WO2017173349A1 - Bcma binding molecules and methods of use thereof - Google Patents

Bcma binding molecules and methods of use thereof Download PDF

Info

Publication number
WO2017173349A1
WO2017173349A1 PCT/US2017/025516 US2017025516W WO2017173349A1 WO 2017173349 A1 WO2017173349 A1 WO 2017173349A1 US 2017025516 W US2017025516 W US 2017025516W WO 2017173349 A1 WO2017173349 A1 WO 2017173349A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
region
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/025516
Other languages
English (en)
French (fr)
Inventor
Jed WILTZIUS
Ruben Alvarez Rodriguez
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kite Pharma Inc
Original Assignee
Kite Pharma Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN202310108490.6A priority Critical patent/CN116425876A/zh
Priority to CN202310115780.3A priority patent/CN117903307A/zh
Priority to EA201891966A priority patent/EA201891966A1/ru
Priority to KR1020187031269A priority patent/KR102397674B1/ko
Priority to CN201780030900.2A priority patent/CN109414455B/zh
Priority to EP17776833.0A priority patent/EP3436036A4/en
Priority to KR1020237012515A priority patent/KR102591930B1/ko
Priority to SG11201808403SA priority patent/SG11201808403SA/en
Priority to AU2017240150A priority patent/AU2017240150C1/en
Priority to JP2018550679A priority patent/JP7366543B2/ja
Priority to CU2018000120A priority patent/CU20180120A7/es
Priority to NZ746700A priority patent/NZ746700A/en
Priority to CR20180462A priority patent/CR20180462A/es
Application filed by Kite Pharma Inc filed Critical Kite Pharma Inc
Priority to KR1020227015639A priority patent/KR102522622B1/ko
Priority to BR112018070159-9A priority patent/BR112018070159A2/pt
Priority to CA3019135A priority patent/CA3019135A1/en
Publication of WO2017173349A1 publication Critical patent/WO2017173349A1/en
Priority to IL261942A priority patent/IL261942A/en
Priority to PH12018550164A priority patent/PH12018550164A1/en
Priority to CONC2018/0010475A priority patent/CO2018010475A2/es
Anticipated expiration legal-status Critical
Priority to ZA2018/06962A priority patent/ZA201806962B/en
Priority to JP2022019896A priority patent/JP2022065073A/ja
Priority to AU2022201243A priority patent/AU2022201243A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7076Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70521CD28, CD152
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596Molecules with a "CD"-designation not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/53Hinge
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells

Definitions

  • This invention relates to chimeric antigen receptors (CARs) and engineered T cell receptors (TCRs) comprising an antigen binding molecule which binds to B-cell maturation antigen (BCMA), polynucleotides encoding the same, and methods of treating a cancer or other disease or disorder in a patient using the same.
  • CARs chimeric antigen receptors
  • TCRs engineered T cell receptors
  • BCMA B-cell maturation antigen
  • Human cancers are by their nature comprised of normal cells that have undergone a genetic or epigenetic conversion to become abnormal cancer cells. In doing so, cancer cells begin to express proteins and other antigens that are distinct from those expressed by normal cells. These aberrant tumor antigens can be used by the body's innate immune system to specifically target and kill cancer cells. However, cancer cells employ various mechanisms to prevent immune cells, such as T and B lymphocytes, from successfully targeting cancer cells.
  • Human T ceil therapies rely on enriched or modified human T cells to target and kill cancer cells in a patient.
  • methods have been developed to engineer T cells to express constructs which direct T cells to a particular target cancer cell.
  • CARs Chimeric antigen receptors
  • TCRs engineered T cell receptors
  • the present invention is directed to an isolated polynucleotide encoding a chimeric antigen receptor (CAR) or T cell receptor (TCR) comprising a binding molecule that specifically binds to B-cell maturation antigen (BCMA), wherein the binding molecule comprises: (a) a heavy chain variable region (VH) complementarity determining region (CDR) 1 comprising, consisting of, or consisting essentially of the amino acid sequence GX2X3X4X5X6X7 SY (SEQ ID NO: 145) wherein: X 2 is not present or G; X 3 is not present or S; X4 is F, G, I, or Y; X 5 is S or T; 3 ⁇ 4 is F or S, and X?
  • VH heavy chain variable region
  • CDR complementarity determining region
  • VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence Xi3 ⁇ 4X 3 ⁇ 4X7X8X9XioYXi2Xi3Xi4Xi 5Xi6Xi7 (SEQ ID NO: 146), wherein: Xi is A, G, I, S, T, or V; X3 is I, N, or S; X 4 is G, P, S, or Y; X 5 is D, G, I, or S; 3 ⁇ 4 is F, G, or S; X 7 is not present or G or S; 3 ⁇ 4 is N, S, or T; X9 is A, I, K, or T; X 10 is N, S, or Y; X12 is A or N; Xo is D, P, or Q; X 14 is or S; X 15 is F, L, or V; Xie is K or Q; and X17 is G or S; and/or (b) a VH CDR2 compris
  • X 17 is A or D;
  • a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1X28X4X5X0X7 (SEQ ID NO: 149), wherein Xi is D, G, L, S, or W; X 2 is A or G; X4 is N, S, or T; X5 is L or R; X(, is A, E, or Q; and X?
  • VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1QX3X4X5X6PX8T (SEQ ID NO: 150), wherein Xi is M or Q; X 3 is F, G, H, I, R, or Y; X 4 is A, F, H, I, L, or Y; X5 is A, G, H, S, T, V, or Y, 3 ⁇ 4 i s F, L, T, W, or Y; and Xs is not present or F, L, P, or W.
  • the invention is directed to an isolated polynucleotide encoding an antibody or an antigen binding molecule thereof that specifically binds to BCMA, wherein the antibody or the antigen binding molecule thereof comprises: (a) a heavy chain variable region (VH) complementarity determining region (CDR) 1 comprising, consisting of, or consisting essentially of the amino acid sequence GX2X3X4X5X0X7SY (SEQ ID NO: 145), wherein: X2 is not present or G; X3 is not present or S; X4 is F, G, I, or Y; X5 is S or T; Xe is F or S; and X? is S or T; and/or (b) a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence
  • X1IX3X4X5X6X7X8X9X10YX12X13X14X15X16X17 (SEQ ID NO: 146), wherein: Xi is A, G, I, S, T, or V; X 3 is I, N, or S, X 4 is G, P, S, or Y; X 5 i s D, G, I, or S, X6 is F, G, or S, X 7 is not present or G or S; Xg is N, S, or T; X 9 is A, I, K, or T; Xio is N, S, or Y; X u is A or N; X i3 is D, P, or Q; X !4 is K or S; X 15 is F, L, or V; ⁇ is K or Q; and Xr?
  • VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17DX19 (SEQ ID NO: 147), wherein: X 3 is A or V; X2 is K or R; X3 is not present or D, G, or T; X4 is not present or A, D, G, P, R, or S; X5 is not present or E, F, G, L, Q, or T, X is not present or E, M, Q, W, or Y, X?
  • Xs is not present or G, P, S, or T; X9 is not present or G, P, or S; Xio is not present or I, L, P, or Y; Xu is not present or W; X12 is not present or H; X 13 is not present or E or Y; XM is not present or D, G, H, P, S, W, or Y; X15 is A, G, L, W, or Y; X 16 is not present or A, G, I, P, or V; X 17 is F, L, or M; and X19 is I, L, V, or Y; and/or (d) a light chain variable region (VL) CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2SQX5X6X7X8X9X10X11X12X13X14X15LX17 (SEQ ID NO: 148), wherein X
  • Xn is A or D;
  • a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1X28X4X5X5X7 (SEQ ID NO: 149), wherein Xi is D, G, L, S, or W;
  • X 2 is A or G: 3 ⁇ 4 is N, S, or T;
  • X 5 is L or R; 3 ⁇ 4 is A, E, or Q; and
  • X 7 is S or T; and/or
  • a VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence XiQXiXiXf
  • the VH CDRl comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9-16.
  • the VH CDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 25-32.
  • the VL CDRl comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 81-88.
  • the VL CDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 97-104.
  • the VL CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1 13-120.
  • the binding molecul e comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 9; a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 25; a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 41 ; a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 81 ; a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 97; and a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 1 13; (b) a VH CDRl region compri sing the amino acid sequence of SEQ ID NO: 10; a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 26; a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 42; a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 82, a
  • the binding molecule is single chained. In some embodiments, the binding molecule comprises an scFv.
  • the CAR comprises a transmembrane domain.
  • the transmembrane domain is a transmembrane domain of CD28, 4- 1BB/CD137, CDS (e.g., CDS alpha, CD4, C D S 9 CD3 epsilon, CD45, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CDI37, CD154, an alpha chain of a T cell receptor, a beta chain of a T cell receptor, a zeta chain of a T cell receptor, or any combination thereof.
  • the CAR comprises a hinge region between the transmembrane domain and the binding molecule.
  • the hinge region is of IgGl, IgG2, IgG3, IgG4, IgA, IgD, IgE, IgM, CD28, or CD 8 alpha.
  • the CAR or TCR comprises a costimulatory region.
  • the costimulatory region is a signaling region of CD28, OX-40, 4-1BB/CD137, CD2, CD7, CD27, CD3G, CD40, programmed death- 1 (PD-1), inducible T cell costimulator (ICOS), lymphocyte function-associated antigen- 1 (LFA-1 (GDI la/CD18), CD3 gamma, CD3 delta, CD 3 epsilon, CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamily member 14; TNFSF 14), NKG2C, Ig alpha (CD79a), DAP- 10, Fc gamma receptor, MHC class I molecule, TNF receptor proteins, Immunoglobuiin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), activating NK cell receptors, BTLA, a Toll iigand receptor, ICAM-1, B7-H3, CDS, ICAM
  • the invention is directed to a vector comprising the polynucleotide or a polypeptide encoded by the polynucleotide.
  • the invention is directed to a cell comprising the polynucleotide, the vector, the polypeptide, or any combination thereof.
  • the invention is directed to a cell, e.g., an immune ceil, e.g., a tumor-infiltrating lymphocyte (TIL), autologous T cell, engineered autologous T cell (eACT), an allogeneic T cell, or any combination thereof.
  • an immune ceil e.g., a tumor-infiltrating lymphocyte (TIL), autologous T cell, engineered autologous T cell (eACT), an allogeneic T cell, or any combination thereof.
  • TIL tumor-infiltrating lymphocyte
  • eACT engineered autologous T cell
  • an allogeneic T cell or any combination thereof.
  • the invention is directed to a method of inducing an immunity against a tumor comprising administering to a subject an effective amount of a ceil comprising the polynucleotide, the vector, the polypeptide, or any combination thereof.
  • Other aspects of the invention include a method of treating a cancer in a subject in need thereof comprising administering to the subject the polynucleotide, the vector, the polypeptide, the cell, or the composition.
  • the cancer treatable by the method can be a hematologic cancer.
  • FIG.1 A- IF show CLUTSTAL W (1 ,83) multiple sequence alignments of eight example anti-BCMA binding molecules disclosed herein.
  • FIG. I A shows a sequence alignment of example anti-BCMA binding molecules comprising a VH domain. Complementarity determining regions (CDRs) and framework regions (FRs) are shown, as determined by Chothia.
  • FIG. IB is a table providing the SEQ ID NO for each VH, CDR, and FR sequence illustrated in FIG. 1A.
  • FIG. 1C shows a sequence alignment of example anti- BCMA binding molecules comprising a VH domain, with alternate CDRs and FRs shown.
  • FIG. ID is a table providing the SEQ ID NO for each VH, CDR, and FR sequence illustrated in FIG.
  • FIG. IE shows a sequence alignment of example anti-BCMA binding molecules comprising a VL domain. CDRs and FRs are shown, as determined by Chothia.
  • FIG. IF is a table providing the SEQ ID NO for each VH, CDR, and FR sequence illustrated in FIG. IE.
  • FIGs. 2A-2F show BCMA. expression in various cells.
  • FIG. 2 A shows multiple myeloma cell expression of BCMA, CD138, CS-1 , CD38, and CD19. Box-plot analysis shows the distribution of gene expression levels in the various multiple myeloma cell lines tested (FIG. 2A).
  • FIGs. 2B-2D show BCMA expression in EoLl (FIG. 2B), MM ! S (FIG. 2C), and NCI-H929 (FIG. 2D) cancer cell lines as measured by flow cytometric analysis of BCMA cell surface expression on the respective cell lines.
  • FIG. 2 A shows multiple myeloma cell expression of BCMA, CD138, CS-1 , CD38, and CD19. Box-plot analysis shows the distribution of gene expression levels in the various multiple myeloma cell lines tested (FIG. 2A).
  • FIGs. 2B-2D show BCMA expression in EoLl (FIG. 2B), MM ! S
  • FIG. 2E shows the expression of BCMA, CS-1, CLL-1, DLL3, CD70, and FLT3 in alternatively activated macrophages: CD14-positive, CD16-negative cells, CD38-negative naive B cells; CD4-positive, alpha-beta T cells; central memory CD4-positive cells; central memory CD8-positve cells; class switched memory B cells; cytotoxic CD56-dim natural killer cell; effector memory Compositive cells; effector memory CD8-positive ceils; inflammatory macrophages; macrophages; mature neutrophils; memory B cells; monocytes; myeloid cells; and regulatory T cells, FIG. 2F shows the express!
  • FIG. 3 A and FIG. 3B show CAR expression in lentivirus transduced primary human T cells from a first healthy donor (FIG. 3 A.) and a second healthy donor (FIG. 3B).
  • FIGs 4A-4F shows IFNy, TNFa, and IL-2 production by lentivirus transduced
  • FIGs. 4A and 4B show the IFNy (pg/ml; y-axis) production in lentivirus transduced CAR T cells from a first donor (FIG, 4A) and a second donor (FIG. 4B).
  • FIGs. 4C and 4D show the TNFa (pg/ml; y-axis) production in lentivirus transduced CAR T cells from a first donor (FIG. 4C) and a second donor (FIG. 4D).
  • FIGs. 4E and 4F show the IL-2 production (pg/ml; y-axis) in lentivirus transduced CAR T cells from a first donor (FIG. 4E) and a second donor (FIG. 4F).
  • FIGs, 5A-5F show the average cytolytic activity (as a percentage of viable target cells remaining; y-axis) over time from two healthy donors expressing the indicated CARs co-cultured with EoLl (FIGs. 5 A and 5B), NCI-H929 (FIGs. 5C and 5D), or MMI S (FIGs. 5E and 5F) target cells for 16 hours, 40 hours, 64 hours, 88 hours, or 112 hours.
  • FIGs. 5A and 5B show the average cytolytic activity of transduced CAR T cells from a first donor (FIG. 5 A) and a second donor (FIG.
  • FIGs. 5B and 5B show the average cytolytic activity of transduced CAR T ceils from a first donor (FIG. 5C) and a second donor (FIG. 5D) co- cultured with NCI-H929 target ceils for 16 hours, 40 hours, 64 hours, 88 hours, or 112 hours.
  • FIGs. 5E and 5F show the average cytolytic activity of transduced CAR T cells from a first donor (FIG. 5E) and a second donor (FIG. 5F) co-cultured with MMI S target cells for 16 hours, 40 hours, 64 hours, 88 hours, or 112 hours.
  • FIGs. 6A and 6B show proliferation of CFSE-labeled lentivirus transduced
  • FIG. 7 A shows Clone FS-26528 HC DNA sequence (SEQ ID NO: 271)
  • FIG. 7B shows Clone FS-26528 HC AA sequence (SEQ ID NO: 272)
  • FIG. 7C shows HC CDR sequences for clone FS-26528.
  • FIG. 7D shows Clone FS-26528 LC DNA sequence (SEQ ID NO: 276).
  • FIG. 7E shows Clone FS-26528 LC AA sequence (SEQ ID NO: 277).
  • FIG. 7F shows LC CDR sequences for clone FS-26528
  • FIG. 7G shows Clone FS-26528 CAR DNA HxL sequences (SEQ ID NO:
  • FIG. 7H shows Clone FS-26528 CAR HxL AA sequences (SEQ ID NO: 282)
  • FIG. 71 shows Clone FS-26528 CAR DNA LxH sequences (SEQ ID NO: 283).
  • FIG. 7J shows Clone FS-26528 CAR LxH sequences (SEQ ID NO: 284).
  • FIG. 8A shows Clone PC-26534 HC DNA sequence (SEQ ID NO: 285).
  • FIG 8B shows Clone PC-26534 HC sequence (SEQ ID NO: 286).
  • FIG. 8C shows HC CDR sequences for clone FS-26528.
  • FIG. 8D shows Clone PC-26534 LC DNA sequences (SEQ ID NO: 290).
  • FIG. 8E shows the Clone PC-26534 LC sequence (SEQ ID NO: 291).
  • FIG. 8F shows LC CDR sequences for Clone PC-26534.
  • FIG. 8G shows the Clone PC-26534 CAR DNA HxL sequence (SEQ ID NO: 295).
  • FIG. 8H shows the Clone PC-26534 CAR HxL AA sequence (SEQ ID NO: 296)
  • FIG. 81 shows the Clone PC-26534 CAR DNA LxH sequence (SEQ ID NO: 297).
  • FIG. 8J shows Clone PC-26534 CAR LxH sequence (SEQ ID NO: 298).
  • FIG. 9A shows Clone AJ-26545 HC DNA sequence (SEQ ID NO: 299).
  • FIG. 9B shows Clone AJ-26545 variable HC sequence (SEQ ID NO: 300).
  • FIG. 9C shows HC CDR sequences for Clone AJ-26545.
  • FIG. 9D shows Clone AJ-26545 variable LC DNA sequence (SEQ ID NO: 304),
  • FIG. 9E shows Clone AJ-26545 variable LC AA sequence (SEQ ID NO: 305)
  • FIG. 9F shows Clone AJ-26545 LC CDR sequences.
  • FIG. 9G shows Clone AJ-26545 CAR DNA HxL sequence (SEQ ID NO: 309).
  • FIG. 9H shows Clone AJ-26545 CAR HxL AA sequence (SEQ ID NO: 310)
  • FIG. 91 shows Clone AJ-26545 CAR DNA LxH sequence (SEQ ID NO: 311)
  • FIG. 9J shows Clone AJ-26545 CAR LxH sequence (SEQ ID NO: 312).
  • FIG. 10A shows Clone AJ-26554 HC DNA sequence (SEQ ID NO: 313)
  • FIG. 10B shows Clone AJ-26554 HC AA sequence (SEQ ID NO: 314).
  • FIG. IOC shows Clone AJ-26554 HC CDR sequences
  • FIG. 10D shows Clone AJ-26554 LC DNA sequence (SEQ ID NO: 318)
  • FIG 10E shows Clone AJ-26554 LC AA sequence (SEQ ID NO: 3 19).
  • FIG. 10F shows Clone AJ-26554 LC CDR sequences.
  • FIG. 0G shows Clone AJ-26554 CAR DNA HxL chain sequences (SEC NO: 323).
  • FIG. 10H shows Clone AJ-26554 CAR HxL chain AA sequences (SEQ ID NO: 324).
  • FIG. 101 shows Clone AJ-26554 CAR DNA LxH chain sequences (SEQ ID NO: 325).
  • FIG. 10J shows Clone AJ-26554 CAR LxH AA sequences (SEQ ID NO: 326).
  • FIG. 11 A shows Clone NM-26562 HC DNA sequence (SEQ ID NO: 327).
  • FIG. 1 IB shows Clone NM-26562 HC AA sequence (SEQ ID NO: 328).
  • FIG. HC shows Clone NM-26562 HC CDR sequences.
  • FIG. 1 ID shows Clone NM-26562 LC DNA sequence (SEQ ID NO: 332).
  • FIG. 1 IE shows Clone NM-26562 LC AA sequence (SEQ ID NO: 333).
  • FIG. 1 IF shows the Clone NM-26562 LC CDR sequences.
  • FIG. 11G shows the Clone NM-26562 CAR DNA HxL sequences (SEQ ID NO: 337)
  • Figure 11H shows Clone NM-26562 CAR HxL AA sequences (SEQ ID NO:
  • FIG. H I shows Clone NM-26562 CAR DNA LxH sequences ⁇ SEQ ID NO:
  • FIG. I IJ shows Clone NM-26562 CAR LxH AA sequences (SEQ ID NO:
  • FIG. 12A shows Clone TS-26564 HC DNA sequence (SEQ ID NO: 341).
  • FIG. 12B shows Clone TS-26564 HC AA sequence (SEQ ID NO: 342).
  • FIG. 12C shows the Clone TS-26564 HC CDR sequences.
  • FIG. 12D shows the Clone TS-26564 LC DNA sequence (SEQ ID NO: 346).
  • FIG 12E shows the Clone TS-26564 LC AA sequence (SEQ ID NO: 347),
  • FIG. 12F shows the Clone TS-26564 LC CDR sequences
  • FIG. 12G shows the Clone TS-26564 CAR DNA HxL sequences (SEQ ID NO: 351).
  • FIG. 12H shows the Clone TS-26564 CAR HxL chain AA sequences (SEQ ID NO: 352)
  • FIG, 121 shows the Clone TS-26564 CAR DNA LxH sequences (SEQ ID NO: 353)
  • FIG. 12J shows the Clone TS-26564 CAR LxH AA sequences (SEQ ID NO: 354)
  • FIG. 13A shows the Clone RY-26568 HC DNA sequence (SEQ ID NO: 355)
  • FIG. 13B shows the Clone RY-26568 HC AA sequence (SEQ ID NO: 356)
  • FIG. 13C shows the Clone RY-26568 HC CDR sequences.
  • FIG 13D shows the Clone RY-26568 LC DNA sequence (SEQ ID NO: 360).
  • FIG 13E shows the Clone RY-26568 LC AA sequence (SEQ ID NO: 361).
  • FIG 13F shows the Clone RY-26568 LC CDR AA sequences
  • FIG 13G shows the Clone RY-26568 CAR DNA HxL sequences (SEQ ID NO: 365)
  • FIG. 13H shows the Clone RY-26568 CAR HxL AA sequences (SEQ ID NO:
  • FIG 131 shows the Clone RY-26568 CAR DNA LxH sequences (SEQ ID NO:
  • FIG 13J shows the Clone RY-26568 CAR LxH AA sequences (SEQ ID NO:
  • FIG. 14A shows the Clone PP-26575 HC DNA sequence (SEQ ID NO: 369).
  • FIG. 14B shows the Clone PP-26575 HC AA sequence (SEQ ID NO: 370).
  • FIG. 14C shows the Clone PP-26575 HC CDR AA sequences.
  • FIG. 14D shows the Clone PP-26575 LC DNA sequence (SEQ ID NO: 374).
  • FIG ME shows the Clone PP-26575 LC AA sequence (SEQ ID NO: 375).
  • FIG. 14F shows the Clone PP-26575 LC CDR AA sequences.
  • FIG. 14G shows the Clone PP-26575 CAR DNA HxL sequences (SEQ ID NO: 379).
  • FIG. 14H shows Clone PP-26575 CAR HxL A A sequences (SEQ ID NO:
  • FIG. 141 shows Clone PP-26575 CAR DNA LxH sequence (SEQ ID NO:
  • FIG. 14 J shows the Clone PP-26575 CAR LxH AA sequence (SEQ ID NO:
  • FIG. 15 A shows the Clone RD-26576 HC DNA sequence (SEQ ID NO: 383)
  • FIG. 15B shows Clone RD-26576 HC AA sequence (SEQ ID NO: 384)
  • FIG. 15C shows the Clone RD-26576 HC CDR sequences.
  • FIG. 15D shows the Clone RD-26576 LC DNA sequence (SEQ ID NO: 388)
  • FIG 15E shows the Clone RD-26576 LC AA sequence (SEQ ID NO: 389).
  • FIG 15 F shows the Clone RD-26576 LC CDR sequences.
  • FIG. 15G shoes the Clone RD-26576 CAR DNA HxL sequences (SEQ ID NO: 393).
  • FIG. 15H shows the Clone RD-26576 CAR HxL chain AA sequences (SEQ ID NO: 394)
  • FIG. 151 shows the Clone RD-26576 CAR DNA LxH sequences (SEQ ID NO:
  • FIG. 15J shows the Clone RD-26576 CAR LxH AA sequences (SEQ ID NO:
  • FIG. 16A shows the Clone RD-26578 HC DNA sequences (SEQ ID NO: 397).
  • FIG. 16B shows the Clone RD-26578 HC AA sequence (SEQ ID NO: 398).
  • FIG. 16C shows the Clone RD-26578 HC CDR AA sequences.
  • FIG. 16D shows the Clone RD-26578 LC DNA sequence (SEQ ID NO: 402).
  • FIG, 16E shows the Clone RD-26578 LC AA sequence (SEQ ID NO: 403)
  • FIG. 16F shows the Clone RD-26578 LC CDR sequences.
  • FIG. 16G shows the Clone RD-26578 CAR DNA HxL chain sequence (SEQ ID NO:
  • FIG. 16H shows the Clone RD-26578 CAR HxL A A sequence (SEQ ID NO:
  • FIG. 161 shows the Clone RD-26578 CAR DNA LxH sequences (SEQ ID NO:
  • FIG. 16J shows the Clone RD-26578 CAR LxH AA sequence (SEQ ID NO:
  • FIG. 17 shows the outcome of an in vivo study examining the efficacy of cl one
  • RD-21530 in a subcutaneous RPMI-8226 mouse model. Cohorts of 10 mice each were tested for the CAR (dashed lines) and mock transduced (bolded lines) T cells,
  • FIG. 18A and FIG. 18B show the outcome of an in vitro cytotoxicity assay using the optimized BCMA scFv variants cocultured with NCI-H929 and MM. I S ceils, respectively. CAR T cells using these optimized scFvs were incubated overnight with lucif erase labeled target cells in 3 : 1 and 1 : 1 effector to target cell ratios.
  • the present invention relates to antibodies, antigen binding molecules thereof, chimeric antigen receptors (CARs), and engineered T cell receptors, which bind BCMA, polynucleotides encoding the same, and in vitro cells comprising the same.
  • CARs chimeric antigen receptors
  • engineered T cell receptors which bind BCMA
  • polynucleotides encoding the same, and in vitro cells comprising the same.
  • the polynucleotides, polypeptides, and in vitro cells described herein can be used in an engineered CAR T cell therapy, e.g., an autologous cell therapy (eACTTM), for the treatment of a patient suffering from a cancer.
  • eACTTM autologous cell therapy
  • the polynucleotides, polypeptides, and in vitro cells described herein can be used for the treatment of multiple myeloma. Definitions
  • administering refers to the physical introduction of an agent to a subject, using any of the various methods and delivery systems known to those skilled in the art.
  • exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, for example by injection or infusion.
  • parenteral administration means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation.
  • the formulation is administered via a non-parenteral route, e.g., orally.
  • non-parenteral routes include a topical, epidermal or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingualiy or topically.
  • Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.
  • antibody includes, without limitation, a glycoprotein immunoglobulin which binds specifically to an antigen.
  • antibody can comprise at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or an antigen binding molecule thereof.
  • Each H chain comprises a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
  • the heavy chain constant region comprises three constant domains, CHI, CH2 and CH3.
  • Each light chain comprises a light chain variable region (abbreviated herein as VL) and a light chain constant region.
  • the light chain constant region is comprises one constant domain, CL.
  • VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDRs complementarity determining regions
  • FR framework regions
  • Each VH and VL comprises three CDRs and four FRs, arranged from amino-tenninus to carboxy-terminus in the following order: FR1, CDRl, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the Abs may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system ⁇ e.g., effector cells) and the first component (Clq) of the classical complement system.
  • Antibodies can include, for example, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multi specific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, an antibody light chain monomer, an antibody heavy chain monomer, an antibody light chain dimer, an antibody heavy chain dimer, an antibody light chain- antibody heavy chain pair, intrabodies, antibody fusions (sometimes referred to herein as "antibody conjugates”), heteroconjugate antibodies, single domain antibodies, monovalent antibodies, single chain antibodies or single-chain Fvs (scFv), camelized antibodies, affybodies, Fab fragments, F(ab') 2 fragments, disulfide-linked Fvs (sdFv), anti -idiotypic (anti-Id) antibodies (including, e.g.
  • antibodies described herein refer to polyclonal antibody populations.
  • An immunoglobulin may derive from any of the commonly known isotypes, including but not limited to IgA, secretory IgA, IgG and IgM.
  • IgG subclasses are also well known to those in the art and include but are not limited to human IgGl, IgG2, IgG3 and IgG4.
  • “Isotype” refers to the Ab class or subclass (e.g., IgM or IgGl) that is encoded by the heavy chain constant region genes.
  • antibody includes, by way of example, both naturally occurring and non-naturally occurring Abs; monoclonal and polyclonal Abs; chimeric and humanized Abs; human or nonhuman Abs; wholly synthetic Abs; and single chain Abs.
  • a nonhuman Ab may be humanized by recombinant methods to reduce its immunogenicity in man.
  • the term "antibody” also includes an antigen-binding fragment or an antigen binding molecule of any of the aforementioned immunoglobulins, and includes a monovalent and a divalent fragment or portion, and a single chain Ab.
  • an "antigen binding molecule,” “antigen binding portion,” or “antibody fragment” refers to any molecule that comprises the antigen binding parts (e.g., CDRs) of the antibody from which the molecule is derived.
  • An antigen binding molecule can include the antigenic complementarity determining regions (CDRs).
  • antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, dAb, linear antibodies, scFv antibodies, and multi specific antibodies formed from antigen binding molecules.
  • Peptibodies i .e., Fc fusion molecules comprising peptide binding domains
  • suitable antigen binding molecules are another example of suitable antigen binding molecules.
  • the antigen binding molecule binds to an antigen on a tumor cel l . In some embodiments, the antigen binding molecule binds to an antigen on a cell involved in a hyperproliferative disease or to a viral or bacterial antigen. In certain embodiments, the antigen binding molecule binds to BCMA. In further embodiments, the antigen binding molecule is an antibody of fragment thereof, including one or more of the complementarity determining regions (CDRs) thereof. In further embodiments, the antigen binding molecule is a single chain variable fragment (scFv). In some embodiments, the antigen binding molecule comprises or consists of avimers.
  • variable region typically refers to a portion of an antibody, generally, a portion of a light or heavy chain, typically about the amino- terminal 1 10 to 120 amino acids in the mature heavy chain and about 90 to 1 15 amino acids in the mature light chain, which differ extensively in sequence among antibodies and are used in the binding and specificity of a particular antibody for its particular antigen.
  • CDRs complementarity determining regions
  • FR framework regions
  • variable region is a human variable region.
  • variable region comprises rodent or murine CDRs and human framework regions (FRs).
  • FRs human framework regions
  • the variable region i s a primate (e.g., non-human primate) variable region.
  • the variable region comprises rodent or murine CDRs and primate (e.g., non- human primate) framework regions (FRs).
  • VH and "VH domain” are used interchangeably to refer to the heavy chain variable region of an antibody or an antigen-binding fragment thereof.
  • the AbM definition is a compromise between the two used by Oxford Molecular's AbM: antibody model ling software.
  • the contact definition is based on an analysis of the available complex crystal structures.
  • Kabat numbering and like terms are recognized in the art and refer to a system of numbering amino acid residues in the heavy and light chain variable regions of an antibody, or an antigen binding molecule thereof.
  • the CDRs of an antibody can be determined according to the Kabat numbering system (see, e.g., Kabat EA & Wu TT (1971) Ann NY Acad Sci 190: 382-391 and Kabat EA et al, (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242).
  • CDRs within an antibody heavy chain molecule are typically present at amino acid positions 31 to 35, which optionally can include one or two additional amino acids, following 35 (referred to in the Kabat numbering scheme as 35A and 35B) (CDR1), amino acid positions 50 to 65 (CDR2), and amino acid positions 95 to 102 (CDR3).
  • CDRs within an antibody light chain molecule are typically present at amino acid positions 24 to 34 (CDR1), amino acid positions 50 to 56 (CDR2), and amino acid positions 89 to 97 (CDR3).
  • the CDRs of the antibodies described herein have been determined according to the Kabat numbering scheme.
  • the CDRs of an antibody can be determined according to the Chothia numbering scheme, which refers to the location of immunoglobulin structural loops (see, e.g., Chothia C & Lesk AM, (1987), J Mol Biol 196: 901-917, Al-Lazikani B et al, (1997) J Mol Biol 273 : 927-948; Chothia C et al, (1992) J Mol Biol 227: 799-817; Tramontane A et al, (1990) J Mol Biol 215(1): 175-82; and U.S. Patent No. 7,709,226).
  • Chothia numbering scheme refers to the location of immunoglobulin structural loops
  • the Chothia CDR-Hl loop is present at heavy chain amino acids 26 to 32, 33, or 34, the Chothia CDR-H2 loop is present at heavy chain amino acids 52 to 56, and the Chothia CDR-H3 loop is present at heavy chain amino acids 95 to 102, while the Chothia CDR-L1 loop is present at light chain amino acids 24 to 34, the Chothia CDR-L2 loop is present at light chain amino acids 50 to 56, and the Chothia CDR-L3 loop is present at light chain amino acids 89 to 97,
  • the end of the Chothia CDR-HI loop when numbered using the abat numbering convention varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places the insertions at H35A and H35B; if neither 35 A.
  • the loop ends at 32 if only 35A is present, the loop ends at 33; if both 35A and 35B are present, the loop ends at 34).
  • the CDRs of the antibodies described herein have been determined according to the Chothia numbering scheme.
  • constant region and “constant domain” are interchangeable and have a meaning common in the art.
  • the constant region is an antibody portion, e.g., a carboxyl terminal portion of a light and/or heavy chain which is not directly involved in binding of an antibody to antigen but which can exhibit various effector functions, such as interaction with the Fc receptor.
  • the constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence relative to an immunoglobulin variable domain.
  • the term "heavy chain” when used in reference to an antibody can refer to any distinct type, e.g., alpha (a), delta ( ⁇ ), epsilon ( ⁇ ), gamma ( ⁇ ) and mu ( ⁇ ), based on the amino acid sequence of the constant domain, which give rise to IgA, IgD, IgE, IgG and IgM classes of antibodies, respectively, including subclasses of IgG, e.g., IgGi, IgG 2 , IgGs and IgG 4 .
  • the term "light chain” when used in reference to an antibody can refer to any distinct type, e.g., kappa ( ⁇ ) or lambda ( ⁇ ) based on the amino acid sequence of the constant domains. Light chain amino acid sequences are well known in the art. In specific embodiments, the light chain is a human light chain.
  • Binding affinity generally refers to the strength of the sum total of non- covending interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, "binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen).
  • the affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (KD). Affinity can be measured and/or expressed in a number of ways known in the art, including, but not limited to, equilibrium dissociation constant (KD), and equilibrium association constant (KA).
  • the KD is calculated from the quotient of k 0 ff/k ot i
  • KA is calculated from the quotient of k oti /koff.
  • kon refers to the association rate constant of, e.g.., an antibody to an antigen
  • koff refers to the dissociation of, e.g., an antibody to an antigen.
  • the k oa and k 0 ff can be determined by techniques known to one of ordinary skill in the art, such as BIAcore* or KinExA.
  • a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having side chains have been defined in the art. These families include amino acids with basic side chains ⁇ e.g., lysine, arginine, histidine), acidic side chains ⁇ e.g., aspartic acid, glutamic acid), uncharged polar side chains ⁇ e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains ⁇ e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains ⁇ e.g., threonine, valine, isoleucine) and aromatic side chains ⁇ e.g., tyrosine, phenylalanine
  • an epitope is a term in the art and refers to a localized region of an antigen to which an antibody can specifically bind.
  • An epitope can be, for example, contiguous amino acids of a polypeptide (linear or contiguous epitope) or an epitope can, for example, come together from two or more non-contiguous regions of a polypeptide or polypeptides (conformational, non-linear, discontinuous, or non-contiguous epitope).
  • the epitope to which an antibody binds can be determined by, e.g., NMR spectroscopy, X-ray diffraction crystallography studies, ELISA assays, hydrogen/deuterium exchange coupled with mass spectrometry ⁇ e.g., liquid chromatography electrospray mass spectrometry), array-based oligo-peptide scanning assays, and/or mutagenesis mapping ⁇ e.g., site-directed mutagenesis mapping).
  • crystallization may be accomplished using any of the known methods in the art ⁇ e.g., Giege R et al, (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4): 339-350; McPherson A (1990) Eur J Biochem 189: 1-23; C hay en NE (1997) Structure 5: 1269-1274; McPherson A (1976) J Biol Chem 251 : 6300-6303).
  • Antibody antigen crystals may be studied using well known X-ray diffraction techniques and may be refined using computer software such as X-PLOR (Yale University, 1992, distributed by Molecular Simulations, Inc.; see e.g.
  • an antigen binding molecule, an antibody, or an antigen binding molecule thereof "cross competes" with a reference antibody or an antigen binding molecule thereof if the interaction between an antigen and the first binding molecule, an antibody, or an antigen binding molecule thereof blocks, limits, inhibits, or otherwise reduces the ability of the reference binding molecule, reference antibody, or an antigen binding molecule thereof to interact with the antigen.
  • Cross competition can be complete, e.g., binding of the binding molecule to the antigen completely blocks the ability of the reference binding molecule to bind the antigen, or it can be partial, e.g., binding of the binding molecule to the antigen reduces the ability of the reference binding molecule to bind the antigen.
  • an antigen binding molecule that cross competes with a reference antigen binding molecule binds the same or an overlapping epitope as the reference antigen binding molecule. In other embodiments, the antigen binding molecule that cross competes with a reference antigen binding molecule binds a different epitope as the reference antigen binding molecule.
  • RIA solid phase direct or indirect radioimmunoassay
  • EIA solid phase direct or indirect enzyme immunoassay
  • sandwich competition assay Stahli et ah, 1983, Methods in Enzymology 9:242-253
  • solid phase direct biotin-avidin EIA Karlland et ah, 1986, J. Immunol.
  • solid phase direct labeled assay solid phase direct labeled sandwich assay (Harlow and Lane, 1988, Antibodies, A Laboraton,' Manual, Cold Spring Harbor Press); solid phase direct label RIA using 1-125 label (Morel et ah, 1988, Molec. Immunol. 25:7-15); solid phase direct biotin- avidin EIA (Cheung, et ah, 1990, Virology 176:546-552); and direct labeled RIA (Moldenhauer ei a/., 1990, Scand. J. Immunol, 32:77-82).
  • the terms “immunospecifically binds,” “immunospecifically recognizes,” “specifically binds,” and “specifically recognizes” are analogous terms in the context of antibodies and refer to molecules that bind to an antigen (e.g., epitope or immune complex) as such binding is understood by one skilled in the art.
  • a molecule that specifically binds to an antigen may bind to other peptides or polypeptides, generally with lower affinity as determined by, e.g., immunoassays, BIAcore ® , KinExA 3000 instalment (Sapidyne Instalments, Boise, ID), or other assays known in the art.
  • molecules that specifically bind to an antigen bind to the antigen with a KA that is at least 2 logs, 2, 5 logs, 3 logs, 4 logs or greater than the KA when the molecules bind to another antigen.
  • molecules that specifically bind to an antigen bind with a dissociation constant (Kd) of about 1 x 10 "7 M.
  • Kd dissociation constant
  • the antigen binding molecule specifically binds an antigen with " " high atfinity when the KQ is about 1 x 10 "9 M to about 5 x 1 Q "9 M.
  • the antigen binding molecule specifically binds an antigen with "very high affinity” when the Kd is I x 10 "10 M to about 5 x 10 "10 M.
  • the antigen binding molecule has a d of 10 "9 M.
  • the off-rate is less than about 1 x 10 " °.
  • the antigen binding molecule binds human BCMA with a Kd of between about 1 x 10 " ' ' M and about 1 x 1 G "13 M. In yet another embodiment, the antigen binding molecule binds human BCMA with a Kd of about 1 x 1 0 "10 M to about 5 x 10 "I 0 M.
  • molecules that specifically bind to an antigen do not cross react with other proteins under similar binding conditions. In another specific embodiment, molecules that specifically bind to an antigen do not cross react with other non- BCM A proteins.
  • an antibody or fragment thereof that binds to BCMA with higher affinity than to another unrelated antigen e.g., human BCMA
  • an antibody or fragment thereof that binds to BCMA e.g., human BCMA
  • the extent of binding of an anti-BCMA antibody or antigen-binding fragment thereof described herein to an unrelated, non-BCMA protein is less than 10%, 15%, or 20% of the binding of the antibody to BCMA protein as measured by, e.g., a radioimmunoassay.
  • provided herein is an antibody or fragment thereof that binds to human BCMA with higher affinity than to another species of BCMA.
  • an antibody or fragment thereof described herein, which binds to human BCMA will bind to another species of BCMA protein with less than 10%, 15%, or 20% of the binding of the antibody or fragment thereof to the human BCMA protein as measured by, e.g., a radioimmunoassay, surface plasmon resonance, or kinetic exclusion assay.
  • an "antigen” refers to any molecule that provokes an immune response or is capable of being bound by an antibody or an antigen binding molecule.
  • the immune response may involve either antibody production, or the activation of specific immunologically- competent cells, or both.
  • An antigen can be endogenous! ⁇ ' expressed, i.e. expressed by genomic DNA, or can be recombinantly expressed.
  • An antigen can be specific to a certain tissue, such as a cancer cell, or it can be broadly expressed.
  • fragments of larger molecules can act as antigens.
  • antigens are tumor antigens.
  • the antigen is BCMA.
  • neutralizing refers to an antigen binding molecule, scFv, antibody, or a fragment thereof that binds to a ligand and prevents or reduces the biological effect of that ligand.
  • the antigen binding molecule, scFv, antibody, or a fragment thereof directly blocking a binding site on the ligand or otherwise alters the ligand's ability to bind through indirect means (such as structural or energetic alterations in the ligand).
  • the antigen binding molecule, scFv, antibody, or a fragment thereof prevents the protein to which it is bound from performing a biological function.
  • BCMA refers to B cell maturation antigen, which can include, but is not limited to, native BCMA, an isoform of BCMA, or an interspecies BCMA homolog of BCMA
  • BCMA also known as TNFRSF17, CD269, and TNFRSF13A
  • TNF tumor necrosis factor
  • BCMA human BCMA
  • BCMA proteins may further include fragments comprising all or a portion of the extracellular domain of BCMA (e.g., all or a portion of amino acids 1-54 of hBCMA).
  • autologous refers to any material derived from the same individual to which it is later to be re-introduced.
  • eACTTM engineered autologous cell therapy
  • allogeneic refers to any material derived from one individual which is then introduced to another individual of the same species, e.g., allogeneic T cell transplantation.
  • transduction and “transduced” refer to the process whereby foreign DNA is introduced into a cell via viral vector (see Jones et al., “Genetics: principles and analysis,” Boston: Jones & Bartlett Publ. (1998)).
  • the vector is a retroviral vector, a DNA vector, a RNA vector, an adenoviral vector, a baculoviral vector, an Epstein Barr viral vector, a papovavirai vector, a vaccinia viral vector, a herpes simplex viral vector, an adenovirus associated vector, a lentiviral vector, or any combination thereof,
  • a "cancer” refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream.
  • a “cancer” or “cancer tissue” can include a tumor.
  • the methods of the present invention can be used to reduce the tumor size of a tumor derived from, for example, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, multiple myeloma, Hodgkin's Disease, non- Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lympho
  • NHL
  • the cancer is multiple myeloma.
  • the particular cancer can be responsive to chemo- or radiation therapy or the cancer can be refractor ⁇ '.
  • a refractor cancer refers to a cancer that is not amendable to surgical intervention and the cancer is either initially unresponsive to chemo- or radiation therapy or the cancer becomes unresponsive over time.
  • an "anti -tumor effect" as used herein refers to a biological effect that can present as a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, a decrease in the number of metastases, an increase in overall or progression-free survival, an increase in life expectancy, or amelioration of various physiological symptoms associated with the tumor.
  • An a ti -turn or effect can also refer to the prevention of the occurrence of a tumor, e.g., a vaccine.
  • a "cytokine,” as used herein, refers to a non-antibody protein that is released by one cell in response to contact with a specific antigen, wherein the cytokine interacts with a second cell to mediate a response in the second cell.
  • a cytokine can be endogenously expressed by a cell or administered to a subject. Cytokines may be released by immune ceils, including macrophages, B cells, T cells, and mast cells to propagate an immune response. Cytokines can induce various responses in the recipient cell. Cytokines can include homeostatic cytokines, chemokines, pro-inflammatory cytokines, effectors, and acute-phase proteins.
  • homeostatic cytokines including interleukin (IL) 7 and IL-15, promote immune cell survival and proliferation, and pro-inflammatory cytokines can promote an inflammatory response.
  • homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN) gamma.
  • IFN interferon
  • pro-inflammatory cytokines include, but are not limited to, IL- la, IL-lb, IL-6, IL-13, IL-17a, tumor necrosis factor (TNF)-alpha, TNF-beta, fibroblast growth factor (FGF) 2, granulocyte macrophage colony-stimulating factor (GM-CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-l), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF).
  • TNF tumor necrosis factor
  • FGF fibroblast growth factor
  • GM-CSF granulocyte macrophage colony-stimulating factor
  • sICAM-1 soluble intercellular adhesion molecule 1
  • sVCAM-l soluble vascular adhesion molecule 1
  • VEGF vascular endothelial growth factor
  • VEGF-C VE
  • effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), and perforin.
  • acute phase-proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA),
  • chemokines are a type of cytokine that mediates ceil chemotaxis, or directional movement.
  • chemokines include, but are not limited to, IL-8, IL-16, eotaxin, eotaxin-3, macrophage-derived chemokine (MDC or CCL22), monocyte chemotactic protein J (MCP-1 or CCL2), MCP-4, macrophage inflammatory protein l a (MTP-la, ⁇ -la), MIP- ⁇ (MIP-lb), gamma-induced protein 10 (IP-1Q), and thymus and activation regulated chemokine (TARC or CCL17).
  • therapeutically effective dosage of a therapeutic agent is any amount that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom- free periods, or a prevention of impairment or disability due to the disease affliction.
  • the ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.
  • NK cells include natural killer (NK) cells, T cells, orB cells.
  • NK cells are a type of cytotoxic (cell toxic) lymphocyte that represent a major component of the inherent immune system. NK cells reject tumors and cells infected by viruses. It works through the process of apoptosis or programmed cell death. They were termed "natural killers” because they do not require activation in order to kill cells.
  • T-ceils play a major role in cell-mediated-immunity (no antibody involvement). Its T-cell receptors (TCR) differentiate themselves from other lymphocyte types.
  • TCR T-cell receptors
  • the thymus a specialized organ of the immune system, is primarily responsible for the T cell's maturation.
  • T-cells There are six types of T-cells, namely: Helper T-cells (e.g., CD4+ cells), Cytotoxic T-cells (also known as TC, cytotoxic T lymphocyte, CTL, T-killer cell, cytolytic T cell, CD8+ T-cells or killer T cell), Memory T-cells ((i) stem memory TSCM cells, like naive cells, are CD45RO-, CCR7+, CD45RA+, (1)621.
  • Helper T-cells e.g., CD4+ cells
  • Cytotoxic T-cells also known as TC, cytotoxic T lymphocyte, CTL, T-killer cell, cytolytic T cell, CD8+ T-cells or killer T cell
  • Memory T-cells (i) stem memory TSCM cells, like naive cells, are CD45RO-, CCR7+, CD45RA+, (1)621.
  • L-selectin CD27+, CD28+ and IL-7Ra+, but they also express large amounts of CD95, IL-2R , CXCR3, and LFA-1 , and show numerous functional attributes distinctive of memory cells);
  • central memory TCM cells express L-selectin and the CCR7, they secrete IL-2, but not IFNy or IL-4, and
  • effector memory TEM cells do not express L-seleetin or CCR7 but produce effector cytokines like ⁇ and IL-4), Regulatory T-cells (Tregs, suppressor T cells, or CD4+CD25+ regulator ⁇ ' T cells), Natural Killer T-cells (NKT) and Gamma Delta T-cells.
  • B-ce!ls play a principal role in humoral immunity (with antibody involvement). It makes antibodies and antigens and performs the role of antigen-presenting ceils (APCs) and turns into memory B-celis after activation by antigen interaction. In mammals, immature B-cells are formed in the bone marrow, where its name is derived from.
  • the term "genetically engineered” or “engineered” refers to a method of modifying the genome of a cell, including, but not limited to, deleting a coding or non-coding region or a portion thereof or inserting a coding region or a portion thereof.
  • the cell that is modified is a lymphocyte, e.g., a T cell, which can either be obtained from a patient or a donor.
  • the cell can be modified to express an exogenous coiistmct, such as, e.g., a chimeric antigen receptor (CAR.) or a T cell receptor (TCR), which is incorporated into the cell's genome.
  • CAR chimeric antigen receptor
  • TCR T cell receptor
  • an "immune response” refers to the action of a cell of the immune system (for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils) and soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and/or elimination from a vertebrate's body of invading pathogens, ceils or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues.
  • a cell of the immune system for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils
  • soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that
  • immunotherapy refers to the treatment of a subject afflicted with, or at risk of contracting or suffering a recurrence of, a disease by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response.
  • immunotherapy include, but are not limited to, T cell therapies.
  • T cell therapy can include adoptive T cell therapy, tumor-infiltrating lymphocyte (TIL) immunotherapy, autologous ceil therapy, engineered autologous cell therapy (eACT), and allogeneic T cell transplantation.
  • TIL tumor-infiltrating lymphocyte
  • eACT engineered autologous cell therapy
  • T cell therapies are described in U.S. Patent Publication Nos. 2014/0154228 and 2002/0006409, U.S. Patent No. 5,728,388, and International Publication No. WO 2008/081035.
  • the T ceils of the immunotherapy can come from any source known in the art.
  • T cells can be differentiated in vitro from a hematopoietic stem cell population, or T cells can be obtained from a subject.
  • T cells can be obtained from, e.g., peripheral blood mononuclear ceils (PBMCs), bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors.
  • PBMCs peripheral blood mononuclear ceils
  • the T cells can be derived from one or more T cell lines available in the art.
  • T cells can also be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as FICOLLTM separation and/or apheresis. Additional methods of isolating T cells for a T cell therapy are disclosed in U.S. Patent Publication No. 2013/0287748, which is herein incorporated by references in its entirety.
  • eACTTM also known as adoptive cell transfer, is a process by which a patient's own T cells are collected and subsequently genetically altered to recognize and target one or more antigens expressed on the cell surface of one or more specific tumor cells or malignancies.
  • T cells can be engineered to express, for example, chimeric antigen receptors (CAR) or T ceil receptor (TCR).
  • CAR positive (+) T cells are engineered to express an extracellular single chain variable fragment (scFv) with specificity for a particular tumor antigen linked to an intracellular signaling part comprising at least one costimulatory domain and at least one activating domain.
  • the costimulatory domain can be derived from, e.g., CD28, and the activating domain can be derived from, e.g., CD3-zeta.
  • the CAR is designed to have two, three, four, or more costimulatory domains.
  • the CAR scFv can be designed to target, for example, CD 19, which is a transmembrane protein expressed by cells in the B cell lineage, including all normal B cells and B cell malignances, including but not limited to NHL, CLL, and non-T ceil ALL.
  • the CAR is engineered such that the costimulatory domain is expressed as a separate polypeptide chain.
  • Example CAR T ceil therapies and constructs are described in U.S. Patent Publication Nos. 2013/0287748, 2014/0227237, 2014/0099309, and 2014/0050708, and these references are incorporated by reference in their entirety.
  • a "patient” as used herein includes any human who is afflicted with a cancer
  • a lymphoma or a leukemia e.g., a lymphoma or a leukemia.
  • subject e.g., a lymphoma or a leukemia.
  • patient e.g., a lymphoma or a leukemia.
  • an in vitro cell refers to any cell which is cultured ex vivo.
  • an in vitro cell can include a T cell.
  • the terms "peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
  • Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
  • Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
  • the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
  • polypeptides and/or proteins have deletions from, additions to, and/or substitutions of one or more amino acid of antigen-binding protein, and in some embodiments preferably no more than 8 amino acid substitutions therein.
  • Useful polypeptide fragments may include immunologically functional fragments of antigen binding molecules, including not limited to one or more CDR regions, variable domains of a heavy and/or light chain, a portion of other portions of an antibody chain, and the like. Additionally, polypeptide fragments of activating and/or eostimuiatory molecules and the like are within the scope of the invention.
  • activation refers to a primary response induced by binding of an activating molecule with its cognate ligand, wherein the binding mediates a signal transduction event.
  • An "activating molecule” or “stimulating molecule” refers to a molecule on a T cell, e.g., the TCR/CD3 complex that specifically binds with a cognate stimulatory ligand present on an antigen present cell. Suitable activating molecules are described herein.
  • a "stimulatory ligand” is a ligand that when present on an antigen presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) can specifically bind with a stimulatory molecule on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like.
  • Stimulatory ligands include, but are not limited to, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist anti-CD28 antibody, and a superagonist anti-CD2 antibody.
  • a "costimulatory signal,” as used herein, refers to a signal, which in combination with a primary signal, such as TCR/CD3 ligation, leads to a T ceil response, such as, but not limited to, proliferation and/or upregulation or down regulation of key molecules.
  • a "costimulatory ligand" as used herein includes a molecule on an antigen presenting cell that specifically binds a cognate co-stimulatory molecule on a T cell. Binding of the costimulatory ligand provides a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. A costimulatory ligand induces a signal that is in addition to the primary signal provided by a stimulatory molecule, for instance, by binding of a T cell receptor (TCR)/CD3 complex with a major histocompatibility complex (MHC) molecule loaded with peptide.
  • TCR T cell receptor
  • MHC major histocompatibility complex
  • a co-stimulatory ligand can include, but is not limited to, CD7, B7-1 (CD80), B7-2 (CD86), programmed death (PD) LI, PD-L2, 4- IBB ligand, OX40 ligand, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30 ligand, CD40, CD 70.
  • HLA-G human leukocyte antigen G
  • MICA MHC class I chain-related protein A
  • MHC class I chain-related protein B MHC class I chain-related protein B
  • HVEM herpes virus entry mediator
  • lymphotoxin beta receptor 3/TR6, immunoglobulin-like transcript (ILT) 3, ILT4, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3.
  • a co-stimulatory ligand includes, without limitation, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as, but not limited to, CD27, CD28, 4- IBB, OX40, CD30, CD40, PD-1 , ICOS, lymphocyte function-associated antigen-l (L.FA-1), CD2, CD7, tumor necrosis factor superfamily member 14 (TNFSF14 or LIGHT), natural killer cell receptor C (N G2C), B7-H3, and a ligand that specificall binds with CD83.
  • an antibody that specifically binds with a co-stimulatory molecule present on a T cell such as, but not limited to, CD27, CD28, 4- IBB, OX40, CD30, CD40, PD-1 , ICOS, lymphocyte function-associated antigen-l (L.FA-1), CD2, CD7, tumor necrosis factor superfamily member 14 (TNFSF14 or LIGHT), natural killer cell receptor C (N G2
  • costimulatory molecule is a cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation.
  • Costimulatory molecules include, but are not limited to, CD28, CD28T, OX40, 4-1BB/CD137, CD2, CD3 (alpha, beta, delta, epsilon, gamma, zeta), CD4, CDS, CD7, CD9, CD16, CD22, CD27, CD30, CD 33, CD37, CD40, CD 45, CD64, CD80, CD86, CD134, (1) 137, CD154, PD-1, ICOS, lymphocyte function- associated antigen- l (LFA-1 (CD1 la/CD 18), CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), NKG2C, Ig alpha (CD79a), DAP- 10, Fc gamma receptor, MHC class I molecule, TNF, TNFr, integrin, signaling lymphocytic activation molecule, BTLA, Toil ligand receptor, ICAM-1, B7-H3,
  • CD84 CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGLl , CDIOO (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD 150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, CD 19a, CD83 ligand, or fragments or combinations thereof.
  • Treatment or “treating” of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with a disease.
  • treatment or “treating” includes a partial remission. In another embodiment, “treatment” or “treating” includes a complete remission.
  • the sequences being compared are typically aligned in a way that gives the largest match between the sequences.
  • One example of a computer program that can be used to determine percent identity is the GCG program package, which includes GAP (Devereux et al., 1984, Nuci. Acid Res. 12:387; Genetics Computer Group, University of Wisconsin, Madison, Wis.), The computer algorithm GAP is used to align the two polypeptides or polynucleotides for which the percent sequence identity is to be determined. The sequences are aligned for optimal matching of their respective amino acid or nucleotide (the "matched span", as determined by the algorithm).
  • a standard comparison matrix (see, Dayhoff et al., 1978, Atlas of Protein Sequence and Structure 5 :345-352 forthe PAM 250 comparison matrix; Henikoff etal., 1992, Proc. Natl. Acad. Sci. U.S.A. 89: 10915-10919 for the BLOSUM 62 comparison matrix) is also used by the algorithm.
  • the terms "about” or “comprising essentially of refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system.
  • “about” or “comprising essentially of can mean within 1 or more than 1 standard deviation per the practice in the art.
  • “about” or “comprising essentially of can mean a range of up to 10% (i.e., ⁇ 10%).
  • about 3mg can include any number between 2.7 mg and 3.3 mg (for 10%).
  • the terms can mean up to an order of magnitude or up to 5- fold of a value.
  • any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one-tenth and one-hundredth of an integer), unless otherwise indicated,
  • the present invention is directed to a polynucleotide encoding an anti-BCMA antibody or antigen binding molecule thereof which cross competes with one or more antibodies described herein (i.e., one or more described in Figure 1) or an antibody or antigen binding molecule thereof encoded by the polynucleotide.
  • the invention is directed to a polynucleotide encoding an anti-BCMA antibody or antigen binding molecule thereof which binds to the same epitope as one or more antibodies described in Figure 1 or an antibody or antigen binding molecule thereof encoded by the polynucleotide.
  • the polynucleotide encodes an antibody or antigen binding molecule thereof that specifically binds to BCMA, wherein the antibody or binding molecule comprises a heavy chain VH comprising: (a) a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence GX2X3X4X5X6X7SY (SEQ ID NO: 145), wherein: X 2 is not present or G; X3 is not present or S; Xs is F, G, I, or Y; X? is S or T; 3 ⁇ 4 is F or S; and X?
  • VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1DC3X4X5X6X7X8X9X10YX12X13X14X15X16X17 (SEQ ID NO: 146), wherein: Xi is A, G, I, S, T, or V; X 3 is I, N, or S; X 4 is G, P, S, or Y; X 5 is D, G, I, or S; 3 ⁇ 4 is F, G, or S; X?
  • X9 is A, I, K, or T
  • X10 is N, S, or Y
  • X12 is A or N
  • X13 is D, P, or Q
  • X14 is K or S
  • X35 is F, !,, or V
  • X16 is or Q
  • X17 is G or S
  • a VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X 1 X 2 X 3 X 4 X5X6X7X8X XioXnXi2Xi3Xi4Xi5Xi6Xi7DX 1 (SEQ ID NO: 147), wherein: Xi is A or V; X2 is K or R; X3 is not present or D, G, or T; X4 is not present or A, D, G, P, R, or S; X5 is not present or E, F, G,
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VH comprising: (a) a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6SYX9X10X11 (SEQ ID NO:
  • Xi is not present or G
  • X 2 is not present or S
  • X 3 is F, G, I, or Y
  • X4 is S or T
  • X5 is F or S
  • X 6 is S or T
  • X9 is A, G, S, or Y
  • Xio is I, M, or W
  • Xn is G, H, N, or S
  • Xi is A or V
  • X 2 is K or R
  • X 3 is not present or D, G, or T
  • X is not present or D, G, or P
  • X5 is not present or F, L, or T
  • 3 ⁇ 4 is not present or P, Q, R, W, or Y
  • X 7 is not present or E, G, L, or S
  • X is not present or A, G, P, S, or Y
  • X9 is not present or A, E, G, P, Q, or S
  • X-o is not present or E, L, M, PS, T, or Y
  • Xu is not present or D, G, H, P, S or W
  • Xi2 is not present or A, G, L L, or Y, X ⁇ ; is not present or A, G, I, V, or W
  • X 14 is not present or H
  • Xj5 is not present or Y
  • X 16 is not present or Y
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VL comprising: (a) a VL CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence XiX SQXsXeXTXsXgXioXiiXnXnXMXisLXi? (SEQ ID NO: 148), wherein Xi is K or R; X 2 is A or S; X 5 is G or S; Xe is L L, or V; X?
  • Xs is L or S; Xs is not present or H or Y; X9 is not present or S; X 10 is not present or N or S; Xu is not present or G or N; X12 is not present or N, X13 is not present or K or Y; XH is N, R, or S; X15 is N, W, or Y; and X17 is A or D; and/or (b) a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2SX4X5X6X7 (SEQ ID NO: 149), wherein Xi is D, G, L, S, or W; X2 is A or G, X4 is N, S, or T, X 5 is L or R; Xe is A, E, or Q; and X?
  • VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence Xj QX3X4X5X6PX8T (SEQ ID NO: 150), wherein Xi is M or Q; X 3 is F, G, H, I, R, or Y; X 4 is A, F, H, I, L, or Y; X 5 is A, G, 1 1, S, T, V, or Y: X 6 is F, L, T, W, or Y, and Xg is not present or F, L, P, or W.
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule compri ses a VH comprising: (a) a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence GX2X3X4X5X6X7 SY (SEQ ID NO: 145), wherein : X? is not present or G; X 3 i s not present or S; X4 is F, G, I, or Y; X 5 is S or T; Xe is F or S; and X?
  • VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence Xt 1X ⁇ X5X6X7X8X9X ⁇ X1:1X0X14X15X16X17 (SEQ ID NO: 146), wherein: Xi is A, G, I, S, T, or V: X 3 is I, N, or S; X 4 is G, P, S, or Y; X?
  • VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence
  • XiX 2 X3X4X5X6X7X8X9XioXiiXi2Xi3Xi Xi5Xi6Xi7DX 1 9 (SEQ ID NO: 147), wherein: Xi is A or V; X2 is K or R; X3 is not present or D, G, or T; X4 is not present or A, D, G, P, R, or S; X5 is not present or E, F, G, L, Q, or T; Xe is not present or E, M, Q, W, or Y; X7 is not present or A, E, L, or S; 3 ⁇ 4 is not present or G, P, S, or T; X9 is not present or G, P, or S; Xio is not present or I, L, P, or Y; X i ⁇ is not present or W; X 12 is not present or H; X13 is not present or E or Y; XM is not present or D
  • Xg is L or S; Xg is not present or H or Y; X9 is not present or S; X 10 is not present or N or S; 3 ⁇ 4i is not present or G or N; X 12 is not present or N; Xi3 is not present or K or Y; XM is N, R, or S; X15 is N, W, or Y; and Xi?
  • VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2SX4X5X6X7 (SEQ ID NO: 149), wherein Xi is D, G, L, S, or W, X 2 is A or G; X 4 is N, S, or T; X5 is L or R; 3 ⁇ 4 is A, E, or Q; and X7 is S or T; and/or (f) a VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1QX3X4X5X6PX8T (SEQ ID NO: 1 50), wherein Xi is M or Q, X3 is F, G, H, I, R, or Y; X 4 is A, F, 1 1. L L, or Y, X 5 is A, G, H, S, T, V, or Y; X 6 is F, L, T, W, or
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VH comprising: (a) a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6SYX9X10X11 (SEQ ID NO:
  • Xi is not present or G, X 2 is not present or S
  • X3 is F, G, I, or Y
  • X is S or T
  • Xs is F or S
  • X 6 is S or T
  • X 9 is A, G, S, or Y
  • Xio is I, M, or W
  • 3 ⁇ 4i is G, H, N, or S
  • a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence ⁇ 3 ⁇ 4 ⁇ 5 ⁇ 6 ⁇ ? ⁇ 8 ⁇ 9 ⁇ 2 ⁇ 3 ⁇ 4 ⁇ 5 ⁇ 6 ⁇ 7 (SEQ ID NO: 146), wherein: Xi is A, G, I, S, T, or V; X3 is I, N, or S: Xs is G, P, S, or Y; X 5 is D, G, I, or S; X 6 is F, G, or S: X?
  • Xg is G or S; Xg is not present or N, S, or T, X9 is A, I, K, or T; Xio is N, S, or Y, X 12 is A or N; Xi3 is D, P, or Q; X 14 is K or S; X15 is F, L, or V; X 16 is K or Q; and X 17 is G or S; and/or (c) a VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19DX21 (SEQ ID NO:
  • X17 is A or D; and/or (e) a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence (SEQ ID NO: 149), wherein Xi is D, G, L, S, or W; X 2 is A or G; X 4 is N, S, or T; X 5 is L or R; X 6 is A, E, or Q; and X 7 is S or T; and/or (f) a VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1QX3X4X5X6PX8T (SEQ ID NO: 149), wherein Xi is D, G, L, S, or W; X 2 is A or G; X 4 is N, S, or T; X 5 is L or R; X 6 is A, E, or Q; and X 7 is S or T; and/or (f) a VL CDR3 comprising, consisting of, or consisting
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VH and a VL, wherein: (i) the VH comprises: (a) a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence GX2X3X4X5X6X7SY (SEQ ID NO: 145), wherein: X 2 is not present or G, X 3 is not present or S; X 4 is F, G, I, or Y; X 5 is S or T; X 6 is F or S; and X 7 is S or T; and/or (b) a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence XiLX3X4X5X6X7XsX9XioYXi2Xi3Xi 4 Xi5Xi6Xi7 (SEQ ID NO:
  • Xs is N, S, or T; X9 is A, I, K, or T; Xio is N, S, or Y; X12 is A or N; X 13 is D, P, or Q; X 14 is K or S; X 15 is F, L, or V; X 16 is K or Q; and X 17 is G or S; and/or (c) a VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17DX19 (SEQ ID NO: 147), wherein: Xi is A or V, X 2 is K or R; X 3 is not present or D, G, or T; X 4 is not present or A, D, G, P, R, or S; Xs is not present or E, F, G, L, Q, or T; Xe is not
  • VL comprises: (a) a VL CDRl comprising, consisting of, or consisting essentially of the amino acid sequence X]X2SQX53 ⁇ 4X7XsX9 ioXiiXi2Xi3Xi4Xi5LX]7 (SEQ ID NO: 148), wherein Xi is K or R; X 2 is A or S, Xs is G or S; X 6 is I, L, or V; X?
  • X 17 is A or D; and/or (b) a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2SX4X5X0X7 (SEQ ID NO: 149), wherein X , is D, G, L, S, or W; X 2 is A or G; X 4 is N, S, or T; X5 is I, or R; X* is A, E, or Q; and X 7 is S or T; and/or (c) a VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence ⁇
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VH and a VL, wherein: (i) the VH comprises: (a) a VH CDRl comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6SYX9X10X11 (SEQ ID NO: 263), wherein: Xi is not present or G; X 2 is not present or S X3 is F, G, I, or Y; X4 is S or T; X5 is F or S; X > is S or T; X9 is A, G, S, or Y; X10 is I, M, or W; and Xu is G, H, N, or S; and/or (b) a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X ;
  • X is A, G, I, S, T, or V; X3 is I, N, or S, X4 is G, P, S, or Y, X5 is D, G, I, or S; X 6 is F, G, or S, X 7 is G or S; Xg is not present or N, S, or T; X9 is A, I, K, or T; X10 is N, S, or Y; X 12 is A or N; X13 is D, P, or Q; X14 is K or S; X 15 is F, L, or V; Xie is K or Q; and X 17 is G or S; and/or (c) a VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15
  • VL comprises: (a) a VL CDRl comprising, consisting of, or consisting essentially of the amino acid sequence X1X2S
  • VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1QX3X4X5X6PX8T (SEQ ID NO: 150), wherein Xi is M or Q; X 3 is F, G, H, I, R, or Y; X 4 is A, F, H, I, L, or Y; X 5 is A, G, H, S, T, V, or Y, X& is F, L, T, W, or Y, and X% is not present or F, L, P, or W.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence GX2X3X4X5X6X7SY (SEQ ID NO: 145), wherein: X 2 is not present or G; X 3 is not present or S; X4 is F, G, I, or Y; X5 is S or T; X 6 is F or S; and X? is S or T.
  • BCMA e.g., hBCMA
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence GX 2 TFSSY (SEQ ID NO: 151), wherein : X 2 i s F or G.
  • BCMA e.g., hBCMA
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6SYX9X10X11 (SEQ ID NO: 263), wherein: X- is not present or G; X? is not present or S X 3 is F, G, I, or Y; X 4 is S or T; X 5 is F or S: X 6 is S or T; X, is A, G, S, or Y: Xio is I, M, or W; and Xn is G, H, N, or S.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR1 comprising, consisting of, or consisting essentially of the amino acid sequence XiTF tSY zXgXg (SEQ ID NO: 265), wherein: Xi is F, G, or Y; 3 ⁇ 4 is S or T; X 7 is A, G, S, or Y; 3 ⁇ 4 is I or M; and X 9 is H, N, or S.
  • BCMA e.g., hBCMA
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR1 comprising, consisting of, or consi sting essentially of the amino acid sequence FTFSSYX7MX9 (SEQ ID NO: 266), wherein: X 7 is A, G, or S; and X9 is H, N, or S.
  • BCMA e.g., hBCMA
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence ( Si Q ID NO: 146), wherein: X ; is A, G, I, S, T, or V; X3 is I, N, or S, 3 ⁇ 4 is G, P, S, or Y, X5 is D, G, I, or S; X 6 is F, G, or S, X?
  • VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence ( Si Q ID NO: 146), wherein: X ; is A, G, I, S, T, or V; X3 is I, N, or S, 3 ⁇ 4 is G, P, S, or Y, X5 is D, G, I, or S; X 6 is F, G, or S, X?
  • X9 is A, I, K, or T
  • X10 is N, S, or Y
  • X 12 is A or N
  • X13 is D, P, or Q
  • X 14 is K or S
  • X15 is F, L, or V
  • X 16 is K or Q
  • Xi? is G or S.
  • the antibody or antigen binding molecule whi ch specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence XiK 3 X4X5X6X7X8X9XioYAXi 3 Xi4Xi5Xi6G(SEQ ID NO: 153), wherein: Xi is A, G, I, T, or V; X 3 is I, N, or S; X4 is G, P, S, or Y , X5 is D, G, I, or S; X 6 is F, G, or S, X?
  • Xg is G or S
  • Xg is N, S, or T
  • X 9 is A, I, K, or T
  • X 10 is N, S, or Y
  • X u is D or Q
  • X i4 is K or S
  • X 15 is F or V;
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1ISX4X5X6X7XSX9YYADSVKG (SEQ ID NO: 154), wherein: Xi is A, T, or V; X* is G, S, or Y; X 5 is D or S; X 6 is G or S: X 7 i s G or S; Xg is N, S, or T; and X9 i s I, , or T.
  • BCMA e.g., hBCMA
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VH CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence XiIXsPXsXeGXgXgXioYAQKFQG (SEQ ID NO: 155), wherein: Xi is G or I; X3 is I or N; 3 ⁇ 4 is G or I; X 6 is F or G; X 8 is S or T; X9 is A or T; and Xio is N or S.
  • BCMA e.g., hBCMA
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises three VH CDRs and three VL CDRs, wherein the VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence ⁇ , ⁇ ,. ⁇ - ⁇ , ⁇ , ⁇ : X; , ⁇ ,. ⁇ , ⁇ .- ⁇ (SEQ ID NO: 147) and wherein: Xi is A or V ; X?.
  • BCMA e.g., hBCMA
  • X 3 is K or R; X 3 is not present or D, G, or T; 3 ⁇ 4 is not present or A, D, G, P, R, or S, Xs is not present or E, F, G, L, Q, or T; Xe is not present or E, M, Q, W, or Y; X?
  • X 12 is not present or H; X 1 is not present or E or Y; X 14 is not present or D, G, H, P, S, W, or Y; X 15 is A, G, L, W, or Y; Xi6 is not present or A, G, I, P, or V; Xi? is F, L, or M; and X19 is I, L, V, or Y.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises three VH CDRs and three VL CDRs, wherein the VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence ARX;XiX ⁇ X --XHXv :nXiiX r .
  • X 3 is not present or D, G, or T; Xt is not present or A, D, G, P, R, or S; X5 is not present or E, F, G, Q, or T; Xe is not present or E, M, W, or Y; X?
  • Xs is not present or G, S, or T; X9 is not present or G or S; X 10 is not present or I, L, or P; X11 is not present or W; X 12 is not present or H; X 13 is not present or E or Y; X 14 is not present or G, H, P, S, W, or Y; X 15 is A, G, L, W, or Y; X 16 is not present or A, G, I, P, or V; Xr? is F, L, or M; and X19 is I, L, V, or Y.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises three VH CDRs and three VL CDRs, wherein the VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19DX21 (SEQ ID NO: 264) and wherein: Xi is A or V; X2 is K or R; X 3 is not present or D, G, or T, X4 is not present or
  • X5 is not present or F, L, or T; Xe is not present or P, Q, R, W, or Y; X? is not present or E, G, L, or S; Xs is not present or A, G, P, S, or Y; X9 is A, E, G, P, Q, or S; X10 is
  • E, L, M, P, S, T, or Y; Xn is not present or D, G, H, P, S or W, X 12 is not present or A, G, I, L, or Y; X 13 is not present or A, G, I, V, or W; X 14 is not present or H; X 15 is not present or Y; Xie is not present or Y; X 17 is not present or W or Y, X 18 is not present or P or G, X19 is
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises three VH CDRs and three VL CDRs, wherein the VH CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence ARXiXiXsXeXiX ⁇ wX Xu nXuXis ieXnXis wOX!i (SEQ ID NO: 267), wherein: X3 is not present or D or T; X 4 is not present or D or G; X5 is not present or F or T; Xe is not present or P, R, W, or Y; X?
  • Xj is not present or E, G, L, or S; Xg is not present or A, G, S, or Y; X9 is A, E, G, Q, or S; X10 is E, L, M, P, S, or T, Xn is not present or G, H, P, S or W; Xj?
  • Xi 8 is not present or P or G; Xi9 is F, L, or M; and X2J is I, L, V, or Y.
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises one, two, or all three of any of the VH CDRs listed above or described in FIG. 1A or FIG. IB.
  • the antibody or antigen binding molecule comprises the VH framework regions (FRs) described herein.
  • the antibody or antigen binding molecule comprises the VH FRs of an antibody set forth in FIG. 1A or FIG. IB (e.g., one, two, three, or four of the FRs in one sequence of FIG. l A).
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), compri ses a VI. CDRI comprising, consisting of, or consisting essentially of the amino acid sequence XiX 2 SQX5X6X7X8X XioXiiXi2Xi3Xi4Xi5LXi7 (SEQ ID NO: 148), wherein: X3 ⁇ 4 is K or R; X2 is A or S; X5 is G or S; Xe is I, L, or V; X?
  • Xg is L or S; Xg is not present or H or Y; X9 is not present or S, X 10 is not present or N or S; Xn is not present or G or N; Xj ? is not present or N; Xi3 is not present or K or Y; X14 is N, R, or S; X15 is N, W, or Y; and X 17 is A or D.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VL CDRI comprising, consisting of, or consisting essentially of the amino acid sequence RASQXsXeSXgXgLA (SEQ ID NO: 157), wherein: X5 is G or S; Xe is I or V, Xg is R or S, and X9 is N, W, or Y.
  • BCMA e.g., hBCMA
  • VL CDRI comprising, consisting of, or consisting essentially of the amino acid sequence RASQXsXeSXgXgLA (SEQ ID NO: 157), wherein: X5 is G or S; Xe is I or V, Xg is R or S, and X9 is N, W, or Y.
  • the antibody or antigen binding molecule which specifically binds to BCM A (e.g., hBCMA), comprises a VL CDR I comprising, consisting of, or consisting essentially of the amino acid sequence Xi SSQSXrXXsSXioXuXj iiXisNYLXr? (SEQ ID NO: 158), wherein: Xi is K or R; X 6 is L or V; Xg is H or Y; X 10 is N or S; Xn is G or N; X 12 is not present or N; X 13 is K or Y; and X 17 is A or D.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), compri ses a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1 X2SX X5X6X7 (SEQ ID NO: 149), wherein: Xi is D, G, L, S, or W; X? is A or G; X 4 is N, S, or T; 3 ⁇ 4 is L or R; X 6 is A, E, or Q; and X? is S or T.
  • BCMA e.g., hBCMA
  • VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X1 X2SX X5X6X7 (SEQ ID NO: 149), wherein: Xi is D, G, L, S, or W; X? is A or G; X 4 is N, S, or T; 3 ⁇ 4 is L or R; X 6
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X] ASX 4 RAT (SEQ ID NO: 159), wherein: Xi is D, G, or S; and X 4 is N or T.
  • BCMA e.g., hBCMA
  • VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X] ASX 4 RAT (SEQ ID NO: 159), wherein: Xi is D, G, or S; and X 4 is N or T.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VL CDR2 comprising, consisting o or consisting essentially of the amino acid sequence Xi AS X5X6X7 (SEQ ID NO: 160), wherein: Xi is D, G, or S; X is N, S, or T; X5 is L or R; X$ is A or Q; and X? is S or T.
  • VL CDR2 comprising, consisting o or consisting essentially of the amino acid sequence Xi AS X5X6X7 (SEQ ID NO: 160), wherein: Xi is D, G, or S; X is N, S, or T; X5 is L or R; X$ is A or Q; and X? is S or T.
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X 1 X 2 SX 4 RX 6 S (SEQ ID NO: 161), wherein X 1 is L or W; X 2 is A or G; X 4 is N or T; and Xe is A or E.
  • BCMA e.g., hBCMA
  • VL CDR2 comprising, consisting of, or consisting essentially of the amino acid sequence X 1 X 2 SX 4 RX 6 S (SEQ ID NO: 161), wherein X 1 is L or W; X 2 is A or G; X 4 is N or T; and Xe is A or E.
  • the antibody or antigen binding molecule which specifically binds to BCM A (e.g., hBCMA), comprises a VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X 1 QX 3 X 4 X 5 X6PXsT (SEQ ID NO: 150), wherein: Xj is M or Q, X3 is F, G, H, I, R, or Y; X is A, F, H, I, L, or Y; X 5 i s A, G, H, S, T, V, or Y; Xe is F, L, T, W, or Y; and 3 ⁇ 4 is not present or F, L, P, or W.
  • VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence X 1 QX 3 X 4 X 5 X6PXsT (SEQ ID NO: 150), wherein: Xj is M or Q, X3 is F, G, H,
  • the antibody or antigen binding molecule which specifically binds to BCMA (e.g., hBCMA), comprises a VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence QQX3 X5X6PX8T (SEQ ID NO: 162), wherein: X 3 i s H, I, R, or Y, X 4 is A, F, H, I, or Y; X 5 is A, S, T, V, or Y, X 6 is F, W, or Y; and Xs is not present or F, L, P, or W.
  • VL CDR3 comprising, consisting of, or consisting essentially of the amino acid sequence QQX3 X5X6PX8T (SEQ ID NO: 162), wherein: X 3 i s H, I, R, or Y, X 4 is A, F, H, I, or Y; X 5 is A, S, T, V, or Y,
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises one, two, or all three of any of the VL CDRs listed above or described in FIG. 2.
  • the antibody or antigen binding molecule comprises the VL framework regions (FRs) described herein.
  • the antibody or antigen binding molecule comprises the VL FRs of an antibody set forth in FIG. 4 (e.g., one, two, three, or four of the FRs in one row of FIG . 4).
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VH CDRl, wherein the VH CDRl comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9-16.
  • the antibody or antigen binding molecule comprises a VH CDRl, wherein the VH CDRl comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 215-222.
  • the antibody or antigen binding molecule comprises a VH CDR2, wherein the VH CDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 25-32.
  • the antibody or antigen binding molecule comprises a VH CDR2, wherein the VH CDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 231-238. In some embodiments, the antibody or antigen binding molecule comprises a VH CDR3, wherein the VH CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 41-48. In some embodiments, the antibody or antigen binding molecule comprises a VH CDR3, wherein the VH CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 247-254.
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VH CDRl, a VH CDR2, and VH CDR3, wherein the VH CDRl , VH CDR2, and VH CDR3 comprise the amino acid sequence of the VH CDRl , VH CDR2, and VH CDR3 of an antibody in FIG. 1 A or FIG. I B, respectively,
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VL CDRl , wherein the VL CDRl comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 81-88.
  • the antibody or antigen binding molecule comprises a VL CDR2, wherein the VL CDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 97-104.
  • the antibody or antigen binding molecule comprises a VL CDR3, wherein the VL CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1 13-120.
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VL CDRl, a VL CDR2, and VL CDR3, wherein the VL CDRl, VL CDR2, and VL CDR3 comprise the amino acid sequence of the VL CDRl, VL CDR2, and VL CDR3 of an antibody in FIG. I C, respectively.
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises a VH framework region 1 (FRl ), wherein the VH FRl comprises an amino acid sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%>, at least about 96%, at least about 97%, at least about 98%>, at least about 99%, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 1-8 and 207-214.
  • FRl VH framework region 1
  • the antibody or antigen binding molecule comprises a VH FR2, wherein the VH FR2 comprises an amino acid sequence at least about 75%, at least about 80%), at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%>, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 17-24 and 223-23.
  • the antibody or antigen binding molecule comprises a VH FR3, wherein the VH FR3 comprises an amino acid sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 33-40 and 239-246.
  • the antibody or antigen binding molecule comprises a VH FR4, wherein the VH FR4 comprises an amino acid sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 49-56 and 255-262.
  • the antibody or antigen binding molecule or a fragment thereof comprises a VL FRl, wherein the VL FRl comprises an amino acid sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 73-80.
  • the antibody or antigen binding molecule or a fragment thereof comprises a VL FR2, wherein the VL FR2 comprises an amino acid sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or i0Q% identical to an amino acid sequence selected from SEQ ID NOs: 89-96.
  • the antibody or antigen binding molecule or a fragment thereof comprises a VL FR3, wherein the VL FR3 comprises an amino acid sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 105-1 12.
  • the antibody or antigen binding molecule or a fragment thereof comprises a VL FR4, wherein the VL FR4 comprises an amino acid sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%>, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 121-128.
  • the polynucleotide encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule comprises any one, two, and/or three VH CDR sequences disclosed herein.
  • the antibody or antigen binding molecule comprises a VH CDRl, a VH CDR2, and a VH CDR3 having the amino acid sequence of any VH CDRl , VH CDR2, and VH CDR3 disclosed herein, respectively.
  • the antibody or antigen binding molecule comprises any one, two, and/or three VL CDR sequences disclosed herein.
  • the antibody or antigen binding molecule comprises a VL CDRl, a VL CDR2, and a VL CDR3 having the amino acid sequence of any VL CDRl, VL CDR2, and VL CDR3 disclosed herein, respectively.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 9; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 25; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 41; (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 81; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 97, and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 113.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 10; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 26; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 42; (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 82; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 98; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 114.
  • the antibody or antigen binding molecule comprises:(a) a
  • VH CDRl region comprising the amino acid sequence of SEQ ID NO: 11 ;
  • a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 27;
  • a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 43;
  • a VL CDR1 region comprising the amino acid sequence of SEQ ID NO: 83;
  • a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 99;
  • VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 1 15.
  • the antibody or antigen binding molecule comprises: (a) a VH CDR1 region comprising the amino acid sequence of SEQ ID NO: 12; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 28; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 44; (d) a VL CDR1 region comprising the amino acid sequence of SEQ ID NO: 84; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 100; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ K) NO: 116.
  • the antibody or antigen binding molecule comprises: (a) a VH CDR1 region comprising the amino acid sequence of SEQ E) NO: 13; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 29, (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 45; (d) a VL CDR1 region comprising the amino acid sequence of SEQ ID NO: 85; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 101; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 117.
  • the antibody or antigen binding molecule comprises: (a) a VH CDR1 region comprising the amino acid sequence of SEQ ID NO: 14; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 30; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 46; (d) a VL CDR1 region comprising the amino acid sequence of SEQ ID NO: 86; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 102; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 1 18.
  • the antibody or antigen binding molecule comprises: (a) a VH CDR1 region comprising the amino acid sequence of SEQ ID NO: 15; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 31; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 47; (d) a VL CDR1 region comprising the amino acid sequence of SEQ ID NO: 87; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 103; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 119.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 16; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 32; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 48; (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 88; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 104; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 120,
  • the antibody or antigen binding molecule comprises: (a) a VH CD 1 region comprising the amino acid sequence of SEQ ID NO : 215 ; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 231 ; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 247, (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 81; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 97; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 113.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 216; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 232; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 248; (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 82; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 98; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 114.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 217; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 233; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 249, (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 83; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 99, and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 115.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO:218; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 234, (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 250; (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 84; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 100; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 116.
  • the antibody or antigen binding molecule comprises: (a) a VH CDR1 region comprising the amino acid sequence of SEQ ID NO: 219; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 235, (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 251; (d) a VL CDR1 region comprising the amino acid sequence of SEQ ID NO: 85; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 101; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 1 17.
  • the antibody or antigen binding molecule comprises: (a) a VH CDR1 region comprising the amino acid sequence of SEQ ID NO: 220; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 236; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 252; (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 86; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 102; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 1 18.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 221 ; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 237; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 253, (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 87; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 103; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 119.
  • the antibody or antigen binding molecule comprises: (a) a VH CDRl region comprising the amino acid sequence of SEQ ID NO: 222; (b) a VH CDR2 region comprising the amino acid sequence of SEQ ID NO: 238; (c) a VH CDR3 region comprising the amino acid sequence of SEQ ID NO: 254; (d) a VL CDRl region comprising the amino acid sequence of SEQ ID NO: 88; (e) a VL CDR2 region comprising the amino acid sequence of SEQ ID NO: 104; and (f) a VL CDR3 region comprising the amino acid sequence of SEQ ID NO: 120.
  • the antibody or antigen binding molecule comprises a heavy chain variable region sequence comprising an amino acid sequence of FIG. 1 A or FIG. IB. In some embodiments, the antibody or antigen binding molecule comprises a heavy chain variable region sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 65-72. In some embodiments, the antibody or antigen binding molecule comprises a light chain variable region sequence comprising an amino acid sequence selected from FIG. 1C. In some embodiments, the antibody or antigen binding molecule comprises a light chain variable region sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 137-144.
  • the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 65; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO 137.
  • the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 66; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 138.
  • the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 67; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 139.
  • the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 68; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 140, [0246] In some embodiments, the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 69; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 141.
  • the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ) ID NO: 70; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 142.
  • the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 71; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 143, [0249] In some embodiments, the antibody or antigen binding molecule comprises (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 72; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 144.
  • the polynucleotide of the present invention comprises a nucleotide sequence at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%>, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a nucleotide sequence selected form the group consisting of SEQ ID NOs: 57-64.
  • the polynucleotide of the present invention comprises a nucleotide sequence at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a nucleotide sequence selected form the group consisting of SEQ ID NOs: 129-136.
  • the antibody or antigen binding molecule encoded by the polypeptide of the present invention can be single chained or double chained.
  • the antibody or antigen binding molecule comprises is single chained.
  • the antigen binding molecule is selected from the group consisting of an scFv, an Fab, an Fab', an Fv, an F(ab')2, a dAb, and any combination thereof.
  • the antibody or antigen binding molecule comprises an scFv.
  • the antibody or antigen binding molecule comprises a single chain, wherein the heavy chain variable region and the light chain variable region are connected by a linker.
  • the VH is located at the N terminus of the linker and the VL is located at the C terminus of the linker. In other embodiments, the VL is located at the N terminus of the linker and the VH is located at the C terminus of the linker.
  • the linker comprises at least about 5, at least about 8, at least about 10, at least about 13, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 amino acids. In some embodiments, the linker comprises at least about 18 amino acids.
  • the linker comprises an amino acid sequence that is at least about 75%, at least about 85%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the amino acid sequence GSTSGSGKPGSGEGSTKG (SEQ ID NO: 174) or a poly-Gly linker such as the amino acid sequence GGGGS GGGGS GGGGS (SEQ ID NO: 268). Or GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 41 1).
  • the linker is a Whitlow linker.
  • the antibody or antigen binding molecule comprises a single chain, wherein the heavy chain variable region and the light chain variable region are connected by a linker, wherein the linker comprises the amino acid sequence of SEQ ID NO: 174.
  • the antibody or antigen binding molecules of the present invention specifically bind BCMA ⁇ e.g., hBCMA), In certain embodiments, an anti- BCMA antibody or antigen binding molecule of the present invention binds human BCMA with a KD of less than 1 x 10 "6 M, less than 1 x 10 "7 M, less than 1 x 10 '8 M, or less than 1 x 10 "9 M.
  • the anti-BCMA antibody or antigen binding molecules binds human BCMA with a KD of less than I x 10 "7 M. In another embodiment, the anti- BCMA antibody or antigen binding molecules binds human BCMA with a KD of less than 1 x 10 "8 M.
  • the anti-BCMA antibody or antigen binding molecules binds human BCMA with a KD of about 1 x 10 "7 M, about 2 x 10 "7 M, about 3 x 10 "7 M, about 4 x 10 "7 M, about 5 x 10 "7 M, about 6 x 10 "” ⁇ 1, about 7 x 10 "7 M, about 8 x 10 "7 M, about 9 x lO "7 M, about I x 10 "8 M, about 2 x 10 '8 M, about 3 x !0 '8 M, about 4 x 10 "8 M, about 5 x I0 "8 M, about 6 x 10 "8 M, about 7 x 10 "8 M, about 8 x 10 "8 M, about 9 x 10 "8 M, about 1 x 10 "9 M, about 2 x 10 "9 M, about 3 x 10 "9 M, about 4 x 10 "9 M, about 5 x 10 "9 M, about 6 x 10 "9 M, about 6 x 10 “9
  • the KD is calculated as the quotient of koir/kon, and the k on and k 0 ff are determined using a monovalent antibody, such as a Fab fragment, as measured by, e.g., BIAcore ® surface plasmon resonance technology.
  • the D IS calculated as the quotient of k 0 ff/k 0 n, and the k oa and k 0 ff are determined using a bivalent antibody, such as a Fab fragment, as measured by, e.g., BIAcore ® surface plasmon resonance technology.
  • the anti-BCMA antibody or antigen binding molecule binds human BCMA-Fc with a D of less than 1 x i O "'' ' M. less than 3 x 10 '9 M, less than 5 x lO "9 M, less than I x 10 '10 M, less than 3 x 10 -10 M, or less than 5 x !0 '10 M.
  • the anti-BCMA antibody or antigen binding molecules binds cyno BCMA-Fc with a K D of less than 1 x 10 '5 M, less than 1 x 10 "6 M, less than 1 x 10 "7 M, less than 1 x 10 " M:, less than 1 x 10 "9 M, or less than 1 x 10 "10 M.
  • the anti-BCMA antibody or antigen binding molecule binds human BCMA with an association rate (kon) of less than 1 x 10 "4 M “1 s “1 , less than 2 x 10 "4 M- 1 s “1 , less than 3 x 10 "4 M “1 s '1 , less than 4 x 1Q "4 M “j s “1 , less than 5 x 10 "4 M “1 s “1 , less than 6 x I Q "4 M '1 s “1 , less than 7 x lO "4 M “1 s "1 , less than 8 x UT 4 M -1 s '1 , less than 9 x 10 "4 M “ 1 s ' less than 1 x 1Q "5 M '1 s ' less than 2 x 10 "5 M '1 s “1 , less than 3 x 10 "5 M '1 s “1 , less than 4 x lO "
  • the k 0 n is determined using a monovalent antibody, such as a Fab fragment, as measured by, e.g., BIAcore ® surface pi asm on resonance technology.
  • the k on is determined using a bivalent antibody as measured by, e.g., BIAcore : surface plasmon resonance technology,
  • the anti-BCMA antibody or antigen binding molecule binds human BCMA with an dissociation rate (koff) of less than 1 x 10 "2 s “1 , less than 2 x !0 "2 s "1 , less than 3 x 10 '2 s "1 , less than 4 x 10 "2 s "!
  • the k 0 ff is determined using a monovalent antibody, such as a Fab fragment, as measured by, e.g., BIAcore ® surface plasmon resonance technology.
  • the k 0 ff is determined using a bivalent antibody as measured by, e.g., BIAcore ® surface plasmon resonance technology.
  • the polynucleotide of the present invention encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule cross competes with a reference antibody disclosed herein.
  • the antibody or antigen binding molecule cross competes with a reference antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 -56, 65-128, and 137-144.
  • the antibody or antigen binding molecule cross competes with a reference antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 65-72 and 137-144.
  • the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VH CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 9-16. In certain embodiments, the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VH CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 25-32. In certain embodiments, the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VH CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 41-48.
  • the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VL CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89-96. In certain embodiments, the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VL CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 105- 112. In certain embodiments, the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VL CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 121-128.
  • the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 65-72. In another embodiment, the antibody or antigen binding molecule cross competes with a reference antibody, wherein the reference antibody comprises a VL comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 137-144.
  • the polynucleotide of the present invention encodes an antibody or antigen binding molecule that specifically binds to BCMA, wherein the antibody or antigen binding molecule binds the same or an overlapping epitope as a reference antibody disclosed herein (e.g., Figure 1).
  • the antibody or antigen binding molecule binds the same or an overlapping epitope as a reference antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-56, 65-128, and 137-144.
  • the antibody or antigen binding molecule binds the same or an overlapping epitope as a reference antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 65-72 and 137-144.
  • the present invention is also directed to polynucleotides encoding chimeric antigen receptors (CARs) or T cell receptors (TCRs) comprising an antigen binding molecule that specifically binds to BCMA described in Section II, and engineered T cells comprising an antigen binding molecule that specifically binds to BCMA described in Section I I.
  • an anti-BCMA CAR or TCR encoded by the polynucleotide of the present invention comprises an antigen binding molecule that specifically binds to BCMA
  • the anti-BCMA CAR or TCR encoded by the polynucleotide further comprises a costimulatory domain.
  • the costimulatory domain in the anti-BCMA CAR or TCR encoded by the polynucleotide comprises an extracellular domain (i.e., a hinge region), a tra smembrane domain, and/or an intracellular (signaling) domain.
  • the anti-BCMA CAR or TCR encoded by the polynucleotide further comprises a CD3 zeta activating domain.
  • the anti-BCMA CAR or TCR encoded by the polynucleotide comprises an antigen binding molecule that specifically binds BCMA. (e.g., hBCMA), a costimulatory domain comprising an extracellular domain, a transmembrane domain, and an intracellular domain, and a CD3 zeta activating domain.
  • the polynucleotide of the present invention encodes a
  • the TCR comprises an antigen binding molecule that specifically binds to BCMA, and wherein the TCR further comprises a fourth complementarity determining region (CDR4).
  • the polynucleotide encodes a TCR, wherein the TCR comprises an antigen binding molecule that specifically binds to BCMA, and a constant region.
  • the constant region is selected from a constant region of IgGl , IgG2, IgG3, IgG4, IgA, IgD, IgE, and IgM.
  • the polynucl eotide of the present invention encodes a
  • the CAR comprises an antigen binding molecule that specifically binds to BCMA (one or more antigen binding molecules in Section II), and wherein the CAR further comprises a costimulatory domain.
  • the costimulatory domain is positioned between the antigen binding molecule and an activating domain.
  • the costimulatory domain can comprise an extracellular domain, a transmembrane domain, and an intracellular signaling domain.
  • Extracellular Domain comprises a hinge region (e.g., a spacer region).
  • the extracellular domain is from or derived from (e.g., comprises) CD28, CD28T, OX40, 4-1BB/CD137, CD2, CD3 (alpha, beta, delta, epsilon, gamma, zeta), CD4, CDS, CD7, CDS, CD9, CD 16, CD22, CD27, CD30, CD 33, CD37, CD40, CD 45, CD64, CD80, CD86, CD134, CDI37, CD154, programmed death -1 (PD-1), ICOS, April, BAFF, lymphocyte function-associated antigen- 1 (LFA-1 (CD1 la/CD 18), CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamiiy member 14, TNFSF14), NK.G2C, Ig alpha (CD79a), DAP-10, Fc
  • the extracellular domain in the costimulatory domain is positioned between the antigen binding molecule and the transmembrane domain.
  • the extracellular domain in the costimulatory domain is from or derived from an immunoglobulin.
  • the extracellular domain in the costimulatory domain is selected from the hinge regions of IgGl, IgG2, IgG3, IgG4, IgA, IgD, IgE, and IgM, or a fragment thereof.
  • the extracellular domain in the costimulatory domain is from or derived from the hinge region of CDS alpha. In one particular embodiment, the extracellular domain in the costimulatory domain is from or derived from the hinge region of CD28.
  • the extracellular domain in the costimulatory domain compri ses a fragment of the hinge region of CD8 alpha or a fragment of the hinge region of CD28, wherein the fragment is anything less than the whole hinge region.
  • the fragment of the CD8 alpha hinge region or the fragment of the CD28 hinge region comprises an amino acid sequence that excludes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 amino acids at the N-terminus or C-Terminus, or both, of the CDS alpha hinge region of the CD28 hinge region.
  • the extracellular domain in the costimulatory domain comprises an amino acid sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the amino acid sequence LDNEKSNGTIIHVKGKHLCPSPLFPGPSKP (SEQ ID NO: 167) or a fragment thereof.
  • the extracellular domain in the costimulatory domain comprises the amino acid sequence of SEQ ID NO: 167 or a fragment thereof.
  • the extracellular domain in the costimulatory domain is encoded by a nucleotide sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the nucleotide sequence CTTGATAATGAAAAGTCAAACGGAACAATCATT
  • the extracellular domain in the costimulator domain is encoded by a nucleotide sequence that compri ses the nucleotide sequence of SEQ ID NO: 166 or a fragment thereof.
  • the CD28T domain is derived from a human CD28 hinge region. In other embodiments, the CD28T domain is derived from a rodent, murine, or primate (e.g., non-human primate) CD28 hinge region. In some embodiments, the CD28T domain is derived from a chimeric CD28 hinge region.
  • the extracellular domain comprises some or ail of a member of the immunoglobulin family such as IgGl, IgG2, IgG3, IgG4, IgA, IgD, IgE, IgM, or fragment thereof,
  • the costimulatory domain for the CAR or TCR of the invention can further comprise a tra smembrane domain.
  • the transmembrane domain can be designed to be fused to the extracellular domain in the costimulatory domain. It can similarly be fused to the intracellular domain in the costimulatory domain.
  • the transmembrane domain that naturally is associated with one of the domains in a CAR is used.
  • the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
  • the transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain can be derived from any membra e-bound or transmembrane protein.
  • the transmembrane domain is derived from CD28, OX-40, 4-1BB/CD137, CD2, CDS (alpha, beta, delta, epsilon, zeta), CD4, CD 5, CD7, CD 8, CD9, CD16, CD22, CD27, CD30, CD 33, CD37, CD40, CD 45, CD64, CD80, CD86, CD134, CD137, CD154, programmed death- 1 (PD-l), ICOS, lymphocyte function-associated antigen- 1. (LFA-1 (CD!
  • CD3 gamma CD247, CD276 (B7-H3), LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), N G2C, Ig alpha (CD79a), DAP- 10, Fc gamma receptor, MHC class I molecule, TNFr, integrin, signaling lymphocytic activation molecule, BTLA, Toll iigand receptor, ICAM-1, B7-H3, CDS, ICAM-1, GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, N p80 (KLRF1), NK.p44, N p30, p46, CD19, CD4, CDSalpha, CDSbeta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDl
  • a short oligo or polypeptide linker preferably between 2 and 10 amino acids in length may form the linkage between the transmembrane domain and the cytoplasmic signaling domain of the CAR.
  • a glycine-serine doublet provides a particularly suitable linker.
  • the transmembrane domain in the CAR of the invention comprises the CDS transmembrane domain.
  • the CDS transmembrane domain comprises the transmembrane portion of the nucleic acid sequence of GCTGCAGCATTGAGCAACTCAATAATGTATTTTAGTCACTTTGTACCAGTGTTCT TGCCGGCTAAGCCTACTACCACACCCGCTCCACGGCCACCTACCCCAGCTCCTA CCATCGCTTCACAGCCTCTGTCCCTGCGCCCAGAGGCTTGCCGACCGGCCGCAG GGGGCTGTTCATACCAGAGGACTGGATTTCGCCTGCGATATCTATATCTGGG CACCCCTGGCCGGAACCTGCGGCGTACTCCTGCTGTCCCTGGTCATCACGCTCTCT ATTGTAATCACAGGAAC (SEQ ID NO: 269).
  • the CDS transmembrane domain comprises the nucleic acid sequence that encodes the transmembrane amino acid sequence contained within
  • the transmembrane domain in the costimulating domain is a CD28 transmembrane domain.
  • the transmembrane domain comprises an amino acid sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%>, at least about 99%>, or 100% identical to the amino acid sequence FWVLVVVGGVLACYSLLVTVAFIIFWV (SEQ ID NO: 169).
  • the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 169.
  • the transmembrane domain is encoded by a nucleotide sequence at least about 75%, at least about 80%>, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%>, at least about 99%, or 100% identical to the nucleotide sequence TTCTGGGTGTTGGTCGTAGTGGGTGGAGTCCTCGCTTGTTACTCTCTGCTCGTCA CCGTGGCTTTTATAATCTTCTGGGTT (SEQ ID NO: 168).
  • the transmembrane domain is encoded by a nucleotide sequence that comprises the nucleotide sequence of SEQ ID NO: 168,
  • Intracellular (signaling) Domain The intracellular (signaling) domain of the engineered T cells of the invention can provide signaling to an activating domain, which then activates at least one of the normal effector functions of the immune cell. Effector function of a T cell, for example, can be cytolytic activity or helper activity including the secretion of cytokines.
  • suitable intracellular signaling domain include ⁇ i.e., comprise), but are not limited to CD28, CD28T, OX-40, 4-1BB/CD137, CD2, CD7, CD27, CD30, CD40, programmed death-1 (PD-1), inducible T cell costimulator (ICOS), lymphocyte function-associated antigen- 1 (LFA-1, CDl-la/CD18), CD3 gamma, CDS delta, CD3 epsilon, CD247, CD276 (B7-H3), LIGHT, (TNFSF ' 14), NKG2C, Ig alpha (CD79a), DAP- 10, Fc gamma receptor, MHC class 1 molecule, TNF receptor proteins, an Immunoglobulin protein, cytokine receptor, integrins, Signaling Lymphocytic Activation Molecules (SLAM proteins), activating NK cell receptors, BTLA, a Toll ligand receptor, ICAM-1, B7-
  • nucleotide sequence encoding the intracellular signaling domain is set forth in SEQ ID NO. 170:
  • the polynucleotide encoding an intracellular signaling domain within a costimulatory domain comprises a nucleotide sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%>, at least about 99%, or about 100% identical to the nucleotide sequence of SEQ ID NO: 170.
  • An example of an intracellular signaling domain is set forth in SEQ ID NO.
  • the intracellular signaling domain within a costimulatory domain comprises an amino acid sequence at least about 80%, at least about 85%t, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100%o identical to the amino acid sequence of SEQ ID NO: 171.
  • the intracellular signaling sequences within the CAR of the invention can be linked to each other or to an activating domain in a random or specified order.
  • a short oligo- or polypeptide linker preferably between 2 and 10 amino acids in length may form the linkage.
  • a glycine-serine doublet provides a particularly suitable linker.
  • costimulatory regions described herein can be expressed in a separate chain from the antigen binding molecule (e.g., scFv) and activating domains, in so-called "trans" configuration.
  • intracellular domains for use in the engineered T cell of the invention include cytoplasmic sequences of the T ceil receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen/receptor engagement, as well as any derivative or variant of these sequences and any synthetic sequence that has the same functional capability.
  • CD3 is an element of the T cell receptor on native T cells, and has been shown to be an important intracellular activating element in CARs.
  • the activating domain is CD3, e.g., CD3 zeta, the nucleotide sequence of which is set forth in SEQ ID NO. 172:
  • the polynucleotide encoding an activating domain comprises a nucleotide sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the nucleotide sequence of SEQ ID NO: 172.
  • the activating domain comprises an amino acid sequence at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the amino acid sequence of SEQ ID NO: 173.
  • the activating domain comprises an amino acid sequence at least about 70%, at least about 75%, at least about 80%>, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the amino acid sequence of a CD3 zeta variant as set forth in SEQ ID NO: 412:
  • the polynucleotide of the present invention encodes a
  • the CAR or the TCR comprises an antigen binding molecule that specifically binds to BCMA, and wherein the CAR or the TCR further comprises a leader peptide (also referred to herein as a "signal peptide").
  • the leader peptide comprises an amino acid sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the amino acid sequence MALPVTALLLPLALLLHAARP (SEQ ID NO: 165).
  • the signal peptide comprises the amino acid sequence of SEQ ID NO: 165.
  • the leader peptide is encoded by a nucleotide sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%>, at least about 98%, at least about 99%, or about 100% identical to SEQ ID NO: 164.
  • the polynucleotide of the present invention encodes a
  • the CAR comprises a leader peptide (P), an antigen binding molecule (B), a hinge domain (H), a transmembrane domain (T), a costimulaiory region (C), and an activation domain (A), wherein the CAR is configured according to the following: P-B-H-T-C-A.
  • the antigen binding molecule comprises a VH and a VL, wherein the CAR is configured according to the following: P-VH-VL-H-T-C-A or P-VL-VH-H-T-C-A.
  • the VH and the VL are connected by a linker (L), wherein the anti- BCMA CAR is configured according to the following, from N-terminus to C-terminus: P- VH-L-VL-H-T-C-A or P-VH-L-VL-H-T-C-A.
  • L linker
  • the polynucleotide of the present invention encodes a
  • the polynucleotide of the present invention encodes a CAR, wherein the CAR comprises an amino acid sequence selected from Table 2.
  • the polynucleotide of the present invention encodes a
  • the CAR comprises an amino acid sequence at least about 75%, at least about 85%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, and 206.
  • the CAR comprises an amino acid sequence selected from the group consisting of SEQ ED NOs: 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, and 206.
  • the CAR comprises the amino acid sequence of SEQ ID NO: 176.
  • the CAR comprises the amino acid sequence of SEQ ID NO: 178.
  • the CAR comprises the amino acid sequence of SEQ ID NO: 180,
  • the CAR comprises the amino acid sequence of SEQ ID NO: 182.
  • the CAR comprises the amino acid sequence of SEQ ID NO: 184.
  • the CAR comprises the amino acid sequence of SEQ ID NO: 186. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 188. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 190. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 192. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 194. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 196. In another embodiment, the CAR comprises the amino acid sequence of S EQ ID NO: 198, In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 200. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 202. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 204. In another embodiment, the CAR comprises the amino acid sequence of SEQ ID NO: 206.
  • the polynucleotide of the present invention comprises an nucleotide sequence at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 85%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, and 205.
  • the polynucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, and 205.
  • the poiynucleotide comprises the nucleotide sequence of SEQ ID NO: 175.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 177.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 179.
  • the poiynucleotide comprises the nucleotide sequence of SEQ ID NO: 181.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 183.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 185.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 187.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 189.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 191.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 193. In another embodiment, the polynucleotide comprises the nucleotide sequence of SEQ) ID NO: 195. In another embodiment, the poiynucleotide comprises the nucleotide sequence of SEQ ID NO: 197. In another embodiment, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 199. In another embodiment, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 201. In another embodiment, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 203. In another embodiment, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 205.
  • the invention relates to Clone FS-26528 HC DNA
  • the invention relates to the Clone FS-26528 HC amino acid sequence (SEQ ID NO: 272):
  • the invention relates to HC CDR1 thereof:
  • the invention relates to HC CDR2 thereof: AISDAGDRTYYADSVRG (SEQ ID NO: 274).
  • the invention relates to HC CDR3 thereof: ARAEMGAVFDI (SEQ ID NO: 275) [HC CDR3]
  • the invention relates to Clone FS-26528 LC DNA
  • the invention relates to Clone FS-26528 LC AA sequence (SEQ ID NO: 277):
  • the invention relates to LC CDR1 thereof:
  • RASQSVSRYLA (SEQ ID NO: 278).
  • the invention relates to LC CDR2 thereof: DASNRAT (SEQ ID NO: 279).
  • the invention relates to the LC CDR3 thereof: QQRISWPFT (SEQ ID NO: 280).
  • the invention relates to Clone FS-26528 CAR DN A
  • HxL (SEQ ID NO: 281):
  • the invention relates to Clone FS-26528 CAR HxL
  • the invention relates to Clone FS-26528 CAR DNA
  • the invention relates to the Clone FS-26528 CAR
  • the invention relates to Clone PC-26534 HC DNA
  • the invention relates to Clone PC-26534 HC (SEQ ID NO:
  • the invention relates to HC CDR1 thereof:
  • the invention relates to HC CDR2 thereof: AIS YDGRNKHY AD SVKG (SEQ ID NO: 288). In further embodiments, the invention relates to HC CDR3 thereof: ARDGTYLGGLWYFDL (SEQ ID NO: 289).
  • the invention relates to Clone PC-26534 LC DNA
  • the invention relates to Clone PC-26534 LC AA sequence (SEQ ID NO: 291):
  • the invention relates to LC CDR1 AA sequence thereof: RS SQ SLLHSNG YN YLD (SEQ ID NO: 292). In further embodiments, the invention relates to LC CDR2 thereof: LGSNRAS (SEQ ID NO: 293). In further embodiments, the invention relates to LC CDR3 thereof: MQGLGLPLT (SEQ ID NO: 294).
  • the invention relates to Clone PC-26534 CAR DNA
  • HxL (SEQ ID NO: 295) as follows: ATGGCACTCCCCGTAACTGCTCTGCTGCTGCCGTTGGCATTGCTCCTGCA
  • the invention relates to Clone PC-26534 CAR HxL
  • the invention relates to Clone PC-26534 CAR DNA
  • the invention relates to Clone PC-26534 CAR LxH chain sequences (SEQ ID NO: 298):
  • the invention relates to Clone AJ-26545 HC DNA
  • the invention relates to Clone AJ-26545 HC AA sequence (SEQ ID NO: 300):
  • the invention relates to HC CDR1 thereof:
  • the invention relates to HC CDR2 thereof: VIGPSGGKTSYAQKFQG (SEQ ID NO: 302). In further embodiments, the invention relates to HC CDR3 thereof: ARESWPMDV (SEQ ID NO: 303),
  • the invention relates to Clone AJ-26545 LC DNA
  • the invention relates to Clone AJ-26545 LC AA sequence (SEQ ID NO: 305):
  • the invention relates to LC CDR1 thereof:
  • RASQSVSSNLA (SEQ ID NO: 306).
  • the invention relates to LC CDR2 thereof: GASTRAT (SEQ ID NO: 307).
  • the invention relates to the LC CDR3 thereof: QQYAAYPT (SEQ ID NO: 308),
  • the invention relates to Clone AJ-26545 CAR DNA
  • HxL (SEQ ID NO: 309):
  • ATGGCACTCCCCGTAACTGCTCTGCTGCTGCCGTTGGCATTGCTCCTGCA CGCCGCACGCCCGCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAG AAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAGGGCATCTGGATACACCT TCATGGAGCACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCT TGAGTGGATGGGAGTAATCGGGCCTAGTGGTGGTAAGACAAGCTACGCA
  • the invention relates to Clone AJ-26545 CAR HxL
  • the invention relates to Clone AJ-26545 CAR DNA
  • the invention relates to Clone AJ-26545 CAR LxH
  • the invention relates to Clone AJ-26554 HC DNA
  • the invention relates to Clone AJ-26554 HC (SEQ ID NO:
  • the invention relates to HC CDR1 thereof:
  • YTFTEHYMH (SEQ ID NO: 315).
  • the invention relates to HC CDR2 thereof: VIGPSGGKTSYAQKFQG (SEQ ID NO: 316).
  • the invention relates to HC CDR3 thereof: ARESWPMDV (SEQ ID NO: 317).
  • the invention relates to Clone AJ-26554 LC DNA
  • the invention relates to Clone AJ-26554 LC AA sequence (SEQ ID NO: 319): EIVMTQSPAT LSVSPGERAT LSCRASQSVS SNLAWYOOKP GQAPRLLIYG ASTRATGIPA RFSGSGSGTE FTLTISSLQS EDFAVYYCQjQ YAAYPTFGGG TKVEIKR.
  • the invention relates to the LC CDRl thereof:
  • RASQSVSSNLA (SEQ ID NO: 320).
  • the invention relates to the LC CDR2 thereof: GASTRAT (SEQ ID NO: 321).
  • the invention relates to LC CDR3 thereof: QQYAAYPT (SEQ ID NO: 322).
  • the invention relates to Clone AJ-26554 CAR DNA
  • HxL (SEQ ID NO: 323):
  • the invention relates to Clone AJ-26554 CAR HxL
  • the invention relates to Clone AJ-26554 CAR LxH
  • the invention relates to Clone NM-26562 HC DNA
  • the invention relates to Clone NM-26562 HC AA sequence (SEQ ID NO: 328): QVQLQESGPG LV PSQTLSL TCTVSGGSIG SGGSYWSWIR QHPGKGLEWI GLIYYDGSTY YNPSLKSRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCARG RGYETSLAFD IWGQGTMVTV SS.
  • the invention relates to HC CDR1 thereof:
  • the invention relates to HC CDR2 thereof: LIYYDGS T Y YNP S LK S (SEQ ID NO: 330). In further embodiments, the invention relates to HC CDR3 thereof: ARGRGYETSLAFDI (SEQ ID NO: 331).
  • the invention relates to Clone NM-26562 LC DNA
  • the invention relates to Clone NM-26562 LC AA sequence (SEQ ID NO: 333):
  • the invention relates to LC CDR1 AA sequence thereof: RASQSVSSYLA (SEQ ID NO: 334) In further embodiments, the invention relates to LC CDR2 AA sequence thereof: DASNRAT (SEQ ID NO: 335). In further embodiments, the invention relates to LC CDR3 A A sequence thereof: QQRHVWPPT (SEQ ID NO: 336) (LC CDR3).
  • the invention relates to Clone NM-26562 CAR DNA
  • HxL (SEQ ID NO: 337):
  • the invention relates to Clone NM-26562 CAR HxL
  • the invention relates to Clone NM-26562 CAR DNA
  • LxH (SEQ ID NO: 339): ATGGCACTCCCCGTAACTGCTCTGCTGCTGCCGTTGGCATTGCTCCTGCA
  • the invention relates to Clone NM-26562 CAR LxH
  • the invention relates to Clone TS-26564 HC DNA sequence (SEQ ID NO: 341):
  • the invention relates to Clone TS-26564 HC AA sequence (SEQ ID NO: 342): EVQLVESGGG LVQPGGSLRL SCAASGFTFS SYSMNWVRQA PGKGLEWVST ISSSSSIIYY ⁇ ADSVKGRFTI SRDNAKNSLY LQMNSLRAED TAVYYCARGS OEHLIFDYWG QGTLVTVSS
  • the invention relates to HC CDR1 AA sequence thereof: FTFSSYSMN (SEQ ID NO: 343).
  • the invention relates to HC CDR2 AA sequence thereof: TISSSSSITYYADSVKG (SEQ ID NO: 344).
  • the invention relates to HC CDR3 AA sequence thereof: ARGSQEHLIFDY (SEQ ID NO: 345).
  • the invention relates to Clone TS-26564 LC DNA
  • the invention relates to Clone TS-26564 LC AA sequence (SEQ ID NO: 347):
  • the invention relates to LC CDR1 AA sequence thereof: RASQSVSRYLA (SEQ) ID NO: 348). In further embodiments, the invention relates to LC CDR2 AA sequence thereof: DASNRAT (SEQ ID NO: 349). In further embodiments, the invention relates to LC CDR3 AA sequence thereof: QQRFYYPWT (SEQ ID NO: 350).
  • the invention relates to Clone TS-26564 CAR DNA
  • HxL (SEQ ID NO: 351):
  • the invention relates to Clone TS-26564 CAR HxL
  • the invention relates to Clone TS-26564 CAR DNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2017/025516 2016-04-01 2017-03-31 Bcma binding molecules and methods of use thereof Ceased WO2017173349A1 (en)

Priority Applications (22)

Application Number Priority Date Filing Date Title
CR20180462A CR20180462A (es) 2016-04-01 2017-03-31 Moleculas de unión a bcma y metodos de uso de las mismas
EA201891966A EA201891966A1 (ru) 2016-04-01 2017-03-31 Молекулы, связывающие bcma, и способы их применения
KR1020187031269A KR102397674B1 (ko) 2016-04-01 2017-03-31 Bcma 결합 분자 및 그의 사용 방법
CN201780030900.2A CN109414455B (zh) 2016-04-01 2017-03-31 Bcma结合分子及其使用方法
EP17776833.0A EP3436036A4 (en) 2016-04-01 2017-03-31 BCMA BINDING MOLECULES AND METHODS OF USE THEREOF
KR1020237012515A KR102591930B1 (ko) 2016-04-01 2017-03-31 Bcma 결합 분자 및 그의 사용 방법
SG11201808403SA SG11201808403SA (en) 2016-04-01 2017-03-31 Bcma binding molecules and methods of use thereof
AU2017240150A AU2017240150C1 (en) 2016-04-01 2017-03-31 BCMA binding molecules and methods of use thereof
CN202310115780.3A CN117903307A (zh) 2016-04-01 2017-03-31 Bcma结合分子及其使用方法
CU2018000120A CU20180120A7 (es) 2016-04-01 2017-03-31 Moléculas de unión a bcma
NZ746700A NZ746700A (en) 2016-04-01 2017-03-31 Bcma binding molecules and methods of use thereof
CN202310108490.6A CN116425876A (zh) 2016-04-01 2017-03-31 Bcma结合分子及其使用方法
JP2018550679A JP7366543B2 (ja) 2016-04-01 2017-03-31 Bcma結合分子及びその使用方法
KR1020227015639A KR102522622B1 (ko) 2016-04-01 2017-03-31 Bcma 결합 분자 및 그의 사용 방법
BR112018070159-9A BR112018070159A2 (pt) 2016-04-01 2017-03-31 moléculas de ligação de bcma e métodos de uso das mesmas
CA3019135A CA3019135A1 (en) 2016-04-01 2017-03-31 Bcma binding molecules and methods of use thereof
IL261942A IL261942A (en) 2016-04-01 2018-09-26 Bcma binding molecules and methods of use thereof
PH12018550164A PH12018550164A1 (en) 2016-04-01 2018-09-27 Bcma binding molecules and methods of use thereof
CONC2018/0010475A CO2018010475A2 (es) 2016-04-01 2018-09-28 Moléculas de unión a bcma y métodos de uso de las mismas
ZA2018/06962A ZA201806962B (en) 2016-04-01 2018-10-18 Bcma binding molecules and methods of use thereof
JP2022019896A JP2022065073A (ja) 2016-04-01 2022-02-10 Bcma結合分子及びその使用方法
AU2022201243A AU2022201243A1 (en) 2016-04-01 2022-02-23 BCMA binding molecules and methods of use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662317334P 2016-04-01 2016-04-01
US62/317,334 2016-04-01

Publications (1)

Publication Number Publication Date
WO2017173349A1 true WO2017173349A1 (en) 2017-10-05

Family

ID=59959188

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/025516 Ceased WO2017173349A1 (en) 2016-04-01 2017-03-31 Bcma binding molecules and methods of use thereof

Country Status (25)

Country Link
US (3) US10689450B2 (https=)
EP (1) EP3436036A4 (https=)
JP (2) JP7366543B2 (https=)
KR (3) KR102397674B1 (https=)
CN (3) CN109414455B (https=)
AR (1) AR108067A1 (https=)
AU (2) AU2017240150C1 (https=)
BR (1) BR112018070159A2 (https=)
CA (1) CA3019135A1 (https=)
CL (1) CL2018002763A1 (https=)
CO (1) CO2018010475A2 (https=)
CR (1) CR20180462A (https=)
CU (1) CU20180120A7 (https=)
DO (1) DOP2018000212A (https=)
EA (1) EA201891966A1 (https=)
EC (1) ECSP18073836A (https=)
IL (1) IL261942A (https=)
MX (1) MX2023007400A (https=)
NZ (1) NZ746700A (https=)
PE (1) PE20190120A1 (https=)
PH (1) PH12018550164A1 (https=)
SG (2) SG10201912515XA (https=)
TW (4) TWI795133B (https=)
WO (1) WO2017173349A1 (https=)
ZA (1) ZA201806962B (https=)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019154313A1 (zh) 2018-02-11 2019-08-15 江苏恒瑞医药股份有限公司 一种分离的嵌合抗原受体以及包含其的修饰t细胞及用途
WO2019161035A1 (en) * 2018-02-14 2019-08-22 Kite Pharma, Inc. Anti-idiotypic antibodies directed to the antigen-binding portion of an bcma-binding molecule
WO2019210280A1 (en) * 2018-04-27 2019-10-31 Casebia Therapeutics Limited Liability Partnership Anti-bcma car-t-cells for plasma cell depletion
WO2020029774A1 (zh) * 2018-08-08 2020-02-13 华夏英泰(北京)生物技术有限公司 一种嵌合t细胞受体star及其应用
US10597456B2 (en) 2016-04-01 2020-03-24 Amgen Inc. Chimeric receptors and methods of use thereof
US10603380B2 (en) 2016-04-01 2020-03-31 Kite Pharma, Inc. Chimeric antigen and T cell receptors and methods of use
US10689450B2 (en) 2016-04-01 2020-06-23 Kite Pharma, Inc BCMA binding molecules and methods of use thereof
WO2020181142A1 (en) * 2019-03-06 2020-09-10 Dana-Farber Cancer Institute, Inc. T cell receptors specific to b-cell maturation antigen for treatment of cancer
CN112272675A (zh) * 2018-02-21 2021-01-26 细胞基因公司 Bcma结合抗体及其用途
WO2021147941A1 (zh) * 2020-01-23 2021-07-29 和铂医药(苏州)有限公司 一种bcma结合蛋白及其制备方法和应用
US11517591B2 (en) 2017-09-01 2022-12-06 Dana-Farber Cancer Institute, Inc. Immunogenic peptides specific to BCMA and TACI antigens
WO2023019398A1 (en) * 2021-08-16 2023-02-23 Utc Therapeutics (Shanghai) Co., Ltd. Bcma targetting antibodies, chimeric antigen receptors, and uses thereof
US12049510B2 (en) 2018-09-27 2024-07-30 Autolus Limited Chimeric antigen receptor
US12150959B2 (en) 2018-07-19 2024-11-26 Regeneron Pharmaceuticals, Inc. Chimeric antigen receptors with BCMA specificity and uses thereof
US12258412B2 (en) 2018-07-19 2025-03-25 Regeneron Pharmaceuticals, Inc. Nucleic acid molecules encoding bispecific anti-BCMA x anti-CD3 antibodies
US12269859B2 (en) 2016-12-02 2025-04-08 Angeles Therapeutics, Inc. Synthetic immune receptors and methods of use thereof
WO2026072709A1 (en) 2024-09-25 2026-04-02 Orna Therapeutics, Inc. Chimeric antigen receptors targeting bcma

Families Citing this family (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108778329B (zh) 2016-02-17 2022-09-16 西雅图基因公司 Bcma抗体和其用以治疗癌症和免疫病症的用途
WO2018175476A1 (en) * 2017-03-20 2018-09-27 Baylor College Of Medicine Transgenic c-mpl provides ligand-dependent co-stimulation and cytokine signals to tcr-engineered cells
EP3622092A4 (en) 2017-05-11 2021-06-23 The Broad Institute, Inc. METHODS AND COMPOSITIONS OF USE OF CD8 + TUMOR-INFILTRATING LYMPHOCYTE SUBTYPES AND GENE SIGNATURES THEREOF
WO2018232195A1 (en) 2017-06-14 2018-12-20 The Broad Institute, Inc. Compositions and methods targeting complement component 3 for inhibiting tumor growth
US12049643B2 (en) 2017-07-14 2024-07-30 The Broad Institute, Inc. Methods and compositions for modulating cytotoxic lymphocyte activity
WO2019070755A1 (en) 2017-10-02 2019-04-11 The Broad Institute, Inc. METHODS AND COMPOSITIONS FOR DETECTING AND MODULATING A GENETIC SIGNATURE OF IMMUNOTHERAPY RESISTANCE IN CANCER
PT3703750T (pt) 2017-11-01 2025-01-17 Memorial Sloan Kettering Cancer Center Recetores de antigénio quimérico específicos para o antigénio de maturação das células b e polinucleótidos codificantes
US11851679B2 (en) 2017-11-01 2023-12-26 Juno Therapeutics, Inc. Method of assessing activity of recombinant antigen receptors
MX2020004568A (es) 2017-11-06 2020-10-05 Juno Therapeutics Inc Combinación de una terapia celular y un inhibidor de gamma secretasa.
WO2019094955A1 (en) 2017-11-13 2019-05-16 The Broad Institute, Inc. Methods and compositions for targeting developmental and oncogenic programs in h3k27m gliomas
EP3710039A4 (en) 2017-11-13 2021-08-04 The Broad Institute, Inc. METHODS AND COMPOSITIONS FOR TREATMENT OF CANCER BY TARGETING THE CLEC2D-KLRB1 PATH
EP3710471A1 (en) 2017-11-16 2020-09-23 Kite Pharma, Inc. Modified chimeric antigen receptors and methods of use
CN119193493A (zh) 2017-12-08 2024-12-27 朱诺治疗学股份有限公司 生产工程化t细胞组合物的过程
US11957695B2 (en) 2018-04-26 2024-04-16 The Broad Institute, Inc. Methods and compositions targeting glucocorticoid signaling for modulating immune responses
WO2019232542A2 (en) 2018-06-01 2019-12-05 Massachusetts Institute Of Technology Methods and compositions for detecting and modulating microenvironment gene signatures from the csf of metastasis patients
US12036240B2 (en) 2018-06-14 2024-07-16 The Broad Institute, Inc. Compositions and methods targeting complement component 3 for inhibiting tumor growth
WO2020058762A1 (en) * 2018-09-20 2020-03-26 Tikcro Technologies Ltd Antibodies specific to ctla-4 and uses thereof
WO2020072700A1 (en) 2018-10-02 2020-04-09 Dana-Farber Cancer Institute, Inc. Hla single allele lines
US20210379057A1 (en) 2018-10-16 2021-12-09 Massachusetts Institute Of Technology Nutlin-3a for use in treating a mycobacterium tuberculosis infection
US20220170097A1 (en) 2018-10-29 2022-06-02 The Broad Institute, Inc. Car t cell transcriptional atlas
MA54078A (fr) 2018-11-01 2021-09-15 Juno Therapeutics Inc Méthodes pour le traitement au moyen de récepteurs antigéniques chimériques spécifiques de l'antigene de maturation des lymphocytes b
US20220062394A1 (en) 2018-12-17 2022-03-03 The Broad Institute, Inc. Methods for identifying neoantigens
EP3670530A1 (en) * 2018-12-18 2020-06-24 Max-Delbrück-Centrum für Molekulare Medizin in der Helmholtz-Gemeinschaft Cd22-specific t cell receptors and adoptive t cell therapy for treatment of b cell malignancies
US11739156B2 (en) 2019-01-06 2023-08-29 The Broad Institute, Inc. Massachusetts Institute of Technology Methods and compositions for overcoming immunosuppression
US20220154282A1 (en) 2019-03-12 2022-05-19 The Broad Institute, Inc. Detection means, compositions and methods for modulating synovial sarcoma cells
EP3942023A1 (en) 2019-03-18 2022-01-26 The Broad Institute, Inc. Compositions and methods for modulating metabolic regulators of t cell pathogenicity
US20220235340A1 (en) 2019-05-20 2022-07-28 The Broad Institute, Inc. Novel crispr-cas systems and uses thereof
SG11202111943UA (en) 2019-07-02 2021-11-29 Hutchinson Fred Cancer Res Recombinant ad35 vectors and related gene therapy improvements
WO2021030627A1 (en) 2019-08-13 2021-02-18 The General Hospital Corporation Methods for predicting outcomes of checkpoint inhibition and treatment thereof
US12421557B2 (en) 2019-08-16 2025-09-23 The Broad Institute, Inc. Methods for predicting outcomes and treating colorectal cancer using a cell atlas
WO2021041922A1 (en) 2019-08-30 2021-03-04 The Broad Institute, Inc. Crispr-associated mu transposase systems
US12297426B2 (en) 2019-10-01 2025-05-13 The Broad Institute, Inc. DNA damage response signature guided rational design of CRISPR-based systems and therapies
US12394502B2 (en) 2019-10-02 2025-08-19 The General Hospital Corporation Method for predicting HLA-binding peptides using protein structural features
US12195725B2 (en) 2019-10-03 2025-01-14 Dana-Farber Cancer Institute, Inc. Compositions and methods for modulating and detecting tissue specific TH17 cell pathogenicity
US11981922B2 (en) 2019-10-03 2024-05-14 Dana-Farber Cancer Institute, Inc. Methods and compositions for the modulation of cell interactions and signaling in the tumor microenvironment
US11793787B2 (en) 2019-10-07 2023-10-24 The Broad Institute, Inc. Methods and compositions for enhancing anti-tumor immunity by targeting steroidogenesis
US11844800B2 (en) 2019-10-30 2023-12-19 Massachusetts Institute Of Technology Methods and compositions for predicting and preventing relapse of acute lymphoblastic leukemia
CN113045657B (zh) * 2019-12-26 2022-06-07 杭州济元基因科技有限公司 一种人源化抗人bcma单克隆抗体及其car-t细胞
US12165747B2 (en) 2020-01-23 2024-12-10 The Broad Institute, Inc. Molecular spatial mapping of metastatic tumor microenvironment
WO2021231959A1 (en) * 2020-05-15 2021-11-18 Precision Biosciences, Inc. Methods for immunotherapy
EP4281566A1 (en) 2021-01-20 2023-11-29 Coding Bio Limited Methods for high throughput screening of chimeric antigen receptors
GB202100754D0 (en) 2021-01-20 2021-03-03 Coding Bio Ltd Methods for high throughput screening of chimeric antigen receptors
TW202246333A (zh) * 2021-01-20 2022-12-01 大陸商江蘇恆瑞醫藥股份有限公司 特異性結合bcma和cd3的抗原結合分子及其醫藥用途
GB202116514D0 (en) 2021-11-16 2021-12-29 Coding Bio Ltd Computational methods for the design and optimisation of chimeric antigen receptors (cars)
US20240059782A1 (en) * 2022-03-01 2024-02-22 Agilent Technologies, Inc. Anti-human b cell maturation antigen (bcma) antibodies and their use in immunohistochemistry (ihc)
WO2024077256A1 (en) 2022-10-07 2024-04-11 The General Hospital Corporation Methods and compositions for high-throughput discovery ofpeptide-mhc targeting binding proteins
WO2024124044A1 (en) 2022-12-07 2024-06-13 The Brigham And Women’S Hospital, Inc. Compositions and methods targeting sat1 for enhancing anti¬ tumor immunity during tumor progression
WO2025059533A1 (en) 2023-09-13 2025-03-20 The Broad Institute, Inc. Crispr enzymes and systems
WO2025097055A2 (en) 2023-11-02 2025-05-08 The Broad Institute, Inc. Compositions and methods of use of t cells in immunotherapy
WO2025117544A1 (en) 2023-11-29 2025-06-05 The Broad Institute, Inc. Engineered omega guide molecule and iscb compositions, systems, and methods of use thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020164588A1 (en) * 1999-01-29 2002-11-07 The Regents Of The University Of California Determining the functions and interactions of proteins by comparative analysis
US20120227134A1 (en) * 2009-11-17 2012-09-06 Basf Plant Science Company Gmbh Plants with Increased Yield
US20160046724A1 (en) * 2014-07-21 2016-02-18 The Trustees Of The University Of Pennsylvania Treatment of cancer using humanized anti-bcma chimeric antigen receptor

Family Cites Families (79)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0281604B1 (en) 1986-09-02 1993-03-31 Enzon Labs Inc. Single polypeptide chain binding molecules
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5260203A (en) 1986-09-02 1993-11-09 Enzon, Inc. Single polypeptide chain binding molecules
US5728388A (en) 1989-10-03 1998-03-17 Terman; David S. Method of cancer treatment
US6319494B1 (en) 1990-12-14 2001-11-20 Cell Genesys, Inc. Chimeric chains for receptor-associated signal transduction pathways
IL104570A0 (en) 1992-03-18 1993-05-13 Yeda Res & Dev Chimeric genes and cells transformed therewith
US5869337A (en) 1993-02-12 1999-02-09 President And Fellows Of Harvard College Regulated transcription of targeted genes and other biological events
US5834266A (en) 1993-02-12 1998-11-10 President & Fellows Of Harvard College Regulated apoptosis
US5830462A (en) 1993-02-12 1998-11-03 President & Fellows Of Harvard College Regulated transcription of targeted genes and other biological events
US20030036654A1 (en) 1994-08-18 2003-02-20 Holt Dennis A. Synthetic multimerizing agents
US5827642A (en) 1994-08-31 1998-10-27 Fred Hutchinson Cancer Research Center Rapid expansion method ("REM") for in vitro propagation of T lymphocytes
JP3262724B2 (ja) 1996-12-25 2002-03-04 福岡丸本株式会社 栽培装置
US6406699B1 (en) 1999-10-05 2002-06-18 Gary W. Wood Composition and method of cancer antigen immunotherapy
US6867041B2 (en) 2000-02-24 2005-03-15 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US6797514B2 (en) 2000-02-24 2004-09-28 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
KR20030032922A (ko) 2000-02-24 2003-04-26 싸이트 테라피스 인코포레이티드 세포의 동시 자극 및 농축
MXPA05000511A (es) 2001-07-12 2005-09-30 Jefferson Foote Anticuepros super humanizados.
US20040014194A1 (en) 2002-03-27 2004-01-22 Schering Corporation Beta-secretase crystals and methods for preparing and using the same
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
US7393531B2 (en) * 2003-01-21 2008-07-01 Arius Research Inc. Cytotoxicity mediation of cells evidencing surface expression of MCSP
EP2322547A1 (en) 2003-06-25 2011-05-18 Crucell Holland B.V. Myeloid cell-specific lectin
US20130266551A1 (en) 2003-11-05 2013-10-10 St. Jude Children's Research Hospital, Inc. Chimeric receptors with 4-1bb stimulatory signaling domain
WO2007137300A2 (en) 2006-05-23 2007-11-29 Bellicum Pharmaceuticals, Inc. Modified dendritic cells having enhanced survival and immunogenicity and related compositions and methods
GB0700058D0 (en) 2007-01-03 2007-02-07 Scancell Aps Anti-tumor vaccine based on normal cells
US8536310B2 (en) 2007-10-17 2013-09-17 Arca Biopharma, Inc. Antibodies to CLL-1
DK2352756T3 (da) * 2008-11-24 2012-12-03 Helmholtz Zentrum Muenchen Højaffin T-cellereceptor og anvendelse af denne
MX341884B (es) 2009-03-10 2016-09-07 Biogen Ma Inc Anticuerpos anti-antigeno de maduracion de celulas b (bcma).
CA2776143A1 (en) 2009-10-01 2011-04-07 The United States Of America, As Represented By The Secretary, Departmen T Of Health And Human Services Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer
EP2566886A1 (en) 2010-05-05 2013-03-13 Addex Pharma SA Methods and tools for screening agents exhibiting an activity on receptors of the tumor necrosis factor receptor superfamily
US9089520B2 (en) 2010-05-21 2015-07-28 Baylor College Of Medicine Methods for inducing selective apoptosis
ES2602743T3 (es) 2010-09-08 2017-02-22 Chemotherapeutisches Forschungsinstitut Georg-Speyer-Haus Receptores de antígenos quiméricos con una región bisagra optimizada
WO2012033885A1 (en) 2010-09-08 2012-03-15 Baylor College Of Medicine Immunotherapy of cancer using genetically engineered gd2-specific t cells
US9845362B2 (en) 2010-10-08 2017-12-19 The University Of North Carolina At Charlotte Compositions comprising chimeric antigen receptors, T cells comprising the same, and methods of using the same
PH12013501201A1 (en) 2010-12-09 2013-07-29 Univ Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer
KR20140004174A (ko) 2011-01-18 2014-01-10 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 암 치료를 위한 조성물 및 방법
AU2012209103B2 (en) 2011-01-26 2015-12-03 Takeda Pharmaceutical Company Limited Methods and compositions for the synthesis of multimerizing agents
US9987308B2 (en) 2011-03-23 2018-06-05 Fred Hutchinson Cancer Research Center Method and compositions for cellular immunotherapy
KR101972446B1 (ko) 2011-05-27 2019-04-25 글락소 그룹 리미티드 Bcma(cd269/tnfrsf17)­결합 단백질
EP2532740A1 (en) 2011-06-11 2012-12-12 Michael Schmück Antigen-specific CD4+ and CD8+ central-memory T cell preparations for adoptive T cell therapy
CN103946952A (zh) 2011-09-16 2014-07-23 宾夕法尼亚大学董事会 用于治疗癌症的rna改造的t细胞
TWI679212B (zh) 2011-11-15 2019-12-11 美商安進股份有限公司 針對bcma之e3以及cd3的結合分子
DE102012204596A1 (de) 2012-03-22 2013-09-26 Ford Global Technologies, Llc Verfahren und Vorrichtung zum Regeln der Geschwindigkeit eines Kraftfahrzeugs
EP2828290B1 (en) 2012-03-23 2018-08-15 The United States of America, represented by the Secretary, Department of Health and Human Services Anti-mesothelin chimeric antigen receptors
WO2013151665A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of proteins associated with human disease
RU2766608C2 (ru) 2012-04-11 2022-03-15 Дзе Юнайтед Стейтс Оф Америка, Эз Репрезентед Бай Дзе Секретари, Департмент Оф Хелс Энд Хьюман Сёрвисез Химерные антигенные рецепторы, нацеленные на антиген созревания b-клеток
US9163090B2 (en) 2012-05-07 2015-10-20 Cellerant Therapeutics, Inc. Antibodies specific for CLL-1
WO2013169691A1 (en) 2012-05-07 2013-11-14 Trustees Of Dartmouth College Anti-b7-h6 antibody, fusion proteins, and methods of using the same
WO2014055657A1 (en) 2012-10-05 2014-04-10 The Trustees Of The University Of Pennsylvania Use of a trans-signaling approach in chimeric antigen receptors
WO2014055771A1 (en) 2012-10-05 2014-04-10 The Trustees Of The University Of Pennsylvania Human alpha-folate receptor chimeric antigen receptor
TW201425336A (zh) * 2012-12-07 2014-07-01 Amgen Inc Bcma抗原結合蛋白質
WO2014122143A1 (en) 2013-02-05 2014-08-14 Engmab Ag Method for the selection of antibodies against bcma
CN113005091A (zh) * 2013-02-06 2021-06-22 细胞基因公司 具有改进特异性的修饰的t淋巴细胞
DK2956175T3 (da) 2013-02-15 2017-11-27 Univ California Kimærisk antigenreceptor og fremgangsmåder til anvendelse deraf
CA2905352A1 (en) 2013-03-14 2014-09-25 Bellicum Pharmaceuticals, Inc. Methods for controlling t cell proliferation
EP3783098A1 (en) 2013-05-14 2021-02-24 Board Of Regents, The University Of Texas System Human application of engineered chimeric antigen receptor (car) t-cells
EP3925618A1 (en) 2013-07-29 2021-12-22 2seventy bio, Inc. Multipartite signaling proteins and uses thereof
EP3074419B1 (en) 2013-11-25 2018-08-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Chimeric antigen receptors to control hiv infection
WO2015080981A1 (en) 2013-11-27 2015-06-04 Baylor College Of Medicine Csgp4-specific chimeric antigen receptor for cancer
EP3087101B1 (en) 2013-12-20 2024-06-05 Novartis AG Regulatable chimeric antigen receptor
AU2015214145A1 (en) 2014-02-04 2016-08-25 Kite Pharma. Inc. Methods for producing autologous T cells useful to treat B cell malignancies and other cancers and compositions thereof
US10934346B2 (en) 2014-02-14 2021-03-02 Bellicum Pharmaceuticals, Inc. Modified T cell comprising a polynucleotide encoding an inducible stimulating molecule comprising MyD88, CD40 and FKBP12
US20170335281A1 (en) 2014-03-15 2017-11-23 Novartis Ag Treatment of cancer using chimeric antigen receptor
EP3131927B8 (en) 2014-04-14 2020-12-23 Cellectis Bcma (cd269) specific chimeric antigen receptors for cancer immunotherapy
SG10201913782UA (en) 2014-07-21 2020-03-30 Novartis Ag Treatment of cancer using a cll-1 chimeric antigen receptor
ES2878449T3 (es) * 2014-07-24 2021-11-18 2Seventy Bio Inc Receptores antigénicos quiméricos de BCMA
MA40579A (fr) 2014-09-12 2016-03-17 Genentech Inc Anticorps anti-cll-1 et immunoconjugués
JP2017529841A (ja) 2014-09-19 2017-10-12 リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. キメラ抗原受容体
BR112017005631A2 (pt) * 2014-09-19 2018-06-26 City Of Hope células t com receptor de antígeno coestimulador quimérico direcionadas à il13ra2
MY191537A (en) 2014-12-05 2022-06-30 Memorial Sloan Kettering Cancer Center Chimeric antigen receptors targeting b-cell maturation antigen and uses thereof
KR102558502B1 (ko) 2014-12-05 2023-07-20 시티 오브 호프 Cs1 표적화된 키메라 항원 수용체-변형된 t 세포
HRP20191873T1 (hr) 2014-12-12 2020-01-24 Bluebird Bio, Inc. Kimerni antigenski receptori
CN105445991A (zh) 2014-12-26 2016-03-30 深圳市华星光电技术有限公司 彩色滤光片的制作方法
TWI703159B (zh) 2015-04-13 2020-09-01 美商輝瑞股份有限公司 Bcma特異性治療性抗體及其用途
US10294304B2 (en) 2015-04-13 2019-05-21 Pfizer Inc. Chimeric antigen receptors targeting B-cell maturation antigen
CN105384825B (zh) 2015-08-11 2018-06-01 南京传奇生物科技有限公司 一种基于单域抗体的双特异性嵌合抗原受体及其应用
TWI795133B (zh) 2016-04-01 2023-03-01 美商凱特製藥公司 Bcma結合分子類及彼等之用途
CA3019650C (en) 2016-04-01 2023-07-25 Kite Pharma, Inc. Chimeric receptors and methods of use thereof
ES2891578T3 (es) * 2016-04-01 2022-01-28 Kite Pharma Inc Antígeno quimérico y receptores de células T y métodos de uso
IL262061B2 (en) 2016-04-01 2023-03-01 Amgen Inc Chimeric flt-3 receptors and methods of using them

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020164588A1 (en) * 1999-01-29 2002-11-07 The Regents Of The University Of California Determining the functions and interactions of proteins by comparative analysis
US20120227134A1 (en) * 2009-11-17 2012-09-06 Basf Plant Science Company Gmbh Plants with Increased Yield
US20160046724A1 (en) * 2014-07-21 2016-02-18 The Trustees Of The University Of Pennsylvania Treatment of cancer using humanized anti-bcma chimeric antigen receptor

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11505613B2 (en) 2016-04-01 2022-11-22 Kite Pharma, Inc. BCMA binding molecules and methods of use thereof
US10597456B2 (en) 2016-04-01 2020-03-24 Amgen Inc. Chimeric receptors and methods of use thereof
US10603380B2 (en) 2016-04-01 2020-03-31 Kite Pharma, Inc. Chimeric antigen and T cell receptors and methods of use
US10689450B2 (en) 2016-04-01 2020-06-23 Kite Pharma, Inc BCMA binding molecules and methods of use thereof
US12269859B2 (en) 2016-12-02 2025-04-08 Angeles Therapeutics, Inc. Synthetic immune receptors and methods of use thereof
US11517591B2 (en) 2017-09-01 2022-12-06 Dana-Farber Cancer Institute, Inc. Immunogenic peptides specific to BCMA and TACI antigens
WO2019154313A1 (zh) 2018-02-11 2019-08-15 江苏恒瑞医药股份有限公司 一种分离的嵌合抗原受体以及包含其的修饰t细胞及用途
WO2019161035A1 (en) * 2018-02-14 2019-08-22 Kite Pharma, Inc. Anti-idiotypic antibodies directed to the antigen-binding portion of an bcma-binding molecule
EP4253959A3 (en) * 2018-02-14 2023-11-22 Kite Pharma, Inc. Anti-idiotypic antibodies directed to the antigen-binding portion of an bcma-binding molecule
CN112272675A (zh) * 2018-02-21 2021-01-26 细胞基因公司 Bcma结合抗体及其用途
WO2019210280A1 (en) * 2018-04-27 2019-10-31 Casebia Therapeutics Limited Liability Partnership Anti-bcma car-t-cells for plasma cell depletion
CN112512557A (zh) * 2018-04-27 2021-03-16 克里斯珀医疗股份公司 用于浆细胞耗竭的抗bcma car-t-细胞
US12150959B2 (en) 2018-07-19 2024-11-26 Regeneron Pharmaceuticals, Inc. Chimeric antigen receptors with BCMA specificity and uses thereof
US12258412B2 (en) 2018-07-19 2025-03-25 Regeneron Pharmaceuticals, Inc. Nucleic acid molecules encoding bispecific anti-BCMA x anti-CD3 antibodies
CN110818802B (zh) * 2018-08-08 2022-02-08 华夏英泰(北京)生物技术有限公司 一种嵌合t细胞受体star及其应用
CN110818802A (zh) * 2018-08-08 2020-02-21 华夏英泰(北京)生物技术有限公司 一种嵌合t细胞受体star及其应用
WO2020029774A1 (zh) * 2018-08-08 2020-02-13 华夏英泰(北京)生物技术有限公司 一种嵌合t细胞受体star及其应用
US12049510B2 (en) 2018-09-27 2024-07-30 Autolus Limited Chimeric antigen receptor
US12454578B2 (en) 2018-09-27 2025-10-28 Autolus Limited Cytolytic immune cell comprising BCMA- and CD19-specific chimeric antigen receptors
WO2020181142A1 (en) * 2019-03-06 2020-09-10 Dana-Farber Cancer Institute, Inc. T cell receptors specific to b-cell maturation antigen for treatment of cancer
AU2020231218B2 (en) * 2019-03-06 2025-09-11 Dana-Farber Cancer Institute, Inc. T cell receptors specific to B-cell maturation antigen for treatment of cancer
US12448429B2 (en) 2019-03-06 2025-10-21 Dana-Farber Cancer Institute, Inc. T cell receptors specific to b-cell maturation antigen for treatment of cancer
WO2021147941A1 (zh) * 2020-01-23 2021-07-29 和铂医药(苏州)有限公司 一种bcma结合蛋白及其制备方法和应用
WO2023019398A1 (en) * 2021-08-16 2023-02-23 Utc Therapeutics (Shanghai) Co., Ltd. Bcma targetting antibodies, chimeric antigen receptors, and uses thereof
WO2026072709A1 (en) 2024-09-25 2026-04-02 Orna Therapeutics, Inc. Chimeric antigen receptors targeting bcma

Also Published As

Publication number Publication date
JP2019515661A (ja) 2019-06-13
JP7366543B2 (ja) 2023-10-23
CL2018002763A1 (es) 2019-04-26
CN109414455A (zh) 2019-03-01
DOP2018000212A (es) 2018-10-31
EA201891966A1 (ru) 2019-04-30
ECSP18073836A (es) 2018-12-31
KR20220066193A (ko) 2022-05-23
CR20180462A (es) 2019-04-01
CN116425876A (zh) 2023-07-14
EP3436036A1 (en) 2019-02-06
US10689450B2 (en) 2020-06-23
CU20180120A7 (es) 2019-05-03
NZ746700A (en) 2023-04-28
TW202231658A (zh) 2022-08-16
AU2017240150B2 (en) 2022-02-24
TWI707950B (zh) 2020-10-21
TW201803993A (zh) 2018-02-01
CA3019135A1 (en) 2017-10-05
KR102522622B1 (ko) 2023-04-18
CO2018010475A2 (es) 2018-10-10
EP3436036A4 (en) 2020-03-18
KR102397674B1 (ko) 2022-05-18
US20200109209A1 (en) 2020-04-09
PE20190120A1 (es) 2019-01-17
MX2023007400A (es) 2023-07-06
US20230146195A1 (en) 2023-05-11
KR102591930B1 (ko) 2023-10-24
KR20180132751A (ko) 2018-12-12
BR112018070159A2 (pt) 2019-04-30
AU2017240150A2 (en) 2019-08-22
KR20230056058A (ko) 2023-04-26
US20170283504A1 (en) 2017-10-05
AU2017240150A1 (en) 2018-10-18
CN117903307A (zh) 2024-04-19
JP2022065073A (ja) 2022-04-26
TWI761831B (zh) 2022-04-21
TW202323273A (zh) 2023-06-16
SG11201808403SA (en) 2018-10-30
TWI795133B (zh) 2023-03-01
AU2022201243A1 (en) 2022-03-17
SG10201912515XA (en) 2020-02-27
AR108067A1 (es) 2018-07-11
PH12018550164A1 (en) 2019-05-15
IL261942A (en) 2018-10-31
CN109414455B (zh) 2023-01-20
ZA201806962B (en) 2021-08-25
AU2017240150C1 (en) 2022-10-27
TW202108607A (zh) 2021-03-01
US11505613B2 (en) 2022-11-22

Similar Documents

Publication Publication Date Title
US20230146195A1 (en) Bcma binding molecules and methods of use thereof
JP7434250B2 (ja) Cd19に対するヒト化抗原結合ドメイン及び使用方法
US11793834B2 (en) Chimeric antigen and T cell receptors and methods of use
EP4692125A2 (en) Cd70 binding molecules and methods of use thereof
US20230060292A1 (en) Split chimeric antigen receptors and methods of use
OA19653A (en) BCMA binding molecules and methods of use thereof.
CA3060426C (en) Humanized antigen-binding domains against cd19 and methods of use
HK40000650A (en) Bcma binding molecules and methods of use thereof

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 3019135

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 11201808403S

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2018550679

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/011969

Country of ref document: MX

Ref document number: 201891966

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: CR2018-000462

Country of ref document: CR

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018070159

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2017240150

Country of ref document: AU

Date of ref document: 20170331

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20187031269

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017776833

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017776833

Country of ref document: EP

Effective date: 20181102

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17776833

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 112018070159

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180928

WWR Wipo information: refused in national office

Ref document number: 518400145

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 518400145

Country of ref document: SA