible.
  • GMP good manufacturing practices
  • cells can be mammalian cells. Mammalian cells can be human cells. Human cells can be primary cells. In some cases, cells can be stimulated prior to contacting of cells with a plurality of AAV particles. In some cases, stimulation can be performed with anti-CD3, anti-CD28, interleukin-2 (IL-2), and any combination thereof. In some cases, a contacting can be performed before, after, or concurrent with stimulation. In some cases, a contacting of cells with a plurality of AAV particles can be performed after stimulation.
  • IL-2 interleukin-2
  • stimulation can be performed from 4 days before to 24 hours before a contacting of cells with a plurality of AAV particles. In some cases, stimulation can be performed 3 days before a contacting of cells with a plurality of AAV particles.
  • a method can further comprise a genomic disruption.
  • a genomic disruption can comprise a CRISPR system. In some cases, a genomic disruption can be performed prior to a contacting of cells with a plurality of AAV particles.
  • a method can further comprise expanding engineered cells.
  • a method can further comprise administering engineered cells in unit dosage form to a subject in need thereof. An administering can be an infusion. An administering of engineered cells can at least partially ameliorate a disease or condition in a subject in need thereof.
  • a disease or condition can comprise a cancer.
  • amelioration can comprise a reduction in a cancer by at least about 30% as measured by computerized tomography (CT) scan.
  • Amelioration can comprise stabilizing tumor size as measured by a less than 10% change in a baseline measurement of a diameter of a tumor lesion as measured by computerized tomography (CT) scan.
  • AAV engineered adeno associated viral
  • AAV adeno-associated virus
  • B introducing a plurality of the engineered AAV particles from A. to a plurality of cellular genomes
  • C quantifying a level of expression of a transgene encoded by the plurality of AAV particles in the plurality of cellular genomes wherein the level of expression is compared to a second level of expression obtained from a second AAV particle introduced a different mutation or exogenous AAV genome from A.
  • a mutation can comprise at least one of a point mutation, missense mutation, nonsense mutation, insertion, deletion, duplication, frameshift, or repeat expansion.
  • a mutation can comprise a point mutation.
  • a genome of an adeno-associated virus (AAV) nucleotide sequence can be of serotype AAV6.
  • An exogenous AAV genome can be of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12.
  • An exogenous AAV genome can be AAV4.
  • An exogenous AAV genome can be AAV5.
  • An exogenous AAV genome can be AAV11.
  • An exogenous AAV genome can be AAV 12.
  • a cellular genome can be from a primary cell.
  • a quantifying of a level of an expression can be determined by flow cytometry.
  • engineered AAV particles when introduced to cellular genomes can confer increased transduction as compared to non-engineered AAV particles.
  • increased transduction can be from about 30%, 40%, 50%, 60%, and up to 100% as compared to a second level of expression obtained from a second AAV particle introduced a different mutation or exogenous AAV genome from A.
  • a transduction can be measured by flow cytometry.
  • engineered cell comprising introducing to a cell a viral sequence that is at least 95%, 96%, 97%, 98%, and up to 99% identical to at least one of SEQ ID NO: 195 to SEQ ID NO: 220.
  • engineered cells can be expanded to a population of engineered cells.
  • a population of engineered cells can be formulated into a pharmaceutical composition.
  • a method of making a viral supernatant comprising introducing to a cell a polynucleic acid.
  • a method can further comprise collecting viral supernatant from a cell or cells from at least about 24 to 72 hours post an introducing.
  • collecting can comprise determining a concentration of a viral particle in a supernatant.
  • a method can further comprise cryopreserving a viral supernatant in unit dosage form.
  • Disclosed herein is a method of increasing expression of an exogenous transgene in a cell comprising introducing to a cell a viral supernatant.
  • a method of making engineered cells comprising: genomically disrupting at least a portion of a gene with a CRISPR system; introducing to cells a plurality of adeno-associated viral (AAV) particles comprising at least one of a mutation in a capsid protein or a serologically chimeric capsid protein; and expanding the cells.
  • Cells can be primary cells.
  • a gene can be an immune checkpoint gene.
  • AAV particles can be AAV6.
  • a mutation can be selected from a group consisting: F129L, H642N, and D418N; F129L, H642N, and L584N; F129L, H462N, and V598L; F129L, H462N, and V598I.
  • a serologically chimeric capsid protein can comprise at least a portion of a capsid from AAV4 and AAV6, AAV5 and AAV6, AAV11 and AAV6, AAV 12 and AAV6, and any combination thereof.
  • AAV particles can encode at least one transgene.
  • a transgene can encode an exogenous receptor.
  • a method can further comprise administering engineered cells to a subject in need thereof.
  • a subject can have a cancer.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • Disclosed herein is a method of making engineered cells comprising genomically disrupting at least a portion of a gene with a CRISPR system; introducing to a plurality of cells a plurality of adeno-associated viral (AAV) particles comprising at least one of a first mutation in a VP1 region and a second mutation in a VP3 region in a capsid protein or a serologically chimeric capsid protein comprising at least a portion of an AAV6 capsid protein; and expanding the cells.
  • AAV adeno-associated viral
  • FIG. 1 shows an exemplary AAV vector that encodes for an exogenous TCR.
  • FIG. 2 shows a comparison of percent receptor expression in human primary cells transduced with AAV VI (WT) or F129L (V2) and CRISPR at target gene sites as compared to control (electroporation with no CRISPR). Experiment was performed at a MOI of lxlO 6 GC/mL.
  • FIG. 3A shows a summary of percent receptor expression determined by flow cytometry of a sequential electroporation experiment.
  • Primary human cells were electroporated with CRISPR gRNA at target gene sites and transduced with AAV VI (WT).
  • FIG. 3B shows a summary of percent receptor expression determined by flow cytometry of a sequential electroporation experiment.
  • Human primary cells were electroporated with CRISPR gRNA to target gene sites and transduced with AAV V2 (F129L).
  • FIG. 4 shows percent TCR receptor expression on days 3, 7, and 14 post genomic modification with CRISPR and an AAV vector, VI (WT) or V2 (F129L) encoding an exogenous TCR transgene.
  • FIG. 5A shows percent receptor expression on day 14 post genomic modification with CRISPR at the target genes and transduction with AAV VI (WT) or F129L (V2).
  • FIG. 5B shows mean fluorescence intensity (MFI) on day 14 post genomic modification with CRISPR at target genes and transduction with AAV VI (WT) or F129L (V2).
  • FIG. 6A shows percent receptor expression on days 13 or 14 post genomic modification with
  • FIG. 6B shows mean fluorescence intensity (MFI) on days 13 or 14 post genomic modification with CRISPR at target genes AAVS 1, CISH, CTLA4, or PD-1 and transduction with a high titer (MOI of lxlO 6 GC/mL) AAV VI or V2.
  • FIG. 7A shows a transfection schematic of AAV viral particles into 293 T cells to generate viral supernatant.
  • FIG. 7B shows a pDG6-AAV6 helper-free packaging plasmid.
  • FIG. 8 shows an AAVS 1 -specific transgene donor encoding an exogenous TCR with flanking AAV2 inverted terminal repeats.
  • FIG. 9 shows a schematic of AAV mediated homologous recombination of a transgene donor encoding an exogenous TCR with homology arms to any one of AAVS 1, CISH, PD1, or CTLA4.
  • FIG. 10 shows a lymphocyte CRISPR and AAV modification timeline.
  • FIG. 11A shows percent GFP expression on day 5 post genomic modification with triple mutant
  • FIG. 11B shows percent GFP expression on day 8 post genomic modification with triple mutant AAV variants 15, 17, 19, and 20 as compared to WT AAV.
  • FIG. 12 shows percent GFP expression on days 3, 7, and 14 post genomic modification of single, double, and triple AAV mutants as compared to WT AAV.
  • FIG. 13 shows an annotated AAV6 WT sequence (SEQ ID NO: 246).
  • FIG. 14A shows average percent TCR expression on days 7, 14, and 21 post-transduction of a single donor done in triplicate to assess variability in percent TCR expression at different genomic targets.
  • Cells were transduced with a VP1 F129L mutant AAV virus encoding a TCR and also genomically edited with a CRISPR system specific for disrupting the AAVS 1 gene.
  • FIG. 14B shows average percent TCR expression on days 7, 14, and 21 post-transduction cellular single donor done in triplicate transduced with VP1 F129L mutant AAV virus encoding a TCR and also genomically edited with a CRISPR system specific for disrupting the CISH gene.
  • FIG. 14A shows average percent TCR expression on days 7, 14, and 21 post-transduction of a single donor done in triplicate transduced with VP1 F129L mutant AAV virus encoding a TCR and also genomically edited with a CRISPR system specific for disrupting the CISH gene.
  • FIG. 14C shows average percent TCR expression on days 7, 14, and 21 post-transduction of a single donor done in triplicate.
  • Cells were transduced with F129L mutant AAV virus encoding a TCR and also genomically edited with a CRISPR system specific for disrupting the CTLA-4 gene.
  • FIG. 14D shows average percent TCR expression on days 7, 14, and 21 post-transduction of a single donor done in duplicate.
  • Cells were transduced with VP1 F129L mutant AAV virus encoding a TCR and also genomically edited with a CRISPR system specific for disrupting the PD-1 gene.
  • FIG. 15 shows flow cytometric plots of triplicate experiments of TCR expression on days 7, 14, or 21 post-transduction with VP1 F129L mutant AAV viral particles encoding for the exogenous TCR.
  • the cells were also genomically edited with a CRISPR system specific for CISH gene disruption.
  • FIG. 16 shows flow cytometric plots of triplicate experiments of TCR expression on days 7, 14, or 21 post-transduction with VP1 F129L mutant AAV viral particles encoding for the TCR.
  • the cells were also genomically edited with a CRISPR system specific for AAVS 1 gene disruption.
  • FIG. 17A shows flow cytometry results of untransduced human CD3+ cells (control).
  • FIG. 17B shows flow cytometry results of transduced human CD3+ cells with variants 1-20 of Table 14.
  • FIG. 17C shows a summary of percent GFP of the CD3+ cells transduced with variants 1-20.
  • FIG. 18A shows day 3 post CRISPR/AAV flow cytometry results of different controls:
  • FIG. 18B shows percent GFP by flow cytometry of CRISPR modified and modified AAV (variants 1-20 of Table 14) transduced human cells.
  • FIG. 19A shows day 7 post CRISPR/AAV flow cytometry results of different controls:
  • FIG. 19B shows percent GFP by flow cytometry of CRISPR modified
  • AAV (variants 1-20 of Table 14) transduced human cells on day 7 post CRISPR and AAV.
  • FIG. 20 shows a plot of percent GFP expression on days 3 and 7 post transduction/CRISPR
  • FIG. 21A shows day 14 post CRISPR/AAV flow cytometry results of different controls:
  • FIG. 21B shows percent splice acceptor (SA)-GFP by flow cytometry of CRISPR modified and AAV-WT cells transduced at MOIs lxlO 6 , 2xl0 5 , lxlO 5 , lxlO 4 , lxlO 3 , or 2xl0 2 .
  • SA percent splice acceptor
  • FIG. 21C shows percent SA-GFP by flow cytometry of CRISPR modified and AAV variant 15 cells transduced at MOIs lxlO 6 , 2xl0 5 , lxlO 5 , lxlO 4 , lxlO 3 , or 2xl0 2 .
  • FIG. 21D shows percent SA-GFP by flow cytometry of CRISPR modified and AAV variant 17 cells transduced at MOIs lxlO 6 , 2xl0 5 , lxlO 5 , lxlO 4 , lxlO 3 , or 2xl0 2 .
  • FIG. 21C shows percent SA-GFP by flow cytometry of CRISPR modified and AAV variant 15 cells transduced at MOIs lxlO 6 , 2xl0 5 , lxlO 5 , lxlO 4 , lxlO 3 , or 2xl0 2 .
  • FIG. 21E shows percent SA-GFP by flow cytometry of CRISPR modified and AAV variant 19 cells transduced at MOIs lxlO 6 , 2xl0 5 , lxlO 5 , lxlO 4 , lxlO 3 , or 2xl0 2 .
  • FIG. 21F shows percent SA-GFP by flow cytometry of CRISPR modified and AAV variant 20 cells transduced at MOIs lxlO 6 , 2xl0 5 , lxlO 5 , lxlO 4 , lxlO 3 , or 2xl0 2 .
  • FIG. 21G shows a summary of the percent GFP expression of human CD3+ cells transduced with WT or AAV variants at different MOIs.
  • FIG. 22A shows luminescence data on Day 9 post CRISPR and AAV (WT or variant 15, 17, 19, or 20) at different MOIs. Legend is shown in FIG. 22B.
  • FIG. 22B shows luminescence data on Day 14 post CRISPR and AAVX (WT or variant 15, 17, 19, or 20) at different MOIs.
  • FIG. 23 shows luminescence data on day 14 after CRISPR and AAV (WT or chimera 1-8 of Table 15) at different MOIs.
  • FIG. 24A shows luminescence data on day 7 after CRISPR and AAV (WT, non-transfected, or chimera 1-8 of Table 15) at different MOIs.
  • FIG. 24B shows luminescence data on day 14 after CRISPR and AAV (WT, non-transfected, or chimera 1-8 of Table 15) at different MOIs.
  • FIG. 25A and FIG. 25B show a schematic of a PCR strategy to amplify regions of the AAV signature region to identify AAV serotypes.
  • FIG. 26A shows a western blot of human PBMC donors screened for AAV signature using CISH control primers, Forward primer: 0752 and Reverse primer 0753; amplicon size: 455bp, and AAV signature region controls NTC, pAAV DJ, and pDG.
  • FIG. 26B shows a western blot of human PBMC donors screened for AAV using primers forward-2 and reverse-4 that yield a 1600 bp product.
  • FIG. 26C shows a western blot of human PBMC donors screened for AAV using primers forward-2 and reverse-3 that yield a 258 bp product.
  • FIG. 26D shows a western blot of human PBMC donors screened for AAV using primers forward-5 and reverse-3 that yield a 921 bp product.
  • FIG. 26E shows a western blot of human PBMC donors screened for AAV using primers forward-6 and reverse-4 that yield a 1639 bp product.
  • FIG. 27A shows qPCR summary of tired AAV chimeras 3, 5, and 6 using cell lysate and post purification.
  • FIG. 27B shows ELISA results of AAV chimeras 3, 5, and 6 using cell lysate and post purification.
  • FIG. 28A shows a summary of luminescence (RLU) on day 7 post transduction of CD34+ cells with WT-AAV6 or chimeras 3, 5, or 6 (CMV NanoLuc virus) at MOI of 10,000 GC/mL. Virus only and Virus + CRISPR are shown as controls.
  • FIG. 28B shows a summary of luminescence (RLU) on day 7 post transduction of T cells with WT-AAV6 or chimeras 3, 5, or 6 (CMV NanoLuc virus) at MOI of 10,000 GC/mL. Virus only and Virus + CRISPR are shown as controls.
  • FIG. 29A shows a schematic of AAV chimeras.
  • FIG. 29B shows a schematic of AAV chimeras 6 (SEQ ID NO: 307) and 8 (SEQ ID NO: 308) as compared to AAV6 (SEQ ID NO: 309).
  • FIG. 30A shows a summary of luminescence (RLU) on day 7 post transduction of T cells with WT-AAV6 or chimeras 3, 5, or 6 (CMV NanoLuc virus) at MOI of 10,000 GC/mL. Virus only and Virus + CRISPR are shown as controls.
  • FIG. 30B shows a summary of luminescence (RLU) on day 14 post transduction of T cells with WT-AAV6 and chimeras 3, 5, and 6 (CMV NanoLuc virus) at MOI of 10,000 GC/mL. Virus only and Virus + CRISPR are shown as controls. CRISPR editing confirmed by TIDE analysis at 88% editing efficiency.
  • FIG. 31 shows luminescence (RLU) on day 7 post transduction of T cells with WT-AAV6 or chimeras 3, 5, or 6 (CMV NanoLuc virus) at MOI of le4 GC/mL or le6 GC/mL.
  • RC stands for Rep Cap and refers to the amount of rep/cap plasmid used in the transfection.
  • FIG. 32A shows luminescence (RLU) on day 7 post transduction of T cells with WT-AAV6 or chimera 6 (CMV NanoLuc virus) at MOI of le4 GC/mL or le6 GC/mL.
  • FIG. 32B shows luminescence (RLU) on day 15 post transduction of T cells with WT-AAV6 or chimera 6 (CMV NanoLuc virus) at MOI of le4 GC/mL or le6 GC/mL.
  • FIG. 32C shows luminescence (RLU) on day 7 post transduction of T cells with WT-AAV6 or chimera 6 (CMV NanoLuc virus) at MOI of le4 GC/mL or le6 GC/mL.
  • AAV adeno-associated virus of any of the known serotypes, including AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, or AAV-12, scAAV, rhlO, chimeric or hybrid AAV, or any combination, derivative, or variant thereof.
  • AAV is a small non-enveloped single-stranded DNA virus.
  • a hybrid AAV is an AAV comprising a capsid protein of one AAV serotype and genomic material from another AAV serotype.
  • a chimeric AAV comprises genetic and/or protein sequences derived from two or more AAV serotypes, and can include mutations made to the genetic sequences of those two or more AAV serotypes.
  • An exemplary chimeric AAV can comprise a chimeric AAV capsid, for example, a capsid protein with one or more regions of amino acids derived from two or more AAV serotypes.
  • An AAV variant is an AAV comprising one or more amino acid mutations in its genome or proteins as compared to its parental AAV, e.g., one or more amino acid mutations in its capsid protein as compared to its parental AAV.
  • AAV includes avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV, wherein primate AAV refers to AAV that infect non-primates, and wherein non-primate AAV refers to AAV that infect non- primate animals, such as avian AAV that infects avian animals.
  • the wild-type AAV contains rep and cap genes, wherein the rep gene is required for viral replication and the cap gene is required for the synthesis of capsid proteins.
  • the terms "recombinant AAV” and "rAAV” are interchangeable.
  • an AAV vector can comprise one or more of the AAV wild-type genes deleted in whole or part, such as the rep and/or cap genes, but contains functional elements that are required for packaging and use of AAV virus for gene therapy.
  • functional inverted terminal repeats or ITR sequences that flank an open reading frame or exogenous sequences cloned in are known to be important for replication and packaging of an AAV virion, but the ITR sequences can be modified from the wild-type nucleotide sequences, including insertions, deletions, or substitutions of nucleotides, so that the AAV is suitable for use for the embodiments described herein, such as a gene therapy or gene delivery system.
  • a self-complementary vector can be used, such as a self-complementary AAV vector, which can bypass the requirement for viral second-strand DNA synthesis and can lead to higher rate of expression of a transgene protein, as described in Wu, Hum Gene Ther. 2007, 18(2): 171-82, incorporated by reference herein.
  • AAV vectors can be generated to allow selection of an optimal serotype, promoter, and transgene.
  • the vector can be targeted vector or a modified vector that selectively binds or infects immune cells.
  • AAV virion or "AAV virion” refer to a virus particle comprising a capsid comprising at least one AAV capsid protein that encapsidates an AAV vector as described herein, wherein the vector can further comprise a heterologous polynucleotide sequence or a transgene in some embodiments.
  • the term "about” and its grammatical equivalents in relation to a reference numerical value and its grammatical equivalents as used herein can include a range of values plus or minus 10% from that value.
  • the amount “about 10” includes amounts from 9 to 11.
  • the term “about” in relation to a reference numerical value can also include a range of values plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value.
  • activation and its grammatical equivalents as used herein can refer to a process
  • a cell transitions from a resting state to an active state.
  • This process can comprise a response to an antigen, migration, and/or a phenotypic or genetic change to a functionally active state.
  • activation can refer to the stepwise process of T cell activation.
  • a T cell can require at least two signals to become fully activated. The first signal can occur after engagement of a TCR by the antigen-MHC complex, and the second signal can occur by engagement of co-stimulatory molecules.
  • Anti-CD3 can mimic the first signal and anti-CD28 can mimic the second signal in vitro.
  • adjacent and its grammatical equivalents as used herein can refer to right next to the object of reference.
  • adjacent in the context of a nucleotide sequence can mean without any nucleotides in between.
  • polynucleotide A adjacent to polynucleotide B can mean AB without any nucleotides in between A and B.
  • antigen can refer to a molecule that contains one or more epitopes capable of being bound by one or more receptors.
  • an antigen can stimulate a host's immune system to make a cellular antigen-specific immune response when the antigen is presented, or a humoral antibody response.
  • An antigen can also have the ability to elicit a cellular and/or humoral response by itself or when present in combination with another molecule.
  • a tumor cell antigen can be recognized by a TCR.
  • epitope and its grammatical equivalents as used herein can refer to a part of an antigen that can be recognized by antibodies, B cells, T cells or engineered cells.
  • an epitope can be a cancer epitope that is recognized by a TCR. Multiple epitopes within an antigen can also be recognized. The epitope can also be mutated.
  • autologous and its grammatical equivalents as used herein can refer to as originating from the same being.
  • a sample e.g., cells
  • An autologous process is distinguished from an allogenic process where the donor and the recipient are different subjects.
  • barcoded to refers to a relationship between molecules where a first molecule contains a barcode that can be used to identify a second molecule.
  • cancer and its grammatical equivalents as used herein can refer to a hyperproliferation of cells whose unique trait— loss of normal controls— results in unregulated growth, lack of differentiation, local tissue invasion, and metastasis.
  • the cancer can be any cancer, including any of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer, bone cancer, brain cancer, breast cancer, cancer of the anus, anal canal, rectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumor, Hodgkin lymphoma, hypopharynx cancer, kidney cancer, larynx cancer, leukemia, liquid tumors, liver cancer, lung cancer, lymphoma, malignant mesothelioma, mastocytoma, melanoma, multiple myelom
  • cancer neo-antigen or “neo-antigen” or “neo-epitope” and its grammatical equivalents as used herein can refer to antigens that are not encoded in a normal, non-mutated host genome.
  • a "neo-antigen” can in some instances represent either oncogenic viral proteins or abnormal proteins that arise as a consequence of somatic mutations.
  • a neo-antigen can arise by the disruption of cellular mechanisms through the activity of viral proteins.
  • Another example can be an exposure of a carcinogenic compound, which in some cases can lead to a somatic mutation. This somatic mutation can ultimately lead to the formation of a tumor/cancer.
  • cytotoxicity refers to an unintended or undesirable
  • the normal state of a cell can refer to a state that is manifested or exists prior to the cell's exposure to a cytotoxic composition, agent and/or condition.
  • a cell that is in a normal state is one that is in homeostasis.
  • An unintended or undesirable alteration in the normal state of a cell can be manifested in the form of, for example, cell death (e.g. , programmed cell death), a decrease in replicative potential, a decrease in cellular integrity such as membrane integrity, a decrease in metabolic activity, a decrease in developmental capability, or any of the cytotoxic effects disclosed in the present application.
  • reducing cytotoxicity refers to a reduction in degree or frequency of unintended or undesirable alterations in the normal state of a cell upon exposure to a cytotoxic composition, agent and/or condition.
  • the phrase can refer to reducing the degree of cytotoxicity in an individual cell that is exposed to a cytotoxic composition, agent and/or condition, or to reducing the number of cells of a population that exhibit cytotoxicity when the population of cells is exposed to a cytotoxic composition, agent and/or condition.
  • engineered and its grammatical equivalents as used herein can refer to one or more alterations of a nucleic acid, e.g., the nucleic acid within an organism's genome.
  • engineered can refer to alterations, additions, and/or deletion of genes.
  • An engineered cell can also refer to a cell with an added, deleted and/or altered gene.
  • cell or "engineered cell” and their grammatical equivalents as used herein can refer to a cell of human or non-human animal origin.
  • checkpoint gene and its grammatical equivalents as used herein can refer to any gene that is involved in an inhibitory process (e.g., feedback loop) that acts to regulate the amplitude of an immune response, for example, an immune inhibitory feedback loop that mitigates uncontrolled propagation of harmful responses. These responses can include contributing to a molecular shield that protects against collateral tissue damage that might occur during immune responses to infections and/or maintenance of peripheral self-tolerance.
  • inhibitory process e.g., feedback loop
  • These responses can include contributing to a molecular shield that protects against collateral tissue damage that might occur during immune responses to infections and/or maintenance of peripheral self-tolerance.
  • Non-limiting examples of checkpoint genes can include members of the extended CD28 family of receptors and their ligands as well as genes involved in co-inhibitory pathways (e.g. , CTLA-4 and PD-1).
  • the term "checkpoint gene” can also refer to an immune checkpoint gene.
  • a "CRISPR,” “CRISPR system system,” or “CRISPR nuclease system” and their grammatical equivalents can include a non-coding RNA molecule (e.g. , guide RNA) that binds to DNA and Cas proteins (e.g. , Cas9) with nuclease functionality (e.g., two nuclease domains).
  • RNA molecules e.g. , guide RNA
  • Cas proteins e.g. , Cas9
  • nuclease functionality e.g., two nuclease domains.
  • disrupting and its grammatical equivalents as used herein can refer to a process of altering a gene, e.g. , by deletion, insertion, mutation, rearrangement, or any combination thereof.
  • a gene can be disrupted by knockout.
  • Disrupting a gene can be partially reducing or completely suppressing expression of the gene.
  • Disrupting a gene can also cause activation of a different gene, for example, a downstream gene.
  • engineered and its grammatical equivalents as used herein can refer to one or more alterations of a nucleic acid, e.g., the nucleic acid within an organism's genome.
  • the term “engineered” and its grammatical equivalents as used herein can refer to one or more alterations of a nucleic acid, e.g., the nucleic acid within an organism's genome.
  • engineered can refer to alterations, additions, and/or deletion of genes.
  • An engineered cell can also refer to a cell with an added, deleted and/or altered gene.
  • the term "function" and its grammatical equivalents as used herein can refer to the capability of operating, having, or serving an intended purpose. Functional can comprise any percent from baseline to 100% of normal function. For example, functional can comprise or comprise about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50,55, 60, 65, 70, 75, 80, 85, 90, 95, and/or 100% of normal function. In some cases, the term functional can mean over or over about 100% of normal function, for example, 125, 150, 175, 200, 250, 300% and/or above normal function.
  • the term "gene editing " and its grammatical equivalents as used herein can refer to genetic engineering in which one or more nucleotides are inserted, replaced, or removed from a genome. Gene editing can be performed using a nuclease (e.g., a natural -existing nuclease or an artificially engineered nuclease).
  • GMP good manufacturing practices
  • cGMP current
  • Manufacturers of a product can employ technologies and systems which are up-to-date in order to comply with regulation of GMP products.
  • GMP compatible products are typically utilized in the clinical setting as opposed to the research setting.
  • mutants can include the substitution, deletion, and insertion of one or more nucleotides in a polynucleotide. For example, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 20, 25, 30, 40, 50, or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence can be substituted, deleted, and/or inserted.
  • a mutation can affect the coding sequence of a gene or its regulatory sequence.
  • a mutation can also affect the structure of the genomic sequence or the structure/stability of the encoded mR A.
  • a mutation in a nucleic acid can encode a mutation that increases or decreases the hydrophilicity of the amino acid encoded at the position being mutated.
  • a mutation in a nucleic acid can encode a mutation that increases or decreases the hydrophobicity of the amino acid encoded at the position being mutated.
  • a mutation in a nucleic acid can encode an amino acid selected from: nonpolar aliphatic amino acids (e.g., G, A, V, L, I, M), aromatic amino acids (e.g., F, Y, W), positively charged amino acids (e.g., K, R, H), negatively charged amino acids (e.g., D, E), and polar amino acids (e.g., S,T, C, P, N, Q).
  • a mutation in a nucleic acid can alter the encoded amino acid within one of the above groups (e.g., a V to I mutation) or between groups (e.g., an F to L mutation).
  • a mutation can encode an aromatic amino acid to nonpolar aliphatic amino acid change.
  • a mutation can encode a positively charged amino acid to polar amino acid change.
  • a mutation can encode a change from a nonpolar aliphatic amino acid to another nonpolar amino acid.
  • a mutation can encode a nonpolar aliphatic amino acid to negatively charged amino acid change.
  • a mutation can encode a nonpolar aliphatic amino acid to positively charged amino acid change.
  • non-human animal and its grammatical equivalents as used herein can include all animal species other than humans, including non-human mammals, which can be a native animal or a genetically modified non-human animal.
  • non-human mammals which can be a native animal or a genetically modified non-human animal.
  • nucleic acid can be used interchangeably and can refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. For the purposes of the present disclosure, these terms should not to be construed as limiting with respect to length.
  • the terms can also encompass analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g. , phosphorothioate backbones). Modifications of the terms can also encompass demethylation, addition of CpG methylation, removal of bacterial methylation, and/or addition of mammalian methylation.
  • an analogue of a particular nucleotide can have the same base- pairing specificity, i.e. , an analogue of A can base-pair with T.
  • percent (%) identity can be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof.
  • a fragment is at least about 8 amino acids in length, and can be up to about 700 amino acids.
  • identity when referring to "identity”, “homology”, or “similarity” between two different adeno-associated viruses, "identity”, “homology” or
  • aligned sequences refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.
  • peripheral blood lymphocytes can refer to lymphocytes that circulate in the blood (e.g., peripheral blood).
  • Peripheral blood lymphocytes can refer to lymphocytes that are not localized to organs.
  • Peripheral blood lymphocytes can comprise T cells, NK cells, B cell, or any combinations thereof.
  • phenotype and its grammatical equivalents as used herein can refer to a composite of an organism's observable characteristics or traits, such as its morphology, development, biochemical or physiological properties, phenology, behavior, and products of behavior. Depending on the context, the term “phenotype” can sometimes refer to a composite of a population's observable characteristics or traits.
  • protospacer and its grammatical equivalents as used herein can refer to a PAM- adjacent nucleic acid sequence capable to hybridizing to a portion of a guide R A, such as the spacer sequence or engineered targeting portion of the guide RNA.
  • a protospacer can be a nucleotide sequence within gene, genome, or chromosome that is targeted by a guide RNA. In the native state, a protospacer is adjacent to a PAM (protospacer adjacent motif). The site of cleavage by an RNA- guided nuclease is within a protospacer sequence.
  • the Cas protein when a guide RNA targets a specific protospacer, the Cas protein will generate a double strand break within the protospacer sequence, thereby cleaving the protospacer.
  • disruption of the protospacer can result though non-homologous end joining (NHEJ) or homology-directed repair (HDR).
  • NHEJ non-homologous end joining
  • HDR homology-directed repair
  • Disruption of the protospacer can result in the deletion of the protospacer.
  • disruption of the protospacer can result in an exogenous nucleic acid sequence being inserted into or replacing the protospacer.
  • the term "recipient” and their grammatical equivalents as used herein can refer to a human or non-human animal. The recipient can also be in need thereof.
  • recombination and its grammatical equivalents as used herein can refer to a process of exchange of genetic information between two polynucleic acids.
  • homologous recombination or “HR” can refer to a specialized form of such genetic exchange that can take place, for example, during repair of double-strand breaks. This process can require nucleotide sequence homology, for example, using a donor molecule to template repair of a target molecule (e.g. , a molecule that experienced the double-strand break), and is sometimes known as non-crossover gene conversion or short tract gene conversion.
  • Such transfer can also involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or synthesis-dependent strand annealing, in which the donor can be used to resynthesize genetic information that can become part of the target, and/or related processes.
  • Such specialized HR can often result in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide can be incorporated into the target polynucleotide.
  • the terms "recombination arms” and “homology arms” can be used interchangeably.
  • target vector and “targeting vector” are used interchangeably herein.
  • transgene and its grammatical equivalents as used herein can refer to a gene or genetic material that is transferred into an organism.
  • a transgene can be a stretch or segment of DNA containing a gene that is introduced into an organism. When a transgene is transferred into an organism, the organism is then referred to as a transgenic organism.
  • a transgene can retain its ability to produce RNA or polypeptides (e.g., proteins) in a transgenic organism.
  • a transgene can be composed of different nucleic acids, for example RNA or DNA.
  • a transgene can encode for an engineered T cell receptor, for example a TCR transgene.
  • a transgene can be a TCR sequence.
  • a transgene can be a receptor.
  • a transgene can comprise recombination arms.
  • a transgene can comprise engineered sites.
  • T cell and its grammatical equivalents as used herein can refer to a T cell from any origin.
  • a T cell can be a primary T cell, e.g. , an autologous T cell, a cell line, etc.
  • the T cell can also be human or non-human.
  • TIL tumor infiltrating lymphocyte and its grammatical equivalents as used herein can refer to a cell isolated from a tumor.
  • a TIL can be a cell that has migrated to a tumor.
  • a TIL can also be a cell that has infiltrated a tumor.
  • a TIL can be any cell found within a tumor.
  • a TIL can be a T cell, B cell, monocyte, natural killer cell, or any combination thereof.
  • a TIL can be a mixed population of cells.
  • a population of TILs can comprise cells of different phenotypes, cells of different degrees of differentiation, cells of different lineages, or any combination thereof.
  • a "therapeutic effect" can occur if there is a change in the condition being treated.
  • the change can be positive or negative.
  • a 'positive effect' can correspond to an increase in the number of activated T-cells in a subject.
  • a 'negative effect' can correspond to a decrease in the amount or size of a tumor in a subject.
  • There is a "change" in the condition being treated if there is at least 10% improvement, preferably at least 25%, more preferably at least 50%, even more preferably at least 75%, and most preferably 100%.
  • the change can be based on improvements in the severity of the treated condition in an individual, or on a difference in the frequency of improved conditions in populations of individuals with and without treatment with the therapeutic compositions with which the compositions of the present invention are administered in combination.
  • a method of the present disclosure can comprise administering to a subject an amount of cells that is "therapeutically effective".
  • the term "therapeutically effective” should be understood to have a definition corresponding to 'having a therapeutic effect' .
  • safe harbor and "immune safe harbor”, and their grammatical equivalents as used herein can refer to a location within a genome that can be used for integrating exogenous nucleic acids wherein the integration does not cause any significant effect on the growth of the host cell by the addition of the nucleic acid alone.
  • Non-limiting examples of safe harbors can include HPRT, AAVS SITE (e.g. AAVS 1, AAVS2, ETC.), CCR5, or Rosa26.
  • AAVS SITE e.g. AAVS 1, AAVS2, ETC.
  • CCR5 CCR5
  • Rosa26 Rosa26
  • the human parvovirus, AAV is known to integrate preferentially into human chromosome 19 ql3.3-qter, or the AAVS 1 locus.
  • Integration of a gene of interest at the AAVS 1 locus can support stable expression of a transgene in various cell types.
  • a nuclease can be engineered to target generation of a double strand break at the AAVS 1 locus to allow for integration of a transgene at the AAVS 1 locus or to facilitate homologous recombination at the AAVS 1 locus for integrating an exogenous nucleic acid sequence at the AAVS 1 site, such as a transgene, a cell receptor, or any gene of interest as disclosed herein.
  • an AAV viral vector is used to deliver a transgene for integration at the AAVS 1 site with or without an exogenous nuclease.
  • a viral vector that targets AAVS 1 can be for example FIG. 25A or FIG. 25B.
  • sequence and its grammatical equivalents as used herein can refer to a nucleotide sequence, which can be DNA or RNA; can be linear, circular or branched; and can be either single- stranded or double stranded.
  • a sequence can be mutated.
  • a sequence can be of any length, for example, between 2 and 1,000,000 or more nucleotides in length (or any integer value there between or there above), e.g., between about 100 and about 10,000 nucleotides or between about 200 and about 500 nucleotides.
  • viral vector refers to a gene transfer vector or a gene delivery system derived from a virus. Such vector can be constructed using recombinant techniques known in the art.
  • the virus for deriving such vector is selected from adeno-associated virus (AAV), helper- dependent adenovirus, hybrid adenovirus, Epstein-Bar virus, retrovirus, lentivirus, herpes simplex virus, hemmaglutinating virus of Japan (HVJ), Moloney murine leukemia virus, poxvirus, and HIV- based virus.
  • AAV adeno-associated virus
  • helper- dependent adenovirus hybrid adenovirus
  • Epstein-Bar virus Epstein-Bar virus
  • retrovirus retrovirus
  • lentivirus lentivirus
  • herpes simplex virus herpes simplex virus
  • HVJ hemmaglutinating virus of Japan
  • Moloney murine leukemia virus poxvirus
  • HIV- based virus HIV- based virus
  • modified adeno-associated viral vector compositions and methods useful for performing an intracellular genomic transplant can comprise genetically modifying cells and nucleic acids for therapeutic applications utilizing modified adeno- associated viral vectors.
  • the compositions and methods described throughout can use a mutated or chimeric adeno-associated viral vector for delivering an exogenous cellular receptor in a way that improves physiologic and immunologic potency of an engineered cell.
  • Modified adeno-associated viral vectors can be useful to treat various indications, including for instance cancer (e.g., metastatic cancer) subjects.
  • autologous peripheral blood lymphocytes can be modified using adeno-associated viral methods to express exogenous cellular receptors that recognize unique mutations, neo-antigens, on cancer cells and can be used in the disclosed compositions and methods of an intracellular genomic transplant.
  • adeno-associated vector -modified cells can also comprise a genomic disruption of at least one gene or portion thereof.
  • compositions utilizing mutated and chimeric adeno-associated viral vectors and methods utilizing said AAV vectors for intracellular genomic transplant can provide a cancer therapy with many advantages. For example, they can provide high efficiency gene transfer, expression, increased cell survival rates, an efficient introduction of recombinogenic double strand breaks, and a process that favors the Homology Directed Repair (HDR) over Non-Homologous End Joining (NHEJ) mechanism, and efficient recovery and expansion of homologous recombinants.
  • HDR Homology Directed Repair
  • NHEJ Non-Homologous End Joining
  • Intracellular genomic transplant can be a method of genetically modifying cells and nucleic acids for therapeutic applications.
  • the compositions and methods described throughout can use mutated and chimeric adeno-associated viral vectors to improve upon existing viral delivery mechanisms.
  • Effective adoptive cell transfer-based immunotherapies can be useful to treat various indications including for instance cancer (e.g., metastatic cancer) subjects.
  • cancer e.g., metastatic cancer
  • autologous peripheral blood lymphocytes (PBL) can be modified using modified adeno-associated viral vectors with mutations in at least a portion of a capsid protein or adeno-associated viral vectors with capsid proteins from at least two different serologies.
  • Engineered adeno-associated viral vectors can include mutations in a capsid protein such as any of VP 1, VP2, and VP3. In direct contrast to the current literature, the disclosed modified adeno-associated viral vectors improve upon comparable vectors by enhancing rates of transgene expression in transduced cells.
  • Modified adeno-associated viral vectors as described herein, provide a novel avenue for delivering a payload to a primary cell with an increased degree of transduction efficiency and transgene expression.
  • Modified adeno-associated viral vectors can be combined with various systems of genomic modification, such as CRISPR, to provide engineered cells with at least one genomic disruption and high rates of transgene expression, such as a cellular receptor, for immunotherapy of various conditions, such as cancer.
  • a first step of modifying a primary cell with a modified adeno-associated viral vector can include stimulation of primary cells by contacting primary cells with at least one stimulatory agent.
  • a stimulatory agent for example, to stimulate proliferation of either CD4 T cells or CD8 T cells, an anti-CD3 antibody and an anti-CD28 antibody can be used.
  • the agents providing a signal can be in solution or coupled to a surface.
  • the ratio of particles to cells can depend on particle size relative to the target cell.
  • the cells such as T cells, can be combined wlith agent-coated beads, where the beads and the cells can be subsequently separated, and optionally cultured.
  • Each bead can be coated with either anti-CD3 antibody or an anti-CD28 antibody, or in some cases, a combination of the two.
  • the agent-coated beads and cells prior to culture, are not separated but are cultured together.
  • Cell surface proteins can be ligated by allowing paramagnetic beads to which anti-CD3 and anti-CD28 can be attached (3x28 beads) to contact the T cells.
  • the cells and beads (for example, DYNABEADS ® M-450 CD3/CD28 T paramagnetic beads at a ratio of 1 : 1) are combined in a buffer, for example, phosphate buffered saline (PBS) (e.g., without divalent cations such as, calcium and magnesium). Any cell concentration can be used.
  • PBS phosphate buffered saline
  • Any cell concentration can be used.
  • the mixture can be cultured for or for about several hours (e.g., about 3 hours) to or to about 14 days or any hourly integer value in between.
  • the mixture can be cultured for or for about 21 days or for up to or for up to about 21 days.
  • Conditions appropriate for T cell culture can include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 5, (Lonza)) that can contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-g , IL-4, IL-7, GM-CSF, IL-10, IL-21, IL- 15, TGF beta, and TNF alpha or any other additives for the growth of cells.
  • serum e.g., fetal bovine or human serum
  • IL-2 interleukin-2
  • insulin IFN-g , IL-4, IL-7, GM-CSF, IL-10, IL-21, IL- 15, TGF beta, and TNF alpha or any other additives for the growth of cells.
  • additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol.
  • Media can include RPMI 1640, Al M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or
  • T cells can be supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of T cells.
  • Antibiotics e.g., penicillin and streptomycin
  • the target cells can be maintained under conditions necessary to support growth; for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% C0 2 ).
  • an appropriate temperature e.g., 37° C
  • atmosphere e.g., air plus 5% C0 2
  • T cells that have been exposed to varied stimulation times can exhibit different characteristics.
  • a soluble monospecific tetrameric antibody against human CD3, CD28, CD2, or any combination thereof can be used.
  • cells to undergo genomic transplant can be activated or expanded by co-culturing with tissue or cells.
  • a cell can be an antigen presenting cell.
  • An artificial antigen presenting cells (aAPCs) can express ligands for T cell receptor and costimulatory molecules and can activate and expand T cells for transfer, while improving their potency and function in some cases.
  • An aAPC can be engineered to express any gene for T cell activation.
  • An aAPC can be engineered to express any gene for T cell expansion.
  • An aAPC can be a bead, a cell, a protein, an antibody, a cytokine, or any combination.
  • An aAPC can deliver signals to a cell population that can undergo genomic transplant.
  • an aAPC can deliver a signal 1, signal, 2, signal 3 or any combination.
  • a signal 1 can be an antigen recognition signal.
  • signal 1 can be ligation of a TCR by a peptide-MHC complex or binding of agonistic antibodies directed towards CD3 that can lead to activation of the CD3 signal-transduction complex.
  • Signal 2 can be a co-stimulatory signal.
  • a co- stimulatory signal can be anti-CD28, inducible co-stimulator (ICOS), CD27, and 4-1BB (CD137), which bind to ICOS-L, CD70, and 4-1BBL, respectively.
  • Signal 3 can be a cytokine signal.
  • a cytokine can be any cytokine.
  • a cytokine can be IL-2, IL-7, IL-12, IL-15, IL-21, or any combination thereof. In some cases, IL-2, IL-7, and IL-15 are used to culture cells of the invention.
  • an artificial antigen presenting cell can be used to activate and/or expand a cell population.
  • an aAPC does not induce allospecificity.
  • an aAPC does not express HLA.
  • An aAPC can be genetically modified to stably express genes that can be used in activation and/or stimulation.
  • a K562 cell can be used for activation.
  • a K562 cell can also be used for expansion.
  • a K562 cell can be a human erythroleukemic cell line.
  • a K562 cell can be engineered to express genes of interest.
  • K562 cells do not endogenously express HLA class I, II, or CDld molecules but can express ICAM-1 (CD54) and LFA-3 (CD58).
  • K562 can be engineered to deliver a signal 1 to T cells.
  • K562 cells can be engineered to express HLA class I.
  • K562 cells can be engineered to express additional molecules such as B7, CD80, CD83, CD86, CD32, CD64, 4-1BBL, anti-CD3, anti-CD3 mAb, anti-CD28, anti- CD28mAb, CDld, anti-CD2, membrane-bound IL-15, membrane-bound IL-17, membrane -bound IL-21, membrane-bound IL-2, truncated CD 19, or any combination.
  • an engineered K562 cell can expresses a membranous form of anti-CD3 mAb, clone OKT3, in addition to CD80 and CD83. In some cases, an engineered K562 cell can expresses a membranous form of anti-CD3 mAb, clone OKT3, membranous form of anti-CD28 mAb in addition to CD80 and CD83.
  • An aAPC can be a bead.
  • a spherical polystyrene bead can be coated with antibodies against CD3 and CD28 and be used for T cell activation.
  • a bead can be of any size. In some cases, a bead can be or can be about 3 and 6 micrometers. A bead can be or can be about 4.5 micrometers in size.
  • a bead can be utilized at any cell to bead ratio. For example, a 3 to 1 bead to cell ratio at 1 million cells per milliliter can be used.
  • An aAPC can also be a rigid spherical particle, a polystyrene latex microbeads, a magnetic nano- or micro-particles, a nanosized quantum dot, a 4, poly(lactic-co- glycolic acid) (PLGA) microsphere, a nonspherical particle, a 5, carbon nanotube bundle, a 6, ellipsoid PLGA microparticle, a 7, nanoworms, a fluidic lipid bilayer-containing system, an 8, 2D- supported lipid bilayer (2D-SLBs), a 9, liposome, a 10, RAFTsomes/microdomain liposome, an 11, SLB particle, or any combination thereof.
  • PLGA poly(lactic-co- glycolic acid)
  • an aAPC can expand CD4 T cells.
  • an aAPC can be engineered to mimic an antigen processing and presentation pathway of HLA class II-restricted CD4 T cells.
  • a K562 can be engineered to express HLA-D, DP a, DP ⁇ chains, Ii, DM a, DM ⁇ , CD80, CD83, or any combination thereof.
  • engineered K562 cells can be pulsed with an HLA-restricted peptide in order to expand HLA-restricted antigen-specific CD4 T cells.
  • aAPCs can be combined with exogenously introduced cytokines for T cell activation, expansion, or any combination.
  • Cells can also be expanded in vivo, for example in the subject's blood after administration of genomically transplanted cells into a subject.
  • the methods disclosed herein comprise introducing into a cell one or more nucleic acids (e.g. , a first nucleic acid or a second acid).
  • nucleic acid can generally refer to a substance whose molecules consist of many nucleotides linked in a long chain.
  • Non-limiting examples of the nucleic acid include an artificial nucleic acid analog (e.g., a peptide nucleic acid, a morpholino oligomer, a locked nucleic acid, a glycol nucleic acid, or a threose nucleic acid), a circular nucleic acid, a DNA, a single stranded DNA, a double stranded DNA, a genomic DNA, a mini-circle DNA, a plasmid, a plasmid DNA, a viral DNA, a viral vector, a gamma-retroviral vector, a lentiviral vector, an adeno-associated viral vector, an RNA, short hairpin RNA, psiRNA and/or a hybrid or combination thereof.
  • an artificial nucleic acid analog e.g., a peptide nucleic acid, a morpholino oligomer, a locked nucleic acid, a glycol nucleic acid, or
  • a method can comprise a nucleic acid, and the nucleic acid is synthetic.
  • a sample can comprise a nucleic acid, and the nucleic acid can be fragmented.
  • a nucleic acid is a minicircle.
  • a nucleic acid can encode for a transgene such as an exogenous TCR. An exogenous
  • TCR can bind a cancer cell.
  • Specific epitopes that can be bound by an exogenous TCR can be immunogenic epitopes encoded by mutations in a subject's cancer, for instance as described in
  • a cancer-specific TCR transgene can be inserted into the genome of a cell (e.g. , T cell) using random or specific insertions.
  • an insertion can be a viral insertion.
  • a viral insertion of a transgene can be targeted to a particular genomic site or in other cases a viral insertion of a transgene can be a random insertion into a genomic site.
  • a nucleic acid can readily bind to another nucleic acid (e.g. , the nucleic acid
  • the nucleic acid can comprise an overhang at a first end of the nucleic acid.
  • a sticky end or overhang can refer to a series of unpaired nucleotides at the end of a nucleic acid.
  • the nucleic acid can comprise a single stranded overhang at one or more ends of the nucleic acid.
  • the overhang can occur on the 3 ' end of the nucleic acid.
  • the overhang can occur on the 5 ' end of the nucleic acid.
  • the overhang can comprise any number of nucleotides.
  • the overhang can comprise 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, or 5 or more nucleotides.
  • the nucleic acid can require modification prior to binding to another nucleic acid (e.g., the nucleic acid can need to be digested with an endonuclease).
  • modification of the nucleic acid can generate a nucleotide overhang, and the overhang can comprise any number of nucleotides.
  • the overhang can comprise 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, or 5 or more nucleotides.
  • the nucleic acid can comprise a restriction site, wherein digesting the nucleic acid at the restriction site with a restriction enzyme (e.g. , Notl) produces a 4 nucleotide overhang.
  • the modifying comprises generating a blunt end at one or more ends of the nucleic acid.
  • a blunt end can refer to a double stranded nucleic acid wherein both strands terminate in a base pair.
  • the nucleic acid can comprise a restriction site, wherein digesting the nucleic acid at the restriction site with a restriction enzyme
  • Promoters are sequences of nucleic acid that control the binding of RNA polymerase and transcription factors, and can have a major effect on the efficiency of gene transcription, where a gene can be expressed in the cell, and/or what cell types a gene can be expressed in.
  • Non limiting examples of promoters include a cytomegalovirus (CMV) promoter, an elongation factor 1 alpha
  • EFla simian vacuolating virus
  • SV40 simian vacuolating virus
  • PGK1 phosphogly cerate kinase
  • Ubc ubiquitin C
  • human beta actin promoter a CAG promoter
  • CAG CAG promoter
  • Tetracycline response element (TRE) promoter Tetracycline response element
  • UAS promoter an Actin 5c (Ac5) promoter
  • Ac5 Actin 5c
  • polyhedron promoter an Actin 5c (Ac5) promoter
  • CaMKIIa Ca2+/calmodulin-dependent protein kinase II
  • GAL1 promoter a GAL 10 promoter
  • TEF1 promoter a glyceraldehyde 3-phosphage dehydrogenase
  • GDS GDS
  • ADH1 promoter an ADH1 promoter
  • CaMV35S promoter a CaMV35S promoter
  • Ubi promoter a human polymerase
  • HI III RNA
  • a promoter can be cytomegalovirus (CMV), U6, myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted (MND), or EFla.
  • a promoter can be adjacent to an exogenous TCR sequence.
  • an AAV vector can further comprises a splicing acceptor.
  • the splicing acceptor can be adjacent to the exogenous TCR sequence.
  • a promoter sequence can be a PKG or an MND promoter.
  • An MND promoter can be a synthetic promoter that contains a U3 region of a modified MoMuLV LTR with a myeloproliferative sarcoma virus enhancer.
  • a viral vector can be utilized to introduce a transgene into a cell.
  • a viral vector can be, without limitation, a lentivirus, a retrovirus, or an adeno-associated virus.
  • a viral vector can be an adeno-associated viral vector.
  • an adeno-associated virus can be used to introduce an exogenous transgene, such as a cellular receptor.
  • a viral vector can be isogenic in some cases.
  • a viral vector can be integrated into a portion of a genome with known SNPs in some cases.
  • an adeno-associated viral vector is not be integrated into a portion of a genome with known SNPs.
  • an AAV can be designed to be isogenic or homologous to a subjects own genomic DNA.
  • an isogenic vector can improve efficiency of homologous recombination.
  • a gRNA can be designed so that it does not target a region with known SNPs to improve the expression of an integrated vector transgene.
  • the frequency of SNPs at checkpoint genes, such as PD-1, CISH, AAVS1, and CTLA-4, can be determined.
  • the frequency of SNPs at an endogenous TCR gene can be
  • An adeno-associated virus can be a non-pathogenic single-stranded DNA parvovirus.
  • An AAV can have a capsid diameter of about 26nm.
  • a capsid diameter can also be from about 20nm to about 50nm in some cases.
  • Each end of the AAV single-stranded DNA genome can contain an inverted terminal repeat (ITR), which can be the only cis-acting element required for genome replication and packaging.
  • ITR can be from any AAV serotype.
  • an ITR can be from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12. In some cases, an ITR is from AAV2.
  • the genome carries two viral genes: rep and cap.
  • the virus utilizes two promoters and alternative splicing to generate four proteins necessary for replication (Rep78, Rep 68, Rep 52 and Rep 40), while a third promoter generates the transcript for three structural viral capsid proteins, 1, 2 and 3 (VP1, VP2 and VP3), through a combination of alternate splicing and alternate translation start codons.
  • VPlu is the unique sequence of VP1 (i.e. the sequence that does not overlap with VP2 and/or VP3).
  • the three capsid proteins share the same C-terminal 533 amino acids, while VP2 and VP1 contain additional N-terminal sequences of 65 and 202 amino acids, respectively.
  • a REP protein for example, Rep78, Rep 68, Rep 52 or Rep 40
  • a capsid protein can be modified and utilized in the disclosed compositions and methods.
  • the capsid is comprised of three VPs: VP1,VP2, and VP3.
  • an AAV provided herein comprises an assembly -activating protein (AAP).
  • AAP assembly -activating protein
  • the AAP promotes capsid assembly.
  • an AAV can comprise a AAP polypeptide modified to enhance AAV capsid structure and function, for example by improving capsid assembly.
  • a modified REP protein or capsid protein can provide
  • AAV can undergo 5 steps prior to achieving gene expression: 1) binding or attachment to cellular surface receptors, 2) endocytosis, 3) trafficking to the nucleus, 4) uncoating of the virus to release the genome and 5) conversion of the genome from single-stranded to double- stranded DNA as a template for transcription in the nucleus.
  • the cumulative efficiency with which AAV can successfully execute each individual step can determine the overall transduction efficiency.
  • Rate limiting steps in AAV transduction can include the absence or low abundance of required cellular surface receptors for viral attachment and internalization, inefficient endosomal escape leading to lysosomal degradation, and slow conversion of single-stranded to double-stranded DNA template. Therefore, vectors with modifications to the genome and/or the capsids can be designed to facilitate more efficient or more specific transduction or cells or tissues for gene therapy.
  • Disclosed herein can be a method of identifying an AAV serotype.
  • an AAV serotype In some cases, an AAV
  • serotype can be identified using a PCR approach. Using PCR one can amplify regions of the AAV genome, principally a 255 bp fragment of the capsid gene called the "signature region" in which the 5 ' and 3 ' sequences can be conserved but the central sequence can be variable and unique to each AAV serotype.
  • the signature region can be from about 50 bp, 75 bp, 80 bp, 100 bp, 125 bp, 150 bp, 175 bp, 200 bp, 225 bp, 255 bp, 260 bp, 270 bp, 280 bp, 290 bp, 300 bp, 325 bp, 350 bp, 375 bp, 400 bp, or up to about 450 bp.
  • Primers can be designed to anneal to conserved regions of the Rep and Cap genes to amplify and identify novel AAV serotypes (for instance as shown in Gao et al, 2002).
  • the signature region of AAV can be amplified from genomic DNA.
  • Genomic DNA can be extracted from a mammalian cell or a non-mammalian cell. In some cases, genomic DNA can be extracted from a cell line such as HCT116, HEK293, Jurkat, U-937, NCI-H838, pDG, AAV DJ, or a combination thereof. In some cases, genomic DNA can be extracted from a human cell. Genomic DNA can be extracted from peripheral blood mononuclear cells (PBMCs). Genomic DNA can be extracted from liver, cardiac, brain, kidney, lung, spleen, bone, skin, buccal, blood, saliva, and the like.
  • PBMCs peripheral blood mononuclear cells
  • an AAV viral capsid can be modified.
  • a modification can be of any AAV
  • a modification is of a wildtype AAV6, FIG. 15.
  • a modification can include modifying a combination of capsid components.
  • a mosaic capsid AAV is a virion that can be composed of a mixture of viral capsid proteins from different serotypes. The capsid proteins can be provided by complementation with separate plasmids that are mixed at various ratios. During viral assembly, the different serotypes capsid proteins can be mixed in each virion, at subunit ratios stoichiometrically reflecting the ratios of the complementing plasmids.
  • a mosaic capsid can confer increased binding efficacy to certain cell types or improved performance as compared to an unmodified capsid.
  • a chimeric capsid AAV can be generated.
  • a chimeric capsid can have an insertion of a foreign protein sequence, either from another wild-type (wt) AAV sequence or an unrelated protein, into the open reading frame of the capsid gene.
  • Chimeric modifications can include the use of naturally existing serotypes as templates, which can involve AAV capsid sequences lacking a certain function being co-transfected with DNA sequences from another capsid.
  • a chimera can include at least one cap polypeptide from an AAV serotype chosen from: AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, and AAV12.
  • a viral vector can include a polypeptide comprising a VP1 from an AAV serotype chosen from: AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, and AAV12.
  • a viral vector can include a polypeptide comprising a VP2 from an AAV serotype chosen from: AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, and AAV12.
  • a viral vector can include a polypeptide comprising a VP3 from an AAV serotype chosen from: AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.
  • a viral vector can comprise a chimera with capsids from: AAV4 and AAV6,
  • a first AAV serotypes can be AAV4 and a second serotype can be AAV6.
  • a first AAV serotype and a second AAV serotype of a chimeric AAV vector can be AAV5 and AAV6.
  • a first AAV serotype and a second AAV serotype of a chimeric AAV vector can be AAV1 1 and AAV6.
  • AAV vector can be AAV 12 and AAV6.
  • chimeric capsid can also include the use of an epitope identified from a peptide library inserted into a specific position in the capsid coding sequence. The use of gene library to screen can be performed.
  • a screen of chimeras or mutant AAVs can be performed to identify chimeras and mutants that when used to transduce a cell confer increased transduction efficiency and/or increased expression of a transgene, such as an exogenous receptor.
  • Chimeric capsids in AAV vectors can expand the range of cell types that can be transfected and can increase the efficiency of transduction. Increased transduction or transfection can be from about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250% increase to about a 300% increase as compared to a transduction using an AAV with an unmodified capsid.
  • transduction or transfection can be measured as compared to a wild- type AAV in terms of the detection of a transgene present (as a nucleic acid or polypeptide) on or in a cell.
  • an AAV comprising a chimeric capsid of two different AAV serotypes will have increased transduction efficiency as compared to one of or both of the wild-type AAVs from which the capsid was derived.
  • a chimeric capsid can contain a degenerate, recombined, shuffled or otherwise modified Cap protein. For example targeted insertion of receptor-specific ligands or single-chain antibodies at the N-terminus of VP proteins can be performed.
  • virions having chimeric capsids e.g., capsids containing a degenerate or otherwise modified Cap protein
  • capsids containing a degenerate or otherwise modified Cap protein
  • additional mutations can be introduced into the capsid of the virion.
  • suitable chimeric capsids can have ligand insertion mutations for facilitating viral targeting to specific cell types.
  • AAV capsid mutants including insertion mutants, alanine screening mutants, and epitope tag mutants is described in Wu et al, J. Virol. 74:8635-45, 2000.
  • Methods of making AAV capsid mutants are known, and include site-directed mutagenesis (Wu et al., J. Virol. 72:5919- 5926); molecular breeding, nucleic acid, exon, and DNA family shuffling (Soong et al, Nat. Genet. 25 :436-439, 2000; Coco et al., Nature Biotech. 2001 ; 19:354; and U.S. Pat. Nos. 5,837,458;
  • Transcapsidation can be performed.
  • Transcapsidation can be a process that
  • an AAV vector can be modified.
  • an AAV vector can comprise a modification such as an insertion, deletion, chemical alteration, or synthetic modification.
  • a single nucleotide is inserted into an AAV vector.
  • multiple nucleotides are inserted into a vector. Nucleotides that can be inserted can range from about 1 nucleotide to about 5 kb. Nucleotides that can be inserted can encode for a functional protein. A nucleotide that can be inserted can be endogenous or exogenous to a subject receiving a vector.
  • a human cell can receive an AAV vector that can contain at least a portion of a murine genome, such as a portion of a TCR.
  • a modification such as an insertion or deletion of an AAV vector can comprise a protein coding region or a non-coding region of a vector.
  • a modification can improve activity of a vector when introduced into a cell.
  • a modification can improve expression of protein coding regions of a vector when introduced into a human cell.
  • a host cell can contain sequences which drive expression of a novel AAV capsid protein (or a capsid protein comprising a fragment thereof) in the host cell and rep sequences of the same source as the source of the AAV ITRs, or a cross-complementing source.
  • the AAV cap and rep sequences can be independently obtained from an AAV source as described above and can be introduced into the host cell in any manner known to one in the art as described above.
  • the sequences encoding each of the rep proteins can be supplied by different AAV sources ⁇ e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12).
  • a host cell stably contains the capsid protein under the control of a suitable promoter.
  • a capsid protein can be expressed under the control of an inducible promoter.
  • a capsid protein can be supplied to the host cell in trans.
  • the capsid protein When delivered to the host cell in trans, the capsid protein can be delivered via a plasmid which contains the sequences necessary to direct expression of the selected capsid protein in the host cell.
  • a plasmid carrying a capsid protein also carries other sequences required for packaging the AAV, e.g., the rep sequences.
  • rep and cap sequences can be transfected into a host cell on a single nucleic acid molecule and exist stably in the cell as an episome.
  • the rep and cap sequences are stably integrated into the chromosome of the cell.
  • Another embodiment has the rep and cap sequences transiently expressed in the host cell.
  • a useful nucleic acid molecule for such transfection comprises, from 5' to 3', a promoter, an optional spacer interposed between the promoter and the start site of the rep gene sequence, an AAV rep gene sequence, and an AAV cap gene sequence.
  • helper vectors that provide AAV Rep and Cap proteins for producing stocks of virions composed of an AAV vector (e.g. , a vector encoding an exogenous receptor sequence) and a chimeric capsid (e.g., a capsid containing a degenerate, recombined, shuffled or otherwise modified Cap protein).
  • a modification can involve the production of AAV cap nucleic acids that are modified, e.g. , cap nucleic acids that contain portions of sequences derived from more than one AAV serotype (e.g. , AAV serotypes 1-12).
  • Such chimeric nucleic acids can be produced by a number of mutagenesis techniques.
  • a method for generating chimeric cap genes can involve the use of degenerate oligonucleotides in an in vitro DNA amplification reaction.
  • a protocol for incorporating degenerate mutations (e.g., polymorphisms from different AAV serotypes) into a nucleic acid sequence is described in Coco et al. (Nature
  • top-strand oligonucleotides are constructed that contain polymorphisms
  • degeneracies from genes within a gene family. Complementary degeneracies are engineered into multiple bridging "scaffold" oligonucleotides. A single sequence of annealing, gap-filling, and ligation steps results in the production of a library of nucleic acids capturing every possible permutation of the parental polymorphisms. Any portion of a capsid gene can be mutated using methods such as degenerate homoduplex recombination. Particular capsid gene sequences, however, are preferred. For example, critical residues responsible for binding of an AAV2 capsid to its cell surface receptor heparin sulfate proteoglycan (HSPG) have been mapped.
  • HSPG cell surface receptor heparin sulfate proteoglycan
  • Arginine residues at positions 585 and 588 appear to be critical for binding, as non-conservative mutations within these residues eliminate binding to heparin-agarose.
  • Computer modeling of the AAV2 and AAV4 atomic structures identified seven hypervariable regions that overlap arginine residues 585 and 588, and that are exposed to the surface of the capsid. These hypervariable regions are thought to be exposed as surface loops on the capsid that mediates receptor binding. Therefore, these loops can be used as targets for mutagenesis in methods of producing chimeric virions with tropisms different from WT virions.
  • novel AAV amino acid sequences, peptides and proteins can be expressed from AAV nucleic acid sequences described herein. Additionally, these amino acid sequences, peptides and proteins can be generated by other methods known in the art, including, e.g., by chemical synthesis, by other synthetic techniques, or by other methods. The sequences of any of the AAV capsids provided herein can be readily generated using a variety of techniques. Suitable production techniques are well known to those of skill in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY).
  • peptides can also be synthesized by the well-known solid phase peptide synthesis methods (Merrifield, J. Am. Chem. Soc, 85:2149 (1962); Stewart and Young, Solid Phase Peptide Synthesis (Freeman, San Francisco, Calif.).
  • sequences and proteins described herein can be produced by any suitable means, including recombinant production, chemical synthesis, or other synthetic means. Such production methods are within the knowledge of those of skill in the art.
  • sequences can encode an AAV capsid or engineered AAV vector described herein.
  • vectors can contain, at a minimum, sequences encoding an AAV rep protein or a fragment thereof.
  • vectors can contain both AAV cap and rep proteins.
  • the AAV rep and AAV cap sequences can originate from an AAV of the same clade.
  • provided herein can be vectors in which a rep sequences are from an AAV source which differs from that which is providing the cap sequences.
  • the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector).
  • these rep sequences are fused in frame to cap sequences of a different AAV source to form a chimeric AAV vector.
  • vectors can be vectors packaged in an AAV capsid.
  • These vectors and other vectors described herein can further contain a transgene comprising a selected transgene which is flanked by AAV 5' ITR and AAV 3' ITR.
  • a subject mutant AAV virion can comprise a mutation in at least one capsid protein (e.g., at least one of VP1, VP2, and VP3).
  • at least one of VP1, VP2, and VP3 has at least one amino acid substitution compared to wild-type AAV capsid protein.
  • a mutation can occur in VP1 and VP2, in VP1 and VP3, in VP2 and VP3, or in VP1, VP2, and VP3.
  • a VP can be removed.
  • a mutant AAV does not comprise at least one of VP1, VP2, or VP3.
  • a mutation in a VP1 region can be an F to L mutation.
  • a mutation in a VP1 region can be at position 129 of an AAV VP1 polypeptide sequence encoded by said AAV nucleotide sequence.
  • a VP2 and/or VP3 region can have any number of mutations.
  • a VP1, VP2, and/or VP3 region can have mutations that can include: H to N, D to N, D to N, V to L, and V to I. Mutations in a capsid can occur at positions 418, 462, 584, 598, or 642 of an AAV polypeptide sequence encoded by said AAV nucleotide sequence. Any number of mutations can be performed on an AAV capsid protein or portion thereof.
  • mutations can include at least one of F129L, H642N, and D418N. In some cases, mutations can include at least one of: F129L, H642N, and L584N. In some cases, mutations can include: F129L, H462N, or V598L. In some cases, any of the above mutations can be made, alone or in combination, in a nucleic acid encoding a polypeptide of SEQ ID NO: 20, or a fragment of SEQ ID NO: 20. Likewise, any of the above mutations can be made alone or in combination in a nucleic acid encoding any one of SEQ ID NOS: 21-24, in a position aligning to that in SEQ ID NO: 20.
  • mutations can include at least one of: F129L, H462N, or V598I.
  • Mutations in an AAV capsid can occur at additional locations.
  • mutations in an AAV capsid can occur at positions: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,
  • AAV capsid can be made with reference to the start location of the capsid protein.
  • the AAV capsid comprises three polypeptides encoded by the cap gene (VPl, VP2, and VP3, e.g. of AAV6).
  • VPl polypeptide can be said to comprise
  • VP2 and VP3 regions are formed by alternative splicing from the mRNA transcribed from the cap gene.
  • references to particular positions are with respect to the VPl capsid protein. The skilled worker will appreciate that, where a mutation has been made, at a position that encodes more than one of VPl, VP2, and VP3, this mutation will be present in each of the resultant polypeptides containing an amino acid at that position. The skilled worker will also appreciate that the mutations described herein can be made in an AAV of a selected serotype as described herein at the corresponding position of the capsid of that serotype.
  • a mutation can occur at any of the previously mentioned AAV capsid positions and can include any number of mutations. In some cases, a mutation can be from one amino acid to another amino acid. Any combination or permutation of the canonical amino acids can be performed.
  • Any of the following amino acid modifications can be made at any of VPl, VP2, and VP3: A to R, A to N, A to D, A to C, A to Q, A to E, A to G, A to H, A to I, A to L, A to K, A to M, A to F, A to P, A to S, A to T, A to W, A to Y, A to V, R to N, R to D, R to C, R to Q, R to E, R to G, R to H, R to I, R to L, R to K, R to M, Rto F, R to P, R to S, R to T, R to W, R to Y, R to V, N to D, N to C, N to Q, N to E, N to G, N to H, N to I, N to L, N to K, N to M, N to F, N to P, N to S, N to T, N to W, N to Y, N to V, D to D, N to C, N to
  • a mutation can be a conservative mutation or replacement.
  • 20 naturally occurring amino acids can share similar characteristics.
  • Aliphatic amino acids can be: glycine, alanine, valine, leucine, or isoleucine.
  • Hydroxyl or sulfur/selenium-containing amino acids can be: Serine, cysteine, selenocysteine, threonine, or methionine.
  • a cyclic amino acid can be proline.
  • An aromatic amino acid can be phenylalanine, tyrosine, or tryptophan.
  • a basic amino acid can be histidine, lysine, and arginine.
  • An acidic amino acid can be aspartate, glutamate, asparagine, or glutamine.
  • a conservative mutation can be, serine to glycine, serine to alanine, serine to serine, serine to threonine, serine to proline.
  • a conservative mutation can be arginine to asparagine, arginine to lysine, arginine to glutamine, arginine to arginine, arginine to histidine.
  • a conservative mutation can be Leucine to phenylalanine, leucine to isoleucine, leucine to valine, leucine to leucine, leucine to methionine.
  • a conservative mutation can be proline to glycine, proline to alanine, proline to serine, proline to threonine, proline to proline.
  • a conservative mutation can be threonine to glycine, threonine to alanine, threonine to serine, threonine to threonine, threonine to proline.
  • a conservative mutation can be alanine to glycine, alanine to threonine, alanine to proline, alanine to alanine, alanine to serine.
  • a conservative mutation can be valine to methionine, valine to phenylalanine, valine to isoleucine, valine to leucine, valine to valine.
  • a conservative mutation can be glycine to alanine, glycine to threonine, glycine to proline, glycine to serine, glycine to glycine.
  • a conservative mutation can be Isoleucine to phenylalanine, isoleucine to isoleucine, isoleucine to valine, isoleucine to leucine, isoleucine to methionine.
  • a conservative mutation can be phenylalanine to tryptophan, phenylalanine to phenylalanine, phenylalanine to tyrosine.
  • a conservative mutation can be tyrosine to tryptophan, tyrosine to phenylalanine, tyrosine to tyrosine.
  • a conservative mutation can be cysteine to serine, cysteine to threonine, cysteine to cysteine.
  • a conservative mutation can be histidine to asparagine, histidine to lysine, histidine to glutamine, histidine to arginine, histidine to histidine.
  • a conservative mutation can be glutamine to glutamic acid, glutamine to asparagine, glutamine to aspartic acid, glutamine to glutamine.
  • a conservative mutation can be asparagine to glutamic acid, asparagine to asparagine, asparagine to aspartic acid, asparagine to glutamine.
  • a conservative mutation can be lysine to asparagine, lysine to lysine, lysine to glutamine, lysine to arginine, lysine to histidine.
  • a conservative mutation can be aspartic acid to glutamic acid, aspartic acid to asparagine, aspartic acid to aspartic acid, aspartic acid to glutamine.
  • a conservative mutation can be glutamine to glutamine, glutamine to asparagine, glutamine to aspartic acid, glutamine to glutamine.
  • a conservative mutation can be methionine to phenylalanine, methionine to isoleucine, methionine to valine, methionine to leucine, methionine to methionine.
  • a conservative mutation can be tryptophan to tryptophan, tryptophan to phenylalanine, tryptophan to tyrosine.
  • At least one of VPl, VP2, and VP3 has from one to about 25 amino acid substitutions compared to wild-type AAV VPl, VP2, and VP3, e.g., from about one to about 5, from about 5 to about 10, from about 10 to about 15, from about 15 to about 20, or from about 20 to about 25 amino acid substitutions compared to wild-type AAV VPl, VP2, and VP3.
  • a mutant AAV virion can have from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or up to about 100 mutations in at least a portion of an AAV sequence, such as a capsid sequence.
  • a mutation in a capsid sequence can be within anyone of VPl, VP2, VP3, or combinations thereof. In some cases, a mutant AAV variant can have 1 mutation in a capsid sequence. In some cases, a mutant AAV variant can have 2 mutations in a capsid sequence. In some cases, a mutant AAV variant can have 3 mutations in a capsid sequence.
  • a subject mutant AAV virion comprises one or more amino acid deletions and/or insertions in at least one capsid protein relative to wild-type capsid protein. In some embodiments, a subject mutant AAV virion comprises one or more amino acid substitutions and/or deletions and/or insertions in a capsid protein relative to a wild-type capsid protein.
  • a mutation can be a point mutation. In some cases, at least a portion of an AAV can be mutated.
  • a capsid of an AAV can have a mutation such as a point mutation, missense mutation, nonsense mutation, insertion, deletion, duplication, frameshift, or repeat expansion.
  • a mutant AAV library can be generated that comprises one or more mutations relative to a WT AAV cap gene.
  • a WT cap gene can be a cap comprising a nucleotide sequence as set forth in SEQ ID NOs: 55. Mutations in the AAV cap gene are generated using any known method. Suitable methods for mutagenesis of a starter AAV cap gene include, but are not limited to, a polymerase chain reaction (PCR)- based method, oligonucleotide-directed mutagenesis, saturation mutagenesis, loop- swapping mutagenesis, fragment shuffling mutagenesis (i.e., DNA shuffling), and the like. Methods for generating mutations are well described in the art.
  • PCR polymerase chain reaction
  • Viral particles are generated (thus producing a library of modified AAV virions), and subjected to one or more selection steps to identify a modified AAV virion with an altered property of infection as compared to a WT AAV.
  • Properties of infection that are selected for can include, but are not limited to: 1) altered binding (e.g., decreased binding) to AAV neutralizing antibodies; 2) increased evasion of AAV neutralizing antibodies; 3) increased infectivity of a cell that is resistant to infection with AAV; and 4) increased expression of a transgene in a transduced cell.
  • modified AAV can have increased transfection, transduction, or infectivity function as compared to unmodified cells.
  • modified AAV vectors can function from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or up to about 100% over a comparable WT AAV vector.
  • mutated or chimeric AAV vectors can function over 100% of a WT AAV vector as measured by percent expression of a transgene in a transfected or transduced cell.
  • cells transfected or transduced can function 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, or up to about 5000 % of a comparable cell transfected or transduced with a WT AAV vector encoding a comparable transgene.
  • a mutant AAV library comprising mutations in the cap gene can be generated using a staggered extension process.
  • a staggered extension process can involve amplification of the cap gene using a PCR-based method.
  • the template cap gene can be primed using specific PCR primers, followed by repeated cycles of denaturation and very short annealing/polymerase-catalyzed extension. In each cycle, the growing fragments anneal to different templates based on sequence complementarity and extend further. The cycles of denaturation, annealing, and extension are repeated until full-length sequences form.
  • the resulting full-length sequences include at least one mutation in the cap gene compared to a wild-type AAV cap gene.
  • a modification can be of an AAV serotype 6 capsid. Modifications to a capsid can be single, double, or triple mutations in a capsid sequence.
  • a subject variant AAV capsid protein (or the variant AAV capsid protein encoded by a subject nucleic acid) can comprise homology to any one of the nucleic, SEQ ID NO: 1 to SEQ ID NO: 19, or protein sequences, SEQ ID NO: 267 to SEQ ID NO: 285 of Table 1, from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • a subject mutated or modified vector can comprise homology to any one of the sequences disclosed in Table 12, SEQ ID NO: 195 to SEQ ID NO: 213, from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • Table 1 Modified capsid AAV6 constructs. In bold is the AAV6 rep sequence. In italics is a spacer sequence. The nucleic acid capsid sequence is in uppercase. Boxed sequences refer to an Agel restriction site. Underlined sequences refer to the VPl start. Bold and italisized sequences refer to the
  • VP2 start site Bold and underlined sequences refer to the VP3 start site.
  • a modification can be of an AAV serotype 6 capsid.
  • an AAV capsid protein can be mutated or otherwise modified.
  • AAV capsid proteins that can be mutated can be any one of the viral serotypes of Table 2.
  • a modified AAV capsid can comprise homology to any one of the protein sequences of SEQ ID NO: 20 to SEQ ID NO: 24 or nucleic acid sequences of SEQ ID NO: 286 to SEQ ID NO: 290 from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • a WT AAV, or control AAV can comprise homology to any one of the protein sequences of SEQ ID NO: 20 to SEQ ID NO: 24 or nucleic acid sequences of SEQ ID NO: 286 to SEQ ID NO: 290 from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • a subject mutated or modified vector can comprise homology to any one of the sequences disclosed in Table 13, SEQ ID NO: 214 to SEQ ID NO: 220 from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • Table 2 WT AAV capsid sequences
  • a modification can be of an AAV serotype 6 capsid.
  • a subject in some cases, can be of an AAV serotype 6 capsid.
  • variant AAV capsid protein (or the variant AAV capsid protein encoded by a subject nucleic acid) can comprise homology to any one of the protein, SEQ ID NO: 25 to SEQ ID NO: 32, or nucleic acid sequences, SEQ ID NO: 291 to SEQ ID NO: 297, in Table 3 from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • AAV4VP1 MTDGYLPDWLEDNLSEGVREWW 294 atgactgacggttaccttcc /2 - ALQPGAPKPKANQQHQDNARGL agattggctagaggacaacc
  • GNLGRAVFQAKKRVLEPLGLVE atcaacaacatcaggacaac QAGETAPGKKRPLIESPQQPDS gctcggggtcttgtgcttcc STGIGKKGKQPAKKKLVFEDET gggttacaaatacctcggac GAGDGPPEGSTSGAMSDDSEMA ccggcaacggactcgacaag SGGGAPMADNNEGADGVGNASG ggggaacccgtcaacgcagc NWHCDSTWLGDRVITTSTRTWA ggacgcggcagccctcgagc LPTYNNHLYKQISSASTGASND acgacaaggcctacgaccag NHYFGYSTPWGYFDFNRFHCHF cagctcaaggccggtgacaa SPRDWQRLINNNWGFRPKRLNF cccctacctcaagtacaacc K
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F 129L and L584D in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F 129L and D418N in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F129L and L584H in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F129L, H642N, and D418N in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F 129L, H642N, and L584D in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F 129L, H642N, and L584N in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F 129L, H642N and L584H in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F129L, H642N, and V598L in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • An isolated and purified adeno-associated virus (AAV) nucleic acid sequence can have mutations F129L, H642N, and V598I in the corresponding polypeptide sequence of an AAV capsid nucleic acid sequence.
  • DNA shuffling Another mutagenesis technique that can be used in methods of the invention is DNA shuffling.
  • DNA or gene shuffling involves the creation of random fragments of members of a gene family and their recombination to yield many new combinations.
  • To shuffle AAV capsid genes several parameters can be considered, including: involvement of the three capsid proteins VP 1, VP2, and VP3 and different degrees of homologies between 8 serotypes.
  • a shuffling protocol yielding a high diversity and large number of permutations is preferred.
  • a DNA shuffling protocol for the generation of chimeric AAV is random chimeragenesis on transient templates (RACHITT), Coco et al., Nat. Biotech. 19:354-358, 2001.
  • the RACHITT method can be used to recombine two PCR fragments derived from AAV genomes of two different serotypes (e.g., AAV 5d AAV6).
  • conservative regions of the cap gene segments that are 85% identical, spanning approximately 1 kbp and including initiating codons for all three genes (VP1, VP2, and VP3) can be shuffled using a RATCHITT or other DNA shuffling protocol, including in vivo shuffling protocols (U.S. Pat. No.
  • a resulting combinatorial chimeric library can be cloned into a suitable AAV TR-containing vector to replace the respective fragment of the WT AAV genome.
  • Random clones can be sequenced and aligned with parent genomes using AlignX application of Vector NTI 7 Suite Software. From the sequencing and alignment, the number of recombination crossovers per 1 Kbp gene can be determined. Alternatively, the variable domain of AAV genomes can be shuffled using methods of the invention.
  • mutations can be generated within two amino acid clusters (amino acids 509-522 and 561-591) of AAV that likely form a particle surface loop in VP3.
  • amino acids 509-522 and 561-591 amino acids 509-522 and 561-591
  • recombination protocols can be utilized that are independent of parent's homology (Ostermeier et al, Nat. Biotechnol. 17: 1205-1209, 1999; Lutz et al.,
  • a targeted mutation of S/T/K residues on an AAV capsid can be performed.
  • AAV Following cellular internalization of AAV by receptor-mediated endocytosis, it can travel through the cytosol, undergoing acidification in the endosomes before getting released. Post endosomal escape, AAV undergoes nuclear trafficking, where uncoating of the viral capsid takes place resulting in release of its genome and induction of gene expression. S/T/K residues are potential sites for phosphorylation and subsequent poly-ubiquitination which serves as a cue for proteasomal degradation of capsid proteins. This can prevent trafficking of the vectors into the nucleus to express its transgene, an exogenous TCR, leading to low gene expression.
  • the proteasomally degraded capsid fragments can be presented by the MHC-Class I molecules on the cell surface for CD8 T-cell recognition. This leads to immune response thus destroying the transduced cells and further reducing persistent transgene expression. Point mutations, S/T to A and K to R, can prevent/reduce phosphorylation sites on the capsid. This can lead to reduced ubiquitination and proteosomal degradation allowing more number of intact vectors to enter nucleus and express the transgene. Preventing/lowering the overall capsid degradation also reduces antigen presentation to T cells resulting in lower host immune response against the vectors.
  • an engineered AAV can include exogenous sequences from alternate serotypes.
  • a chimeric AAV can be generated that can include sequences from at least 2 different AAV serotypes.
  • serotype can be a distinction with respect to an AAV having a capsid which is serologically distinct from other AAV serotypes.
  • Serologic distinctiveness can be determined on the basis of the lack of cross-reactivity between antibodies to the AAV as compared to other AAV.
  • Cross-reactivity can be measured in a neutralizing antibody assay.
  • polyclonal serum can be generated against a specific AAV in a rabbit or other suitable animal model using the adeno-associated viruses.
  • serum generated against a specific AAV can then be tested in its ability to neutralize either the same (homologous) or a heterologous AAV.
  • the dilution that achieves 50% neutralization is considered the neutralizing antibody titer. If for two AAVs the quotient of the heterologous titer divided by the homologous titer is lower than 16 in a reciprocal manner, those two vectors are considered as the same serotype. Conversely, if the ratio of the heterologous titer over the homologous titer is 16 or more in a reciprocal manner the two AAVs are considered distinct serotypes. 208] In some cases, a modification can be of an AAV serotype 6 capsid.
  • a subject variant AAV capsid protein (or the variant AAV capsid protein encoded by a subject nucleic acid) can comprise homology to any one of the nucleic acid sequences and/or protein sequences encoded therefrom in Table 4, SEQ ID NO: 38 to SEQ ID NO: 45, from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • AAV5VP1_2 ggtaccaaaacaaatgttctcgtcacgtgggcatgaatctgatgctgtttt ccctgcagacaatgcgagagaatgaatcagaattcaaatatctgcttcac -AAV6VP3
  • a modification can be of an AAV serotype 6 capsid.
  • a subject in some cases, can be of an AAV serotype 6 capsid.
  • variant AAV capsid protein (or the variant AAV capsid protein encoded by a subject amino acid) can comprise homology to any one of of the protein or nucleic acid sequences of Table 5 from about
  • AAV5 TTTFQKERRLGPKRTPSLPPR 300 ACGACCACTTTCCAAAAAGA
  • RGSTLKRTLEPETDPLKDQIP TCCTCCTCGGGCATCGGCAA APCLQTLKCVQHRAEMLSMRD AAAAGGCAAACAACCAGCCA KVPMEWVMPRVIGIAIPPGLR GAAAGAGGCTCAACTTTGAA ARSQQPRPEPGSCPPTTTTCT GAGGACACTGGAGCCGGAGA CVSEQHQAATPTTDSPPPGDI CGGACCCCCTGAAGGATCAG LTSTDSTVTSHHVTGKDSSTT ATACCAGCGCCATGTCTTCA TGDYDQKPCALKSSISKLRRS GACATTGAAATGCGTGCAGC QRRTARLRSLITLPARFRYLR ACCGGGCGGAAATGCTGTCG TRRMSSRT ATGCGGGACAAGGTTCCGAT GGAGTGGGTAATGCCTCGGG TGATTGGCATTGCGATTCCA CCTGGTCTGAGGGCAAGGTC ACAACAACCTCGACCAGAAC CTGGGTCTTGCCCACCTACA ACAACCACTTGTACCTGC
  • AAV12 KRLQIGRPTRTLGRPRPRKSK 302 AAAAGACTCCAAATCGGCCG
  • KRSSFSKTKLEQATDPLRDQL TTGAATCCCCCCAGCAGCCC
  • AAV6VP3 TKAPTEWVMPQEIGIAIPHGW CAAAAAAGGCAAGCAGCCGG
  • AAV5VP1 TTTFQKERRLGPKRTPSLPPR 304 ACGACCACTTTCCAAAAAGA
  • proteins can include AAV capsid proteins, which are encoded by the nucleotide sequences identified above.
  • An AAV capsid can be composed of three proteins, vpl, vp2 and vp3, which can be alternative splice variants.
  • Other desirable fragments of the capsid protein include the constant and variable regions, located between hypervariable regions (HVR).
  • HVR hypervariable regions
  • fragments of a capsid protein include the HVR themselves.
  • an AAV vector comprising a nucleotide sequence of interest flanked by AAV ITRs can be constructed by directly inserting heterologous sequences into an AAV vector.
  • These constructs can be designed using techniques well known in the art. See, e.g., Carter B., Adeno- associated virus vectors, Curr. Opin. Biotechnol., 3:533-539 (1992); and Kotin RM, Prospects for the use of adeno-associated virus as a vector for human gene therapy, Hum Gene Ther 5:793-801 (1994).
  • an AAV expression vector comprises a heterologous nucleic acid
  • AAV virion can be constructed using methods that are well known in the art. See, e.g. , Koerber et al. (2009) Mol. Ther. 17:2088; Koerber et al. (2008) Mol Ther.16: 1703-1709; U.S. Patent Nos. 7,439,065 and 6,491 ,907.
  • exogenous or heterologous sequence(s) can be inserted into an AAV genome wherein its major AAV open reading frames have been excised therefrom.
  • Other portions of the AAV genome can also be deleted, which certain portions of the ITRs remain intact to support replication and packaging functions.
  • Such constructs can be designed using techniques well known in the art. See, e.g., U.S. Pat. Nos. 5, 173,414 and 5, 139,941 ; Lebkowski et al. ( 1988) Molec. Cell. Biol.
  • Disclosed herein can be a method of generating a variant AAV capsid protein from a WT capsid protein, the method comprising: subjecting a nucleic acid that comprises a nucleotide sequence encoding a WT capsid protein to a type of mutagenesis selected from the group consisting of:
  • a screen can be performed to isolate highly effective mutated AAV from a plurality of mutated AAVs.
  • a screen can include a flow cytometry assay to determine a mutated or chimeric AAV that is able to transduce a primary cell at a greater efficiency as compared to a WT AAV.
  • a mutated or chimeric AAV capsid protein (or any variant AAV capsid protein encoded by a subject nucleic acid) can be said to confer to an infectious AAV virion an increased transduction of mammalian cells compared to the transduction exhibited by a wild type AAV (e.g., AAV6 (wild type AAV serotype 6)) or an AAV comprising a wild-type capsid protein.
  • AAV6 wild type AAV serotype 6
  • the increased transduction is at least about 1.5-fold (e.g., at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5- fold, at least about 7.5-fold, at least about 10-fold, at least about 12-fold, at least about 15-fold, at least about 17-fold, at least about 20-fold, at least about 25 -fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75 -fold, at least about 100-fold, at least about 150-fold, at least about 200-fold, at least about 250-fold, at least about 300-fold, etc.) greater than the transduction exhibited by a wild type AAV (e.g., AAV6 (wild type AAV serotype 6)) or an AAV comprising a wild-type capsid protein.
  • AAV6 wild type AAV serotype 6
  • the increased transduction is at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or up to about 100% greater than the transduction exhibited by a wild type AAV (e.g., AAV6 (wild type AAV serotype 6)) or an AAV comprising a wild-type capsid protein as measured by the detection of a transgene by flow cytometry.
  • AAV6 wild type AAV serotype 6
  • an increased transfection can be at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or up to about 100% greater than the transfection exhibited by a wild type AAV (e.g., AAV6 (wild type AAV serotype 6)) or an AAV comprising a wild-type capsid protein as measured by the detection of a transgene by flow cytometry.
  • Transduction and transfection can be detected on a producer cell, such as a 293T cell, or in a primary cell, such as a lymphocyte (e.g., a tumor infiltrating lymphocyte).
  • the increased transduction or transfection is at least about 5% -10%, 15%- 20%, 25% -30%, 35% - 40%, 45%- 50%, 55%-60%, 65%-70%, 75%- 80%, 85%-90%, 95% or up to about 100% greater than the transduction exhibited by a wild type AAV (e.g., AAV6 (wild type AAV serotype 6)) or an AAV comprising a wild-type capsid protein as measured by the detection of a transgene by flow cytometry.
  • Transfection or transduction efficiency can be detected by an in vitro assay such as PCR, qPCR, intracellular staining, flow cytometry, quantitative western blotting, and ELISA, to name a few.
  • a subject variant AAV capsid protein (or the variant AAV capsid protein encoded by a subject nucleic acid) exhibits decreased binding to a neutralizing antibody that binds a wild-type AAV capsid protein.
  • a subject variant AAV capsid protein can exhibit at least about 1.5-fold (e.g., at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 7.5-fold, at least about 10-fold, at least about 12-fold, at least about 15 -fold, at least about 17-fold, at least about 20-fold, at least about 25 -fold, at least about 30- fold, at least about 40-fold, at least about 50-fold, at least about 75 -fold, at least about 100- fold, at least about 150-fold, at least about 200-fold, at least about 250-fold, at least about 300-fold, etc.) reduced binding (e.g., reduced affinity) to a neutralizing antibody that binds a wild-type capsid AAV protein, compared to the binding affinity of the antibody to wild-type AAV capsid protein.
  • reduced binding e.g., reduced affinity
  • the present application provides methods and materials for producing recombinant AAVs that can express one or more proteins of interest in a cell. As described herein, the methods and materials disclosed herein allow for high production or production of the proteins of interest at levels that would achieve a therapeutic effect in vivo.
  • An example of a protein of interest is an exogenous receptor.
  • An exogenous receptor can be a TCR.
  • an AAV expression vector is introduced into a suitable host cell using known techniques, such as by transfection.
  • Transfection techniques are known in the art. See, e.g. , Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981 ) Gene 13: 197.
  • Suitable transfection methods include calcium phosphate co-precipitation, direct micro-injection, electroporation, liposome mediated gene transfer, and nucleic acid delivery using high-velocity microprojectiles, which are known in the art.
  • methods for producing a recombinant AAV include providing a packaging cell line with a viral construct comprising a 5' inverted terminal repeat (ITR) of AAV and a 3' AAV ITR, such as described herein, helper functions for generating a productive AAV infection, and AAV cap genes; and recovering a recombinant AAV from the supernatant of the packaging cell line.
  • ITR inverted terminal repeat
  • Various types of cells can be used as the packaging cell line.
  • packaging cell lines that can be used include, but are not limited to, HEK 293 cells, HeLa cells, and Vero cells to name a few.
  • supernatant of the packaging cell line is treated by PEG precipitation for concentrating the virus.
  • a centrifugation step can be used to concentrate a virus.
  • a column can be used to concentration a virus during a centrifugation.
  • a precipitation occurs at no more than about 4° C. (for example about 3° C, about 2° C, about 1° C, or about 1° C.) for at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 6 hours, at least about 9 hours, at least about 12 hours, or at least about 24 hours.
  • the recombinant AAV is isolated from the PEG-precipitated supernatant by low-speed centrifugation followed by CsCl gradient.
  • the low-speed centrifugation can be to can be about 4000 rpm, about 4500 rpm, about 5000 rpm, or about 6000 rpm for about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes or about 60 minutes.
  • recombinant AAV is isolated from the PEG-precipitated supernatant by centrifugation at about 5000 rpm for about 30 minutes followed by CsCl gradient.
  • CsCl purification can be replaced with IDX gradient ultracentrifugation.
  • Supernatant can be collected at about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, or a time between any of these two time points after a transfection.
  • Supernatant can also be purified, concentrated, or a combination thereof.
  • a concentration or viral titer can be determined by qPCR or silver stain.
  • a viral titer can be from about 10 vp/mL, 10 vp/mL, 10 vp/mL, 10 vp/mL, 10 vp/mL, 10 vp/mL, 10 8 vp/mL, or up to about 10 9 vp/mL.
  • a viral titer can be from about 10 2 GC/mL, 10 3 GC/mL, 10 4 GC/mL, 10 5 GC/mL, 10 6 GC/mL, 10 7 GC/mL, 10 8 GC/mL, or up to about 10 9 GC/mL.
  • a viral titer can be from about 10 2 TU/mL, 10 3 TU/mL, 10 4 TU/mL, 10 5 TU/mL, 10 6 TU/mL, 10 7 TU/mL, 10 8 TU/mL, or up to about 10 9 TU/mL.
  • An optimal viral titer can vary depending on cell type to be transduced.
  • a range of virus can be from about 1000 MOI to 2000 MOI, from 1500 MOI to 2500 MOI, from 2000 MOI to 3000 MOI, from 3000 MOI to 4000 MOI, from 4000 MOI to 5000 MOI, from 5000 MOI to 6000 MOI, from 6000 MOI to 7000MOI, from 7000 MOI to 8000 MOI, from 8000 MOI to 9000 MOI, from 9000 MOI to 10,000 MOI.
  • plasmids or viruses into a host cell can also be accomplished using techniques known to the skilled artisan and as discussed throughout the specification. In some cases, standard transfection techniques are used, e.g., CaP0 4 transfection or electroporation, and/or infection by hybrid adenovirus/AAV vectors into cell lines such as the human embryonic kidney cell line HEK 293 (a human kidney cell line containing functional adenovirus El genes which provides trans-acting El proteins).
  • HEK 293 a human kidney cell line containing functional adenovirus El genes which provides trans-acting El proteins.
  • novel AAV sequences of the invention can be readily adapted for use in these and other viral vector systems for in vitro, ex vivo or in vivo gene delivery.
  • helper functions are provided by one or more helper plasmids or helper viruses comprising adenoviral helper genes.
  • adenoviral helper genes include E1A, E1B, E2A, E4 and VA, which can provide helper functions to AAV packaging.
  • an AAV cap gene can be present in a plasmid.
  • a plasmid can further comprise an AAV rep gene.
  • Serology can be defined as the inability of an antibody that is reactive to the viral capsid proteins of one serotype in neutralizing those of another serotype.
  • a cap gene and/or rep gene from any AAV serotype can be used herein to produce the recombinant AAV disclosed herein to express one or more proteins of interest.
  • An adeno-associated virus can be AAV5 or AAV6 or a variant thereof.
  • an AAV cap gene can encode a capsid from serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, or a variant thereof.
  • a packaging cell line can be transfected with the helper plasmid or helper virus, the viral construct and the plasmid encoding the AAV cap genes; and the recombinant AAV virus can be collected at various time points after co-transfection. For example, the recombinant AAV virus can be collected at about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, or a time between any of these two time points after the co-transfection.
  • a modification can be of an AAV serotype 6 capsid.
  • a subject in some cases, can be of an AAV serotype 6 capsid.
  • variant AAV capsid protein (or the variant AAV capsid protein encoded by a subject nucleic acid) can be compared to a WT AAV, such as AAV6, that can comprise homology to SEQ ID NO: 55 from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • WT AAV such as AAV6
  • AAV6 can comprise homology to SEQ ID NO: 55 from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or up to 100%.
  • a method of screening a plurality of engineered adeno associated viral (AAV) particles can comprise: introducing at least one of a mutation or exogenous AAV genome to a genome of an adeno-associated virus (AAV) nucleotide sequence to form engineered AAV particles.
  • engineered AAV particles are then introduced to a plurality of cellular genomes.
  • a screen can comprise comparing a level of expression of a transgene encoded by a plurality of AAV particles in a plurality of cellular genomes in different mutation or chimeric AAV variants.
  • a level of expression of a transgene is quantified.
  • a level of persistence of a transgene in a cellular population is quantified.
  • a screening method can involve performing a titration experiment of a viral
  • cells can be transduced using AAV supernatant from modified AAV viruses, mutated or chimeric; to determine a degree of infectivity of viral particles from modified AAV viruses.
  • an MOI can be titrated from lxlO 6 GC/mL to 200 GC/mL.
  • An output such as expression of a transgene on a transduced cell can be quantified to determine a mutant or chimera that can be selected.
  • Helper viruses of AAV are known in the art and include, for example, viruses from the family Adenoviridae and the family Herpesviridae.
  • helper viruses of AAV include, but are not limited to, SAdV-13 helper virus and SAdV-13-like helper virus described in US Publication No. 20110201088, helper vectors pHELP (Applied Viromics).
  • SAdV-13 helper virus and SAdV-13-like helper virus described in US Publication No. 20110201088 helper vectors pHELP (Applied Viromics).
  • helper vectors pHELP Applied Viromics
  • a skilled artisan will appreciate that any helper virus or helper plasmid of AAV that can provide adequate helper function to AAV can be used herein.
  • the recombinant AAV viruses disclosed herein can also be produced using any convention methods known in the art suitable for producing infectious recombinant AAV.
  • a recombinant AAV can be produced by using a cell line that stably expresses some of the necessary components for AAV particle production.
  • a plasmid (or multiple plasmids) comprising AAV rep and cap genes, and a selectable marker, such as a neomycin resistance gene, can be integrated into the genome of a cell (the packaging cells).
  • the packaging cell line can then be co-infected with a helper virus (e.g. , adenovirus providing the helper functions) and the viral vector comprising the 5' and 3' AAV ITR and the nucleotide sequence encoding the protein(s) of interest.
  • helper virus e.g. , adenovirus providing the helper functions
  • adenovirus or baculovirus rather than plasmids can be used to introduce rep and cap genes into packaging cells.
  • both the viral vector containing the 5' and 3' AAV ITRs and the rep-cap genes can be stably integrated into the DNA of producer cells, and the helper functions can be provided by a wild-type adenovirus to produce the recombinant AAV.
  • a packaging plasmid can contain all the necessary viral proteins on one plasmid to enable packing of an ITR-flanked donor template into replication-incompetent virus particles.
  • Suitable host cells that can be used to produce AAV virions or viral particles include yeast cells, insect cells, microorganisms, and mammalian cells. Various stable human cell lines can be used, including, but not limited to, 293 cells. Host cells can be engineered to provide helper functions in order to replicate and encapsidate nucleotide sequences flanked by AAV ITRs to produce viral particles or AAV virions. AAV helper functions can be provided by AAV-derived coding sequences that are expressed in host cells to provide AAV gene products in trans for AAV replication and packaging. AAV virus can be made replication competent or replication deficient. In general, a replication-deficient AAV virus lacks one or more AAV packaging genes.
  • Cells can be contacted with viral vectors, viral particles, or virus as described herein in vitro, ex vivo, or in vivo.
  • cells that are contacted in vitro can be derived from established cell lines or primary cells derived from a subject, either modified ex vivo for return to the subject, or allowed to grow in culture in vitro.
  • a virus is used to deliver a viral vector into primary cells ex vivo to modify the cells, such as introducing an exogenous nucleic acid sequence, a transgene, or an engineered cell receptor in an immune cell, or a T cell in particular, followed by expansion, selection, or limited number of passages in culture before such modified cells are returned back to the subject.
  • such modified cells are used in cell-based therapy to treat a disease or condition, including cancer.
  • an engineered AAV is not a self-complementary AAV (scAAV).
  • the recombinant can be isolated and purified from packaging cells and/or the supernatant of the packaging cells.
  • the AAV can be purified by separation method using a CsCl gradient.
  • 20020136710 describes another non-limiting example of method for purifying AAV, in which AAV was isolated and purified from a sample using a solid support that includes a matrix to which an artificial receptor or receptor-like molecule that mediates AAV attachment is immobilized.
  • a population of cells can be transduced with a viral vector, an AAV for example.
  • a transduction with a virus can occur before a genomic disruption with a CRISPR system or after a genomic disruption with a CRISPR system.
  • a genomic disruption with a CRISPR system can facilitate integration of an exogenous polynucleic acid into a portion of a genome.
  • a CRISPR system can be used to introduce a double strand break in a portion of a genome comprising a gene, such as an immune checkpoint gene or a safe harbor gene or portion thereof.
  • a double strand break can be repaired by introducing an exogenous receptor sequence delivered to a cell by a viral vector, an AAV in some cases.
  • An AAV can comprise a polynucleic acid with recombination arms to a portion of a gene disrupted by a CRISPR system.
  • a CRISPR system can introduce a double strand break at a CISH gene.
  • a CISH gene can then be repaired by introduction of a transgene encoding an exogenous TCR, wherein a transgene can be flanked by recombination arms with regions complementary to a portion of a genome previously disrupted by a CRISPR system.
  • a population of cells comprising a genomic disruption and a viral introduction can be transduced.
  • a transduced population of cells can be from about 5% to about 100%.
  • transgenes of the methods described herein can be inserted randomly into the
  • transgenes can be functional if inserted anywhere in a genome.
  • a transgene can encode its own promoter or can be inserted into a position where it is under the control of an endogenous promoter.
  • a transgene can be inserted into a gene, such as an intron of a gene, an exon of a gene, a promoter, or a non-coding region.
  • a nucleic acid e.g., RNA, encoding a transgene sequences can be randomly inserted into a
  • a random integration can result from any method of introducing a nucleic acid, e.g., RNA, into a cell.
  • the method can be, but is not limited to, electroporation, sonoporation, use of a gene gun, lipotransfection, calcium phosphate transfection, use of dendrimers, microinjection, and use of viral vectors including adenoviral, AAV, and retroviral vectors, and/or group II ribozymes.
  • RNA encoding a transgene can also be designed to include a reporter gene so that the presence of a transgene or its expression product can be detected via activation of the reporter gene.
  • Any reporter gene can be used, such as those disclosed above. By selecting in cell culture those cells in which a reporter gene has been activated, cells can be selected that contain a transgene.
  • a transgene to be inserted can be flanked by engineered sites analogous to a targeted double strand break site in the genome to excise the transgene from a polynucleic acid so it can be inserted at the double strand break region.
  • a transgene can be virally introduced in some cases.
  • an AAV virus can be utilized to infect a cell with a transgene.
  • Flow cytometry can be utilized to measure expression of an integrated transgene by an AAV virus.
  • integration of a transgene by an AAV virus does not induce cellular toxicity.
  • cellular viability as measured by flow cytometry of a cellular population engineered utilizing an AAV virus can be from about 30% to 100% viable.
  • Cellular viability as measured by flow cytometry of an engineered cellular population can be from about 30%, 40%, 50%, 60%, 70%, 80%, 90%, to about 100%.
  • an AAV virus can introduce a transgene into the genome of a cell.
  • An integrated transgene can be expressed by an engineered cell from immediately after genomic introduction to the duration of the life of an engineered cell.
  • an integrated transgene can be measured from about 0.1 min after introduction into a genome of a cell up, 1 hour to 5 hours, 5 hours to 10 hours, 10 hours to 20 hours, 20 hours to 1 day, 1 day to 3 days, 3 days to 5 days, 5 days to 15 days, 15 days to 30 days, 30 days to 50 days, 50 days to 100 days, or up to 1000 days after the initial introduction of a transgene into a cell.
  • Expression of a transgene can be detected from 3 days.
  • Expression of a transgene can be detected from 7 days.
  • Expression of a transgene can be detected from about 4 hours, 6 hours, 8 hours, 12 hours, 18 hours, to about 24 hours after introduction of a transgene into a genome of a cell.
  • viral titer can influence the percent of transgene expression.
  • a viral vector such as an AAV viral vector, containing a gene of interest or a transgene as described herein can be inserted randomly into a genome of a cell following transfection of the cell by a viral particle containing the viral vector.
  • random sites for insertion include genomic sites with a double strand break.
  • Some viruses, such as retrovirus, comprise factors, such as integrase, that can result in random insertions of the viral vector.
  • a modified or engineered AAV virus can be used to introduce a transgene to a cell.
  • a modified or wildtype AAV can comprise homology arms to at least one genomic location.
  • An R A encoding a transgene can be introduced into a cell via electroporation.
  • RNA can also be introduced into a cell via lipofection, infection, or transformation. Electroporation and/or lipofection can be used to transfect primary cells. Electroporation and/or lipofection can be used to transfect primary hematopoietic cells.
  • RNA can be reverse transcribed within a cell into DNA.
  • a DNA substrate can then be used in a homologous recombination reaction.
  • a DNA can also be introduced into a cell genome without the use of homologous recombination.
  • a DNA can be flanked by engineered sites that are complementary to the targeted double strand break region in a genome.
  • a DNA can be excised from a polynucleic acid so it can be inserted at a double strand break region without homologous recombination.
  • Expression of a transgene can be verified by an expression assay, for example, qPCR or by
  • RNA expression level can be indicative also of copy number. For example, if expression levels are extremely high, this can indicate that more than one copy of a transgene was integrated in a genome. Alternatively, high expression can indicate that a transgene was integrated in a highly transcribed area, for example, near a highly expressed promoter. Expression can also be verified by measuring protein levels, such as through Western blotting.
  • a splice acceptor assay can be used with a reporter system to measure transgene integration. For example, a splice acceptor can show expression when successfully integrated into a genome and under the control of an endogenous promoter. In some cases, a splice acceptor assay can be used with a reporter system to measure transgene integration when a transgene is introduced to a genome using an AAV system.
  • Inserting one or more transgenes in any of the methods disclosed herein can be site-specific.
  • one or more transgenes can be inserted adjacent to or near a promoter.
  • one or more transgenes can be inserted adjacent to, near, or within an exon of a gene (e.g. , PD-1 gene).
  • Such insertions can be used to knock-in a transgene (e.g. , cancer-specific TCR transgene) while simultaneously disrupting another gene (e.g. , PD-1 gene).
  • one or more transgenes can be inserted adjacent to, near, or within an intron of a gene.
  • a transgene can be introduced by an AAV viral vector and integrate into a targeted genomic location.
  • an AAV vector can be utilized to direct insertion of a transgene into a certain location.
  • a transgene can be integrated into at least a portion of a CTLA4, PD-1, AAVS l, or CISH gene by an AAV.
  • Modification of a targeted locus of a cell can be produced by introducing DNA into cells, where the DNA has homology to the target locus.
  • DNA can include a marker gene, allowing for selection of cells comprising the integrated construct.
  • Complementary DNA in a target vector can recombine with a chromosomal DNA at a target locus.
  • a marker gene can be flanked by complementary DNA sequences, a 3' recombination arm, and a 5' recombination arm.
  • Multiple loci within a cell can be targeted. For example, transgenes with recombination arms specific to 1 or more target loci can be introduced at once such that multiple genomic modifications occur in a single step.
  • recombination arms or homology arms to a particular genomic site can be from about 0.2 kb to about 5 kb in length.
  • Recombination arms can be from about 0.2 kb, 0.4 kb 0.6 kb, 0.8 kb, 1.0 kb, 1.2 kb, 1.4 kb, 1.6 kb, 1.8 kb, 2.0kb, 2.2 kb, 2.4 kb, 2.6 kb, 2.8 kb, 3.0 kb, 3.2 kb, 3.4 kb, 3.6 kb, 3.8 kb, 4.0 kb, 4.2 kb, 4.4 kb, 4.6kb, 4.8 kb, to about 5.0kb in length.
  • Recombination arms can also be from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 1 1 1, 112, 1 13, 1 14, 1 15, 1 16, 1
  • a variety of enzymes can catalyze insertion of foreign DNA into a host genome.
  • site-specific recombinases can be clustered into two protein families with distinct biochemical properties, namely tyrosine recombinases (in which DNA is covalently attached to a tyrosine residue) and serine recombinases (where covalent attachment occurs at a serine residue).
  • recombinases can comprise Cre, fC31 integrase (a serine recombinase derived from Cre, fC31 integrase (a serine recombinase derived from
  • Streptomyces phage fC31 Streptomyces phage fC31
  • bacteriophage derived site-specific recombinases including Flp, lambda integrase, bacteriophage HK022 recombinase, bacteriophage R4 integrase and phage TP901- 1 integrase.
  • Expression control sequences can also be used in constructs.
  • an expression control sequence can comprise a constitutive promoter, which is expressed in a wide variety of cell types.
  • Tissue-specific promoters can also be used and can be used to direct expression to specific cell lineages.
  • Site specific gene editing can be achieved using non-viral gene editing such as CRISPR, TALEN (see U.S. Pat. Nos. 14/193,037), transposon-based, ZFN, meganuclease, or Mega-TAL, or
  • Transposon-based system For example, PiggyBac (see Moriarty, B.S., et al, "Modular assembly of transposon integratable multigene vectors using RecWay assembly," Nucleic Acids Research (8):e92 (2013) or sleeping beauty (see Aronovich, E.L, et al., "The Sleeping Beauty transposon system: a non-viral vector for gene therapy," Hum. Mol. Genet., 20(R1): R14-R20. (2011) transposon systems can be used.
  • Site specific gene editing can also be achieved without homologous recombination.
  • An exogenous polynucleic acid can be introduced into a cell genome without the use of homologous recombination.
  • a transgene can be flanked by engineered sites that are complementary to a targeted double strand break region in a genome.
  • a transgene can be excised from a polynucleic acid so it can be inserted at a double strand break region without homologous recombination.
  • an exogenous or an engineered nuclease can be introduced to a cell in addition to a plasmid, a linear or circular polynucleotide, a viral or a non-viral vector comprising a transgene to facilitate integration of the transgene at a site where the nuclease cleaves the genomic DNA. Integration of the transgene into the cell's genome allows stable expression of the transgene over time.
  • a viral vector can be used to introduce a promoter that is operably linked to the transgene.
  • a viral vector does not comprise a promoter, which requires insertion of the transgene at a target locus that comprises an endogenous promoter for expressing the inserted transgene.
  • a viral vector comprises homology arms that direct integration of a
  • a first nuclease is engineered to cleave at a specific genomic site to suppress or disable a deleterious gene, such as an oncogene, a checkpoint inhibitor gene, or a gene that is implicated in a disease or condition, such as cancer.
  • a non-viral or a viral vector e.g.
  • an AAV viral vector can be introduced to allow integration of a transgene or any exogenous nucleic acid sequence with a therapeutic effect at the site of DNA cleavage or site of the double strand break generated by the nuclease.
  • the transgene can be inserted at a different genomic site using methods known in the art, such as site directed insertion via homologous recombination, using homology arms comprising sequences complementary to the desired site of insertion, such as the AAVS 1 site or a safe harbor locus.
  • a second nuclease can be provided to facilitate site specific insertion of a transgene at a different locus than the site of DNA cleavage by the first nuclease.
  • an AAV virus or an AAV viral vector can be used as a delivery system for introducing the transgene, such as a T cell receptor.
  • Homology arms on an AAV donor can be from 500 base pairs to 2000 base pairs.
  • homology arms on an AAV donor can be from 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1 100 bp, 1200 bp, 1300 bp, 1400 bp, 1500 bp, 1600 bp, 1700bp, 1800 bp, 1900 bp, or up to 2000 bp long.
  • Homology arm length can be 850 bp. In other cases, homology arm length can be 1040 bp.
  • homology arms are extended to allow for accurate integration of a donor. In other cases, homology arms are extended to improve integration of a donor. In some cases, in order to increase the length of homology arms without compromising the size of the donor polynucleic acid, an alternate part of the donor polynucleic acid can be eliminated. In some cases, a poly A tail can be reduced to allow for increased homology arm length.
  • a functional AAV can be an AAV characterized by the ability to produce viral particles with equivalent or greater packaging and transduction efficiency as any one of a WT AAV, such as AAV6. Function can be assessed in a pseudotyping setting with AAV6 rep and AAV6 ITRs.
  • an altered parental AAV can be constructed using conventional techniques and the AAV vector can be considered functional if virus is produced from the parental AAV at titers of at least 50% when compared to production of a WT AAV such as AAV6.
  • the ability of AAV to transduce cells can be readily determined by one of skill in the art.
  • a parental AAV can be constructed such that it contains a marker gene which allows ready detection of virus.
  • an AAV can contain eGFP or another transgene which allows fluorescent detection.
  • CMV-eGFP when the virus produced from the altered parental AAV capsid is transduced into 293 cells at a multiplicity of infection of 10 4 , function is demonstrated where transduction efficiency is greater than 5% GFP fluorescence of total cells in a context where the cells were pretreated with wild-type human adenovirus type 5 at a multiplicity of infection of 20 for 2 hours.
  • the methods disclosed herein can comprise a nucleic acid (e.g., a first nucleic acid and/or a second nucleic acid).
  • the nucleic acid can encode a transgene.
  • a transgene can refer to a linear polymer comprising multiple nucleotide subunits.
  • a transgene can comprise any number of nucleotides.
  • a transgene can comprise less than about 100 nucleotides.
  • a transgene can comprise at least about 100 nucleotides.
  • a transgene can comprise at least about 200 nucleotides.
  • a transgene can comprise at least about 300 nucleotides.
  • a transgene can comprise at least about 400 nucleotides.
  • a transgene can comprise at least about 500 nucleotides. In some cases, a transgene can comprise at least about 1000 nucleotides. In some cases, a transgene can comprise at least about 5000 nucleotides. In some cases, a transgene can comprise at least about 10,000 nucleotides. In some cases, a transgene can comprise at least about 20,000 nucleotides. In some cases, a transgene can comprise at least about 30,000 nucleotides. In some cases, a transgene can comprise at least about 40,000 nucleotides. In some cases, a transgene can comprise at least about 50,000 nucleotides.
  • a transgene can comprise between about 500 and about 5000 nucleotides. In some cases, a transgene can comprise between about 5000 and about 10,000 nucleotides. In any of the cases disclosed herein, the transgene can comprise DNA, RNA, or a hybrid of DNA and RNA. In some cases, the transgene can be single stranded. In some cases, the transgene can be double stranded.
  • Transgenes can be useful for expressing, e.g. , overexpressing, endogenous genes at higher levels than without a transgenes. Additionally, transgenes can be used to express exogenous genes at a level greater than background, i.e. , a cell that has not been transfected with a transgenes. Transgenes can also encompass other types of genes, for example, a dominant negative gene.
  • Transgenes can be placed into an organism, cell, tissue, or organ, in a manner which produces a product of a transgene.
  • a polynucleic acid can comprise a transgene.
  • a polynucleic acid can encode an exogenous receptor.
  • a polynucleic acid comprising at least one exogenous T cell receptor (TCR) sequence flanked by at least two recombination arms having a sequence complementary to polynucleotides within a genomic sequence that is adenosine A2a receptor, CD276, V-set domain containing T cell activation inhibitor 1, B and T lymphocyte associated, cytotoxic T-lymphocyte-associated protein 4, indoleamine 2,3-dioxygenase 1, killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1, lymphocyte -activation gene 3, programmed cell death 1, hepatitis A virus cellular receptor 2, V-domain immunoglobulin suppressor of T-cell activation, or natural killer cell receptor 2B4.
  • TCR exogenous T cell receptor
  • transgene e.g. , exogenous sequence
  • a transgene is typically not identical to the genomic sequence where it is placed.
  • a donor transgene can contain a non-homologous sequence flanked by two regions of homology to allow for efficient HDR at the location of interest.
  • transgene sequences can comprise a vector molecule containing sequences that are not homologous to the region of interest in cellular chromatin.
  • a transgene can contain several, discontinuous regions of homology to cellular chromatin.
  • a sequence can be present in a donor nucleic acid molecule and flanked by regions of homology to sequence in the region of interest.
  • a transgene polynucleic acid can be DNA or RNA, single-stranded or double-stranded and can be introduced into a cell in linear or circular form.
  • a transgene sequence(s) can be contained within a DNA mini-circle, which can be introduced into the cell in circular or linear form. If introduced in linear form, the ends of a transgene sequence can be protected (e.g. , from exonucleolytic degradation) by any method.
  • one or more dideoxynucleotide residues can be added to the 3 ' terminus of a linear molecule and/or self-complementary oligonucleotides can be ligated to one or both ends.
  • Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.
  • a polynucleotide can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance.
  • transgene polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g. , adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
  • viruses e.g. , adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)
  • a virus that can deliver a transgene can be an AAV virus.
  • a transgene is generally inserted so that its expression is driven by the endogenous promoter at the integration site, namely the promoter that drives expression of the endogenous gene into which a transgene is inserted (e.g. , AAVS SITE (E. G. AAVS 1, AAVS2, ETC.), CCR5, HPRT).
  • a transgene can comprise a promoter and/or enhancer, for example a constitutive promoter or an inducible or tissue/cell specific promoter.
  • a minicircle vector can encode a transgene.
  • Targeted insertion of non-coding nucleic acid sequence can also be achieved. Sequences encoding antisense RNAs, RNAi, shRNAs and micro RNAs (miRNAs) can also be used for targeted insertions.
  • a transgene can be inserted into an endogenous gene such that all, some or none of the
  • a transgene as described herein can be inserted into an endogenous locus such that some (N-terminal and/or C-terminal to a transgene) or none of the endogenous sequences are expressed, for example as a fusion with a transgene.
  • a transgene e.g. , with or without additional coding sequences such as for the endogenous gene
  • a TCR transgene can be inserted into an endogenous TCR gene.
  • a transgene can be inserted into any gene, e.g., the genes as described herein.
  • endogenous sequences endogenous or part of a transgene
  • the endogenous sequences can be full-length sequences (wild-type or mutant) or partial sequences.
  • the endogenous sequences can be functional. Non-limiting examples of the function of these full length or partial sequences include increasing the serum half-life of the polypeptide expressed by a transgene (e.g. , therapeutic gene) and/or acting as a carrier.
  • a T cell can comprise one or more transgenes.
  • One or more transgenes can express a TCR alpha, beta, gamma, and/or delta chain protein recognizing and binding to at least one epitope (e.g.
  • a TCR can bind to a cancer neo- antigen.
  • a TCR can be a functional TCR.
  • a TCR can comprise only one of the alpha chain or beta chain sequences as defined herein (e.g., in combination with a further alpha chain or beta chain, respectively) or can comprise both chains.
  • a TCR can comprise only one of the gamma chain or delta chain sequences as defined herein (e.g., in combination with a further gamma chain or delta chain, respectively) or can comprise both chains.
  • a functional TCR maintains at least substantial biological activity in the fusion protein.
  • alpha and/or beta chain of a TCR this can mean that both chains remain able to form a T cell receptor (either with a non-modified alpha and/or beta chain or with another fusion protein alpha and/or beta chain) which exerts its biological function, in particular binding to the specific peptide-MHC complex of a TCR, and/or functional signal transduction upon peptide activation.
  • T cell can also comprise one or more T cell receptor (either with a non-modified gamma and/or delta chain or with another fusion protein gamma and/or delta chain) which exerts its biological function, in particular binding to the specific peptide-MHC complex of a TCR, and/or functional signal transduction upon peptide activation.
  • a T cell can also comprise one or more T cell receptor (either with a non-modified gamma and/or delta chain or with another fusion protein gamma and/or delta chain) which exerts its biological function, in particular binding to the specific peptide-MHC complex of a TCR, and/or functional signal transduction upon peptide activation.
  • a T cell can also comprise one or more
  • a T cell can also comprise a single TCRs specific to more than one target.
  • Transgenes that can be used and are specifically contemplated can include those genes, vectors, or vector cargo that exhibit a certain identity and/or homology to genes, transgenes, or vectors disclosed herein, for example, a TCR gene. Therefore, it is contemplated that if a sequence described herein exhibits at least or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%,
  • a vector comprising a transgene can be described by any one of the sequences of Table 8.
  • a vector comprising a transgene can have percent identity from about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
  • the transgene can be functional and can enhance the performance of an engineered cell by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,
  • a transgene can be incorporated into a cell.
  • a transgene can be incorporated into an organism's germ line.
  • a transgene can be either a complementary DNA (cDNA) segment, which is a copy of messenger RNA (mRNA), or a gene itself residing in its original region of genomic DNA (with or without introns).
  • cDNA complementary DNA
  • mRNA messenger RNA
  • a transgene of protein X can refer to a transgene comprising a nucleotide sequence encoding protein X.
  • a transgene encoding protein X can be a transgene encoding 100% or about 100% of the amino acid sequence of protein X.
  • a transgene encoding protein X can be a transgene encoding at least or at least about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 40%, 30%, 20%, 10%, 5%, or 1% of the amino acid sequence of protein X.
  • Expression of a transgene can ultimately result in a functional protein, e.g., a partially, fully, or overly functional protein. As discussed above, if a partial sequence is expressed, the ultimate result can be a nonfunctional protein or a dominant negative protein.
  • a nonfunctional protein or dominant negative protein can also compete with a functional (endogenous or exogenous) protein.
  • a transgene can also encode RNA (e.g., mRNA, shRNA, siRNA, or microRNA). In some cases, where a transgene encodes for an mRNA, this can in turn be translated into a polypeptide (e.g., a protein). Therefore, it is contemplated that a transgene can encode for protein.
  • a transgene can, in some instances, encode a protein or a portion of a protein. Additionally, a protein can have one or more mutations (e.g. , deletion, insertion, amino acid replacement, or rearrangement) compared to a wild- type polypeptide.
  • a protein can be a natural polypeptide or an artificial polypeptide (e.g., a recombinant polypeptide).
  • a transgene can encode a fusion protein formed by two or more polypeptides.
  • a T cell can comprise or can comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more transgenes.
  • a T cell can comprise one or more transgene comprising a TCR gene.
  • a transgene (e.g., a TCR gene) can be inserted in a safe harbor locus.
  • a safe harbor can comprise a genomic location where a transgene can integrate and function without perturbing endogenous activity.
  • one or more transgenes can be inserted into any one of HPRT, AAVS SITE (E. G. AAVS 1, AAVS2, ETC.), CCR5, hROSA26, and/or any combination thereof.
  • a transgene (e.g., TCR gene) can also be inserted in an endogenous immune checkpoint gene.
  • An endogenous immune checkpoint gene can be stimulatory checkpoint gene or an inhibitory checkpoint gene.
  • a transgene e.g.
  • TCR gene can also be inserted in a stimulatory checkpoint gene such as CD27, CD40, CD 122, OX40, GITR, CD 137, CD28, or ICOS. Immune checkpoint gene locations are provided using the Genome Reference Consortium Human Build 38 patch release 2 (GRCh38.p2) assembly.
  • a transgene e.g., TCR gene
  • one or more transgene can be inserted into any one of CD27, CD40, CD 122, OX40, GITR, CD 137, CD28, ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD- 1, TIM-3, VISTA, HPRT, AAVS SITE (E. G. AAVS 1, AAVS2, ETC.), CCR5, , and/or any combination thereof.
  • a transgene can be inserted in an endogenous TCR gene.
  • a transgene can be inserted within a coding genomic region.
  • a transgene can also be inserted within a noncoding genomic region.
  • a transgene can be inserted into a genome without homologous recombination. Insertion of a transgene can comprise a step of an intracellular genomic transplant.
  • a transgene can be inserted at a PD-1 gene. In some cases, more than one guide can target an immune checkpoint.
  • a transgene can be integrated at a CTLA-4 gene. In other cases, a transgene can be integrated at a CTLA-4 gene and a PD-1 gene.
  • a transgene can also be integrated into a safe harbor such as AAVS 1.
  • a transgene can be inserted into an AAV integration site. An AAV integration site can be a safe harbor in some cases.
  • Alternative AAV integration sites can exist, such as AAVS2 on chromosome 5 or AAVS3 on chromosome 3. Additional AAV integration sites such as AAVS 2, AAVS3, AAVS4, AAVS5, AAVS6, AAVS7, AAVS8, and the like are also considered to be possible integration sites for an exogenous receptor, such as a TCR.
  • AAVS can refer to AAVS1 as well as related adeno-associated virus (AAVS) integration sites.
  • a chimeric antigen receptor can be comprised of an extracellular antigen recognition domain, a trans-membrane domain, and a signaling region that controls T cell activation.
  • the extracellular antigen recognition domain can be derived from a murine, a humanized or fully human monoclonal antibody.
  • the extracellular antigen recognition domain is comprised of the variable regions of the heavy and light chains of a monoclonal antibody that is cloned in the form of single- chain variable fragments (scFv) and joined through a hinge and a transmembrane domain to an intracellular signaling molecule of the T-cell receptor (TCR) complex and at least one co-stimulatory molecule. In some cases a co-stimulatory domain is not used.
  • a transgene such as a cellular receptor
  • a transgene can be inserted into a genome of a T cell in a random or site-specific manner, as described above.
  • a transgene can be inserted to a random locus in a genome of a T cell.
  • These transgenes can be functional, e.g. , fully functional if inserted anywhere in a genome.
  • a transgene can encode its own promoter or can be inserted into a position where it is under the control of an endogenous promoter.
  • a transgene can be inserted into a gene, such as an intron of a gene or an exon of a gene, a promoter, or a non- coding region.
  • a transgene can be inserted such that the insertion disrupts a gene, e.g., an endogenous checkpoint.
  • a transgene insertion can comprise an endogenous checkpoint region.
  • a transgene insertion can be guided by recombination arms that can flank a transgene.
  • Expression of a transgene, such as a cellular receptor can be controlled by one or more
  • a promoter can be a ubiquitous, constitutive (unregulated promoter that allows for continual transcription of an associated gene), tissue-specific promoter or an inducible promoter. Expression of a transgene that is inserted adjacent to or near a promoter can be regulated. For example, a transgene can be inserted near or next to a ubiquitous promoter.
  • Some ubiquitous promoters can be a CAGGS promoter, an hCMV promoter, a PGK promoter, an SV40 promoter, or a ROSA26 promoter.
  • a promoter can be endogenous or exogenous.
  • one or more transgenes can be any transgenes.
  • a promoter can be specific to a T cell.
  • one or more transgenes can be inserted adjacent or near to a porcine ROSA26 promoter.
  • Tissue specific promoter or cell-specific promoters can be used to control the location of expression.
  • one or more transgenes can be inserted adjacent or near to a tissue-specific promoter.
  • Tissue-specific promoters can be a FABP promoter, an Lck promoter, a CamKII promoter, a CD 19 promoter, a Keratin promoter, an Albumin promoter, an aP2 promoter, an insulin promoter, an MCK promoter, a MyHC promoter, a WAP promoter, or a Col2A promoter.
  • Inducible promoters can be used as well. These inducible promoters can be turned on and off when desired, by adding or removing an inducing agent. It is contemplated that an inducible promoter can be, but is not limited to, a Lac, tac, trc, trp, araBAD, phoA, recA, proU, cst-1, tetA, cadA, nar, PL, cspA, T7, VHB, Mx, and/or Trex.
  • an inducible promoter can be, but is not limited to, a Lac, tac, trc, trp, araBAD, phoA, recA, proU, cst-1, tetA, cadA, nar, PL, cspA, T7, VHB, Mx, and/or Trex.
  • a cell can be engineered to knock out endogenous genes.
  • Endogenous genes that can be knocked out can comprise immune checkpoint genes.
  • An immune checkpoint gene can be stimulatory checkpoint gene or an inhibitory checkpoint gene. Immune checkpoint gene locations can be provided using the Genome Reference Consortium Human Build 38 patch release 2 (GRCh38.p2) assembly.
  • a gene to be knocked out can be selected using a database. In some cases, certain endogenous genes are more amendable to genomic engineering.
  • a database can comprise epigenetically permissive target sites.
  • a database can be ENCODE (encyclopedia of DNA Elements) (http://www.genome.gov/10005107) in some cases.
  • a databased can identify regions with open chromatin that can be more permissive to genomic engineering.
  • a T cell can comprise one or more disrupted genes. For example, one or more genes whose
  • adenosine A2a receptor CD276, V-set domain containing T cell activation inhibitor 1 (VTCN1), B and T lymphocyte associated (BTLA), cytotoxic T-lymphocyte-associated protein 4 (CTLA4), indoleamine 2,3-dioxygenase 1 (IDOl), killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), lymphocyte-activation gene 3 (LAG3), programmed cell death 1 (PD-1), hepatitis A virus cellular receptor 2 (HAVCR2), V-domain immunoglobulin suppressor of T-cell activation (VISTA), natural killer cell receptor 2B4 (CD244), cytokine inducible SH2-containing protein (CISH), hypoxanthine phosphoribosyltransferase 1 (HPRT), adeno-associated virus integration site (AAVS SITE (E.
  • ADORA adenosine A2a receptor
  • VTCN1 V-set domain
  • CCR5 chemokine (C-C motif) receptor 5 (gene/pseudogene) (CCR5), CD 160 molecule (CD 160), T-cell immunoreceptor with Ig and ITIM domains (TIGIT), CD96 molecule (CD96), cytotoxic and regulatory T-cell molecule (CRTAM), leukocyte associated immunoglobulin like receptor l(LAIRl), sialic acid binding Ig like lectin 7 (SIGLEC7), sialic acid binding Ig like lectin 9 (SIGLEC9), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), tumor necrosis factor receptor superfamily member 10a (TNFRSF10A), caspase 8 (CASP8), caspase 10 (CASP10), caspase 3 (CASP3), caspase 6 (CASP6), caspase 7 (CASP7), Fas associated via death domain (FADD), Fas cell surface death receptor (FAS), transforming growth
  • C-C motif) receptor 5 gene/p
  • a T cell can comprise one or more suppressed genes.
  • one or more genes whose expression is suppressed can comprise any one of adenosine A2a receptor (ADORA), CD276, V-set domain containing T cell activation inhibitor 1 (VTCN1), B and T lymphocyte associated (BTLA), cytotoxic T-lymphocyte-associated protein 4 (CTLA4), indoleamine 2,3-dioxygenase 1 (IDOl), killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), lymphocyte-activation gene 3 (LAG3), programmed cell death 1 (PD-1), hepatitis A virus cellular receptor 2 (HAVCR2), V-domain immunoglobulin suppressor of T-cell activation (VISTA), natural killer cell receptor 2B4 (CD244), cytokine inducible SH2-containing protein (CISH), hypoxanthine phosphoribosyltransferase 1 (HPRT), aden
  • HMOX2 interleukin 6 receptor
  • IL6ST interleukin 6 signal transducer
  • CSK c-src tyrosine kinase
  • PAG1 glycosphingolipid microdomains 1
  • SIT1 signaling threshold regulating transmembrane adaptor 1(SIT1), forkhead box P3(FOXP3)
  • PR domain l(PRDMl) basic leucine zipper transcription factor
  • BATF guanylate cyclase 1, soluble, alpha 2(GUCY1A2), guanylate cyclase 1, soluble, alpha 3(GUCY1A3), guanylate cyclase 1, soluble, beta 2(GUCYlB2), guanylate cyclase 1, soluble, beta 3(GUCY1B3), cytokine inducible SH2 -containing protein (CISH), or any combination thereof.
  • BATF guanylate cyclase 1, soluble, alpha 2(GUCY1A2)
  • An engineered cell such as one modified with a modified adeno-associated virus, can target an antigen.
  • An engineered cell can also target an epitope.
  • An antigen can be a tumor cell antigen.
  • An epitope can be a tumor cell epitope.
  • Such a tumor cell epitope can be derived from a wide variety of tumor antigens such as antigens from tumors resulting from mutations (neo antigens or neo epitopes), shared tumor specific antigens, differentiation antigens, and antigens overexpressed in tumors.
  • antigens for example, can be derived from alpha-actinin-4, ARTC1, BCR-ABL fusion protein (b3a2), B-RAF, CASP-5, CASP-8, beta-catenin, Cdc27, CDK4, CDKN2A, COA-1, dek-can fusion protein, EFTUD2, Elongation factor 2, ETV6-AML1 fusion protein, FLT3-ITD, FNl, GPNMB, LDLR-fucosyltransferase fusion protein, HLA-A2d, HLA-A1 Id, hsp70-2, KIAAO205, MART2, ME1, MUM-lf, MUM-2, MUM-3, neo-PAP, Myosin class I, NFYC, OGT, OS-9, p53, pml-RARalpha fusion protein, PRDX5, PTPRK, K-ras, N-ras, RBAF600, SIRT2, SNR
  • Tumor-associated antigens can be antigens not normally expressed by the host; they can be mutated, truncated, misfolded, or otherwise abnormal manifestations of molecules normally expressed by the host; they can be identical to molecules normally expressed but expressed at abnormally high levels; or they can be expressed in a context or environment that is abnormal.
  • Tumor-associated antigens can be, for example, proteins or protein fragments, complex
  • a portion of an antigen or epitope of a phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3), Kirsten rat sarcoma (KRAS), or Erbb2 interacting protein (ERBB2IP) (also referred to as "MB”) gene can be targeted with an engineered cell.
  • TCR sequences specific for tumor antigens can readily be identified by sequencing, for example as descrbed in WO2017048593A1 and US20180030110.
  • a target is a neo antigen or neo epitope.
  • a neo antigen can be encoded by an E805G mutation in ERBB2IP.
  • Neo antigen and neo epitopes can be identified by whole-exome sequencing in some cases.
  • a neo antigen and neo epitope target can be expressed by a gastrointestinal cancer cell in some cases.
  • a neo antigen and neo epitope can be expressed on an epithelial carcinoma.
  • an engineered cell can target a universal antigen, such as a neoantigen or neoepitope.
  • An epitope can be a stromal epitope. Such an epitope can be on the stroma of the tumor
  • the antigen can be a stromal antigen. Such an antigen can be on the stroma of the tumor microenvironment.
  • Those antigens and those epitopes can be present on tumor endothelial cells, tumor vasculature, tumor fibroblasts, tumor pericytes, tumor stroma, and/or tumor mesenchymal cells, just to name a few.
  • Those antigens for example, can comprise CD34, MCSP, FAP, CD31, PCNA, CD117, CD40, MMP4, and/or Tenascin.
  • Methods described herein can take advantage of a CRISPR system.
  • CRISPR systems There are at least five types of CRISPR systems which all incorporate RNAs and Cas proteins.
  • Types I, III, and IV assemble a multi-Cas protein complex that is capable of cleaving nucleic acids that are complementary to the crRNA.
  • Types I and III both require pre-crRNA processing prior to assembling the processed crRNA into the multi-Cas protein complex.
  • Types II and V CRISPR systems comprise a single Cas protein complexed with at least one guiding RNA.
  • KS et al "An updated evolutionary classification of CRISPR-Cas systems,", Nature Reviews Microbiology, 13, 1-15 (2015).
  • Site-specific cleavage of a target DNA occurs at locations determined by both 1) base-pairing complementarity between the guide RNA and the target DNA (also called a protospacer) and 2) a short motif in the target DNA referred to as the protospacer adjacent motif (PAM).
  • PAM protospacer adjacent motif
  • an engineered cell can be generated using a CRISPR system, e.g., a type II CRISPR system.
  • a Cas enzyme used in the methods disclosed herein can be Cas9, which catalyzes DNA cleavage.
  • Enzymatic action by Cas9 derived from Streptococcus pyogenes or any closely related Cas9 can generate double stranded breaks at target site sequences which hybridize to 20 nucleotides of a guide sequence and that have a protospacer-adjacent motif (PAM) following the 20 nucleotides of the target sequence.
  • PAM protospacer-adjacent motif
  • a vector can be operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein (CRISPR-associated protein).
  • CRISPR enzyme such as a Cas protein (CRISPR-associated protein).
  • Cas proteins can include Casl, Cas lB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl or Csxl2),
  • An unmodified CRISPR enzyme can have DNA cleavage activity, such as Cas9.
  • a CRISPR enzyme can direct cleavage of one or both strands at a target sequence, such as within a target sequence and/or within a complement of a target sequence.
  • a CRISPR enzyme can direct cleavage of one or both strands within or within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.
  • a vector that encodes a CRISPR enzyme that is mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence can be used.
  • a Cas protein can be a high fidelity Cas protein such as Cas9HiFi.
  • Cas9 can refer to a polypeptide with at least or at least about 50%, 60%, 70%, 80%, 90%, 100% sequence identity and/or sequence similarity to a wild type exemplary Cas9 polypeptide (e.g. , Cas9 from S. pyogenes).
  • Cas9 can refer to a polypeptide with at most or at most about 50%, 60%, 70%, 80%, 90%, 100% sequence identity and/or sequence similarity to a wild type exemplary Cas9 polypeptide (e.g. , from S. pyogenes).
  • Cas9 can refer to the wild type or a modified form of the Cas9 protein that can comprise an amino acid change such as a deletion, insertion, substitution, variant, mutation, fusion, chimera, or any combination thereof.
  • Cas9 can refer to a polypeptide with at least or at least about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity and/or sequence similarity to SEQ ID NO: 56.
  • a sequence identity disclosed herein can be calculated by determining a percent identity between two sequences. For example a percent identity can be calculated by multiplying the number of matches in a sequence pair by 100 and dividing by the length of the aligned region.
  • a variety of sequence alignment programs can be utilized for example, LALIGN, FFAS, BLAST, Gene Wise, SIM, and SSEA to name a few.
  • a polynucleotide encoding an endonuclease (e.g. , a Cas protein such as Cas9) can be codon optimized for expression in particular cells, such as eukaryotic cells. This type of optimization can entail the mutation of foreign-derived (e.g. , recombinant) DNA to mimic the codon preferences of the intended host organism or cell while encoding the same protein.
  • An endonuclease can comprise an amino acid sequence having at least or at least about 50%,
  • nuclease domain of a wild type exemplary site-directed polypeptide (e.g. , Cas9 from S. pyogenes).
  • a wild type exemplary site-directed polypeptide e.g. , Cas9 from S. pyogenes.
  • SpCas9 S. pyogenes Cas9
  • Table 7 S. pyogenes Cas9
  • the PAM sequence for SpCas9 (5' NGG 3') is abundant throughout the human genome, but a NGG sequence is not always positioned correctly to target a desired gene for modification.
  • a different endonuclease can be used to target certain genomic targets.
  • synthetic SpCas9-derived variants with non-NGG PAM sequences can be used.
  • Non-SpCas9s bind a variety of PAM sequences that could also be useful for the present invention.
  • the relatively large size of SpCas9 (approximately 4kb coding sequence) means that plasmids carrying the SpCas9 cDNA may not always be efficiently expressed in a cell.
  • the coding sequence for Staphylococcus aureus Cas9 (SaCas9) is approximately 1 kilo base shorter than SpCas9, possibly allowing it to be efficiently expressed in a cell.
  • the SaCas9 endonuclease is capable of modifying target genes in mammalian cells in vitro and in mice in vivo.
  • Cas9 can include RNA-guided endonucleases from the Cpf 1 family that display cleavage activity in mammalian cells. Unlike Cas9 nucleases, the result of Cpfl- mediated DNA cleavage is a double-strand break with a short 3' overhang. Cpfl 's staggered cleavage pattern can open up the possibility of directional gene transfer, analogous to traditional restriction enzyme cloning, which can increase the efficiency of gene editing. Like the Cas9 variants and orthologues described above, Cpf 1 can also expand the number of sites that can be targeted by CRISPR to AT-rich regions or AT-rich genomes that lack the NGG PAM sites favored by SpCas9.
  • a guide RNA can refer to an RNA which can be specific for a target DNA and can form a complex with a Cas protein.
  • a guide RNA can comprise a guide sequence, or spacer sequence, that specifies a target site and guides an RNA/Cas complex to a specified target DNA for cleavage.
  • a guide RNA can target a CRISPR complex to three genes and perform a targeted double strand break.
  • Site-specific cleavage of a target DNA occurs at locations determined by both 1) base- pairing complementarity between a guide RNA and a target DNA (also called a protospacer) and 2) a short motif in a target DNA referred to as a protospacer adjacent motif (PAM).
  • Guiding polynucleic acids can be designed using methods known to the skilled artisan using for instance publically available software such as Benchling, MIT, or Wellcome Trust tool.
  • a method disclosed herein also can comprise introducing into a cell or embryo at least one guide RNA or nucleic acid, e.g. , DNA encoding at least one guide RNA.
  • a guide RNA can interact with a RNA-guided endonuclease to direct the endonuclease to a specific target site, at which site the 5' end of the guide RNA base pairs with a specific protospacer sequence in a chromosomal sequence.
  • a guide RNA can comprise two RNAs, e.g. , CRISPR RNA (crRNA) and transactivating crRNA
  • a guide RNA can sometimes comprise a single-guide RNA (sgRNA) formed by fusion of a portion (e.g. , a functional portion) of crRNA and tracrRNA.
  • sgRNA single-guide RNA
  • a guide RNA can also be a dual RNA comprising a crRNA and a tracrRNA.
  • a guide RNA can comprise a crRNA and lack a tracrRNA.
  • a crRNA can hybridize with a target DNA or protospacer sequence.
  • a guide RNA can be an expression product.
  • a guide RNA can be a vector comprising a sequence coding for the guide RNA.
  • a guide RNA can be transferred into a cell or organism by transfecting the cell or organism with an isolated guide RNA or plasmid DNA comprising a sequence coding for the guide RNA and a promoter.
  • a guide RNA can also be transferred into a cell or organism in other way, such as using virus-mediated gene delivery.
  • a guide RNA can be isolated.
  • a guide RNA can be transfected in the form of an isolated RNA into a cell or organism.
  • a guide RNA can be prepared by in vitro transcription using any in vitro transcription system.
  • a guide RNA can be transferred to a cell in the form of isolated RNA rather than in the form of plasmid comprising encoding sequence for a guide RNA.
  • a guide RNA can comprise a DNA-targeting segment and a protein binding segment.
  • a DNA- targeting segment (or DNA-targeting sequence, or spacer sequence) comprises a nucleotide sequence that can be complementary to a specific sequence within a target DNA (e.g., a protospacer).
  • a protein-binding segment (or protein-binding sequence) can interact with a site-directed modifying polypeptide, e.g. an RNA-guided endonuclease such as a Cas protein.
  • segment it is meant a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in RNA.
  • a segment can also mean a region/section of a complex such that a segment can comprise regions of more than one molecule.
  • a protein-binding segment of a DNA-targeting RNA is one RNA molecule and the protein-binding segment therefore comprises a region of that RNA molecule.
  • the protein-binding segment of a DNA-targeting RNA comprises two separate molecules that are hybridized along a region of complementarity.
  • a guide RNA can comprise two separate RNA molecules or a single RNA molecule.
  • exemplary single molecule guide RNA comprises both a DNA-targeting segment and a protein- binding segment.
  • An exemplary two-molecule DNA-targeting RNA can comprise a crRNA-like (“CRISPR RNA” or “targeter-RNA” or “crRNA” or “crRNA repeat”) molecule and a corresponding tracrRNA-like (“trans-acting CRISPR RNA” or “activator-RNA” or “tracrRNA”) molecule.
  • a first RNA molecule can be a crRNA-like molecule (targeter-RNA), that can comprise a DNA-targeting segment (e.g., spacer) and a stretch of nucleotides that can form one half of a double-stranded RNA (dsRNA) duplex comprising the protein-binding segment of a guide RNA.
  • dsRNA double-stranded RNA
  • a second RNA molecule can be a corresponding tracrRNA-like molecule (activator-RNA) that can comprise a stretch of nucleotides that can form the other half of a dsRNA duplex of a protein-binding segment of a guide RNA.
  • a stretch of nucleotides of a crRNA-like molecule can be complementary to and can hybridize with a stretch of nucleotides of a tracrRNA-like molecule to form a dsRNA duplex of a protein-binding domain of a guide RNA.
  • each crRNA-like molecule can be said to have a corresponding tracrRNA-like molecule.
  • a crRNA-like molecule additionally can provide a single stranded DNA-targeting segment, or spacer sequence.
  • a crRNA-like and a tracrRNA-like molecule (as a corresponding pair) can hybridize to form a guide RNA.
  • a subject two-molecule guide RNA can comprise any corresponding crRNA and tracrRNA pair.
  • a DNA-targeting segment or spacer sequence of a guide RNA can be complementary to sequence at a target site in a chromosomal sequence, e.g., protospacer sequence) such that the DNA-targeting segment of the guide RNA can base pair with the target site or protospacer.
  • a DNA- targeting segment of a guide RNA can comprise from or from about 10 nucleotides to from or from about 25 nucleotides or more.
  • a region of base pairing between a first region of a guide RNA and a target site in a chromosomal sequence can be or can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, or more than 25 nucleotides in length.
  • a first region of a guide RNA can be or can be about 19, 20, or 21 nucleotides in length.
  • a guide RNA can target a nucleic acid sequence of or of about 20 nucleotides.
  • a target nucleic acid can be less than or less than about 20 nucleotides.
  • a target nucleic acid can be at least or at least about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
  • a target nucleic acid can be at most or at most about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
  • a target nucleic acid sequence can be or can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases immediately 5' of the first nucleotide of the PAM.
  • a guide RNA can target the nucleic acid sequence.
  • a guide nucleic acid for example, a guide RNA, can refer to a nucleic acid that can hybridize to another nucleic acid, for example, the target nucleic acid or protospacer in a genome of a cell.
  • a guide nucleic acid can be RNA.
  • a guide nucleic acid can be DNA.
  • the guide nucleic acid can be programmed or designed to bind to a sequence of nucleic acid site-specifically.
  • a guide nucleic acid can comprise a polynucleotide chain and can be called a single guide nucleic acid.
  • a guide nucleic acid can comprise two polynucleotide chains and can be called a double guide nucleic acid.
  • a guide nucleic acid can comprise one or more modifications to provide a nucleic acid with a new or enhanced feature.
  • a guide nucleic acid can comprise a nucleic acid affinity tag.
  • a guide nucleic acid can comprise synthetic nucleotide, synthetic nucleotide analog, nucleotide derivatives, and/or modified nucleotides.
  • a guide nucleic acid can comprise a nucleotide sequence (e.g. , a spacer), for example, at or near the 5 ' end or 3 ' end, that can hybridize to a sequence in a target nucleic acid (e.g. , a protospacer).
  • a spacer of a guide nucleic acid can interact with a target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing).
  • a spacer sequence can hybridize to a target nucleic acid that is located 5' or 3' of a protospacer adjacent motif (PAM).
  • the length of a spacer sequence can be at least or at least about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
  • the length of a spacer sequence can be at most or at most about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
  • a guide RNA can also comprises a dsRNA duplex region that forms a secondary structure.
  • a secondary structure formed by a guide RNA can comprise a stem (or hairpin) and a loop.
  • a length of a loop and a stem can vary.
  • a loop can range from about 3 to about 10 nucleotides in length
  • a stem can range from about 6 to about 20 base pairs in length.
  • a stem can comprise one or more bulges of 1 to about 10 nucleotides.
  • the overall length of a second region can range from about 16 to about 60 nucleotides in length.
  • a loop can be or can be about 4 nucleotides in length and a stem can be or can be about 12 base pairs.
  • a dsRNA duplex region can comprise a protein-binding segment that can form a complex with an RNA-binding protein, such as a RNA-guided endonuclease, e.g. Cas protein.
  • a guide RNA can also comprise a tail region at the 5' or 3' end that can be essentially single- stranded.
  • a tail region is sometimes not complementarity to any chromosomal sequence in a cell of interest and is sometimes not complementarity to the rest of a guide RNA.
  • the length of a tail region can vary.
  • a tail region can be more than or more than about 4 nucleotides in length.
  • the length of a tail region can range from or from about 5 to from or from about 60 nucleotides in length.
  • a guide RNA can be introduced into a cell or embryo as an RNA molecule.
  • a RNA molecule can be transcribed in vitro and/or can be chemically synthesized.
  • a guide RNA can then be introduced into a cell or embryo as an RNA molecule.
  • a guide RNA can also be introduced into a cell or embryo in the form of a non-RNA nucleic acid molecule, e.g. , DNA molecule.
  • a DNA encoding a guide RNA can be operably linked to promoter control sequence for expression of the guide RNA in a cell or embryo of interest.
  • a RNA coding sequence can be operably linked to a promoter sequence that is recognized by RNA polymerase III (Pol III).
  • a DNA molecule encoding a guide RNA can also be linear.
  • a DNA molecule encoding a guide RNA can also be circular.
  • a DNA sequence encoding a guide RNA can also be part of a vector.
  • Some examples of vectors can include plasmid vectors, phagemids, cosmids, artificial/mini-chromosomes, transposons, and viral vectors.
  • a DNA encoding a RNA-guided endonuclease is present in a plasmid vector.
  • suitable plasmid vectors include pUC, pBR322, pET, pBluescript, and variants thereof.
  • a vector can comprise additional expression control sequences (e.g. , enhancer sequences, Kozak sequences, polyadenylation sequences, transcriptional termination sequences, etc.), selectable marker sequences (e.g., antibiotic resistance genes), origins of replication, and the like.
  • each can be part of a separate molecule (e.g. , one vector containing fusion protein coding sequence and a second vector containing guide RNA coding sequence) or both can be part of a same molecule (e.g. , one vector containing coding (and regulatory) sequence for both a fusion protein and a guide RNA).
  • a Cas protein such as a Cas9 protein or any derivative thereof, can be pre-complexed with a guide RNA to form a ribonucleoprotein (RNP) complex.
  • the RNP complex can be introduced into primary immune cells. Introduction of the RNP complex can be timed. The cell can be synchronized with other cells at Gl, S, and/or M phases of the cell cycle. The RNP complex can be delivered at a cell phase such that HDR is enhanced. The RNP complex can facilitate homology directed repair.
  • a guide RNA can also be modified.
  • the modifications can comprise chemical alterations,
  • a guide RNA can be synthesized.
  • the synthesized guide RNA can enhance CRISPR genome engineering.
  • a guide RNA can also be truncated. Truncation can be used to reduce undesired off-target mutagenesis.
  • the truncation can comprise any number of nucleotide deletions. For example, the truncation can comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or more nucleotides.
  • a guide RNA can comprise a region of target complementarity of any length. For example, a region of target complementarity can be less than 20 nucleotides in length. A region of target complementarity can be more than 20 nucleotides in length.
  • a dual nickase approach can be used to introduce a double stranded break.
  • Cas proteins can be mutated at known amino acids within either nuclease domains, thereby deleting activity of one nuclease domain and generating a nickase Cas protein capable of generating a single strand break.
  • a nickase along with two distinct guide RNAs targeting opposite strands can be utilized to generate a DSB within a target site (often referred to as a "double nick” or "dual nickase” CRISPR system). This approach can dramatically increase target specificity, since it is unlikely that two off-target nicks will be generated within close enough proximity to cause a DSB.
  • GUIDE-Seq analysis can be performed to determine the specificity of engineered guide RNAs.
  • the general mechanism and protocol of GUIDE-Seq profiling of off-target cleavage by CRISPR system nucleases is discussed in Tsai, S. et al., "GUIDE-Seq enables genome-wide profiling of off-target cleavage by CRISPR system nucleases," Nature, 33: 187-197 (2015).
  • a gRNA can be introduced at any functional concentration.
  • a gRNA can be introduced at any functional concentration.
  • a gRNA can be introduced at any functional concentration.
  • a gRNA can be introduced at any functional concentration.
  • a gRNA can be introduced from 0.5 micrograms to 100 micrograms.
  • a gRNA can be introduced from 0.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 micrograms.
  • a method can comprise an endonuclease selected from the group consisting of Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Csyl , Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, CsxlS, Csfl, Csf2, CsO, Csf4, Cpfl, c2cl, c2c3, Cas9HiFi, homologues thereof or modified versions thereof.
  • a Cas protein can be any endonu
  • a method can further comprise at least one guide RNA (gR A).
  • a gR A can comprise at least one modification.
  • An exogenous TCR can bind a cancer neo-antigen.
  • TCR T cell receptor
  • gRNA guide RNA
  • gRNA guide RNA
  • endonuclease wherein the gRNA comprises at least one sequence complementary to at least one endogenous genome.
  • a modification is on a 5' end, a 3' end, from a 5' end to a 3' end, a single base modification, a 2'-ribose modification, or any combination thereof.
  • a modification can be selected from a group consisting of base substitutions, insertions, deletions, chemical modifications, physical modifications, stabilization, purification, and any combination thereof.
  • a modification is a chemical modification.
  • a modification can be selected from 5 'adenylate, 5' guanosine-triphosphate cap, 5'N7-Methylguanosine-triphosphate cap, 5 'triphosphate cap, 3 'phosphate, 3'thiophosphate, 5 'phosphate, 5'thiophosphate, Cis-Syn thymidine dimer, trimers, C12 spacer, C3 spacer, C6 spacer, dSpacer, PC spacer, rSpacer, Spacer 18, Spacer 9,3'-3' modifications, 5 '-5' modifications, abasic, acridine, azobenzene, biotin, biotin BB, biotin TEG, cholesteryl TEG, desthiobiotin TEG, DNP TEG, DNP-X, DOTA, dT-Biotin, dual biotin, PC biotin, psoralen C2, psoralen
  • a modification is a 2-O-methyl 3 phosphorothioate addition.
  • a 2-O-methyl 3 phosphorothioate addition is a 2-O-methyl 3 phosphorothioate addition.
  • phosphorothioate addition can be performed from 1 base to 150 bases.
  • phosphorothioate addition can be performed from 1 base to 4 bases.
  • phosphorothioate addition can be performed on 2 bases.
  • a 2-O-methyl 3 phosphorothioate addition can be performed on 4 bases.
  • a modification can also be a truncation.
  • a truncation can be a 5 base truncation.
  • a 5 base truncation can prevent a Cas protein from performing a cut.
  • endonuclease can be selected from the group consisting of a CRISPR system, TALEN, Zinc Finger, transposon-based, ZFN, meganuclease, Mega-TAL, and any combination.
  • An endonuclease can be a Cas endonuclease.
  • a Cas endonuclease can be selected from the group consisting of Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Csyl , Csy2, Csy3, Cse l, Cse2, Cscl,
  • a Cas endonuclease can have at least or at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or up to about 100% sequence identity and/or sequence similarity to the sequence of SEQ ID NO: 221.
  • a modified version of a Cas can be a clean Cas.
  • a Cas protein can be Cas9.
  • a Cas9 can create a double strand break in said at least one endogenous genome.
  • an endogenous genome comprises at least one gene.
  • a gene can be CISH, PD-1, TRA, TRB, or a combination thereof.
  • a double strand break can be repaired using homology directed repair (HR), non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), or any combination or derivative thereof.
  • HR homology directed repair
  • NHEJ non-homologous end joining
  • MMEJ microhomology-mediated end joining
  • a TCR can be integrated into a double strand break.
  • a T cell can comprise one or more disrupted target genes and one or more transgenes, for instance a receptor.
  • one or more target genes whose expression is disrupted can comprise any one of CD27, CD40, CD 122, OX40, GITR, CD137, CD28, ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, TIM-3, VISTA, CISH, PPP1R12C, and/or any combination thereof.
  • one or more genes whose expression is disrupted can comprise PD-land one or more transgenes comprise TCR.
  • one or more target genes whose expression is disrupted can also comprise CTLA-4, and one or more transgenes comprise TCR.
  • a disruption can result in a reduction of copy number of genomic transcript of a disrupted gene or portion thereof.
  • a target gene that can be disrupted can have reduced transcript quantities compared to the same target gene in an undisrupted cell.
  • a disruption can result in disruption results in less than 145 copies ⁇ L, 140 copies ⁇ L, 135 copies ⁇ L, 130 copies ⁇ L, 125 copies ⁇ L, 120 copies ⁇ L, 115 copies ⁇ L, 110 copies ⁇ L, 105 copies ⁇ L, 100 copies ⁇ L, 95 copies ⁇ L, 190 copies ⁇ L, 185 copies ⁇ L, 80 copies ⁇ L, 75 copies ⁇ L, 70 copies ⁇ L, 65 copies ⁇ L, 60 copies ⁇ L, 55 copies ⁇ L, 50 copies ⁇ L, 45 copies ⁇ L, 40 copies ⁇ L, 35 copies ⁇ L, 30 copies ⁇ L, 25 copies ⁇ L, 20 copies ⁇ L, 15 copies ⁇ L, 10 copies ⁇ L, 5 copies ⁇ L, 1 copies ⁇ L, or 0.05 copies ⁇ L.
  • a disruption can result in less than 100 copies ⁇ L in some cases.
  • CD210a 10 receptor 1 83
  • CDW210A subunit
  • CDW210B CDW210B; IL- 10R2
  • TRB TCRB TRBbeta T cell 6957 14229901 1428132 7q34 receptor beta 1 87
  • HPH-l HPH-3; hypoxia- 1 HIFPH1; HIF- inducible
  • a T cell can comprise one or more suppressed genes and one or more transgenes, such as a
  • one or more genes whose expression is suppressed can comprise any one of CD27, CD40, CD122, OX40, GITR, CD137, CD28, ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, TIM-3, VISTA, CISH, and/or any combination thereof.
  • one or more genes whose expression is suppressed can comprise PD-1 and one or more transgenes comprise TCR.
  • one or more genes whose expression is suppressed can also comprise CTLA-4, and one or more transgenes can comprise an exogenous TCR.
  • transgene can be done with or without the disruption of a gene.
  • a transgene can be inserted adjacent to, near, or within a gene such as CD27, CD40, CD 122, OX40, GITR, CD 137, CD28, ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, TIM-3, VISTA, HPRT, AAVS SITE (E G AAVS 1, AAVS2, ETC.), CCR5, or CISH to reduce or eliminate the activity or expression of the gene.
  • a cancer-specific TCR transgene can be inserted adjacent to, near, or within a gene (e.g.
  • PD-1 to reduce or eliminate the activity or expression of the gene.
  • the insertion of a transgene can be done at an endogenous TCR gene.
  • an endogenous TCR can be disrupted with a CRISPR system.
  • the disruption of genes can be of any particular gene. It is contemplated that genetic homologues
  • genes that are disrupted can exhibit a certain identity and/or homology to genes disclosed herein, e.g. , CD27, CD40, CD122, OX40, GITR, CD137, CD28, ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, TIM-3, VISTA, HPRT, CCR5, AAVS SITE (e.g.
  • a gene that exhibits or exhibits about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity (at the nucleic acid or protein level) can be disrupted.
  • Some genetic homologues are known in the art, however, in some cases, homologues are unknown. However, homologous genes between mammals can be found by comparing nucleic acid (DNA or RNA) sequences or protein sequences using publically available databases such as NCBI BLAST.
  • a gene that can be disrupted can be a member of a family of genes.
  • a gene that can be disrupted can improve therapeutic potential of cancer immunotherapy.
  • a gene can be CISH.
  • a CISH gene can be a member of a cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family (see e.g. , Palmer et al., Cish actively silences TCR signaling in CD8+ T cells to maintain tumor tolerance, The Journal of Experimental Medicine 202(12), 2095-2113 (2015)).
  • CIS cytokine-induced STAT inhibitor
  • SOCS suppressor of cytokine signaling
  • SSI STAT-induced STAT inhibitor
  • a gene can be part of a SOCS family of proteins that can form part of a classical negative feedback system that can regulate cytokine signal transduction.
  • a gene to be disrupted can be CISH.
  • CISH can be involved in negative regulation of cytokines that signal through the JAK-STAT5 pathway such as erythropoietin, prolactin or interleukin 3 (IL-3) receptor.
  • a gene can inhibit STAT5 trans-activation by suppressing its tyrosine phosphorylation.
  • CISH family members are known to be cytokine -inducible negative regulators of cytokine signaling. Expression of a gene can be induced by IL2, IL3, GM-CSF or EPO in hematopoietic cells.
  • Proteasome -mediated degradation of a gene protein can be involved in the inactivation of an erythropoietin receptor.
  • a gene to be targeted can be expressed in tumor-specific T cells.
  • a gene to be targeted can increase infiltration of an engineered cell into antigen-relevant tumors when disrupted.
  • a gene to be targeted can be CISH.
  • a gene that can be disrupted can be involved in attenuating TCR signaling, functional avidity, or immunity to cancer. In some cases, a gene to be disrupted is upregulated when a TCR is stimulated. A gene can be involved in inhibiting cellular expansion, functional avidity, or cytokine
  • a gene can be involved in negatively regulating cellular cytokine production.
  • a gene can be involved in inhibiting production of effector cytokines, IFN-gamma and/or TNF for example.
  • a gene can also be involved in inhibiting expression of supportive cytokines such as IL-2 after TCR stimulation.
  • Gene suppression can also be done in a number of ways.
  • gene expression can be suppressed by knock out, altering a promoter of a gene, and/or by administering interfering R As. This can be done at an organism level or at a tissue, organ, and/or cellular level.
  • the one or more genes can be suppressed by administrating RNA interfering reagents, e.g. , siR A, shRNA, or microRNA.
  • RNA interfering reagents e.g. , siR A, shRNA, or microRNA.
  • a nucleic acid which can express shRNA can be stably transfected into a cell to knockdown expression.
  • a nucleic acid which can express shRNA can be inserted into the genome of a T cell, thus knocking down a gene within the T cell.
  • One or more genes in a T cell can be knocked out or disrupted using any method.
  • knocking out one or more genes can comprise deleting one or more genes from a genome of a T cell.
  • Knocking out can also comprise removing all or a part of a gene sequence from a T cell. It is also contemplated that knocking out can comprise replacing all or a part of a gene in a genome of a T cell with one or more nucleotides.
  • Knocking out one or more genes can also comprise inserting a sequence in one or more genes thereby disrupting expression of the one or more genes. For example, inserting a sequence can generate a stop codon in the middle of one or more genes. Inserting a sequence can also shift the open reading frame of one or more genes.
  • nucleases and transcription factors, polynucleotides encoding same, and/or any transgene polynucleotides and compositions comprising the proteins and/or polynucleotides described herein can be delivered to a target cell by any suitable means.
  • Suitable cells can include but are not limited to eukaryotic and prokaryotic cells and/or cell lines.
  • a suitable cell can be a human primary cell.
  • a human primary cell can be an immune cell.
  • An immune cell can be a T cell, B cell, NK cell, and/or TIL.
  • Non-limiting examples of such cells or cell lines generated from such cells include COS, CHO (e.g.
  • a cell line can be a CHO-K1, MDCK or HEK293 cell line.
  • suitable primary cells include peripheral blood mononuclear cells (PBMC), peripheral blood lymphocytes (PBL), and other blood cell subsets such as, but not limited to, T cell, a natural killer cell, a monocyte, a natural killer T cell, a monocyte-precursor cell, a hematopoietic stem cell or a non-pluripotent stem cell.
  • the cell can be any immune cells including any T-cell such as tumor infiltrating cells (TILs), such as CD3+ T-cells, CD4+ T-cells, CD8+ T-cells, or any other type of T-cell.
  • TILs tumor infiltrating cells
  • the T cell can also include memory T cells, memory stem T cells, or effector T cells.
  • the T cells can also be selected from a bulk population, for example, selecting T cells from whole blood.
  • the T cells can also be expanded from a bulk population.
  • the T cells can also be skewed towards particular populations and phenotypes.
  • the T cells can be skewed to phenotypically comprise, CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+) and/or IL-7Ra(+).
  • Suitable cells can be selected that comprise one of more markers selected from a list comprising: CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+) and/or IL- 7Ra(+).
  • Suitable cells also include stem cells such as, by way of example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells and mesenchymal stem cells.
  • Suitable cells can comprise any number of primary cells, such as human cells, non-human cells, and/or mouse cells.
  • Suitable cells can be progenitor cells.
  • Suitable cells can be derived from the subject to be treated (e.g. , subject). Suitable cells can be derived from a human donor.
  • Suitable cells can be stem memory T SCM cells comprised of CD45RO (-), CCR7(+), CD45RA (+), CD62L+ (L-selectin), CD27+, CD28+ and IL-7Ra+, stem memory cells can also express CD95, IL-2R , CXCR3, and LFA-1, and show numerous functional attributes distinctive of stem memory cells.
  • Suitable cells can be central memory T C M cells comprising L-selectin and CCR7, central memory cells can secrete, for example, IL-2, but not IFNy or IL-4.
  • Suitable cells can also be effector memory T E M cells comprising L-selectin or CCR7 and produce, for example, effector cytokines such as IFNy and IL-4.
  • CRISPR and AAV modified cells can be a stem memory T S CM cell comprised of CD45RO (-), CCR7(+), CD45RA (+), CD62L+ (L-selectin), CD27+, CD28+ and IL-7Ra+, stem memory cells can also express CD95, IL-2R , CXCR3, and LFA-1, and show numerous functional attributes distinctive of stem memory cells.
  • Engineered cells, such as CRISPR and AAV modified cells can also be central memory T CM cells comprising L-selectin and CCR7, where the central memory cells can secrete, for example, IL-2, but not IFNy or IL-4.
  • Engineered cells can also be effector memory T EM cells comprising L-selectin or CCR7 and produce, for example, effector cytokines such as IFNy and IL-4.
  • a population of cells can be introduced to a subject.
  • a population of cells can be a combination of T cells and NK cells.
  • a population can be a combination of naive cells and effector cells.
  • a method of attaining suitable cells can comprise selecting cells.
  • a cell can comprise a marker that can be selected for the cell.
  • marker can comprise GFP, a resistance gene, a cell surface marker, an endogenous tag.
  • Cells can be selected using any endogenous marker.
  • Suitable cells can be selected using any technology. Such technology can comprise flow cytometry and/or magnetic columns. The selected cells can then be infused into a subject. The selected cells can also be expanded to large numbers. The selected cells can be expanded prior to infusion.
  • the transcription factors and nucleases as described herein can be delivered using vectors, for example containing sequences encoding one or more of the proteins.
  • Transgenes encoding polynucleotides can be similarly delivered.
  • Any vector systems can be used including, but not limited to, plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, etc.
  • any of these vectors can comprise one or more transcription factor, nuclease, and/or transgene.
  • CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules and/or transgenes when one or more CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules and/or transgenes are introduced into the cell, CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules and/or transgenes can be carried on the same vector or on different vectors.
  • each vector can comprise a sequence encoding one or multiple CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules and/or transgenes.
  • Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding engineered CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules and/or transgenes in cells (e.g. , mammalian cells) and target tissues. Such methods can also be used to administer nucleic acids encoding CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules and/or transgenes to cells in vitro.
  • nucleic acids encoding CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules and/or transgenes can be administered for in vivo or ex vivo immunotherapy uses.
  • Non- viral vector delivery systems can include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer.
  • Viral vector delivery systems can include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • Methods of non-viral delivery of nucleic acids include electroporation, lipofection, nucleofection, gold nanoparticle delivery, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid: nucleic acid conjugates, naked DNA, mRNA, artificial virions, and agent- enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids. Additional exemplary nucleic acid delivery systems include those provided by AMAXA ® Biosystems (Cologne, Germany), Life Technologies (Frederick, Md.), MAXCYTE, Inc.
  • Lipofection reagents are sold commercially ⁇ e.g. , TRANSFECTAM ® and LIPOFECTIN ® ). Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration). Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis.
  • EDVs EnGeneIC delivery vehicles
  • Vectors including viral and non-viral vectors containing nucleic acids encoding engineered
  • CRISPR, TALEN, transposon-based, ZFN, meganuclease, or Mega-TAL molecules, transposon and/or transgenes can also be administered directly to an organism for transduction of cells in vivo.
  • naked DNA or mRNA can be administered.
  • Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application and electroporation. More than one route can be used to administer a particular composition.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
  • a vector encoding for an exogenous TCR can be shuttled to a cellular nuclease.
  • a vector can contain a nuclear localization sequence (NLS).
  • a vector can also be shuttled by a protein or protein complex.
  • Cas9 can be used as a means to shuttle a minicircle vector. Cas can comprise a NLS.
  • a vector can be pre-complexed with a Cas protein prior to electroporation.
  • a Cas protein that can be used for shuttling can be a nuclease-deficient Cas9 (dCas9) protein.
  • a Cas protein that can be used for shuttling can be a nuclease -competent Cas9.
  • Cas protein can be pre-mixed with a guide RNA and a plasmid encoding an exogenous TCR.
  • Vectors can be delivered in vivo by administration to an individual subject, typically by systemic administration (e.g. , intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below.
  • vectors can be delivered to cells ex vivo, such as cells explanted from an individual subject (e.g., lymphocytes, T cells, bone marrow aspirates, tissue biopsy), followed by reimplantation of the cells into a subject, usually after selection for cells which have incorporated the vector. Prior to or after selection, the cells can be expanded.
  • a cell can be transfected with a mutant or chimeric adeno-associated viral vector encoding an exogenous TCR and a CRISPR system.
  • An AAV vector concentration can be from 0.5 nanograms to 50 micrograms.
  • the amount of nucleic acid (e.g. , ssDNA, dsDNA, RNA) that can be introduced into the cell by electroporation can be varied to optimize transfection efficiency and/or cell viability. In some cases, less than about 100 picograms of nucleic acid can be added to each cell sample (e.g., one or more cells being electroporated).
  • dsDNA 1 microgram of dsDNA can be added to each cell sample for electroporation.
  • the amount of nucleic acid (e.g. , dsDNA) required for optimal transfection efficiency and/or cell viability can be specific to the cell type.
  • the amount of nucleic acid (e.g. , dsDNA) used for each sample can directly correspond to the transfection efficiency and/or cell viability.
  • nucleofection or electroporation can be or can be about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or more than 99.9%.
  • the transfection efficiency can be or can be about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or more than 99.9% than the transfection efficiency of comparable cells using a control delivery platform (e.g., a delivery platform using a wild-type AAV).
  • a transfection or transduction efficiency can be quantified absent a cellular selection, sorting, or the like.
  • Vectors described herein can be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • the methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.
  • Electroporation using, for example, the Neon® Transfection System (ThermoFisher Scientific) or the AMAXA® Nucleofector (AMAXA® Biosystems) can also be used for delivery of nucleic acids into a cell. Electroporation parameters can be adjusted to optimize transfection efficiency and/or cell viability. Electroporation devices can have multiple electrical wave form pulse settings such as exponential decay, time constant and square wave. Every cell type has a unique optimal Field Strength (E) that is dependent on the pulse parameters applied (e.g. , voltage, capacitance and resistance). Application of optimal field strength causes
  • electropermeabilization through induction of transmembrane voltage, which allows nucleic acids to pass through the cell membrane.
  • the electroporation pulse voltage, the electroporation pulse width, number of pulses, cell density, and tip type can be adjusted to optimize transfection efficiency and/or cell viability.
  • electroporation pulse voltage can be varied to optimize transfection efficiency and/or cell viability.
  • the electroporation voltage can be less than about 500 volts.
  • the electroporation voltage can be at least about 500 volts, at least about 600 volts, at least about 700 volts, at least about 800 volts, at least about 900 volts, at least about 1000 volts, at least about 1 100 volts, at least about 1200 volts, at least about 1300 volts, at least about 1400 volts, at least about 1500 volts, at least about 1600 volts, at least about 1700 volts, at least about 1800 volts, at least about 1900 volts, at least about 2000 volts, at least about 2100 volts, at least about 2200 volts, at least about 2300 volts, at least about 2400 volts, at least about 2500 volts, at least about 2600 volts, at least about 2700
  • the electroporation pulse voltage required for optimal transfection efficiency and/or cell viability can be specific to the cell type.
  • an electroporation voltage of 1900 volts can optimal (e.g., provide the highest viability and/or transfection efficiency) for macrophage cells.
  • an electroporation voltage of about 1350 volts can optimal (e.g. , provide the highest viability and/or transfection efficiency) for Jurkat cells or primary human cells such as T cells.
  • a range of electroporation voltages can be optimal for a given cell type. For example, an electroporation voltage between about 1000 volts and about 1300 volts can optimal (e.g., provide the highest viability and/or transfection efficiency) for human 578T cells.
  • electroporation pulse width can be varied to optimize transfection efficiency and/or cell viability. In some cases, the electroporation pulse width can be less than about 5 milliseconds. In some cases, the electroporation width can be at least about 5 milliseconds, at least about 6 milliseconds, at least about 7 milliseconds, at least about 8 milliseconds, at least about 9
  • milliseconds at least about 10 milliseconds, at least about 1 1 milliseconds, at least about 12 milliseconds, at least about 13 milliseconds, at least about 14 milliseconds, at least about 15 milliseconds, at least about 16 milliseconds, at least about 17 milliseconds, at least about 18 milliseconds, at least about 19 milliseconds, at least about 20 milliseconds, at least about 21 milliseconds, at least about 22 milliseconds, at least about 23 milliseconds, at least about 24 milliseconds, at least about 25 milliseconds, at least about 26 milliseconds, at least about 27 milliseconds, at least about 28 milliseconds, at least about 29 milliseconds, at least about 30 milliseconds, at least about 31 milliseconds, at least about 32 milliseconds, at least about 33 milliseconds, at least about 34 milliseconds, at least about 35 milliseconds, at least about 36 milliseconds, at least about 37 milli
  • the electroporation pulse width required for optimal transfection efficiency and/or cell viability can be specific to the cell type. For example, an electroporation pulse width of 30 milliseconds can optimal (e.g. , provide the highest viability and/or transfection efficiency) for macrophage cells. In another example, an electroporation width of about 10 milliseconds can optimal (e.g. , provide the highest viability and/or transfection efficiency) for Jurkat cells. In some cases, a range of electroporation widths can be optimal for a given cell type. For example, an electroporation width between about 20 milliseconds and about 30 milliseconds can optimal (e.g. , provide the highest viability and/or transfection efficiency) for human 578T cells.
  • the number of electroporation pulses can be varied to optimize transfection
  • electroporation can comprise a single pulse. In some cases, electroporation can comprise more than one pulse. In some cases, electroporation can comprise 2 pulses, 3 pulses, 4 pulses, 5 pulses 6 pulses, 7 pulses, 8 pulses, 9 pulses, or 10 or more pulses. In some cases, the number of electroporation pulses required for optimal transfection efficiency and/or cell viability can be specific to the cell type. For example, electroporation with a single pulse can be optimal (e.g., provide the highest viability and/or transfection efficiency) for macrophage cells.
  • electroporation with a 3 pulses can be optimal (e.g., provide the highest viability and/or transfection efficiency) for primary cells.
  • a range of electroporation widths can be optimal for a given cell type.
  • electroporation with between about 1 to about 3 pulses can be optimal (e.g., provide the highest viability and/or transfection efficiency) for human cells.
  • the starting cell density for electroporation can be varied to optimize transfection efficiency and/or cell viability. In some cases, the starting cell density for electroporation can be less than about lxlO 5 cells. In some cases, the starting cell density for electroporation can be at least about lxlO 5 cells, at least about 2xl0 5 cells, at least about 3xl0 5 cells, at least about 4xl0 5 cells, at least about 5xl0 5 cells, at least about 6xl0 5 cells, at least about 7xl0 5 cells, at least about 8xl0 5 cells, at least about 9xl0 5 cells, at least about lxlO 6 cells, at least about 1.5xl0 6 cells, at least about 2xl0 6 cells, at least about 2.5xl0 6 cells, at least about 3xl0 6 cells, at least about 3.5xl0 6 cells, at least about 4xl0 6 cells, at least about 4.5xl0 6 cells, at least about 5xl0 6
  • the starting cell density for electroporation required for optimal transfection efficiency and/or cell viability can be specific to the cell type. For example, a starting cell density for electroporation of 1.5xl0 6 cells can optimal (e.g., provide the highest viability and/or transfection efficiency) for macrophage cells. In another example, a starting cell density for electroporation of 5xl0 6 cells can optimal (e.g. , provide the highest viability and/or transfection efficiency) for human cells. In some cases, a range of starting cell densities for electroporation can be optimal for a given cell type. For example, a starting cell density for electroporation between of 5.6xl0 6 and 5 xlO 7 cells can optimal (e.g. , provide the highest viability and/or transfection efficiency) for human cells such as T cells.
  • genome of a cell with, for example, a CRISPR system can be or can be about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or more than 99.9%.
  • Integration of an exogenous polynucleic acid such as a TCR, can be measured using any of the exogenous polynucleic acid, such as a TCR.
  • integration can be measured by flow cytometry, surveyor nuclease assay, tracking of indels by decomposition (TIDE), junction PCR, or any combination thereof.
  • TIDE indels by decomposition
  • a representative TIDE analysis is shown for percent gene editing efficiency as show for PD-1 and CTLA-4 guide RNAs.
  • transgene integration can be measured by PCR.
  • a TIDE analysis can also be performed on cells engineered to express an exogenous TCR by AAV transduction followed by CRISPR knock out of an endogenous checkpoint gene.
  • Ex vivo cell transfection can also be used for diagnostics, research, or for gene therapy (e.g., via re-infusion of the transfected cells into the host organism).
  • cells are isolated from the subject organism, transfected with a nucleic acid (e.g., gene or cDNA), and re-infused back into the subject organism (e.g., subject).
  • a nucleic acid e.g., gene or cDNA
  • the effective in a subject can vary depending on the viability of the cells, and the efficiency with which the cells have been genetically modified (e.g. , the efficiency with which a transgene has been integrated into one or more cells).
  • the product (e.g., multiplication) of the viability of cells post genetic modification and the efficiency of integration of a transgene can correspond to the therapeutic aliquot of cells available for administration to a subject.
  • an increase in the viability of cells post genetic modification can correspond to a decrease in the amount of cells that are necessary for administration to be therapeutically effective in a subject.
  • an increase in the efficiency with which a transgene has been integrated into one or more cells can correspond to a decrease in the amount of cells that are necessary for administration to be therapeutically effective in a subject.
  • determining an amount of cells that are necessary to be therapeutically effective can comprise determining a function corresponding to a change in the viability of cells over time.
  • determining an amount of cells that are necessary to be therapeutically effective can comprise determining a function corresponding to a change in the efficiency with which a transgene can be integrated into one or more cells with respect to time dependent variables (e.g., cell culture time, electroporation time, cell stimulation time).
  • viral particles such as AAV
  • a viral vector comprising a gene of interest or a transgene, such as an exogenous TCR, into a cell ex vivo or in vivo.
  • a mutated or chimeric adeno-associated viral vector as disclosed herein can be measured as pfu (plaque forming units).
  • the pfu of recombinant virus or mutated or chimeric adeno-associated viral vector of the compositions and methods of the disclosure can be about 10 8 to about 5 ⁇ 10 10 pfu.
  • recombinant viruses of this disclosure are at least about 1 10 8 , 2x 10 8 , 3 10 8 , 4x 10 8 , 5x 10 8 , 6x 10 8 , 7 ⁇ 10 8 , 8 ⁇ 10 8 , 9 ⁇ 10 8 , 1 ⁇ 10 9 , 2x 10 9 , 3 10 9 , 4x 10 9 , 5xl0 9 , 6xl0 9 , 7xl0 9 , 8 ⁇ 10 9 , 9 ⁇ 10 9 , ⁇ ⁇ ⁇ 10 , 2 ⁇ 10 10 , 3 ⁇ 10 10 , 4 ⁇ 10 10 , and 5xl0 10 pfu.
  • recombinant viruses of this disclosure are at most about 1 10 8 , 2 ⁇ 10 8 , 3 ⁇ 10 8 , 4 ⁇ 10 8 , 5 ⁇ 10 8 , 6 ⁇ 10 8 , 7xl0 8 , 8xl0 8 , 9xl0 8 , ⁇ ⁇ ⁇ 9 , 2 ⁇ 10 9 , 3 ⁇ 10 9 , 4 ⁇ 10 9 , 5 ⁇ 10 9 , 6 ⁇ 10 9 , 7 ⁇ 10 9 , 8 ⁇ 10 9 , 9 ⁇ 10 9 , lxlO 10 , 2x 10 10 , 3x 10 10 , 4x 10 10 , and 5 ⁇ 10 10 pfu.
  • a mutated or chimeric adeno-associated viral vector of the disclosure can be measured as vector genomes.
  • recombinant viruses of this disclosure are 1 10 10 to 3 ⁇ 10 12 vector genomes, or 1 ⁇ 10 9 to 3 ⁇ 10 13 vector genomes, or lxlO 8 to 3 x 10 14 vector genomes, or at least about lx 10 ⁇ ⁇ ⁇ 2 , ⁇ ⁇ ⁇ 3 , ⁇ ⁇ ⁇ 4 , ⁇ ⁇ ⁇ 5 , lxlO 6 , lxlO 7 , lxlO 8 , lxlO 9 , lxlO 10 , lxlO 11 , lxlO 12 , lxlO 13 , lxlO 14 , lxlO 15 , lxlO 16 , lxlO 17 , and lxlO 18
  • a mutated or chimeric adeno-associated viral vector of the disclosure can be
  • MOI multiplicity of infection
  • MOI can refer to the ratio, or multiple of vector or viral genomes to the cells to which the nucleic can be delivered.
  • the MOI can be 1 x 10 6 GC/mL.
  • the MOI can be 1 ⁇ 10 5 GC/mL to 1 ⁇ 10 7 GC/mL.
  • the MOI can be 1 x 10 4 GC/mL to 1 ⁇ 10 8 GC/mL.
  • recombinant viruses of the disclosure are at least about 1 ⁇ 10 1 GC/mL, 1 ⁇ 10 2 GC/mL, 1 ⁇ 10 3 GC/mL, 1 ⁇ 10 4 GC/mL, 1 ⁇ 10 5 GC/mL, lxlO 6 GC/mL, lxlO 7 GC/mL, lxlO 8 GC/mL, lxlO 9 GC/mL, lxlO 10 GC/mL, lxlO 11 GC/mL, lxlO 12 GC/mL, lxlO 13 GC/mL, lxlO 14 GC/mL, lxlO 15 GC/mL, lxlO 16 GC/mL, lxlO 17 GC/mL, and 1 ⁇ 10 18 GC/mL MOI.
  • a mutated or chimeric adeno-associated viruses of this disclosure are from about 1 ⁇ 10 8 GC/mL to about 3 ⁇ 10 14 GC/mL MOI, or are at most about 1 x 10 1 GC/mL, 1 ⁇ 10 2 GC/mL, 1 ⁇ 10 3 GC/mL, 1 ⁇ 10 4 GC/mL, 1 ⁇ 10 5 GC/mL, 1 ⁇ 10 6 GC/mL, 1 ⁇ 10 7 GC/mL, lxlO 8 GC/mL, lxlO 9 GC/mL, lxlO 10 GC/mL, lxlO 11 GC/mL, lxlO 12 GC/mL, lxlO 13 GC/mL, lxlO 14 GC/mL, lxlO 15 GC/mL, lxlO 16 GC/mL, lxlO 17 GC/mL, and
  • the viral vectors of the present disclosure are more effective and may have lower off- target effects during transduction of cells as compared to unmodified vectors.
  • a lower MOI of a modified virus may result in fewer off-target transgene insertions as compared to transducing a comparable cell with an unmodified vector.
  • a non-viral vector or nucleic acid can be delivered without the use of a mutated or chimeric adeno-associated viral vector and can be measured according to the quantity of nucleic acid.
  • any suitable amount of nucleic acid can be used with the compositions and methods of this disclosure.
  • nucleic acid can be at least about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 ⁇ ⁇ , 10 ⁇ ⁇ , 100 ⁇ ⁇ , 200 Mg, 300 ng, 400 ⁇ ⁇ , 500 ⁇ ⁇ , 600 ⁇ ⁇ , 700 ⁇ ⁇ , 800 ⁇ ⁇ , 900 ⁇ ⁇ , 1 ng, 10 ng, 100 ng, 200 ng, 300 ng,
  • nucleic acid can be at most about 1 pg, 10 pg, 100 pg, 1 pg, 10 pg, 100 pg, 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 ⁇ ⁇ , 10 ⁇ ⁇ , 100 ⁇ ⁇ , 200 ⁇ ⁇ , 300 ⁇ ⁇ , 400 ⁇ ⁇ , 500 ⁇ ⁇ , 600 ⁇ ⁇ , 700 ⁇ ⁇ , 800 ⁇ g, 900 ⁇ g, 1 ng, 10 ng, 100 ng, 200 ng, 300 ng, 400 ng, 500 ng, 600 ng, 700 ng, 800 ng, 900 ng, 1 mg, 10 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 2 g, 3 g, 4 g, or 5
  • Cells e.g., engineered cells or engineered primary T cells before, after, and/or during
  • transplantation can be functional.
  • transplanted cells can be functional for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 6, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or 100 days after transplantation.
  • Transplanted cells can be functional for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, or 12 months after
  • Transplanted cells can be functional for at least or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 years after transplantation. In some cases, transplanted cells can be functional for up to the lifetime of a recipient.
  • transplanted cells can function at 100% of its normal intended operation.
  • Transplanted cells can also function 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of its normal intended operation.
  • Transplanted cells can also function over 100% of its normal intended operation.
  • transplanted cells can function 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000 or more % of its normal intended operation.
  • Cytokines can be introduced with cells of the invention. Cytokines can be utilized to boost cytotoxic T lymphocytes (including adoptively transferred tumor-specific cytotoxic T lymphocytes) to expand within a tumor microenvironment. In some cases, IL-2 can be used to facilitate expansion of the cells described herein. Cytokines such as IL- 15 can also be employed. Other relevant cytokines in the field of immunotherapy can also be utilized, such as IL-2, IL-7, IL- 12, IL-15, IL-21, or any combination thereof.
  • IL-2 can be administered beginning within 24 hours of cell infusion and continuing for up to about 4 days (maximum 12 doses). In some cases, IL-2 can be administered for up to about 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 days after an initial administration.
  • Doses of IL-2 can be administered every eight hours. In some cases, IL-2 can be administered from about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours after an initial administration. In some cases, IL-2 dosing can be stopped if toxicities are detected. In some cases, doses can be delayed or stopped if subjects reach Grade 3 or Grade 4 toxicity due to aldesleukin except for the reversible Grade 3 toxicities common to Aldesleukin such as diarrhea, nausea, vomiting, hypotension, skin changes, anorexia, mucositis, dysphagia, or constitutional symptoms and laboratory changes. In some cases, if these toxicities can be easily reversed within 24 hours by supportive measures, then additional doses can be given. In addition, dosing can be held or stopped at the discretion of a treating physician.
  • compositions described throughout can be formulation into a pharmaceutical medicament and be used to treat a human or mammal, in need thereof, diagnosed with a disease, e.g. , cancer.
  • These medicaments can be co-administered with one or more T cells (e.g. , engineered T cells) to a human or mammal, together with one or more chemotherapeutic agent or chemotherapeutic compound.
  • T cells e.g. , engineered T cells
  • chemotherapeutic cancer agents that can be used in combination with the disclosed T cell include, but are not limited to, mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine, vindesine and NavelbineTM (vinorelbine, 5 '-noranhydroblastine). In yet other cases,
  • chemotherapeutic cancer agents include topoisomerase I inhibitors, such as camptothecin compounds.
  • camptothecin compounds include CamptosarTM (irinotecan HCL), HycamtinTM (topotecan HCL) and other compounds derived from camptothecin and its
  • chemotherapeutic cancer agents that can be used in the methods and compositions disclosed herein can be podophyllotoxin derivatives, such as etoposide, teniposide and mitopodozide.
  • the present disclosure further encompasses other chemotherapeutic cancer agents known as alkylating agents, which alkylate the genetic material in tumor cells. These include without limitation cisplatin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, belustine, uracil mustard, chlomaphazin, and dacarbazine.
  • alkylating agents which alkylate the genetic material in tumor cells. These include without limitation cisplatin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, belustine, uracil mustard, chlomaphazin, and dacarbazine.
  • the disclosure encompass
  • chemotherapeutic cancer agents examples include cytosine arabinoside, fluorouracil, methotrexate, mercaptopurine, azathioprime, and procarbazine.
  • An additional category of chemotherapeutic cancer agents that can be used in the methods and compositions disclosed herein includes antibiotics. Examples include without limitation doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mytomycin C, and daunomycin. There are numerous liposomal formulations commercially available for these compounds.
  • the present disclosure further encompasses other chemotherapeutic cancer agents including without limitation anti-tumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, ifosfamide and mitoxantrone.
  • chemotherapeutic cancer agents including without limitation anti-tumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, ifosfamide and mitoxantrone.
  • the disclosed T cell herein can be administered in combination with other anti-tumor agents, including cytotoxic/antineoplastic agents and anti-angiogenic agents. Cytotoxic/anti -neoplastic agents can be defined as agents who attack and kill cancer cells.
  • cytotoxic/anti -neoplastic agents can be alkylating agents, which alkylate the genetic material in tumor cells, e.g., cis-platin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, belustine, uracil mustard, chlomaphazin, and dacabazine.
  • Other cytotoxic/antineoplastic agents can be antimetabolites for tumor cells, e.g. , cytosine arabinoside, fluorouracil, methotrexate, mercaptopuirine, azathioprime, and procarbazine.
  • cytotoxic/anti-neoplastic agents can be antibiotics, e.g., doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mytomycin C, and daunomycin.
  • antibiotics e.g., doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mytomycin C, and daunomycin.
  • cytotoxic/anti-neoplastic agents can be mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine and etoposide.
  • Miscellaneous cytotoxic/anti-neoplastic agents include taxol and its derivatives, L-asparaginase, antitumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone, and vindesine.
  • Anti-angiogenic agents can also be used. Suitable anti-angiogenic agents for use in the disclosed methods and compositions include anti-VEGF antibodies, including humanized and chimeric antibodies, anti-VEGF aptamers and antisense oligonucleotides. Other inhibitors of angiogenesis include angiostatin, endostatin, interferons, interleukin 1 (including a and ⁇ ) interleukin 12, retinoic acid, and tissue inhibitors of metalloproteinase-1 and -2. (TIMP-1 and -2). Small molecules, including topoisomerases such as razoxane, a topoisomerase II inhibitor with anti-angiogenic activity, can also be used.
  • anti-cancer agents that can be used in combination with the disclosed T cell include, but are not limited to: acivicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantrone acetate; aminoglutethimide; amsacrine; anastrozole;
  • anthramycin asparaginase; asperlin; avastin; azacitidine; azetepa; azotomycin; batimastat;
  • diaziquone diaziquone; docetaxel; doxorubicin; doxorubicin hydrochloride; droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate; eflornithine hydrochloride; elsamitrucin;
  • enloplatin enpromate; epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; trasrabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; flurocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; ilmofosine; interleukin II (including recombinant interleukin
  • interferon alfa-2a interferon alfa-2b
  • interferon alfa-nl interferon alfa-n3
  • interferon beta-I a interferon gamma-I b
  • iproplatin irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone
  • porfimer sodium porfiromycin; prednimustine; procarbazine hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; safingol hydrochloride; semustine; pumprazene; sparfosate sodium; sparsomycin; spirogermanium hydrochloride; spiromustine;
  • teloxantrone hydrochloride temoporfin; teniposide; teroxirone; testolactone; thiamiprine;
  • thioguanine thiotepa
  • tiazofurin tirapazamine
  • toremifene citrate trestolone acetate
  • triciribine phosphate trimetrexate
  • trimetrexate glucuronate triptorelin
  • tubulozole hydrochloride uracil mustard; uredepa; vapreotide; verteporfm; vinblastine sulfate; vincristine sulfate; vindesine;
  • anti -cancer drugs include, but are not limited to: 20-epi-l,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid;
  • combretastatin A4 combretastatin analogue
  • conagenin crambescidin 816; crisnatol
  • cryptophycin 8 cryptophycin A derivatives
  • curacin A cyclopentanthraquinones
  • cycloplatam cycloplatam
  • cypemycin
  • flezelastine fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat;
  • imidazoacridones imiquimod; immunostimulant peptides; insulin-like growth factor- 1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone;
  • leuprorelin leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide;
  • lipophilic platinum compounds lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin;
  • mitoxantrone mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1-based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin;

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Hematology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/US2018/040480 2017-06-30 2018-06-29 ADENO-ASSOCIATED VIRAL VECTORS FOR GENE THERAPY Ceased WO2019006418A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN201880056905.7A CN111511375A (zh) 2017-06-30 2018-06-29 用于基因治疗的腺相关病毒载体
JP2020521488A JP2020530307A (ja) 2017-06-30 2018-06-29 遺伝子治療のためのアデノ随伴ウイルスベクター
EP18825318.1A EP3645021A4 (en) 2017-06-30 2018-06-29 ADENO-ASSOCIATED VIRAL VECTORS FOR GENE THERAPY
US16/718,400 US11098325B2 (en) 2017-06-30 2019-12-18 Adeno-associated viral vectors for gene therapy
US17/385,513 US20230018860A1 (en) 2017-06-30 2021-07-26 Adeno-associated viral vectors for gene therapy
US17/385,507 US20230015722A1 (en) 2017-06-30 2021-07-26 Adeno-associated viral vectors for gene therapy

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201762527937P 2017-06-30 2017-06-30
US62/527,937 2017-06-30
US201862659472P 2018-04-18 2018-04-18
US62/659,472 2018-04-18
US201862665256P 2018-05-01 2018-05-01
US62/665,256 2018-05-01

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/718,400 Continuation US11098325B2 (en) 2017-06-30 2019-12-18 Adeno-associated viral vectors for gene therapy

Publications (2)

Publication Number Publication Date
WO2019006418A2 true WO2019006418A2 (en) 2019-01-03
WO2019006418A3 WO2019006418A3 (en) 2019-02-21

Family

ID=64742713

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/040480 Ceased WO2019006418A2 (en) 2017-06-30 2018-06-29 ADENO-ASSOCIATED VIRAL VECTORS FOR GENE THERAPY

Country Status (5)

Country Link
US (3) US11098325B2 (https=)
EP (1) EP3645021A4 (https=)
JP (1) JP2020530307A (https=)
CN (1) CN111511375A (https=)
WO (1) WO2019006418A2 (https=)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020014395A1 (en) * 2018-07-10 2020-01-16 University Of Florida Research Foundation, Incorporated Aav vp1u chimeras
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10745447B2 (en) 2015-09-28 2020-08-18 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
WO2020219543A1 (en) * 2019-04-26 2020-10-29 The Regents Of The University Of California Cells for enhanced production of adeno-associated virus
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
US11147837B2 (en) 2015-07-31 2021-10-19 Regents Of The University Of Minnesota Modified cells and methods of therapy
WO2021195494A3 (en) * 2020-03-26 2021-11-04 Asklepios Biopharmaceutical, Inc. Inducible promoter for viral vector production
WO2021195491A3 (en) * 2020-03-26 2021-11-11 Asklepios Biopharmaceutical, Inc. Inducible promoter for viral vector production
WO2021252804A1 (en) * 2020-06-12 2021-12-16 Nkarta, Inc. Genetically modified natural killer cells for cd70-directed cancer immunotherapy
CN114276419A (zh) * 2021-12-30 2022-04-05 上海勉亦生物科技有限公司 肌肉高亲和性的新型腺相关病毒衣壳蛋白及其应用
WO2022100748A1 (en) * 2020-11-16 2022-05-19 Staidson (Beijing) Biopharmaceuticals Co., Ltd. Recombinant adeno-associated viruses with enhanced liver tropism and uses thereof
CN115885046A (zh) * 2020-03-26 2023-03-31 阿斯克肋匹奥生物制药公司 用于病毒载体生产的诱导型启动子
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
WO2023215947A1 (en) * 2022-05-13 2023-11-16 Children's Medical Research Institute Adeno-associated virus capsids
WO2023205610A3 (en) * 2022-04-18 2023-11-30 Regenxbio Inc. Hybrid aav capsids
US11859200B2 (en) 2020-05-13 2024-01-02 Voyager Therapeutics, Inc. AAV capsids with increased tropism to brain tissue
US11905523B2 (en) 2019-10-17 2024-02-20 Ginkgo Bioworks, Inc. Adeno-associated viral vectors for treatment of Niemann-Pick Disease type-C
US11976096B2 (en) 2018-04-03 2024-05-07 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US11981914B2 (en) 2019-03-21 2024-05-14 Ginkgo Bioworks, Inc. Recombinant adeno-associated virus vectors
US12060390B2 (en) 2018-04-03 2024-08-13 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US12104163B2 (en) 2020-08-19 2024-10-01 Sarepta Therapeutics, Inc. Adeno-associated virus vectors for treatment of Rett syndrome
WO2024206831A1 (en) * 2023-03-31 2024-10-03 Duke University Compositions comprising brain-tropic aavs and methods of use thereof
US12116384B2 (en) 2018-04-03 2024-10-15 Ginkgo Bioworks, Inc. Virus vectors for targeting ophthalmic tissues
US12296025B2 (en) 2021-11-02 2025-05-13 Voyager Therapeutics, Inc. AAV capsid variants and uses thereof
US12398187B2 (en) 2019-03-05 2025-08-26 Nkarta, Inc. CD19-directed chimeric antigen receptors and uses thereof in immunotherapy
US12467046B2 (en) 2018-10-02 2025-11-11 Voyager Therapeutics, Inc. Redirection of tropism of AAV capsids
US12611436B2 (en) 2020-10-16 2026-04-28 Sarepta Therapeutics, Inc. AAV transfer cassette

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR100419A1 (es) * 2014-05-14 2016-10-05 Esteve Labor Dr Vectores de virus adenoasociados para el tratamiento de trastornos de almacenamiento lisosómico
CA3041831A1 (en) * 2016-10-27 2018-05-03 Intima Bioscience, Inc. Viral methods of making genetically modified cells
WO2022226294A1 (en) * 2021-04-23 2022-10-27 The University Of North Carolina At Chapel Hill Chimeric aav5 capsids
CN113563430B (zh) * 2021-07-30 2022-05-31 上海信致医药科技有限公司 用于治疗眼部疾病的基因递送系统及其应用
WO2023173062A2 (en) * 2022-03-11 2023-09-14 Intima Bioscience, Inc. Nucleic acid editing systems, methods, and uses thereof
CN114516901B (zh) * 2022-03-11 2023-01-17 上海勉亦生物科技有限公司 一种神经系统高亲和性的aav载体及其应用
CN116693633B (zh) * 2023-02-21 2023-12-22 广州派真生物技术有限公司 腺相关病毒突变体及其应用
CN116287263B (zh) * 2023-03-02 2025-08-12 圣湘生物科技股份有限公司 一种用于甲状腺结节检测的组合物及试剂盒
CN116549667B (zh) * 2023-05-29 2024-02-09 四川普锐特药业有限公司 一种pas修饰的脂质纳米粒、包含其的药物制剂,及其制备方法和用途
CN118480097B (zh) * 2023-09-20 2024-11-05 广州派真生物技术有限公司 腺相关病毒突变体及其应用

Family Cites Families (197)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5906936A (en) 1988-05-04 1999-05-25 Yeda Research And Development Co. Ltd. Endowing lymphocytes with antibody specificity
IL104570A0 (en) 1992-03-18 1993-05-13 Yeda Res & Dev Chimeric genes and cells transformed therewith
US8211422B2 (en) 1992-03-18 2012-07-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Chimeric receptor genes and cells transformed therewith
AU701578B2 (en) 1992-08-21 1999-02-04 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5830755A (en) 1995-03-27 1998-11-03 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services T-cell receptors and their use in therapeutic and diagnostic methods
US5840839A (en) 1996-02-09 1998-11-24 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Alternative open reading frame DNA of a normal gene and a novel human cancer antigen encoded therein
JP2001517206A (ja) 1996-08-16 2001-10-02 ザ ジョンズ ホプキンズ ユニヴァーシティ スクール オヴ メディシン 免疫優性な共有黒色腫抗原を発現する黒色腫細胞株およびその使用方法
CN1237909A (zh) 1996-10-11 1999-12-08 加利福尼亚大学董事会 联合使用肿瘤细胞与混合淋巴细胞的癌症免疫治疗
CA2304168A1 (en) 1997-09-19 1999-04-01 The Trustees Of The University Of Pennsylvania Methods and cell line useful for production of recombinant adeno-associated viruses
ES2340230T3 (es) 1998-11-10 2010-05-31 University Of North Carolina At Chapel Hill Vectores viricos y sus procedimientos de preparacion y administracion.
US6737056B1 (en) 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
WO2000046386A2 (en) 1999-02-03 2000-08-10 The Children's Medical Center Corporation Gene repair involving the induction of double-stranded dna cleavage at a chromosomal target site
EP2311950A1 (en) 2000-01-28 2011-04-20 The Government of the United States of America, as represented by the Secretary, Department of Health and Human Services Novel MHC class II restricted T cell epitopes from the cancer antigen, NY ESO-1
CA2373110A1 (en) * 2000-03-14 2001-09-20 Neurologix, Inc. Production of chimeric capsid vectors
WO2002030184A1 (en) 2000-10-09 2002-04-18 Amrad Operations Pty Ltd Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of socs sequence in the animal
US8716022B2 (en) 2000-11-17 2014-05-06 Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of Agriculture And Agri-Food Modulation of meiotic recombination
US7723111B2 (en) 2001-03-09 2010-05-25 The United States Of America As Represented By The Department Of Health And Human Services Activated dual specificity lymphocytes and their methods of use
US7070995B2 (en) 2001-04-11 2006-07-04 City Of Hope CE7-specific redirected immune cells
AU2002321581C1 (en) 2001-08-31 2008-09-18 Adaptimmune Limited Soluble T cell receptor
AU2003216436A1 (en) 2002-02-08 2003-09-02 Life Technologies Corporation Compositions and methods for restoring immune responsiveness in patients with immunological defects
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
AU2003233734C1 (en) 2002-06-05 2011-01-20 Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of Agriculture And Agri-Food Retrons for gene targeting
CN1856576B (zh) * 2003-09-30 2011-05-04 宾夕法尼亚州立大学托管会 腺伴随病毒(aav)进化支、序列、含有这些序列的载体及它们的应用
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
NZ550815A (en) 2004-05-19 2009-04-30 Immunocore Ltd Method of improving T cell receptors
DK1765860T3 (da) 2004-05-19 2009-03-09 Immunocore Ltd Ny-ESO-T.cellereceptor med höj affinitet
JP2008522951A (ja) 2004-07-19 2008-07-03 ベイラー・カレツジ・オブ・メデイシン サイトカインシグナル伝達調節物質の調節および免疫療法のための応用
EP1828390B1 (en) * 2004-12-15 2012-06-13 The University Of North Carolina At Chapel Hill Chimeric vectors
US8889365B2 (en) 2005-03-16 2014-11-18 Rutgers, The State University Of New Jersey Methods and kit for detecting breast cancer
WO2006110689A2 (en) * 2005-04-07 2006-10-19 The Trustees Of The University Of Pennsylvania Method of increasing the function of an aav vector
US8283151B2 (en) * 2005-04-29 2012-10-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes
US8389708B2 (en) 2005-06-15 2013-03-05 Weiping Min Method of cancer treatment using siRNA silencing
WO2007017201A1 (en) 2005-08-05 2007-02-15 Helmholtz Zentrum München Deutsches Forschungszentrum Für Gesundheit Und Umwelt Gmbh Generation of antigen specific t cells
ES2398918T3 (es) 2005-08-26 2013-03-22 Dupont Nutrition Biosciences Aps Un método y una ordenación para soportar verticalmente elementos de resistencia eléctrica pendientes
US20090220488A1 (en) 2005-08-31 2009-09-03 Humphrey Gardner Evaluating and treating scleroderma
US7867484B2 (en) * 2006-01-27 2011-01-11 University Of North Carolina At Chapel Hill Heparin and heparan sulfate binding chimeric vectors
WO2008016391A2 (en) * 2006-01-31 2008-02-07 The Board Of Trustees Of The Leland Stanford Junior University Self-complementary parvoviral vectors, and methods for making and using the same
MX2008013514A (es) 2006-05-17 2008-10-28 Hoffmann La Roche Celulas productoras de polipeptidos.
PL2018441T3 (pl) 2006-05-19 2012-03-30 Dupont Nutrition Biosci Aps Mikroorganizmy znakowane i sposoby znakowania
EP2848253A1 (en) 2006-06-19 2015-03-18 Asklepios Biopharmaceutical, Inc. Modified factor VIII and factor IX genes and vectors for gene therapy
EP1878744A1 (en) 2006-07-13 2008-01-16 Max-Delbrück-Centrum für Molekulare Medizin (MDC) Epitope-tag for surface-expressed T-cell receptor proteins, uses thereof and method of selecting host cells expressing them
US7750449B2 (en) 2007-03-13 2010-07-06 Micron Technology, Inc. Packaged semiconductor components having substantially rigid support members and methods of packaging semiconductor components
CA2682527C (en) 2007-03-30 2017-07-11 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred t lymphocytes
US8563314B2 (en) 2007-09-27 2013-10-22 Sangamo Biosciences, Inc. Methods and compositions for modulating PD1
EP2910637A1 (en) 2008-05-20 2015-08-26 University of Florida Research Foundation, Inc. Vectors for delivery of light-sensitive proteins and methods of use
WO2010011961A2 (en) 2008-07-25 2010-01-28 University Of Georgia Research Foundation, Inc. Prokaryotic rnai-like system and methods of use
EP4032552B1 (en) 2008-08-26 2023-10-04 City of Hope Method and compositions for enhanced anti-tumor effector functioning of t cells
US20100076057A1 (en) 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
WO2010054108A2 (en) 2008-11-06 2010-05-14 University Of Georgia Research Foundation, Inc. Cas6 polypeptides and methods of use
EP2396343B1 (en) * 2009-02-11 2017-05-17 The University of North Carolina At Chapel Hill Modified virus vectors and methods of making and using the same
PL2403867T3 (pl) 2009-03-04 2019-12-31 Deutsches Krebsforschungszentrum Białko aktywujące składanie (aap) i jego zastosowanie do wytwarzania cząstek parwowirusa zasadniczo składających się z vp3
EP2258719A1 (en) 2009-05-19 2010-12-08 Max-Delbrück-Centrum für Molekulare Medizin (MDC) Multiple target T cell receptor
US20120192298A1 (en) 2009-07-24 2012-07-26 Sigma Aldrich Co. Llc Method for genome editing
US8383099B2 (en) 2009-08-28 2013-02-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Adoptive cell therapy with young T cells
US8956828B2 (en) 2009-11-10 2015-02-17 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
WO2011117258A2 (en) * 2010-03-22 2011-09-29 Association Institut De Myologie Methods of increasing efficiency of vector penetration of target tissue
EP3467101A3 (en) 2010-09-08 2019-06-19 Baylor College of Medicine Immunotherapy of brain tumor using geneticially engineered gd2-specific t cells
WO2012031760A1 (en) 2010-09-08 2012-03-15 Medigene Ag Parvovirus mutated structural proteins comprising cross - protective b - cell epitopes of a hpv l2 protein as well as products and methods relating thereto
GB2498325B (en) 2010-10-15 2018-05-02 Eos Neuroscience Inc Engineered human GRM6 enhancer sequence for use in eye therapies
WO2012078540A1 (en) 2010-12-08 2012-06-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Modulating immune cell activity using cytokine-induced src homology 2 and/or high temperature requirement a-1
PH12013501201A1 (en) 2010-12-09 2013-07-29 Univ Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer
WO2012112079A1 (en) 2011-02-14 2012-08-23 Vitaspero, Inc. IMPROVING CELLULAR IMMUNOTHERAPEUTIC VACCINES EFFICACY WITH GENE SUPPRESSION IN DENDRITIC CELLS AND T-LYMPHOCYTES USING SiRNA
US9528124B2 (en) 2013-08-27 2016-12-27 Recombinetics, Inc. Efficient non-meiotic allele introgression
CN110200997A (zh) 2011-03-23 2019-09-06 弗雷德哈钦森癌症研究中心 用于细胞免疫治疗的方法和组合物
CN103476399A (zh) * 2011-04-18 2013-12-25 独立行政法人国立精神·神经医疗研究中心 药剂递送粒子及其制造方法
WO2012164565A1 (en) 2011-06-01 2012-12-06 Yeda Research And Development Co. Ltd. Compositions and methods for downregulating prokaryotic genes
CN103732238A (zh) 2011-06-08 2014-04-16 奥瑞基尼探索技术有限公司 用于免疫调节的治疗性化合物
KR101307196B1 (ko) 2011-07-15 2013-09-12 국립대학법인 울산과학기술대학교 산학협력단 미세 세포 배양 장치
WO2013040557A2 (en) 2011-09-16 2013-03-21 The Trustees Of The University Of Pennsylvania Rna engineered t cells for the treatment of cancer
WO2013049330A1 (en) 2011-09-28 2013-04-04 The Regents Of The University Of California Synthetic transcriptional control elements and methods of generating and using such elements
EP2768982A4 (en) 2011-10-21 2015-06-03 Adaptive Biotechnologies Corp QUANTIFICATION OF ADAPTIVE IMMUNOCELL GENOMES IN A COMPLEX MIX OF CELLS
JP6074435B2 (ja) 2011-10-26 2017-02-01 ナショナル キャンサー センター 変異ctla4遺伝子移入t細胞及びこれを含む抗がん免疫治療用組成物
US9441206B2 (en) 2011-10-28 2016-09-13 The University Of North Carolina At Chapel Hill Cell line for production of adeno-associated virus
WO2013074916A1 (en) 2011-11-18 2013-05-23 Board Of Regents, The University Of Texas System Car+ t cells genetically modified to eliminate expression of t- cell receptor and/or hla
PH12014501360B1 (en) 2011-12-16 2022-05-20 Targetgene Biotechnologies Ltd Compositions and methods for modifying a predetermined target nucleic acid sequence
WO2013096955A1 (en) 2011-12-23 2013-06-27 Case Western Reserve University Targeted gene modification using hybrid recombinant adeno-associated virus
GB201122458D0 (en) 2011-12-30 2012-02-08 Univ Wageningen Modified cascade ribonucleoproteins and uses thereof
US9637739B2 (en) 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
WO2013141680A1 (en) 2012-03-20 2013-09-26 Vilnius University RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
JP6378172B2 (ja) 2012-05-22 2018-08-22 アメリカ合衆国 マウス抗ny−eso−1t細胞受容体
US20150017136A1 (en) 2013-07-15 2015-01-15 Cellectis Methods for engineering allogeneic and highly active t cell for immunotherapy
EP3241902B1 (en) 2012-05-25 2018-02-28 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
KR102437522B1 (ko) 2012-05-25 2022-08-26 셀렉티스 면역요법을 위한 동종이형 및 면역억제제 저항성인 t 세포의 조작 방법
WO2014006518A1 (en) 2012-07-04 2014-01-09 Indian Institute Of Science Compounds as inhibitor of dna double-strand break repair, methods and applications thereof
KR102530118B1 (ko) 2012-07-25 2023-05-08 더 브로드 인스티튜트, 인코퍼레이티드 유도 dna 결합 단백질 및 게놈 교란 도구 및 이의 적용
HK1207111A1 (en) 2012-08-03 2016-01-22 加利福尼亚大学董事会 Methods and compositions for controlling gene expression by rna processing
CA2881981A1 (en) 2012-08-20 2014-02-27 Fred Hutchinson Cancer Research Center Method and compositions for cellular immunotherapy
EP2906684B8 (en) 2012-10-10 2020-09-02 Sangamo Therapeutics, Inc. T cell modifying compounds and uses thereof
US20140113375A1 (en) 2012-10-21 2014-04-24 Lixin Liu Transient Expression And Reverse Transcription Aided Genome Alteration System
EP4357457B1 (en) 2012-10-23 2024-10-16 Toolgen Incorporated Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof
GB2508414A (en) 2012-11-30 2014-06-04 Max Delbrueck Centrum Tumour specific T cell receptors (TCRs)
EP3363902B1 (en) 2012-12-06 2019-11-27 Sigma Aldrich Co. LLC Crispr-based genome modification and regulation
CA2894684A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Engineering and optimization of improved crispr-cas systems, methods and enzyme compositions for sequence manipulation in eukaryotes
DK2931898T3 (en) 2012-12-12 2016-06-20 Massachusetts Inst Technology CONSTRUCTION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH FUNCTIONAL DOMAINS
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
WO2014093694A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Crispr-cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
AU2013359262C1 (en) 2012-12-12 2021-05-13 Massachusetts Institute Of Technology CRISPR-Cas component systems, methods and compositions for sequence manipulation
WO2014093709A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
DK2931897T3 (en) 2012-12-12 2018-02-05 Broad Inst Inc CONSTRUCTION, MODIFICATION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION AND THERAPEUTICAL APPLICATIONS
WO2014093718A1 (en) 2012-12-12 2014-06-19 The Broad Institute, Inc. Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
CN105121648B (zh) 2012-12-12 2021-05-07 布罗德研究所有限公司 用于序列操纵的系统、方法和优化的指导组合物的工程化
CA2895155C (en) 2012-12-17 2021-07-06 President And Fellows Of Harvard College Rna-guided human genome engineering
WO2014127287A1 (en) 2013-02-14 2014-08-21 Massachusetts Institute Of Technology Method for in vivo tergated mutagenesis
US10227610B2 (en) 2013-02-25 2019-03-12 Sangamo Therapeutics, Inc. Methods and compositions for enhancing nuclease-mediated gene disruption
PT2961831T (pt) 2013-02-26 2020-10-12 Memorial Sloan Kettering Cancer Center Composições e métodos para imunoterapêutica
WO2014134412A1 (en) 2013-03-01 2014-09-04 Regents Of The University Of Minnesota Talen-based gene correction
WO2014153118A1 (en) 2013-03-14 2014-09-25 The Board Of Trustees Of The Leland Stanford Junior University Treatment of diseases and conditions associated with dysregulation of mammalian target of rapamycin complex 1 (mtorc1)
MX374090B (es) 2013-03-14 2025-03-05 Caribou Biosciences Inc Composiciones y métodos de ácidos nucleicos dirigidos al ácido nucleico.
US20140271550A1 (en) * 2013-03-14 2014-09-18 The Trustees Of The University Of Pennsylvania Constructs and Methods for Delivering Molecules via Viral Vectors with Blunted Innate Immune Responses
WO2014159546A1 (en) 2013-03-14 2014-10-02 Asklepios Biopharmaceutical, Inc. Modified soluble vegf receptor-1 genes and vectors for gene therapy
AU2014227653B2 (en) 2013-03-15 2017-04-20 The General Hospital Corporation Using RNA-guided foki nucleases (RFNs) to increase specificity for RNA-guided genome editing
US9234213B2 (en) 2013-03-15 2016-01-12 System Biosciences, Llc Compositions and methods directed to CRISPR/Cas genomic engineering systems
US20140273230A1 (en) 2013-03-15 2014-09-18 Sigma-Aldrich Co., Llc Crispr-based genome modification and regulation
JP2016522679A (ja) 2013-04-04 2016-08-04 プレジデント アンド フェローズ オブ ハーバード カレッジ CRISPR/Cas系を用いたゲノム編集の治療的使用
AU2014251099B2 (en) * 2013-04-08 2019-01-17 The University Of Kansas Chimeric adeno-associated virus/ bocavirus parvovirus vector
MX2015015638A (es) 2013-05-13 2016-10-28 Cellectis Metodos para diseñar celulas t altamente activas para inmunoterapia.
US11311575B2 (en) 2013-05-13 2022-04-26 Cellectis Methods for engineering highly active T cell for immunotherapy
CN105683376A (zh) 2013-05-15 2016-06-15 桑格摩生物科学股份有限公司 用于治疗遗传病状的方法和组合物
WO2014191128A1 (en) 2013-05-29 2014-12-04 Cellectis Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system
US20160122774A1 (en) 2013-05-29 2016-05-05 Cellectis A method for producing precise dna cleavage using cas9 nickase activity
ES2883131T3 (es) 2013-05-29 2021-12-07 Cellectis Métodos para la modificación de células T para inmunoterapia utilizando el sistema de nucleasa CAS guiado por ARN
JP6195474B2 (ja) 2013-05-31 2017-09-13 ギガフォトン株式会社 極端紫外光生成装置及び極端紫外光生成システムにおけるレーザシステムの制御方法
MX2015017312A (es) 2013-06-17 2017-04-10 Broad Inst Inc Suministro y uso de composiciones, vectores y sistemas crispr-cas para la modificación dirigida y terapia hepáticas.
KR20250012194A (ko) 2013-06-17 2025-01-23 더 브로드 인스티튜트, 인코퍼레이티드 바이러스 구성성분을 사용하여 장애 및 질환을 표적화하기 위한 crispr-cas 시스템 및 조성물의 전달, 용도 및 치료 적용
KR20160019553A (ko) 2013-06-17 2016-02-19 더 브로드 인스티튜트, 인코퍼레이티드 유사분열 후 세포의 질병 및 장애를 표적화하고 모델링하기 위한 시스템, 방법 및 조성물의 전달, 유전자 조작 및 최적화
EP3011030B1 (en) 2013-06-17 2023-11-08 The Broad Institute, Inc. Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation
WO2014204724A1 (en) 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation
EP3725885A1 (en) 2013-06-17 2020-10-21 The Broad Institute, Inc. Functional genomics using crispr-cas systems, compositions methods, screens and applications thereof
WO2014204723A1 (en) 2013-06-17 2014-12-24 The Broad Institute Inc. Oncogenic models based on delivery and use of the crispr-cas systems, vectors and compositions
JP2016528890A (ja) 2013-07-09 2016-09-23 プレジデント アンド フェローズ オブ ハーバード カレッジ CRISPR/Cas系を用いるゲノム編集の治療用の使用
WO2015006294A2 (en) 2013-07-10 2015-01-15 President And Fellows Of Harvard College Orthogonal cas9 proteins for rna-guided gene regulation and editing
HK1222673A1 (zh) 2013-07-12 2017-07-07 The Children's Hospital Of Philadelphia Aav载体和用於抗aav(腺相关病毒)中和抗体的检测
US10501753B2 (en) 2013-07-12 2019-12-10 Oms Investments, Inc. Plants comprising events PP009-401, PP009-415, and PP009-469, compositions, sequences, and methods for detection thereof
US10563225B2 (en) 2013-07-26 2020-02-18 President And Fellows Of Harvard College Genome engineering
WO2015021426A1 (en) 2013-08-09 2015-02-12 Sage Labs, Inc. A crispr/cas system-based novel fusion protein and its application in genome editing
CA3109801C (en) 2013-08-22 2024-01-09 Andrew Cigan Plant genome modification using guide rna/cas endonuclease systems and methods of use
US10822606B2 (en) 2013-09-27 2020-11-03 The Regents Of The University Of California Optimized small guide RNAs and methods of use
WO2015048577A2 (en) 2013-09-27 2015-04-02 Editas Medicine, Inc. Crispr-related methods and compositions
US20150098954A1 (en) 2013-10-08 2015-04-09 Elwha Llc Compositions and Methods Related to CRISPR Targeting
DE102013111099B4 (de) 2013-10-08 2023-11-30 Eberhard Karls Universität Tübingen Medizinische Fakultät Permanente Genkorrektur mittels nukleotidmodifizierter messenger RNA
CN104592364B (zh) * 2013-10-30 2018-05-01 北京大学 定点突变和定点修饰的腺相关病毒、其制备方法及应用
AU2014346559B2 (en) 2013-11-07 2020-07-09 Editas Medicine,Inc. CRISPR-related methods and compositions with governing gRNAs
EP3760719A1 (en) 2013-11-18 2021-01-06 CRISPR Therapeutics AG Crispr-cas system materials and methods
US10787684B2 (en) 2013-11-19 2020-09-29 President And Fellows Of Harvard College Large gene excision and insertion
CN106103699B (zh) 2013-11-28 2019-11-26 地平线探索有限公司 体细胞单倍体人类细胞系
WO2015084897A2 (en) 2013-12-02 2015-06-11 Mirimmune, Llc Immunotherapy of cancer
US20150165054A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Methods for correcting caspase-9 point mutations
EP3470089A1 (en) 2013-12-12 2019-04-17 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components
CN103820454B (zh) 2014-03-04 2016-03-30 上海金卫生物技术有限公司 CRISPR-Cas9特异性敲除人PD1基因的方法以及用于特异性靶向PD1基因的sgRNA
MX373460B (es) 2014-03-11 2020-04-07 Cellectis Metodo para generar celulas t compatibles para el trasplante alogenico.
EP3593812A3 (en) 2014-03-15 2020-05-27 Novartis AG Treatment of cancer using chimeric antigen receptor
JP2017511375A (ja) 2014-03-20 2017-04-20 エイチ リー モフィット キャンサー センター アンド リサーチ インスティテュート インコーポレイテッド 養子細胞療法のための腫瘍浸潤リンパ球
WO2015148454A1 (en) 2014-03-28 2015-10-01 Asklepios Biopharmaceutical, Inc. Optimized and modified factor viii genes for gene therapy
US11439712B2 (en) 2014-04-08 2022-09-13 North Carolina State University Methods and compositions for RNA-directed repression of transcription using CRISPR-associated genes
US10253311B2 (en) 2014-04-10 2019-04-09 The Regents Of The University Of California Methods and compositions for using argonaute to modify a single stranded target nucleic acid
CA2945335A1 (en) 2014-04-18 2015-10-22 Editas Medicine, Inc. Crispr-cas-related methods, compositions and components for cancer immunotherapy
RU2763795C2 (ru) 2014-04-23 2022-01-11 Джуно Терапьютикс, Инк. Способы выделения, культивирования и генетической инженерии популяций клеток иммунной системы для адоптивной терапии
EP3152319A4 (en) 2014-06-05 2017-12-27 Sangamo BioSciences, Inc. Methods and compositions for nuclease design
WO2015191508A1 (en) 2014-06-09 2015-12-17 Voyager Therapeutics, Inc. Chimeric capsids
WO2015191693A2 (en) 2014-06-10 2015-12-17 Massachusetts Institute Of Technology Method for gene editing
WO2015188228A1 (en) 2014-06-10 2015-12-17 Monash University Method of producing leukocytes using ptpn2 inhibition for adoptive cell transfer
TWI530276B (zh) 2014-07-08 2016-04-21 原相科技股份有限公司 具去噪功能之生理偵測模組及其生理偵測方法
AU2015289644A1 (en) 2014-07-15 2017-02-02 Juno Therapeutics, Inc. Engineered cells for adoptive cell therapy
WO2016054326A1 (en) 2014-10-01 2016-04-07 The General Hospital Corporation Methods for increasing efficiency of nuclease-induced homology-directed repair
AU2014407539B2 (en) 2014-10-02 2020-10-22 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods of isolating T cell receptors having antigenic specificity for a cancer-specific mutation
EP3204496A1 (en) 2014-10-10 2017-08-16 Editas Medicine, Inc. Compositions and methods for promoting homology directed repair
WO2016069282A1 (en) 2014-10-31 2016-05-06 The Trustees Of The University Of Pennsylvania Altering gene expression in modified t cells and uses thereof
US10900034B2 (en) 2014-12-03 2021-01-26 Agilent Technologies, Inc. Guide RNA with chemical modifications
SG11201704272YA (en) 2014-12-31 2017-06-29 Synthetic Genomics Inc Compositions and methods for high efficiency in vivo genome editing
WO2016112351A1 (en) 2015-01-09 2016-07-14 Bio-Rad Laboratories, Inc. Detection of genome editing
CN107429263A (zh) 2015-01-15 2017-12-01 斯坦福大学托管董事会 调控基因组编辑的方法
KR102422108B1 (ko) 2015-01-20 2022-07-19 삼성디스플레이 주식회사 유기 발광 표시 장치
EP3259284B1 (en) 2015-02-16 2020-04-01 The Trustees of the University of Pennsylvania A fully-human t cell receptor specific for the 369-377 epitope derived from the her2/neu (erbb2) receptor protein
KR20260048600A (ko) 2015-03-27 2026-04-10 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 변형된 t 세포 및 이의 제조 및 사용 방법
GB201508026D0 (en) * 2015-05-11 2015-06-24 Ucl Business Plc Capsid
US20180119174A1 (en) 2015-05-13 2018-05-03 Seattle Children's Hospita (dba Seattle Children's Research Institute Enhancing endonuclease based gene editing in primary cells
US9790490B2 (en) 2015-06-18 2017-10-17 The Broad Institute Inc. CRISPR enzymes and systems
EP3322297B1 (en) * 2015-07-13 2024-12-04 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
GB2592821B (en) 2015-07-31 2022-01-12 Univ Minnesota Modified cells and methods of therapy
JP7185524B2 (ja) 2015-09-15 2022-12-07 アメリカ合衆国 Hla-cw8拘束性の変異krasを認識するt細胞受容体
WO2017053729A1 (en) 2015-09-25 2017-03-30 The Board Of Trustees Of The Leland Stanford Junior University Nuclease-mediated genome editing of primary cells and enrichment thereof
US11015173B2 (en) 2015-12-11 2021-05-25 The Trustees Of The University Of Pennsylvania Scalable purification method for AAV1
ES2952064T3 (es) 2015-12-16 2023-10-26 Walter & Eliza Hall Inst Medical Res Inhibición de la proteína SH2 inducida por citocinas en células NK
US9570114B1 (en) 2016-01-15 2017-02-14 HGST Netherlands B.V. Laminated film-packed hard disk drive for hermetic sealing
WO2017139264A1 (en) 2016-02-09 2017-08-17 President And Fellows Of Harvard College Dna-guided gene editing and regulation
WO2017180854A1 (en) * 2016-04-15 2017-10-19 The Trustees Of The University Of Pennsylvania Novel aav8 mutant capsids and compositions containing same
JP2019524721A (ja) * 2016-07-15 2019-09-05 ポセイダ セラピューティクス, インコーポレイテッド キメラ抗原受容体および使用方法
CA3041831A1 (en) 2016-10-27 2018-05-03 Intima Bioscience, Inc. Viral methods of making genetically modified cells
WO2018109207A1 (en) 2016-12-16 2018-06-21 Uniqure Ip B.V. Immunoadsorption
US10550405B2 (en) 2017-03-15 2020-02-04 The University Of North Carolina At Chapel Hill Rational polyploid adeno-associated virus vectors and methods of making and using the same
CN110770346B (zh) * 2017-03-15 2024-01-12 北卡罗来纳-查佩尔山大学 多倍体腺相关病毒载体及其制备和使用方法
US20200370039A1 (en) * 2017-04-11 2020-11-26 Ruprecht-Karls-Universitat Heidelberg Adeno-associated virus library
WO2019006418A2 (en) 2017-06-30 2019-01-03 Intima Bioscience, Inc. ADENO-ASSOCIATED VIRAL VECTORS FOR GENE THERAPY
KR20200036912A (ko) 2017-07-31 2020-04-07 리플렉션 바이오테크놀러지스 리미티드 안과 질환을 위한 세포 모델 및 치료요법
US11760987B2 (en) 2017-09-07 2023-09-19 The Regents Of The University Of California Compositions and methods for the treatment or prevention of heart failure
JP2020536502A (ja) 2017-09-07 2020-12-17 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー 遺伝子操作のためのヌクレアーゼシステム
SG11202006056RA (en) * 2018-01-17 2020-07-29 Meiragtx Uk Ii Ltd A modified raav capsid protein for gene therapy

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
US11903966B2 (en) 2015-07-31 2024-02-20 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11925664B2 (en) 2015-07-31 2024-03-12 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11642374B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11642375B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11583556B2 (en) 2015-07-31 2023-02-21 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11266692B2 (en) 2015-07-31 2022-03-08 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11147837B2 (en) 2015-07-31 2021-10-19 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11208438B2 (en) 2015-09-28 2021-12-28 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
US11840555B2 (en) 2015-09-28 2023-12-12 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
US10745447B2 (en) 2015-09-28 2020-08-18 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
US11154574B2 (en) 2016-10-18 2021-10-26 Regents Of The University Of Minnesota Tumor infiltrating lymphocytes and methods of therapy
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
US12091435B2 (en) 2018-04-03 2024-09-17 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US12116384B2 (en) 2018-04-03 2024-10-15 Ginkgo Bioworks, Inc. Virus vectors for targeting ophthalmic tissues
US12060390B2 (en) 2018-04-03 2024-08-13 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US11976096B2 (en) 2018-04-03 2024-05-07 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US20210292373A1 (en) * 2018-07-10 2021-09-23 University Of Florida Research Foundation, Incorporated Aav vp1u chimeras
WO2020014395A1 (en) * 2018-07-10 2020-01-16 University Of Florida Research Foundation, Incorporated Aav vp1u chimeras
US12467046B2 (en) 2018-10-02 2025-11-11 Voyager Therapeutics, Inc. Redirection of tropism of AAV capsids
US12398187B2 (en) 2019-03-05 2025-08-26 Nkarta, Inc. CD19-directed chimeric antigen receptors and uses thereof in immunotherapy
US11981914B2 (en) 2019-03-21 2024-05-14 Ginkgo Bioworks, Inc. Recombinant adeno-associated virus vectors
US12577539B2 (en) 2019-04-26 2026-03-17 The Regents Of The University Of California Cells for enhanced production of adeno-associated virus
WO2020219543A1 (en) * 2019-04-26 2020-10-29 The Regents Of The University Of California Cells for enhanced production of adeno-associated virus
US11905523B2 (en) 2019-10-17 2024-02-20 Ginkgo Bioworks, Inc. Adeno-associated viral vectors for treatment of Niemann-Pick Disease type-C
WO2021195491A3 (en) * 2020-03-26 2021-11-11 Asklepios Biopharmaceutical, Inc. Inducible promoter for viral vector production
WO2021195494A3 (en) * 2020-03-26 2021-11-04 Asklepios Biopharmaceutical, Inc. Inducible promoter for viral vector production
JP2023519242A (ja) * 2020-03-26 2023-05-10 アスクレピオス バイオファーマシューティカル, インコーポレイテッド ウイルスベクター産生のための誘導性プロモーター
CN115885046A (zh) * 2020-03-26 2023-03-31 阿斯克肋匹奥生物制药公司 用于病毒载体生产的诱导型启动子
CN115885046B (zh) * 2020-03-26 2026-03-17 阿斯克生物公司 用于病毒载体生产的诱导型启动子
US11859200B2 (en) 2020-05-13 2024-01-02 Voyager Therapeutics, Inc. AAV capsids with increased tropism to brain tissue
US12577588B2 (en) 2020-05-13 2026-03-17 Voyager Therapeutics, Inc. AAV capsids with increased tropism to brain tissue
US12012458B2 (en) 2020-06-12 2024-06-18 Nkarta, Inc. Genetically modified natural killer cells for CD70-directed cancer immunotherapy
WO2021252804A1 (en) * 2020-06-12 2021-12-16 Nkarta, Inc. Genetically modified natural killer cells for cd70-directed cancer immunotherapy
US12104163B2 (en) 2020-08-19 2024-10-01 Sarepta Therapeutics, Inc. Adeno-associated virus vectors for treatment of Rett syndrome
US12611436B2 (en) 2020-10-16 2026-04-28 Sarepta Therapeutics, Inc. AAV transfer cassette
WO2022100748A1 (en) * 2020-11-16 2022-05-19 Staidson (Beijing) Biopharmaceuticals Co., Ltd. Recombinant adeno-associated viruses with enhanced liver tropism and uses thereof
US12419969B2 (en) 2021-11-02 2025-09-23 Voyager Therapeutics, Inc. AAV capsid variants and uses thereof
US12296025B2 (en) 2021-11-02 2025-05-13 Voyager Therapeutics, Inc. AAV capsid variants and uses thereof
CN114276419A (zh) * 2021-12-30 2022-04-05 上海勉亦生物科技有限公司 肌肉高亲和性的新型腺相关病毒衣壳蛋白及其应用
CN114276419B (zh) * 2021-12-30 2023-11-17 上海勉亦生物科技有限公司 肌肉高亲和性的新型腺相关病毒衣壳蛋白及其应用
WO2023205610A3 (en) * 2022-04-18 2023-11-30 Regenxbio Inc. Hybrid aav capsids
WO2023215947A1 (en) * 2022-05-13 2023-11-16 Children's Medical Research Institute Adeno-associated virus capsids
WO2024206831A1 (en) * 2023-03-31 2024-10-03 Duke University Compositions comprising brain-tropic aavs and methods of use thereof

Also Published As

Publication number Publication date
US20200354743A1 (en) 2020-11-12
EP3645021A4 (en) 2021-04-21
US20230018860A1 (en) 2023-01-19
WO2019006418A3 (en) 2019-02-21
US11098325B2 (en) 2021-08-24
CN111511375A (zh) 2020-08-07
EP3645021A2 (en) 2020-05-06
US20230015722A1 (en) 2023-01-19
JP2020530307A (ja) 2020-10-22

Similar Documents

Publication Publication Date Title
US11098325B2 (en) Adeno-associated viral vectors for gene therapy
AU2017347854B2 (en) Viral methods of T cell therapy
US11266692B2 (en) Intracellular genomic transplant and methods of therapy
HK40035088A (en) Adeno-associated viral vectors for gene therapy
HK40018037A (en) Viral methods of t cell therapy
HK1256380B (en) Modified cells and methods of therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18825318

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020521488

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2018825318

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2018825318

Country of ref document: EP

Effective date: 20200130

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18825318

Country of ref document: EP

Kind code of ref document: A2

WWW Wipo information: withdrawn in national office

Ref document number: 2018825318

Country of ref document: EP