WO2017082503A1 - Bcr/abl 음성 골수증식종양 관련 유전자변이 다중검출용 펩티드핵산 프로브, 이를 포함하는 유전자변이 다중검출 조성물, 다중검출 키트 및 유전자변이 다중검출방법 - Google Patents
Bcr/abl 음성 골수증식종양 관련 유전자변이 다중검출용 펩티드핵산 프로브, 이를 포함하는 유전자변이 다중검출 조성물, 다중검출 키트 및 유전자변이 다중검출방법 Download PDFInfo
- Publication number
- WO2017082503A1 WO2017082503A1 PCT/KR2016/005927 KR2016005927W WO2017082503A1 WO 2017082503 A1 WO2017082503 A1 WO 2017082503A1 KR 2016005927 W KR2016005927 W KR 2016005927W WO 2017082503 A1 WO2017082503 A1 WO 2017082503A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- substitution
- mpl
- amino acid
- bcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/107—Modifications characterised by incorporating a peptide nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention relates to a peptide nucleic acid probe for multiple detection of BCR / ABL negative myeloproliferation tumor-related gene mutations, genetically modified multiple detection compositions, multiple detection kits and multiple mutation methods including the same.
- Myeloproliferative neoplasm is a clonal hematopoietic stem cell disease with excessive production of mature cells from one or more blood cell lines, and according to the 2008 WHO classification, BCR / ABL1-positive chronic myelogenous leukemia (CML), Chronic neutrophilic leukemia, polycythaemia vera (PV), primary myelofibrosis (PMF), essential thrombocythaemia (ET), chronic eosinophilic leukin (NO) , Mastocytosis and myeloproliferative neoplasm (unclassifiable).
- CML chronic myelogenous leukemia
- PV polycythaemia vera
- PMF primary myelofibrosis
- ET essential thrombocythaemia
- NO chronic eosinophilic leukin
- Mastocytosis and myeloproliferative neoplasm (unclassifiable).
- Intrinsic erythrocytosis is a myeloproliferative tumor that is characterized by an increase in erythrocyte production regardless of the normal erythropoietic regulation mechanism, resulting in panmyelosis that proliferates not only erythrocytes but also granulocytes and megakaryocytes.
- True thrombocytopenia is a myeloproliferative tumor in which megakaryocytes primarily proliferate, characterized by persistent thrombocytopenia (more than 450 x 10 9 / L) in peripheral blood, large, mature megakaryocytes in the bone marrow, and long asymptomatic It may show thrombosis or bleeding tendency.
- fibrosis Primary myeloid fibrosis is asymptomatic and 30% of the patients are found by accident due to anemia, leukocytosis and thrombocytopenia.
- Leukocytosis leukoerythroblastosis
- serum serum LD increase in the early stages of severe platelet similar to true thrombocytopenia.
- Anisopoikilocytosis with teardrop-shaped erythrocytes is shown, and bone marrow shows high cell fidelity and severe reticulin or collagen fibrosis, which causes bone marrow failure due to myeloid fibrosis.
- JAK2 Janus Tyrosine Kinase 2
- JAK2 V617F mutations caused by c.1849G> T or c.1849_1851delinsTTT base substitution are important genetic variants involved in the development of BCR / ABL-negative myeloid proliferation tumors, but vary slightly depending on the report, but generally 90-95 of true erythrocytosis. %, 35-70% of diabetes mellitus, and 50% of primary myelofibrosis. Therefore, the presence of JAK2 V617F mutation in patients with suspected hyperlipidemia is very useful for diagnosis.
- JAK2 V617F is not observed, so there is a continuing need for new molecular genetic markers other than JAK2 V617F. come.
- MPL W515 mutation was reported in BCR / ABL-negative myeloid tumors in which tryptophan at the exon 10 of the thrombopoietin receptor (TPO-R; myeloproliferative leukemia (MPL)) was replaced with another amino acid.
- TPO-R thrombopoietin receptor
- MPL W515 mutations have been reported mainly in true hyperthrombocytopenia and primary myelofibrosis among BCR / ABL negative myeloid growth tumors. This mutation has been observed in about 7-25% of JAK2 V617F negative primary myeloid fibrosis and 1-24% of true hyperthrombocytosis, and the incidence of intrinsic hypercytosis is so low that only two cases have been reported to date.
- W515L is substituted with lysine
- W515K is substituted with arginine
- W515S is substituted with serine.
- W515L from c.1544G> T base substitution and W515K from c.1543_1544delinsAA base substitution were the most common, with 55% and 21% in true hypertensive hyperplasia and 93% and 7% in primary myelofibrosis, respectively. More often observed.
- Nonpatent Literature 1 calreculin gene
- Non-Patent Document 2 Detailed studies have shown that no CALR gene mutations have been observed in true erythrocytosis, in 67% of patients with JAK2 V617F / MPL W515 mutant negative hypertensive thrombocytopenia, and in 88% of patients with primary myeloid fibrosis.
- Most of the reported CALR gene mutations (approximately 80%) accounted for about 50% of the c.1092_1143del52 nucleotide defects (L367fs * 46, type 1) and about 30% of the c.1154_1155insTTGTC nucleotide insertion (K385fs * 47, type 2) It was a hot spot to occupy.
- the essential requirement for molecular genetic in vitro diagnostic testing is to select a major gene mutation involved in the molecular genetic pathogenesis of BCR / ABL negative myeloid growth tumor with high sensitivity.
- no commercialized in vitro diagnostic method for the multiple detection of gene mutations related to BCR / ABL-negative myeloid growth tumors has been developed by the domestic technology, and there is a lack of clinical trial data. Therefore, the screening method combined with the multi-detection molecular genetic testing technology has been developed. There is an urgent need to ensure that it can be applied.
- the present invention is the base sequence represented by SEQ ID NO: 7 to 10 and the base sequence produced to be capable of multiple detection of gene mutations by complementarily binding to BCR / ABL negative myeloid growth tumor related genes It provides a peptide nucleic acid probe comprising any one or more selected from the group consisting of nucleotide sequences complementary to.
- the BCR / ABL negative myeloid growth tumor-related gene is any one or more selected from Janus tyrosine kinase 2 (JAK2), thrombopoietin receptor (MPL) and calreculin (CALR) do.
- JAK2 Janus tyrosine kinase 2
- MPL thrombopoietin receptor
- CAR calreculin
- the gene mutation is (i) substituted with phenylalanine of amino acid valine at position 617 of Janus tyrosine kinase 2 gene (JAK2 V617F), (ii) amino acid tryptophan at position 515 of thrombopoietin receptor gene Substitution with leucine (MPL W515L), (iii) substitution with lysine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515K), and (iv) arginine with amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515R), (v) substitution with alanine of the amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515A), (vi) substitution with a serine of the amino acid tryptophan at position 515 of the thrombopoietin
- the substitution of phenylalanine of amino acid valine at position 617 of the Janus tyrosine kinase 2 gene is characterized by c.1849G> T or c.1849_1851delinsTTT base substitution.
- the substitution of leucine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene is characterized by c.1544G> T base substitution.
- the substitution of lysine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene is characterized by c.1543_1544delinsAA base substitution.
- the peptide nucleic acid probe is characterized in that the reporter (reporter) and quencher (quencher) is coupled to both ends.
- the reporter is FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein) and Cy5 Characterized in that selected from the group consisting of.
- the quencher is selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl.
- the present invention provides a composition for detecting multiple mutations related to BCR / ABL negative myeloid tumor comprising the above-described peptide nucleic acid probe.
- the present invention provides a BCR / ABL negative myeloid growth tumor-related gene mutation multiple detection kit comprising the above-described composition for detecting the genetic mutation as an active ingredient.
- the present invention is a composition produced by binding to a BCR / ABL negative myeloid growth tumor-related gene complementary to multiple detection, (i) the base sequence represented by SEQ ID NO: 7 and 9 and complementary to the base sequence Any one selected from the group consisting of a first solution comprising a peptide nucleic acid probe comprising at least one selected from the group consisting of a nucleotide sequence, a nucleotide sequence represented by SEQ ID NOs: 8 and 10, and a nucleotide sequence complementary to the nucleotide sequence A second solution comprising a peptide nucleic acid probe comprising the above; Or (ii) a first solution comprising a peptide nucleic acid probe comprising at least one selected from the group consisting of a nucleotide sequence represented by SEQ ID NOs: 7 and 10 and a base sequence complementary to the nucleotide sequence, and SEQ ID NOs: 8 and 9 Comprising a second solution comprising a peptide nucleic acid probe
- the peptide nucleic acid probe included in the first solution of the composition for detecting multiple gene mutations complementarily binds to one or more of Janus tyrosine kinase 2 (JAK2) and calreculin (CALR) genes.
- the peptide nucleic acid probe contained in the second solution is characterized in that it complementarily binds to one or more of the thrombopoietin receptor (MPL) and calreculin (CALR) gene.
- the first solution of the multi-mutant composition for gene mutations is (i) substituted with phenylalanine of the amino acid valine at position 617 of the Janus tyrosine kinase 2 gene (JAK2 V617F), and (ii) caleticulin Detecting any one or more gene mutations selected from the group consisting of c.1092_1143del52 nucleotide deletion (L367fs * 46) or c.1154_1155insTTGTC nucleotide insertion (K385fs * 47) of the gene, wherein the second solution comprises (i) a thrombopoietin receptor Substitution of lysine of amino acid tryptophan at position 515 of the gene (MPL W515K), (ii) substitution of arginine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515R), (iii) of the
- substitution of phenylalanine of amino acid valine at position 617 of the Janus tyrosine kinase 2 gene is by c.1849G> T or c.1849_1851delinsTTT base substitution
- substitution of leucine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene is by c.1544G> T base substitution
- amino acid tryptophan at position 515 of the thrombopoietin receptor gene is characterized by c.1543_1544delinsAA base substitution.
- the present invention provides a BCR / ABL negative myeloid growth tumor-related multiple gene mutation multiple detection kit comprising the above-described composition for multiple gene mutation detection as an active ingredient.
- the present invention is a primer comprising any one or more sequences selected from the group consisting of SEQ ID NOS: 1 to 6, which is designed to specifically amplify a portion of a gene mutation by complementarily binding to a BCR / ABL negative myeloid growth tumor-related gene To provide.
- the present invention comprises the steps of hybridizing by adding the above-described peptide nucleic acid probe to the subject DNA sample; Melting the hybridized product at varying temperatures to obtain a melting curve; And comparing the obtained fusion curve with a standard melting temperature of the mutant gene.
- the step of hybridizing, the step of performing amplification by performing a PCR by mixing the target sample with a primer, and then performing a step of hybridizing by adding a peptide nucleic acid probe to the amplification product It features.
- the present invention comprises the steps of adding the above-described composition for multi-mutation detection to the DNA sample of interest, the hybridization by adding the first solution and the second solution, respectively, or sequentially; Melting the hybridized product at varying temperatures to obtain a melting curve; And comparing the obtained fusion curve with a standard melting temperature of the mutant gene.
- the step of hybridizing, the step of performing amplification by performing a PCR by mixing the target sample with a primer, and then hybridizing by adding a composition for genetic mutation multiple detection to the amplification product is characterized by performing.
- the primers are selected from the group consisting of SEQ ID NOs: 1 to 6, which are designed to specifically amplify gene mutations by complementarily binding to BCR / ABL negative myeloid growth tumor-related genes. It is characterized by including any one or more sequences.
- the genetic variation detected by the method is (i) substitution with phenylalanine of amino acid valine at position 617 of Janus tyrosine kinase 2 gene (JAK2 V617F), (ii) thrombopoietin receptor gene Substitution with leucine of the amino acid tryptophan at position 515 of (MPL W515L), (iii) substitution with lysine of the amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515K), (iv) 515 of the thrombopoietin receptor gene Substitution with arginine of the amino acid tryptophan at position (MPL W515R), (v) substitution with alanine of the amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515A), (vi) position 515 of the thrombopoietin receptor gene Substitution with Ser
- the substitution of the phenylalanine of amino acid valine at position 617 of the Janus tyrosine kinase 2 gene detected by the method is characterized in that c.1849G> T or c.1849_1851delinsTTT base substitution. do.
- the substitution by leucine of the amino acid tryptophan at position 515 of the thrombopoietin receptor gene detected by the method is characterized in that the c.1544G> T base substitution.
- the substitution of lysine (MPL W515K) of amino acid tryptophan at position 515 of the thrombopoietin receptor gene detected by the above method is characterized by c.1543_1544delinsAA base substitution.
- the present invention provides a peptide nucleic acid probe capable of quickly and accurately multiplexing a mutation of a BCR / ABL negative myeloid growth tumor-related gene, thereby effectively detecting the mutation of the gene, and furthermore, a BCR / ABL negative bone marrow Gene mutations related to proliferative tumors can be performed once and multi-detected quickly and effectively for disease diagnosis, follow-up, prognosis and treatment.
- 1 is a diagram showing the base mutation position, PNA probe, primer position of the JAK2 gene.
- Figure 2 is a view showing the base mutation position, PNA probe, primer position of the MPL gene.
- Figure 3 is a view showing the base mutation position, PNA probe, primer position of the CALR gene.
- FIG. 4 is a melting curve graph using a peptide nucleic acid probe and synthetic DNA for detecting JAK2-2 mutation according to an embodiment of the present invention.
- FIG. 5 is a melting curve graph using a peptide nucleic acid probe and synthetic DNA to detect MPL-3 mutation according to an embodiment of the present invention.
- FIG. 6 is a melting curve graph using a peptide nucleic acid probe and synthetic DNA to detect CALR-del4 mutations according to an embodiment of the present invention.
- FIG. 7 is a melting curve graph using a peptide nucleic acid probe and synthetic DNA to detect CALR-ins5p mutation according to an embodiment of the present invention.
- FIG. 8 is a graph showing a related genetic mutation melting curve using DNA of a BCR / ABL negative myeloid tumor patient according to an embodiment of the present invention.
- FIG. 9 is a graph showing a related genetic mutation melting curve using DNA of a BCR / ABL negative myeloid growth tumor patient.
- 10 is a melting curve graph using peptide nucleic acid probes and synthetic DNA to detect various mutations in the JAK2 gene.
- 11 is a melting curve graph using peptide nucleic acid probes and synthetic DNA to detect various mutations in the MPL gene.
- 13 is a melting curve graph using peptide nucleic acid probes and samples for detecting deletion mutations in the CALR gene.
- FIG. 14 is a melting curve graph using peptide nucleic acid probes and synthetic DNA to detect various insertion mutations of the CALR gene.
- Fig. 16 shows the results of confirming the detection limit of the composition of the present invention which is divided into one solution (A set) and two solutions (B set).
- 19 is a result of verifying the multiple detection of the same cause gene of the composition of the present invention divided into one solution (A set) and two solutions (B set).
- composition of the present invention is a result of verifying multiple detection of other causal genes of the composition of the present invention, which is divided into one solution (A set) and two solutions (B set).
- Figure 21 shows the results of verifying the multiple detection of all six causal genes of the composition of the present invention divided into one solution (A set) and two solutions (B set).
- the base sequence represented by SEQ ID NO: 7 to 10 and the base prepared to bind to the BCR / ABL negative myeloid growth tumor-associated gene complementary to multiple detection Peptide nucleic acid probes comprising any one or more selected from the group consisting of nucleotide sequences complementary to the sequence, gene mutation multiple detection compositions, kits comprising the same, and methods for multidetecting BCR / ABL negative myeloid growth tumor related gene variants To provide.
- the present invention will be described in detail with reference to the accompanying drawings.
- target nucleic acid refers to a nucleic acid sequence to be detected, and is annealed or hybridized with a primer or probe under hybridization, annealing or amplification conditions.
- 'Target nucleic acid' is not different from the terms 'target nucleic acid', 'target nucleic acid sequence' or 'target sequence' used in the present specification, and is used interchangeably herein.
- Hybridization' of the present invention is meant that complementary single stranded nucleic acids form a double-stranded nucleic acid.
- Hybridization can occur when the complementarity between two nucleic acid strands is perfect or even when some mismatch base is present.
- the degree of complementarity required for hybridization may vary depending on the hybridization conditions, and may be particularly controlled by temperature.
- the 'genetic variation' of the present invention is a mutation occurs in the base sequence of the target nucleic acid, characterized in that the mutation occurs by substitution, deletion or insertion of the base as well as single nucleotide polymorphism (SNP)
- the PNA probe of the present invention may be analyzed through a melting curve analysis that mutations are caused by substitution, deletion or insertion of the SNP of the target nucleic acid or the base of the target nucleic acid.
- the present invention is selected from the group consisting of the nucleotide sequence shown in SEQ ID NO: 7 to 10 and the nucleotide sequence complementary to the nucleotide sequence produced to enable multiple detection of gene mutations complementary to the BCR / ABL negative myeloid growth tumor-related gene Peptide nucleic acid probes comprising any one or more are provided. More specifically, multi-detection of gene mutations of target nucleic acids, for example, BCR / ABL negative myeloid proliferation-associated genes are selected from Janus tyrosine kinase 2 (JAK2), thrombopoietin receptor (MPL) and caleticulin (CALR). At least one selected.
- JK2 Janus tyrosine kinase 2
- MPL thrombopoietin receptor
- CAR caleticulin
- the gene mutation is (i) substitution with phenylalanine of amino acid valine at position 617 of Janus tyrosine kinase 2 gene (JAK2 V617F), and (ii) leucine with amino acid tryptophan at position 515 of thrombopoietin receptor gene.
- the substitution of phenylalanine of amino acid valine at position 617 of the Janus tyrosine kinase 2 gene is by c.1849G> T or c.1849_1851delinsTTT base substitution, and amino acid at position 515 of the thrombopoietin receptor gene.
- Tryptophan substitution with leucine is by c.1544G> T base substitution
- substitution with lysine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene is due to c.1543_1544delinsAA base substitution Can be.
- the Janus tyrosine kinase 2 gene is composed of the nucleotide sequence described in the NCBI number JAK2_NM_004972.3, and its amino acid sequence may be composed of the amino acid sequence described in NP_004963.1.
- the thrombopoietin receptor gene is composed of the nucleotide sequence described in the NCBI number MPL_NM_005373.2, its amino acid sequence may be composed of the amino acid sequence described in NP_005364.1.
- the caleticulin gene is composed of the base sequence described in NCLR number CALR_NM_004343.3, the amino acid sequence thereof may be composed of the amino acid sequence described in NP_004334.1.
- JAK2 V617F, MPL W515L / K, and CALR L367fs * 46 / K385fs * 47 mutations were selected for detection.
- the present invention enables rapid and accurate multidetection of the presence or absence of JAK2 V617F, MPL W515L / K, and CALR L367fs * 46 / K385fs * 47 mutations.
- the length of the PNA sequence according to the present invention is not particularly limited, but may be 9 to 16 mer in length including SNP and Indel of JAK2, MPL, and CALR associated with BCR / ABL negative myeloid growth.
- the probe can be designed to have a desired Tm value by adjusting the length of the PNA probe, or even a PNA probe of the same length can be adjusted by changing the base sequence.
- PNA has a higher binding force than DNA and the basic Tm value is higher, it is possible to design a shorter length than DNA so that even neighboring SNPs can be detected.
- the difference in Tm value is about 0.5 ° C., which is very small, requiring additional analysis program or detailed temperature change or correction. Therefore, when two or more SNPs appear, the analysis is difficult. PNA probes are not affected by probe sequence and SNP and can be easily analyzed.
- the peptide nucleic acid probe may be coupled to a reporter and a quencher at both ends.
- the reporter may be selected from the group consisting of FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein) and Cy5
- Quencher may be selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl.
- the present invention provides a composition for detecting multiple mutations related to BCR / ABL negative myeloid tumor comprising the above-described peptide nucleic acid probe.
- the present invention provides a BCR / ABL negative myeloid growth tumor-related gene mutation multiple detection kit comprising the above-described composition for multiple gene mutation detection as an active ingredient.
- the kit may optionally include reagents necessary to conduct target amplification reactions (eg, PCR reactions) such as buffers, DNA polymerase cofactors and deoxyribonucleotide-5-triphosphate.
- target amplification reactions eg, PCR reactions
- the kits of the present invention may also include various polynucleotide molecules, reverse transcriptases, various buffers and reagents, and antibodies that inhibit DNA polymerase activity.
- the kit it is possible to effectively detect a single base mutation of a target nucleic acid and a mutation due to a deletion or insertion of a base nucleic acid through a dissolution curve analysis by a PNA probe, and through this BCR / ABL negative myeloid growth tumor-related gene mutation Presence and multiple detection are possible.
- the present invention is a composition produced by binding to a BCR / ABL negative myeloid growth tumor-related gene complementary to multiple detection, (i) the base sequence represented by SEQ ID NO: 7 and 9 and complementary to the base sequence Any one selected from the group consisting of a first solution comprising a peptide nucleic acid probe comprising at least one selected from the group consisting of a nucleotide sequence, a nucleotide sequence represented by SEQ ID NOs: 8 and 10, and a nucleotide sequence complementary to the nucleotide sequence A second solution comprising a peptide nucleic acid probe comprising the above; Or (ii) a first solution comprising a peptide nucleic acid probe comprising at least one selected from the group consisting of a nucleotide sequence represented by SEQ ID NOs: 7 and 10 and a base sequence complementary to the nucleotide sequence, and SEQ ID NOs: 8 and 9 Comprising a second solution comprising a peptide nucleic acid probe
- first solution or “second solution” means that two or more peptide nucleic acid probes are mixed in one or more solutions rather than all of them in one solution. It does not mean the order of contact or detection with.
- the peptide nucleic acid probe included in the first solution of the composition for detecting multiple gene mutations complementarily binds to one or more of Janus tyrosine kinase 2 (JAK2) and calreculin (CALR) genes.
- the peptide nucleic acid probe included in the second solution may complementarily bind to one or more of thrombopoietin receptor (MPL) and caleticulin (CALR) genes.
- the first solution of the multi-mutant composition for gene mutations is (i) substituted with phenylalanine of the amino acid valine at position 617 of the Janus tyrosine kinase 2 gene (JAK2 V617F), and (ii) caleticulin Detecting any one or more gene mutations selected from the group consisting of c.1092_1143del52 nucleotide deletion (L367fs * 46) or c.1154_1155insTTGTC nucleotide insertion (K385fs * 47) of the gene, wherein the second solution comprises (i) a thrombopoietin receptor Substitution of lysine of amino acid tryptophan at position 515 of the gene (MPL W515K), (ii) substitution of arginine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515R), (iii) of the
- the present invention provides a BCR / ABL negative myeloid growth tumor-related multiple gene mutation multiple detection kit comprising the above-described composition for multiple gene mutation detection as an active ingredient.
- the present invention is a primer comprising any one or more sequences selected from the group consisting of SEQ ID NOS: 1 to 6, which is designed to specifically amplify a portion of a gene mutation by complementarily binding to a BCR / ABL negative myeloid growth tumor-related gene To provide.
- Another aspect of the invention the step of hybridizing by adding the above-described peptide nucleic acid probe to the subject DNA sample; Melting the hybridized product at varying temperatures to obtain a melting curve; And comparing the obtained fusion curve with a standard melting temperature of the mutant gene.
- the inventors compared and analyzed JAK2, MPL, and CALR genes related to BCR / ABL negative myeloid proliferation tumors to prepare a PNA including each of one or more base sequences selected from the group consisting of the base sequences of Table 2, and using these PNAs.
- the melting curve was obtained from a sample of a BCR / ABL negative myeloid growth tumor patient, and the melting temperature (Tm) was confirmed from the melting curve. As shown in the following examples, different results according to the genetic variation were obtained.
- Tm melting temperature
- the hybridization step is to react the PNA according to the present invention with a DNA sample of a suspected BCR / ABL negative myeloid tumor.
- the hybridization may be performed by mixing a target sample with a primer, performing amplification by performing PCR, and then hybridizing by adding a peptide nucleic acid probe to the amplification product. That is, the hybridization step may include a PCR process, and it is possible to use a forward / reverse primer set for PCR.
- Such hybridization steps and PCR conditions can include any of a variety of methods that are well known to those of ordinary skill in the art (hereinafter, referred to as “an expert”). It is also possible to include a melting process after PCR.
- the step of obtaining the temperature-specific melting curve is to obtain the melting temperature (Tm) of the DNA sample of suspected BCR / ABL negative myeloid tumor.
- Tm melting temperature
- the hybridization method can be used as FMCA (Fluorescence Melting Curve Analysis), and the FMCA is to analyze the difference in the binding force between the product produced after the PCR reaction and the put probe by Tm.
- the Tm value can be obtained by measuring the intensity of fluorescence every 1 ° C. increase.
- the multi-detection of the BCR / ABL-negative myeloid growth tumor-related gene mutation is a multi-detection of the presence and type of the gene mutation from the melting temperature of the obtained melting curve.
- the presence and type of base mutations can be multi-detected by comparing the melting temperature of the obtained melting curve with the melting temperature according to the difference in genetic variation.
- the melting curve to which the PNA according to the present invention is applied to each genetic variation has a different melting temperature (Tm) (see FIGS. 4 to 7), and multiple detection of the presence and the type of genetic variation is possible by using these differences.
- the present invention comprises the steps of hybridizing each of the gene mutation multiple detection composition consisting of the first solution and the second solution to the target DNA sample or sequentially so as to minimize interference as described above; Melting the hybridized product at varying temperatures to obtain a melting curve; And comparing the obtained fusion curve with a standard melting temperature of the mutant gene. Through this, it is possible to minimize the trunk phenomenon that may occur when simultaneous detection of multiple genes.
- Gene mutation multiple detection composition divided into a first solution and a second solution to minimize the interference phenomenon (i) the group consisting of the nucleotide sequence represented by SEQ ID NO: 7 and 9 and the base sequence complementary to the base sequence Peptide nucleic acid comprising any one or more selected from the group consisting of a first solution comprising a peptide nucleic acid probe comprising any one or more selected from the base sequence shown in SEQ ID NO: 8 and 10 and the base sequence complementary to the base sequence A second solution containing a probe; Or (ii) a first solution comprising a peptide nucleic acid probe comprising at least one selected from the group consisting of a nucleotide sequence represented by SEQ ID NOs: 7 and 10 and a base sequence complementary to the nucleotide sequence, and SEQ ID NOs: 8 and 9 Comprising a second solution comprising a peptide nucleic acid probe comprising at least one selected from the group consisting of a base sequence represented by and a base sequence complementary to the base sequence
- the step of hybridizing, the step of performing amplification by performing a PCR by mixing the target sample with a primer, and then hybridizing by adding a composition for genetic mutation multiple detection to the amplification product Can be done.
- the primer may include any one or more sequences selected from the group consisting of SEQ ID NOS: 1 to 6, which are designed to specifically amplify a portion of gene mutation by complementarily binding to a BCR / ABL negative myeloid growth tumor related gene. have.
- Gene mutations detected by the above method include (i) substitution with phenylalanine of amino acid valine at position 617 of the Janus tyrosine kinase 2 gene (JAK2 V617F), (ii) leucine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515L), (iii) substitution with lysine of amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515K), (iv) substitution with arginine at amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515R), (v) substitution with alanine of the amino acid tryptophan at position 515 of the thrombopoietin receptor gene (MPL W515A), (vi) substitution with serine of the amino acid tryptophan at position 515 of the thrombopoietin receptor gene (M
- the substitution of phenylalanine of amino acid valine at position 617 of the Janus tyrosine kinase 2 gene detected by the above method (JAK2 V617F) mutation is c.1849G> T or c.1849_1851delinsTTT base substitution, position 515 of the thrombopoietin receptor gene
- the substitution of leucine (MPL W515L) of amino acid tryptophan is c.1544G> T base substitution and the substitution of lysine of amino acid tryptophan at position 515 of thrombopoietin receptor gene (MPL W515K) mutation is c.1543_1544delinsAA base substitution Can be.
- genes of JAK2, MPL, and CALR were selected from various BCR / ABL negative myeloid growth tumor-related genes. And primers of JAK2, MPL, CALR were prepared to perform PCR as a template on the DNA of the suspected BCR / ABL negative myeloid growth tumor.
- FIG. 1 to 3 is a sequence diagram showing an example of the nucleotide sequence of the JAK2, MPL, CALR genes and SNP and Indel and PNA derived therefrom according to the present invention.
- the base mutation of each gene is expressed in red or, based on this base sequence of the PNA according to the present invention in the yellow box, the primer is marked in red at the beginning and end of the base.
- primer base sequences for gene amplification according to the present invention were determined and shown in Table 1 below.
- O means a linker and K means lysine.
- the PNA probe was conducted with a combination of three primer sets and four PNA probes in a multiplex form in which all four probes were carried out in one tube. The combination was produced so that the same fluorescence did not overlap. Then, a PNA probe according to the present invention was prepared with the nucleotide sequence, the reporter and the quencher as shown in Table 2 above. All PNA probes (FAM, HEX, Texas Red, Cy5-labeled, Dabcyl) used in the present invention were synthesized by HPLC purification in Panagene (Panagene, Korea), and the purity of all synthesized probes was confirmed by mass spectrometry. The unnecessary secondary structure of the probe was avoided for more efficient binding with the target nucleic acid.
- a lysis curve was derived for the BCR / ABL negative myeloid growth tumor-associated genetically modified DNA sample.
- the melting process of the real-time PCR instrument is denatured for 3 minutes at 95 °C, then 30 seconds at 75 °C, 30 seconds at 65 °C, 30 seconds at 55 °C, 30 seconds at 45 °C, 30 seconds at 25 °C, 25
- the reaction was carried out at 30 ° C. for 30 seconds at 20 ° C. for 50 seconds, after which 1 ° C. was raised to 80 ° C. for 10 seconds, and fluorescence was measured. This is to allow the PNA probe to accurately hybridize with the synthesized DNA oligomer.
- Table 4 summarizes the Tm values derived from the above hybridization reactions, and the genetic variation can be confirmed through the Tm value analysis.
- the prepared PNA probe can obtain a different Tm value for each gene mutation and detect a base mutation for an unknown target nucleic acid.
- Example 3 BCR Of ABL DNA from Patients with Negative Myeloid Tumors Peptide nucleic acid Melting Curve Analysis
- a lysis curve was derived for the BCR / ABL negative myeloid growth tumor-associated genetically modified DNA sample.
- PCR was performed using the CFX96 TM Real-Time System (BIO-RAD, USA), and all experimental conditions used asymmetric PCR (asymmetric PCR) to generate single stranded target nucleic acid.
- the conditions of asymmetric PCR are as follows; 4 0.5 ⁇ l probes (PNA probes prepared in Example 1 above) in 2 ⁇ qPCR PreMix (Sea Bio, Korea), 0.05 ⁇ M forward primer and 0.5 ⁇ M reverse asymmetric PCR so that the total volume is 20 ⁇ l, 1 ⁇ l BCR / ABL negative myeloid tumor suspected DNA was added, the remainder was supplemented with DW and real time PCR was performed.
- FIG. 8 is a graph illustrating an example of a process of hybridizing BCR / ABL negative myeloid growth tumor patient DNA and raising the temperature of the hybridized product according to an embodiment of the present invention.
- the real-time PCR procedure was denatured at 95 ° C. for 10 minutes, and then reacted at 95 ° C. for 30 seconds, 58 ° C. for 30 seconds, and 74 ° C. for 45 seconds. This was repeated 40 cycles, and fluorescence was measured in real time.
- FIG. 9 is an example of a temperature-specific melting curve graph obtained by applying each peptide nucleic acid according to the present invention to DNA of a BCR / ABL negative myeloid tumor tumor.
- the six melting curves were carried out in one tube containing four probes and three sets of PCR primers at the same time, of which the fluorescence with the corresponding variant was shown.
- the Tm value and melting peak of the wild type were observed.
- the top three are JAK2-2 (Cy5), JAK2-2 (Cy5) and MPL-3 (FAM) from the left and the bottom three are MPL-3 (FAM), CALR-ins5p (Texas Red) and CALR- from the left. d4 (HEX).
- the melting curve to which the PNA according to the present invention is applied in the BCR / ABL negative myeloid tumor tumor DNA has different melting temperatures (Tm).
- Tm melting temperature
- Results include gene mutations related to BCR / ABL negative myeloid growth
- Table 5 is an example of the table which summarizes the melting temperature (Tm) obtained from the melting curve graph for each temperature of FIG.
- Tm melting temperature
- Table 5 bold and underlined (temperature) marks the presence of the corresponding genetic variation. Based on the Tm values shown in Table 5, base mutations of JAK2, MPL, and CALR genes can be detected.
- JAK2-3 probes were synthesized with the nucleotide sequences shown in Table 6, but JAK2-1 and JAK2-2 were not prepared to proceed after confirming JAK2-1 first. JAK2-1 showed a peak appearing as a probe dimer near 30 ° C., and did not proceed thereafter, and JAK2-2 was selected (see FIG. 10).
- MPL was eliminated with the same Tm value as MLP-1 and MPL-2 did not distinguish between W515L and W515K.
- MPL-3 probe was selected. (See FIG. 11) MPL-3 was manufactured to fit the opposite strands, not the strands that bind to MLP-1 and MPL-2. This is a part that can be used because the difference in Tm caused by TG> TT vs TG> AA is large because the difference in Tm caused by CA> AA vs CA> TT is large.
- CALR-d1 was eliminated due to poor melting peaks in DNA oligos corresponding to wild type and deletion mutations.
- CALR-d2 and CALR-d3 probes have the same sequence but different types of fluorescence, and have good Tm value and melting point in DNA oligos corresponding to wild type and deletion mutations, but in real samples, the sequence captured by the probe is repeated on the target. Due to the phenomenon indicated by the wild-type portion corresponding to the peak corresponding to the variant (red arrow in Figure 12), despite being a wild type, there is a possibility that it is determined that the variant is included and dropped out. (See FIG. 12)
- FIG. 13 is a graph illustrating a melting point analysis using a sample.
- CALR-in1 CALR-in2
- CALR-in3 The base sequences of CALR-in1 and CALR-in3 are identical, and only fluorescent materials are prepared differently.
- the CALR-in3 probe was manufactured by binding fluorescence to 5 'in order to avoid interference with the PNA probe detecting CALR-del52.
- CALR-in1-3 did not detect the wild type, and therefore, CALR-in5p was used to detect the genetic variation.
- the CALR-del52 mutation is also recognized as a wild type from the CALR-ins5 position, resulting in a Tm value near 52 ° C (see FIG. 7). However, incomplete match occurs at the 3′-terminal C, indicating a slightly lower Tm than the wild type.
- the probes having the interference may be separated and configured to exist in different solutions (mixed composition 2), the problem of self quenching was solved and the mutation detection sensitivity was confirmed to increase (see FIGS. 15A and B).
- MPL W515L / K mutation were 3 consensus and 2 were false negative, but allele specific real-time PCR result confirmed that the amount of mutation was less than 10%.
- MPL W515S As a result of sequencing of one sample having a Tm value different from that of the existing setting, it was confirmed as MPL W515S.
- CALR type 1/2 mutations were 20 concordant, two false positive, and two false negative.
- the false-positive specimens were other exon9 mutations and were identified as deletions containing some of the type1 mutant probe positions and were determined to be detected as type1 mutations.
- False negative samples were identified as c.1105_1156del52 and c.1131_1151delinsGTGCCTCCTCCTGGAGG with 52bp and 4bp deletions, respectively.
- FCMA FCMA was performed on 96 wild-type DNAs to verify the specificity of the mixed composition 2, and it was confirmed that no abnormal curve was observed (see FIG. 18). Specificity was tested three times and each mutation of the causal gene was performed.
- Patient DNA of different causal genes were mixed to confirm multiple detection in different channels (FIGS. 20A, B). Multiple detection validation was performed three times each. Specifically, the test was performed by mixing the JAK2 V617F mutant and the MPL W515L / K mutant, the test was performed by mixing the JAKV V617F mutant and the CALR type 1/2, and the test was performed by mixing the MPL W515L / K mutant and the CALR type 1/2.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이를 다중검출할 수 있도록 제작된, 서열번호 7 내지 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브, 이를 포함하는 유전자 변이 다중검출 조성물, 키트 및 이를 사용하여 BCR/ABL 음성 골수증식종양 관련 유전자 변이를 다중검출하는 방법을 제공한다. 이를 통해, BCR/ABL 음성 골수증식종양 관련 유전자의 돌연변이를 한 번의 검출 과정으로 신속하고 정확하게 다중검출할 수 있으므로 BCR/ABL 음성 골수증식종양을 효과적으로 진단하여 질병의 진단, 추적관찰, 예후추정 및 치료 시에 유용하게 사용할 수 있다.
Description
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자변이를 다중검출하기 위한 펩티드핵산 프로브, 이를 포함하는 유전자변이 다중검출 조성물, 다중검출 키트 및 유전자변이 다중검출방법에 관한 것이다.
골수증식종양(myeloproliferative neoplasm, MPN)이란, 하나 이상의 혈구계열에서 성숙세포가 과도하게 생성되는 클론성 조혈모세포질환이며, 2008 WHO 분류에 따라 BCR/ABL1 양성 만성골수성백혈병(chronic myelogenous leukemia, CML), 만성호중구백혈병(chronic neutrophilic leukemia), 진성적혈구증가증(polycythaemia vera, PV), 일차골수섬유증(primary myelofibrosis, PMF), 진성고혈소판증가증(essential thrombocythaemia, ET), 만성호산구백혈병(chronic eosinophilic leukemia, NOS), 비만세포증(mastocytosis) 및 미분류 골수증식종양(myeloproliferative neoplasm, unclassifiable) 등이 이에 속한다.
진성적혈구증가증은 정상적인 적혈구 생성 조절기전과는 무관하게 적혈구 생성이 증가되는 특징을 갖는 골수증식종양으로 적혈구계뿐만 아니라 과립구계, 거대핵세포계도 동시에 증식하는 범혈구증가증(panmyelosis)을 초래한다. 진성혈소판증가증은 거대핵세포가 일차적으로 증식하는 골수증식종양으로 특징은 말초혈액에서 지속적인 혈소판증가증(450 x 109/L이상)을 보이고, 골수에서는 크고 성숙한 거대핵세포가 증가하며, 긴 무증상기를 보이나 혈전증이나 출혈경향을 나타낼 수 있다. 일차골수섬유증은 환자의 30%는 무증상으로, 비장비대 소견이나 혈액검사에서 빈혈, 백혈구증가, 혈소판증가를 보여 우연히 발견된다. 백적모세포증(leukoerythroblastosis)과 혈청내 LD 증가를 보이며 초기에는 진성혈소판증가증과 유사하게 심한 혈소판 증가를 보인다. 눈물방울모양의 적혈구를 동반한 대소부동변형적혈구증가증(anisopoikilocytosis)을 보이고, 골수는 세포충실도가 높으며 심한 레티쿨린 또는 콜라겐섬유화를 보여 말기에는 골수섬유화로 인한 골수부전을 유발한다.
Classic MPN으로 분류되는 진성적혈구증가증, 진성고혈소판증가증, 일차골수섬유증은 최근까지 뚜렷한 분자유전학적 표지자가 보고되지 않았으나, 2005년 야누스 티로신키나제 2 (Janus Tyrosine Kinase 2, JAK2) V617F 유전자 변이가 보고되면서 진단과 연구의 새로운 전환점을 맞이하게 되었다. 이 부위는 JAK2 단백의 pseudokinase autoinhibitory JH2 domain에 해당하며, 이 돌연변이에 의한 JAK2 티로신키나제의 구조적 활성화(constitutive activation)가 성장인자와 무관하게 세포의 증식을 일으키는 것이 확인되었다. c.1849G>T 또는 c.1849_1851delinsTTT 염기치환에 의해 발생하는 JAK2 V617F 돌연변이는 BCR/ABL 음성 골수증식종양의 발생에 관여하는 중요한 유전자 변이로 보고에 따라 다소 차이가 있지만 대체로 진성적혈구증가증의 90-95%, 진성고혈소판증가증의 35-70%, 일차골수섬유증의 50% 정도에서 검출된다. 따라서 진성적혈구증가증이 의심되는 환자에서 JAK2 V617F 돌연변이 유무가 진단에 매우 유용하다. 그러나 진성적혈구증가증에서는 95% 이상에서 양성인 반면, 진성고혈소판증가증와 일차골수섬유증에서는 30-40% 이상이 JAK2 V617F가 관찰되지 않아, JAK2 V617F 이 외 새로운 분자유전학적 표지자에 대한 필요성이 지속적으로 제기되어 왔다.
두번째로 트롬보포이에틴수용체(thrombopoietin receptor, TPO-R; myeloproliferative leukemia, MPL) 10번 엑손에 위치한 트립토판 (tryptophan)이 다른 아미노산으로 치환되는 MPL W515 돌연변이가 BCR/ABL 음성 골수증식종양에서 보고되었다. MPL W515 변이는 주로 BCR/ABL 음성 골수증식종양 중 진성고혈소판증가증과 일차골수섬유증에서 보고되어 있다. 이 돌연변이는 JAK2 V617F 음성 일차골수섬유증의 약 7-25%, 진성고혈소판증가증의 1-24%에서 관찰되고, 진성적혈구증가증에서 발생빈도는 매우 낮아 현재까지 단 2개의 증례만이 보고되었다. MPL W515 돌연변이의 아형은 지금까지 총 5가지가 알려져 있고, 트립토판이 류신(leucine)으로 치환되는 W515L, 라이신(lysine)으로 치환되는 W515K, 아르기닌(arginine)으로 치환되는 W515R, 알라닌(alanine)으로 치환되는 W515A, 세린(serine)으로 치환되는 W515S이다. 그 중 c.1544G>T염기치환에 의한 W515L과 c.1543_1544delinsAA 염기치환에 의한 W515K가 가장 흔하며, 진성고혈소판증가증에서 각각 55%, 21%, 일차골수섬유증에서 각각 93%, 7%로 W515L이 더 흔히 관찰된다. MPL W515 돌연변이와 임상양상의 연관성에 대한 몇몇 보고에 따르면, 진성고혈소판증가증의 경우, MPL W515 돌연변이를 가질 경우 JAK2 V617F 양성에 비해 혈색소와 총 백혈구수가 낮고 혈소판수가 높았다. 골수소견 상으로는 세포충실도가 비교적 낮고 적혈구 계열의 혈구수가 적었지만, 거대핵세포수는 비교적 많았다.
최근에 보고된 BCR/ABL 음성 골수증식종양과 관련된 칼레티큘린 유전자(CALR) 돌연변이는 JAK2 V617F/MPL W515 돌연변이 음성 골수증식종양 환자에서 대부분 관찰되어 BCR/ABL 음성 골수증식종양을 유발하는 새로운 원인 유전자로 밝혀졌다. Nangalia J 등의 연구는 151명의 BCR/ABL 음성 골수증식종양 환자를 대상으로 massive parallel sequencing을 시행하여 calreticulin을 부호화하는 CALR 유전자의 엑손 9번에서 반복되는 결손/중복 또는 삽입으로 인한 틀이동 돌연변이를 보고하였다(비특허문헌 1). 최근 연구에 의하면 CALR 유전자 돌연변이는 진성적혈구증가증에서 관찰되지 않았고 JAK2 V617F/MPL W515 돌연변이 음성 진성고혈소판증가증 환자의 67%에서, 일차골수섬유증 환자의 88%에서 관찰되었다(비특허문헌 2). 보고된 CALR 유전자 돌연변이의 대부분(약 80%)은 c.1092_1143del52 염기결손(L367fs*46, type 1)이 약 50%를 차지하고, c.1154_1155insTTGTC 염기삽입(K385fs*47, type 2)가 약 30%를 차지하는 hot spot이었다.
선별검사의 성격을 갖는 분자유전학적 체외진단검사의 필수 요건은 높은 민감도로 BCR/ABL 음성 골수증식종양의 분자유전학적 병인에 관여하는 주요 유전자 변이를 검출대상으로 선정하는 것이 매우 중요하다. 그러나 국내 기술에 의한 BCR/ABL 음성 골수증식종양 관련 유전자 돌연변이 다중검출을 위한 상용화된 체외진단법이 개발되어 있지 않으며 임상시험 자료도 부족하여 다중검출 분자유전학적 검사기술이 접목된 선별검사법을 개발하여 임상에 적용될 수 있도록 할 필요성이 시급하다.
상술한 과제를 해결하기 위하여, 본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이를 다중검출할 수 있도록 제작된, 서열번호 7 내지 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 제공한다.
본 발명의 일태양에 따르면, 상기 BCR/ABL 음성 골수증식종양 관련 유전자는 야누스 티로신키나제 2(JAK2), 트롬보포이에틴 수용체(MPL) 및 칼레티큘린(CALR) 중에서 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 유전자 변이는 (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (v) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (vi) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), (vii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46), 및 (viii) 칼레티큘린 유전자의 c.1154_1155insTTGTC 염기삽입(K385fs*47) 중에서 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F)은 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환에 의한 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L)은 c.1544G>T염기치환에 의한 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K)은 c.1543_1544delinsAA 염기치환에 의한 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 펩티드 핵산 프로브는 양 말단에 리포터(reporter) 및 소광자(quencher)가 결합되어 있는 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 리포터는 FAM(6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6- carboxy-4,7-dichlorofluorescein) 및 Cy5로 이루어진 군 중에서 선택되는 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 소광자는 TAMRA(6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 및 Dabcyl로 이루어진 군 중에서 선택되는 것을 특징으로 한다.
본 발명은 상기 상술한 펩티드 핵산 프로브를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출용 조성물을 제공한다.
본 발명은 상술한 유전자 변이 검출용 조성물을 유효성분으로 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 키트를 제공한다.
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이를 다중검출할 수 있도록 제작된 조성물로서, (i) 서열번호 7 및 9로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액; 또는 (ii) 서열번호 7 및 10으로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 9로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액으로 구성되고, 상기 제1용액과 제2용액은 혼합되지 않은 상태로 존재하여, 이를 각각 또는 순차적으로 대상 DNA 시료와 접촉하여 반응시킬 수 있도록 구성된 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물을 제공한다.
본 발명의 일태양에 따르면, 상기 유전자 변이 다중검출용 조성물의 제1용액에 포함되는 펩티드 핵산 프로브는 야누스 티로신키나제 2(JAK2) 및 칼레티큘린(CALR) 유전자 중 하나 이상에 상보적으로 결합하고, 상기 제2용액에 포함되는 펩티드 핵산 프로브는 트롬보포이에틴 수용체(MPL) 및 칼레티큘린(CALR) 유전자 중 하나 이상에 상보적으로 결합하는 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 유전자 변이 다중검출용 조성물의 제1용액은 (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), 및 (ii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46) 또는 c.1154_1155insTTGTC 염기삽입(K385fs*47)으로 이루어진 군에서 선택된 어느 하나 이상의 유전자 변이를 검출하고, 상기 제2용액은 (i) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), 및 (v) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46) 또는 c.1154_1155insTTGTC 염기삽입(K385fs*47)로 이루어진 군에서 선택된 어느 하나 이상의 유전자 변이를 검출하는 것을 특징으로 한다.
본 발명의 일태양에 따르면, (i) 상기 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F)은 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환에 의한 것, (ii) 상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L)은 c.1544G>T염기치환에 의한 것, 또는 (iii) 상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K)은 c.1543_1544delinsAA 염기치환에 의한 것을 특징으로 한다.
본 발명은 상기 상술한 유전자 변이 다중검출용 조성물을 유효성분으로 포함하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출 키트를 제공한다.
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이 부분을 특이적으로 증폭할 수 있도록 제작된, 서열목록 1 내지 6으로 이루어진 군에서 선택된 어느 하나 이상의 서열을 포함하는 프라이머를 제공한다.
본 발명은 대상 DNA 시료에 상술한 펩티드 핵산 프로브를 첨가하여 혼성화시키는 단계; 상기 혼성화된 산물을 온도를 변화시키면서 융해시켜 융해곡선을 얻는 단계; 및 상기 얻어진 융해곡선을 변이 유전자의 표준 융해온도와 비교하는 단계를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법을 제공한다.
본 발명의 일태양에 따르면, 상기 혼성화시키는 단계는, 대상 시료를 프라이머와 혼합하여 PCR을 수행하여 증폭하는 단계를 수행한 다음, 상기 증폭 산물에 펩티드 핵산 프로브를 첨가하여 혼성화시키는 단계를 수행하는 것을 특징으로 한다.
본 발명은 대상 DNA 시료에 상기 상술한 유전자 변이 다중검출용 조성물을 첨가하되, 상기 제1용액 및 제2용액을 각각 또는 순차적으로 첨가하여 혼성화시키는 단계; 상기 혼성화된 산물을 온도를 변화시키면서 융해시켜 융해곡선을 얻는 단계; 및 상기 얻어진 융해곡선을 변이 유전자의 표준 융해온도와 비교하는 단계를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법을 제공한다.
본 발명의 일태양에 따르면, 상기 혼성화시키는 단계는, 대상 시료를 프라이머와 혼합하여 PCR을 수행하여 증폭하는 단계를 수행한 다음, 상기 증폭 산물에 유전자 변이 다중검출용 조성물을 첨가하여 혼성화시키는 단계를 수행하는 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 프라이머는 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이 부분을 특이적으로 증폭할 수 있도록 제작된, 서열목록 1 내지 6으로 이루어진 군에서 선택된 어느 하나 이상의 서열을 포함하는 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 방법에 의하여 검출하는 유전자 변이는, (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (v) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (vi) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), (vii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46), 및 (viii) 칼레티큘린 유전자의 c.1154_1155insTTGTC 염기삽입(K385fs*47) 중에서 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 방법에 의하여 검출하는 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F) 변이는 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환인 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 방법에 의하여 검출하는 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L) 변이는 c.1544G>T염기치환인 것을 특징으로 한다.
본 발명의 일태양에 따르면, 상기 방법에 의하여 검출하는 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K) 변이는 c.1543_1544delinsAA 염기치환인 것을 특징으로 한다.
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자의 변이를 신속하고 정확하게 다중검출할 수 있는 펩티드핵산 프로브를 제공하여, 이를 사용하여 상기 유전자의 변이를 효과적으로 검출할 수 있으며, 나아가 BCR/ABL 음성 골수증식종양과 관련된 유전자 돌연변이를 한 번 시행하여 신속 및 효과적으로 다중검출하여 질병진단, 추적관찰, 예후추정 및 치료 시에 유용하게 사용할 수 있다.
도 1은 JAK2 유전자의 염기변이 위치와 PNA 프로브, 프라이머 위치를 나타내는 도면이다.
도 2는 MPL 유전자의 염기변이 위치와 PNA 프로브, 프라이머 위치를 나타내는 도면이다.
도 3은 CALR 유전자의 염기변이 위치와 PNA 프로브, 프라이머 위치를 나타내는 도면이다.
도 4는 본 발명의 실시예에 따른 JAK2-2 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 5는 본 발명의 실시예에 따른 MPL-3 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 6은 본 발명의 실시예에 따른 CALR-del4 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 7은 본 발명의 실시예에 따른 CALR-ins5p 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 8은 본 발명의 실시예에 따라 BCR/ABL 음성 골수증식종양 환자 DNA를 이용하여 관련 유전자변이 융해곡선를 나타낸 그래프이다.
도 9는 BCR/ABL 음성 골수증식종양 환자 DNA를 이용한 관련 유전자변이 융해곡선을 나타낸 그래프이다.
도 10은 JAK2 유전자의 다양한 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 11은 MPL 유전자의 다양한 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 12는 CALR 유전자의 다양한 결실 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 13은 CALR 유전자의 결실 변이를 검출하는 펩티드핵산 프로브와 샘플을 이용한 융해곡선 그래프이다.
도 14는 CALR 유전자의 다양한 삽입 변이를 검출하는 펩티드핵산 프로브와 합성 DNA를 이용한 융해곡선 그래프이다.
도 15은 본 발명에 따른 조성물의 간섭 효과를 최소화하기 위하여 1용액(A set)과 2용액(B set)으로 나누어 구성한 조성물의 민감도를 확인한 결과이다.
도 16은 1용액(A set)과 2용액(B set)으로 나누어 구성한 본 발명의 조성물의 검출한계를 확인한 결과이다.
도 17은 1용액(A set)과 2용액(B set)으로 나누어 구성한 본 발명의 조성물의 민감도를 확인한 결과이다.
도 18은 1용액(A set)과 2용액(B set)으로 나누어 구성한 본 발명의 조성물의 특이성을 검증한 결과이다.
도 19은 1용액(A set)과 2용액(B set)으로 나누어 구성한 본 발명의 조성물의 동일 원인 유전자의 다중검출을 검증한 결과이다.
도 20은 1용액(A set)과 2용액(B set)으로 나누어 구성한 본 발명의 조성물의 다른 원인 유전자의 다중검출을 검증한 결과이다.
도 21은 1용액(A set)과 2용액(B set)으로 나누어 구성한 본 발명의 조성물의 6개 원인 유전자 모두의 다중검출을 검증한 결과이다.
상기 상술한 목적을 달성하기 위한 본 발명은, BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이를 다중검출할 수 있도록 제작된, 서열번호 7 내지 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브, 이를 포함하는 유전자 변이 다중검출 조성물, 키트 및 이를 사용하여 BCR/ABL 음성 골수증식종양 관련 유전자 변이를 다중검출하는 방법을 제공한다. 이하 도면을 참조하여 본 발명을 구체적으로 설명한다.
본 출원에서 사용한 용어는 단지 특정한 실시 예를 설명하기 위해 사용된 것으로, 본 발명을 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 출원에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다. 제1, 제2 등의 용어는 다양한 구성요소들을 설명하는데 사용될 수 있지만, 상기 구성요소들은 상기 용어들에 의해 한정되어서는 안 된다. 상기 용어들은 하나의 구성요소를 다른 구성요소로부터 구별하는 목적으로만 사용된다.
또한, '표적핵산'은 검출하고자 하는 핵산서열을 의미하며, 혼성화, 어닐링 또는 증폭 조건 하에서 프라이머 또는 프로브와 어닐링 또는 혼성화된다. '표적핵산'은 본 명세서에서 사용되는 용어 '타겟핵산', '타겟핵산서열' 또는 '타겟서열'과 차이가 없으며, 본 명세서에서 혼용된다.
본 발명의 '혼성화'는 상보적인 단일가닥 핵산들이 이중-가닥 핵산을 형성하는 것을 의미한다. 혼성화는 2개의 핵산 가닥 간의 상보성이 완전할 경우(perfect match) 일어나거나 또는 일부 부정합(mismatch) 염기가 존재하여도 일어날 수 있다. 혼성화에 필요한 상보성의 정도는 혼성화 조건에 따라 달라질 수 있으며, 특히 온도에 의하여 조절될 수 있다.
본 발명의 '유전자변이'는 표적핵산의 염기서열에 변이가 일어난 것으로, 단일염기다형성(SNP; single nucleotide polymorphism)뿐만 아니라, 염기의 치환, 결실 또는 삽입되어 변이가 일어난 것을 포함하는 것을 특징으로 하며, 본 발명의 PNA 프로브는 표적핵산의 SNP 또는 표적핵산의 염기가 치환, 결실 또는 삽입되어 변이가 일어난 것을 융해곡선분석을 통해 분석할 수 있다.
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 유전자 변이를 다중검출할 수 있도록 제작된, 서열번호 7 내지 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 제공한다. 보다 구체적으로는 표적핵산의 유전자 변이를 다중검출하며, 일례로 BCR/ABL 음성 골수증식종양 관련 유전자는 야누스 티로신키나제 2(JAK2), 트롬보포이에틴 수용체(MPL) 및 칼레티큘린(CALR) 중에서 선택된 어느 하나 이상이다.
보다 구체적으로는 상기 유전자 변이는 (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (v) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (vi) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), (vii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46), 및 (viii) 칼레티큘린 유전자의 c.1154_1155insTTGTC 염기삽입(K385fs*47) 중에서 선택된 어느 하나 이상인 것이 바람직하다. 일례로, 상기 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F)은 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환에 의한 것, 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L)은 c.1544G>T염기치환에 의한 것, 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K)은 c.1543_1544delinsAA 염기치환에 의한 것일 수 있다.
또한 본 발명에서 상기 야누스 티로신키나제 2 유전자는 NCBI 번호인 JAK2_NM_004972.3에 기재된 염기서열로 구성되어 있으며, 이의 아미노산 서열은 NP_004963.1에 기재된 아미노산 서열로 이루어진 것일 수 있다.
또한, 상기 트롬보포이에틴 수용체 유전자는 NCBI 번호인 MPL_NM_005373.2 에 기재된 염기서열로 구성되어 있으며, 이의 아미노산 서열은 NP_005364.1에 기재된 아미노산 서열로 이루어진 것일 수 있다.
또한, 상기 칼레티큘린 유전자는 NCBI 번호인 CALR_NM_004343.3에 기재된 염기서열로 구성되어 있으며, 이의 아미노산 서열은 NP_004334.1에 기재된 아미노산 서열로 이루어진 것일 수 있다.
선별검사의 성격을 갖는 분자유전학적 체외진단검사의 필수 요건은 높은 민감도로 BCR/ABL 음성 골수증식종양의 분자유전학적 병인에 관여하는 JAK2, MPL, CALR 유전자에서 흔하게 관찰되는 돌연변이를 검출대상으로 선정하는 것이 매우 중요하므로, JAK2 V617F, MPL W515L/K, CALR L367fs*46/K385fs*47 돌연변이를 검출대상으로 선정하였다. BCR/ABL 음성 골수증식종양 진단 시 아형 분류를 위한 관련 돌연변이(JAK2 V617F, MPL W515L/K, CALR L367fs*46/K385fs*47 mutation) 선별진단용 다중검출 검사키트 개발 및 상품화는 BCR/ABL 음성 골수증식종양의 치료방침이 다르므로 의심되는 신환에서 정확한 진단이 매우 중요하며 관련 유전자 돌연변이의 검출이 진단의 정확도를 높이는데 유용하다. 따라서, 본 발명은 대표적인 유전자 변이인 JAK2 V617F, MPL W515L/K, CALR L367fs*46/K385fs*47 돌연변이 여부를 신속하고 정확하게 다중검출하는 것이 가능하다.
본 발명에 따른 PNA 염기서열의 길이는 특별히 제한되지는 않지만, BCR/ABL 음성 골수증식종양에 관련되어있는 JAK2, MPL, CALR의 SNP 및 Indel을 포함하는 9~16 mer 길이로 제작할 수 있다. PNA 프로브의 길이를 조절하여 원하는 Tm값을 가지도록 프로브를 design 할 수도 있고, 같은 길이의 PNA 프로브라도 염기서열에 변화를 주어 Tm 값을 조절하는 것도 가능하다. 또한, PNA는 DNA보다 결합력이 우수하여 기본적인 Tm값이 높기 때문에 DNA보다 짧은 길이로 design이 가능하여 가깝게 이웃한 SNP라도 detection이 가능하다. 기존의 HRM method에 의하면 Tm값의 차이가 약 0.5℃로 매우 적어서 추가적인 분석프로그램이나 세밀한 온도 변화 또는 보정을 필요로 하고, 이 때문에 2개 이상의 SNP가 나타날 경우에는 분석이 어려웠지만, 본 발명에 따른 PNA 프로브는 프로브 sequence와 SNP에 대해서는 영향을 받지 않아 간편하게 분석이 가능하다.
상기 펩티드 핵산 프로브는 양 말단에 리포터(reporter) 및 소광자(quencher)가 결합될 수 있다. 상기 리포터는 FAM(6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6- carboxy-4,7-dichlorofluorescein) 및 Cy5로 이루어진 군 중에서 선택될 수 있고, 소광자는 TAMRA(6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 및 Dabcyl로 이루어진 군 중에서 선택될 수 있다.
본 발명은 상기 상술한 펩티드 핵산 프로브를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출용 조성물을 제공한다.
본 발명은 상술한 유전자 변이 다중검출용 조성물을 유효성분으로 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 키트를 제공한다. 상기 키트는 버퍼, DNA 중합효소 조인자 및 데옥시리보뉴클레오타이드-5-트리포스페이트와 같은 타겟 증폭반응(예컨대, PCR 반응)을 실시하는데 필요한 시약을 선택적으로 포함할 수 있다. 또한, 본 발명의 키트는 또한 다양한 폴리뉴클레오타이드 분자, 역전사효소, 다양한 버퍼 및 시약, 및 DNA 중합효소 활성을 억제하는 항체를 포함하는 것도 가능하다. 상기 키트를 이용하면, PNA 프로브에 의한 용해곡선 분석을 통하여 표적핵산의 단일염기변이 및 염기의 결손 또는 삽입에 의한 변이를 효과적으로 다중검출할 수 있고, 이를 통하여 BCR/ABL 음성 골수증식종양 관련 유전자변이 유무와 다중검출이 가능하다.
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이를 다중검출할 수 있도록 제작된 조성물로서, (i) 서열번호 7 및 9로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액; 또는 (ii) 서열번호 7 및 10으로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 9로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액으로 구성되고, 상기 제1용액과 제2용액은 혼합되지 않은 상태로 존재하여, 이를 각각 또는 순차적으로 대상 DNA 시료와 접촉하여 반응시킬 수 있도록 구성된 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물을 제공한다.
상기와 같이 구성하는 경우, 동일하거나 유사한 유전자 위치에 결합하는 펩티드 핵산 프로브 간에 간섭 현상이나 결합 방해 현상을 최소화하여 보다 정밀하고 정확한 검출이 가능해진다. 즉, 야누스 티로신키나제 2(JAK2)에 대한 펩티드 핵산 프로브와 트롬보포이에틴 수용체(MPL)에 대한 펩티드 핵산 프로브를 혼합하여 동시에 처리하는 경우, 두 프로브간 간섭 현상으로 인한 자기 소광이 일어날 수 있어 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F) 변이에 대한 정확도 및 민감도가 감소할 우려가 있다. 또한, 칼레티큘린(CALR) 유전자에 대한 염기서열 결핍 및 추가를 검출하려고 이들 각각에 대한 펩티드 핵산 프로브를 혼합하여 동시에 처리하는 경우 역시, 두 프로브의 결합위치가 너무 가깝기 때문에 결합과정에서 칼레티큘린 유전자의 염기결손 변이에 대한 검출 정확도 및 민감도가 감소할 우려가 있다. 따라서, 이들을 적당하게 나누어 제1용액 및 제2용액에 포함될 수 있도록 구성하면 상기 문제점을 해결할 수 있다. 상기 제1용액 또는 제2용액이라는 용어는, 2 이상의 펩티드 핵산 프로브를 혼합 시 이를 하나의 용액에 모두 혼합시키는 것이 아니라 2 이상의 용액에 나누어 혼합시켜 검출용 조성물을 준비한다는 의미일 뿐, 대상 DNA 시료와 접촉하거나 검출하는 순서를 의미하는 것은 아니다.
본 발명의 일태양에 따르면, 상기 유전자 변이 다중검출용 조성물의 제1용액에 포함되는 펩티드 핵산 프로브는 야누스 티로신키나제 2(JAK2) 및 칼레티큘린(CALR) 유전자 중 하나 이상에 상보적으로 결합하고, 상기 제2용액에 포함되는 펩티드 핵산 프로브는 트롬보포이에틴 수용체(MPL) 및 칼레티큘린(CALR) 유전자 중 하나 이상에 상보적으로 결합할 수 있다.
본 발명의 일태양에 따르면, 상기 유전자 변이 다중검출용 조성물의 제1용액은 (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), 및 (ii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46) 또는 c.1154_1155insTTGTC 염기삽입(K385fs*47)으로 이루어진 군에서 선택된 어느 하나 이상의 유전자 변이를 검출하고, 상기 제2용액은 (i) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), 및 (v) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46) 또는 c.1154_1155insTTGTC 염기삽입(K385fs*47)로 이루어진 군에서 선택된 어느 하나 이상의 유전자 변이를 검출할 수 있다.
본 발명은 상기 상술한 유전자 변이 다중검출용 조성물을 유효성분으로 포함하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출 키트를 제공한다.
본 발명은 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이 부분을 특이적으로 증폭할 수 있도록 제작된, 서열목록 1 내지 6으로 이루어진 군에서 선택된 어느 하나 이상의 서열을 포함하는 프라이머를 제공한다.
본 발명의 또 다른 일태양은, 대상 DNA 시료에 상술한 펩티드 핵산 프로브를 첨가하여 혼성화시키는 단계; 상기 혼성화된 산물을 온도를 변화시키면서 융해시켜 융해곡선을 얻는 단계; 및 상기 얻어진 융해곡선을 변이 유전자의 표준 융해온도와 비교하는 단계를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법을 제공한다.
본 발명자들은 BCR/ABL 음성 골수증식종양과 관련된 JAK2, MPL, CALR 유전자들을 비교 분석하여, 표 2의 염기서열로 이루어진 군에서 선택된 하나 이상의 염기서열 각각을 포함하는 PNA를 제작하였고, 이러한 PNA를 이용하여 BCR/ABL 음성 골수증식종양 환자 샘플로부터 융해곡선을 얻었으며, 상기 융해곡선으로부터 융해온도(Tm)를 확인한 결과, 후술하는 실시 예에서 확인할 수 있는 바와 같이, 유전자변이에 따른 서로 다른 결과를 얻을 수 있었다.
상기 혼성화시키는 단계는 본 발명에 따른 PNA를 BCR/ABL 음성 골수증식종양 의심 환자 DNA 샘플과 반응시키는 것이다. 이 단계는 상기 혼성화시키는 단계는, 대상 시료를 프라이머와 혼합하여 PCR을 수행하여 증폭하는 단계를 수행한 다음, 상기 증폭 산물에 펩티드 핵산 프로브를 첨가하여 혼성화시키는 단계일 수 있다. 즉, 혼성화 단계는 PCR 과정을 포함할 수 있고, PCR을 위한 정방향/역방향 프라이머 셋트를 이용하는 것이 가능하다. 이러한 혼성화 단계와 PCR 조건은 이 기술분야에서 보통의 지식을 가진 자(이하, '당업자'라고 함)에게 널리 알려진 다양한 모든 방법을 포함할 수 있다. 또한, PCR이 끝난 후에는 용융 과정을 포함하는 것도 가능하다.
그런 다음, 상기 온도별 융해곡선을 얻는 단계는 BCR/ABL 음성 골수증식종양 의심 환자 DNA 샘플의 융해온도(Tm)를 얻기 위한 것이다. 이를 위하여, 상기 혼성화시킨 산물의 온도를 높이면서 형광의 세기를 측정하여, 온도에 따른 형광세기 변화를 온도별 융해곡선으로 얻을 수 있다. 즉, Hybridization methode 분석방법으로서 FMCA (Fluorescence Melting Curve Analysis)를 이용할 수 있고, 상기 FMCA는 PCR 반응이 끝나고 난 후 만들어진 산물과 넣어준 프로브간의 결합력의 차이를 Tm으로 구분하여 분석하는 것이다. 예를 들어, 일반적인 실시간 PCR 장치를 이용하여, 1℃ 증가시킬 때 마다 형광의 세기를 측정함으로서 Tm값을 얻을 수 있다.
이어서, 상기 BCR/ABL 음성 골수증식종양 관련 유전자변이를 다중검출하는 단계는 상기 얻은 융해곡선의 융해온도로부터 유전자변이의 유무와 종류를 다중검출하는 것이다. 예를 들어, 상기 얻은 융해곡선의 융해온도를 기 알고 있는 유전자변이 차이에 따른 융해온도와 비교하여 염기변이의 유무와 종류를 다중검출할 수 있다. 유전자변이마다 본 발명에 따른 PNA를 적용한 융해곡선은 서로 다른 융해온도(Tm)를 가지고 있고(도 4 내지 도 7 참조), 이러한 차이를 이용하여 유전자변이 유무와 종류의 다중검출이 가능하다.
본 발명은 상기에서 상술한 바와 같이 간섭현상이 최소화될 수 있도록 제1용액 및 제2용액으로 나누어 구성한 유전자 변이 다중검출용 조성물을 대상 DNA 시료에 각각 또는 순차적으로 첨가하여 혼성화시키는 단계; 상기 혼성화된 산물을 온도를 변화시키면서 융해시켜 융해곡선을 얻는 단계; 및 상기 얻어진 융해곡선을 변이 유전자의 표준 융해온도와 비교하는 단계를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법을 제공한다. 이를 통해 다중 유전자에 대한 동시 검출시 발생할 수 있는 간선 현상 등을 최소화할 수 있다.
간섭현상이 최소화될 수 있도록 제1용액 및 제2용액으로 나누어 구성한 유전자 변이 다중검출용 조성물은, (i) 서열번호 7 및 9로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액; 또는 (ii) 서열번호 7 및 10으로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 9로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액으로 구성되고, 상기 제1용액과 제2용액은 혼합되지 않은 상태로 존재하여, 이를 각각 또는 순차적으로 대상 DNA 시료와 접촉하여 반응시킬 수 있도록 구성된 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물이다.
본 발명의 일태양에 따르면, 상기 혼성화시키는 단계는, 대상 시료를 프라이머와 혼합하여 PCR을 수행하여 증폭하는 단계를 수행한 다음, 상기 증폭 산물에 유전자 변이 다중검출용 조성물을 첨가하여 혼성화시키는 단계를 수행할 수 있다.
상기 프라이머는 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이 부분을 특이적으로 증폭할 수 있도록 제작된, 서열목록 1 내지 6으로 이루어진 군에서 선택된 어느 하나 이상의 서열을 포함할 수 있다.
상기 방법에 의하여 검출하는 유전자 변이는, (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (v) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (vi) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), (vii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46), 및 (viii) 칼레티큘린 유전자의 c.1154_1155insTTGTC 염기삽입(K385fs*47) 중에서 선택된 어느 하나 이상일 수 있다.
상기 방법에 의하여 검출하는 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F) 변이는 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환인 것, 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L) 변이는 c.1544G>T염기치환인 것, 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K) 변이는 c.1543_1544delinsAA 염기치환일 수 있다.
이하에서는 실시 예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 다만, 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다 할 것이다.
실시예
1:
BCR
/
ABL
음성 골수증식종양 관련
유전자변이
다중검출용
펩티드핵산의
제조
본 실시예에서는, 다양한 BCR/ABL 음성 골수증식종양 관련 유전자 중에서 JAK2, MPL, CALR의 유전자를 선택하였다. 그리고 상기 BCR/ABL 음성 골수증식종양 의심 환자의 DNA를 주형으로 PCR을 수행하기 위해 JAK2, MPL, CALR의 프라이머를 제조하였다.
도 1 내지 도 3은 본 발명에 따른 JAK2, MPL, CALR유전자 일부와 SNP와 Indel 및 이로부터 도출된 PNA의 염기서열 일례를 나타내는 염기서열도이다. 도 1 내지 도 3에서, 각 유전자별 염기변이는 붉은색 또는 로 표기하였고, 이를 바탕으로 한 본 발명에 따른 PNA의 염기서열은 노란색 박스 안에 프라이머는 염기시작과 끝에 붉은색으로 표기하였다.
이와 같이, 본 발명에 따른 유전자 증폭을 위한 프라이머 염기서열을 결정하였고, 하기 표 1에 나타내었다.
| 명칭 | 방향 | 염기서열(5'-3') | 길이 (bp) | 용융온도 (℃) | 크기(bp) | |
| JAK2m | F(정방향) | AGCAGCAAGTATGATGAGCAAGC(서열번호1) | 23 | 63.10 | 122 | |
| R(역방향) | CAGATGCTCTGAGAAAGGCATTA(서열번호2) | 23 | 60.87 | |||
| MPLm | F | GATCTCCTTGGTGACCGCTCT(서열번호3) | 21 | 63.00 | 102 | |
| R | GGGCGGTACCTGTAGTGTGC(서열번호4) | 20 | 62.82 | |||
| CALRm | F | GCAGCAGAGAAACAAATGAAGGA(서열번호5) | 23 | 62.94 | 206 | 결실(del)=154 |
| R | CCTCTCTACAGCTCGTCCTTGG(서열번호6) | 22 | 62.68 | 삽입(ins)=211 | ||
| 명칭 | 유전자변이 | 염기서열(5'-3' Fluorescence) | 완전일치 표적 Perfect match target |
| JAK2-2 | V317F(TTC, TTT) | Dabcyl-GTATGTGTCTGTGG-O-K(Cy5)(서열번호7) | Wild type |
| MPL-3 | W515L, W515K | Dabcyl-CTGAGGTGGCAGT-O-K(FAM)(서열번호8) | Wild type |
| CALR-d4 | 1092_1143del52 | Dabcyl-AAGCCTCTGCTCCTC-O-K(HEX)(서열번호9) | Wild type |
| CALR-in5p | 1154_1155insTTGTC | Dabcyl-CAATTGTCCTCTGCC-O-K(Texas Red)(서열번호10) | c.1154_1155insTTGTC |
* 상기 표 2에서 O는 링커 및 K는 라이신(lysine)을 의미한다.
PNA 프로브는 4개의 프로브를 모두 하나의 튜브에서 실시하는 multiplex 형태로 프라이머 셋트 3개와 4개의 PNA 프로브 조합으로 진행하였다. 조합에는 같은 형광이 겹치지 않도록 제작하였다. 그런 다음, 상기 표 2에 나타난 바와 같은 염기서열과 리포터 및 소광자로 본 발명에 따른 PNA 프로브를 제작하였다. 본 발명에서 사용한 모든 PNA 프로브(FAM, HEX, Texas Red, Cy5-labeled, Dabcyl)는 파나진(Panagene, 한국)에서 HPLC 정제방법을 통해 합성하였고, 합성된 모든 프로브의 순도는 질량분석법을 이용하여 확인하였으며, 표적핵산과의 더 효과적인 결합을 위해 프로브의 불필요한 이차구조는 피하였다.
실시예
2:
BCR
/
ABL
음성 골수증식종양 관련
유전자변이
다중검출용
펩티드핵산의
융해곡선분석
상기 실시예 1에 따라 제작된 본 발명에 따른 PNA를 이용하여, BCR/ABL 음성 골수증식종양 관련 유전자변이 DNA 샘플에 대하여 용해곡선을 도출하였다.
융해곡선분석은 CFX96™ Real-Time 시스템(BIO-RAD 사, 미국)을 이용하여 수행하였다. 비대칭 PCR의 조건은 다음과 같다; 총 볼륨이 20㎕ 이 되도록 10㎕의 2X qPCR PreMix(시선바이오, 한국)에 0.5㎕ 프로브(상기 실시예 1에서 제조된 PNA 프로브), 1㎕ 합성 유전자 염기변이 DNA(네오프로브, 한국, 표3)를 첨가한 다음 융해곡선분석을 실시하였다.
| 명칭 | 염기서열(5'-3') | Type | |
| 1 | JAK2_PM | GTCTCCACAGACACATACTCC(서열번호11) | JAK2 Wild type |
| 2 | JAK2_1MM | GTCTCCACAGAAACATACTCC(서열번호12) | JAK2 V617F (TTC) |
| 3 | JAK2_2MM | GTCTCCACAAAAACATACTCC(서열번호13) | JAK2 V617F (TTT) |
| 4 | MPL-3_PM | TGCTGAGGTGGCAGTTTC(서열번호14) | MPL Wild type |
| 5 | MPL-3_MM1 | TGCTGAGGTTGCAGTTTC(서열번호15) | MPL W515L (TTG) |
| 6 | MPL-3_MM2 | TGCTGAGGAAGCAGTTTC(서열번호16) | MPL W515K (AAG) |
| 7 | CALR-d4_PM | ACGAGGAGCAGAGGCTTAA(서열번호17) | CALR Wild type |
| 8 | CALR-d4_MM | ACGAGGAGCAGAGGACAA(서열번호18) | CALR del52 (c.1092_1143del52) |
| 9 | CALR-ins5p_PM | GGAGGCAGAGGACAATTGTC(서열번호19) | CALR ins5(c.1154_1155insTTGTC) |
| 10 | CALR-ins5p_MM1 | GGAGGCAGAGGACAAGGAGG(서열번호20) | CALR Wild type |
| 11 | CALR-ins5p_MM2 | CGAGGAGCAGAGGACAAGGAGG(서열번호21) | CALR Wild type |
도 4 내지 도 6은 본 발명의 실시예에 따라 PNA 프로브와 유전자변이를 가지는 합성 DNA 샘플을 혼성화시키고, 상기 혼성화시킨 산물의 온도를 높이는 과정에서 나타나는 Tm값을 얻기 위한 melting peak를 나타낸다. 여기에서는, 실시간 PCR 기기의 융해과정은 95℃에서 3분간 변성시킨 다음, 75℃에서 30초, 65℃에서 30초, 55℃에서 30초, 45℃에서 30초, 35℃에서 30초, 25℃에서 30초, 20℃에서 50초 동안 반응시켰으며, 이후 80℃까지 1℃ 올리고 10초간 기다린 후 형광을 측정하였다. 이는 PNA 프로브가 합성된 DNA 올리고머와 정확하게 혼성화되도록 하기 위함이다.
| 프로브 | 유전자변이 | 야생형 | 유전자변이 | 혼합형 Heterozygote (변이형 & 야생형) | 혼합형 Heterozygote (변이형 & 변이형) |
| JAK2-2 | V617F (TTC) | 60±3℃ | 46±3℃ | 46℃ & 60℃ | 30℃ & 46℃ |
| V617F (TTT) | 30±3℃ | 30℃ & 60℃ | |||
| MPL-3 | W515L | 70±3℃ | 57±3℃ | 57℃ & 70℃ | 44℃ & 57℃ |
| W515K | 44±3℃ | 44℃ & 70℃ | |||
| CALR-d4 | del52 | 62±3℃ | 50±3℃ | 50℃ & 62℃ | - |
| CALR-in5p | ins5 | 55±3℃ | 63±3℃ | 63℃ & 55℃ | - |
* Bold : 완전일치, Perfect match(= full matched)
표 4에서는 앞선 혼성화 반응에서 도출된 Tm값을 정리한 것으로 Tm값 분석을 통해서 해당 유전자변이를 확인할 수 있다. 또한 제작된 PNA 프로브가 각각의 유전자변이에 대해서 다른 Tm값을 얻어 미지의 표적핵산에 대한 염기변이를 검출할 수 있다.
실시예
3:
BCR
/
ABL
음성 골수증식종양 관련 환자 샘플 DNA를 이용한
펩티드핵산의
융해곡선 분석
상기 실시예 1에 따라 제작된 본 발명에 따른 PNA를 이용하여, BCR/ABL 음성 골수증식종양 관련 유전자변이 DNA 샘플에 대하여 용해곡선을 도출하였다. PCR은 CFX96™ Real-Time 시스템(BIO-RAD 사, 미국)을 이용하여 수행하였으며, 모든 실험 조건은 단일가닥 표적핵산을 생성하기 위해 비대칭 PCR(asymmetric PCR)을 이용하였다. 비대칭 PCR의 조건은 다음과 같다; 총 볼륨이 20㎕ 이 되도록 2X qPCR PreMix (시선바이오, 한국), 0.05μM 정방향 프라이머 및 0.5μM 역방항 프라미어(asymmetric PCR)에 0.5㎕ 프로브(상기 실시예 1에서 제조된 PNA 프로브) 4종, 1㎕ BCR/ABL 음성 골수증식종양 의심환자 DNA를 첨가하고, 나머지는 DW로 보충한 다음 실시간 PCR을 실시하였다.
도 8은 본 발명의 실시 예에 따라 BCR/ABL 음성 골수증식종양 환자 DNA를 혼성화시키고, 상기 혼성화시킨 산물의 온도를 높이는 과정의 일례를 설명하기 위한 그래프이다. 여기에 나타난 바와 같이, 리얼타임 PCR 과정은 95℃에서 10분간 변성시킨 다음, 95℃에서 30초, 58℃에서 30초, 74℃에서 45초 동안 반응시켰다. 이를 40 cycle 반복하였고, 실시간으로 형광을 측정하였다. 융해곡선 분석은 95℃에서 3분간 변성시킨 다음, 75℃에서 30초, 65℃에서 30초, 55℃에서 30초, 45℃에서 30초, 35℃에서 30초, 25℃에서 30초, 20℃에서 50초 동안 반응시켰으며, 이후 80℃까지 1℃ 상승시키며 형광을 측정하는 용해곡선 분석을 수행하였다. 각 단계 사이마다 10초간 정지 상태를 유지하였다(도 8 참조).
도 9는 각각 본 발명에 따른 각각의 펩티드핵산을 BCR/ABL 음성 골수증식종양 환자 DNA에 대하여 적용하여 얻은 온도별 융해곡선 그래프의 일례이다. 도 9 각각에서, 6개 융해곡선은 4개의 프로브와 3개의 PCR 프라이머 셋트가 동시에 들어있는 1개 튜브에서 실시한 것이며 이중에서 해당 변이형이 있는 형광을 표시한 것이다. 해당 변이형 이외에 다른 유전자에서는 모두 야생형의 Tm값 및 용융점(melting peak)이 관찰되었다. 위 3개는 좌측으로부터 JAK2-2(Cy5), JAK2-2(Cy5), MPL-3(FAM)이고 아래 3개는 좌측으로부터 MPL-3(FAM), CALR-ins5p(Texas Red), CALR-d4(HEX)의 순이다. 도 9에 나타난 바와 같이, BCR/ABL 음성 골수증식종양 환자 DNA에서 본 발명에 따른 PNA를 적용한 융해곡선은 서로 다른 융해온도(Tm)를 가지고 있음을 확인할 수 있다. 또한, 야생형 DNA와 비교하여 서로 다른 융해온도(Tm) 차이가 발생하는 것을 확인할 수 있다.
| 샘플 | JAK2-2 | MPL-3 | CALR-d4 | CALR-in5p | 유전자 변이 |
| 1번 | 30℃&60℃ | 70℃ | 62℃ | 55℃ | JAK2 V617F |
| 2번 | 46℃ | 70℃ | 62℃ | 55℃ | JAK2 V617F |
| 3번 | 60℃ | 44℃&70℃ | 62℃ | 55℃ | MPL W515K |
| 4번 | 60℃ | 57℃&70℃ | 62℃ | 55℃ | MPL W515L |
| 5번 | 60℃ | 70℃ | 62℃ | 55℃&63℃ | CALR ins5 |
| 6번 | 60℃ | 70℃ | 50℃&62℃ | 55℃ | CALR del52 |
* Bold: BCR/ABL 음성 골수증식종양 관련 유전자변이를 포함하는 결과
* Italic: 정상인의 유전자 염기의 Tm 온도
표 5는 상기 도 9의 온도별 융해곡선 그래프로부터 얻은 융해온도(Tm)를 정리한 표의 일례이다. 표 5에서, 굵고 밑줄로 표시된 것은(온도표시) 해당 유전자변이를 가지고 있음을 표시한다. 상기 표 5에 나타난 Tm값을 바탕으로 JAK2, MPL, CALR 유전자의 염기변이를 다중검출할 수 있다.
실시예 4: 효과적인 유전자 변이 검출 펩티드핵산 프로브 선별 과정
효과적인 유전자 변이 검출 펩티드핵산 프로브를 선별하기 위하여 JAK2, MPL, CALR 유전자의 다양한 유전자 변이에 대한 펩티드핵산 프로브를 제작하여 실험을 수행하였다.
(1) JAK2 유전자 변이
JAK2-3 프로브는 표 6에서 보는 염기서열로 합성하려 하였으나, JAK2-1, JAK2-2를 먼저 확인한 다음에 진행하기 위해서 제작하지 않았다. JAK2-1은 30℃ 부근에 프로브 다이머로 보이는 피크가 나타나서 이후 진행을 하지 않고, JAK2-2를 선택하였다.(도 10 참고)
(2) MPL 유전자 변이
MPL은 3개의 후보 중에서 MLP-1, MPL-2는 W515L과 W515K를 구분하지 못하고 모두 같은 Tm값을 가져 탈락하였고 MPL-3 프로브를 선택하여 진행하였다. (도 11 참고) MPL-3는 MLP-1, MPL-2에 결합하는 스트랜드가 아닌 반대쪽 스트랜드에 맞게 제작하였다. 이는 TG>TT vs TG>AA로 변하여서 생기는 Tm값의 차이가 CA>AA vs CA>TT로 바뀌어서 생기는 Tm값의 차이가 크기 때문에 사용 가능한 부분이다.
(3)
CALR 결실 변이
CALR-d1은 야생형과 결실변이에 해당하는 DNA 올리고에서 좋지 않은 용융점(melting peak)를 나타내어 탈락하였다. CALR-d2, CALR-d3 프로브는 같은 서열을 가지나 형광의 종류만 다르게 제작하였으며, 야생형과 결실변이에 해당하는 DNA 올리고에서는 좋은 Tm값과 용융점을 가졌으나 실제 샘플에서는 프로브로 잡은 서열이 표적에 반복적으로 나타나는 현상 때문에 야생형에 해당하는 부분에 변이형에 해당하는 피크(도 12의 붉은 화살표)를 나타내어 야생형임에도 불구하고 변이형이 포함된 것으로 판단할 가능성이 있어 탈락하였다. (도 12 참고) 도 13에는 샘플을 이용한 용융점 분석을 나타낸 그래프이다.
(4) CALR 삽입 변이
삽입변이를 검출하기 위해서는 완전 일치하는 표적핵산을 변이형으로 하고 비완전 매치를 야생형으로 하였을 때 검출이 용이하기 때문에 이에 삽입된 변이를 완전 일치 표적으로 하여 CALR-in1, CALR-in2, CALR-in3은 wild type에서 낮은 Tm값을 나타내었으며 그에 따라 변이형은 어떠한 Tm값도 나타내지 않았다(도 14의 Homozygote의 붉은색). CALR-in1과 CALR-in3는 사용된 염기서열은 동일하며 형광물질만 다르게 제작되었다. 또한 CALR-in3 프로브는 CALR-del52를 검출하는 PNA 프로브와의 간섭을 피하기 위해 형광을 5'에 결합하여 제작하였다. CALR-in1~3은 모두 야생형을 검출하지 못하였으며, 따라서 CALR-in5p를 이용하여 유전자 변이 검출에 사용하였다. CALR-del52 변이도 CALR-ins5 입장에서는 야생형으로 인식되어 52℃ 근처에서 Tm값이 나타나게 된다(도 7 참고). 그러나 3'-말단의 C에 불완전 일치가 발생하여 야생형 보다 약간 낮은 Tm이 발생됨을 알 수 있다.
실시예 5: 선별된 펩티드핵산 프로브들의 최적 조합 구성
상기에서 선별된 펩티드핵산 프로브들간에 간섭 현상을 최소화하는 조합을 찾기 위하여 다음 표와 같이 구성하였다.
| 혼합 조성물 1 | 혼합 조성물 2 | |
| 제1용액(A set) | JAK2-2MPL-3CALR-d4CALR-in5p | JAK2-2CALR-d4 |
| 제2용액(B set) | - | MPL-3CALR-in5p |
상기와 같이 간섭 현상이 발생할 수 있는 프로브들을 다른 용액에 존재하도록 분리하여 구성한 경우(혼합 조성물 2) 문제 되었던 self quenching 문제가 해결되고 돌연변이 검출 민감도가 증가한 것을 확인하였다(도 15a 및 b 참조).
실시예 6: 검출한계 설정
돌연변이 6개와 상보적인 야생형 3개를 대상으로 인공 클로닝을 시행한 후 희석하여 상기에서 제작한 혼합조성물 2의 검출한계를 설정하였다. 검출한계 설정은 3회 반복시행하며 원인 유전자의 돌연변이별로 각각 시행하였다. 희석배수는 100% 돌연변이, 50% 돌연변이, 25% 돌연변이, 10% 돌연변이, 7.5% 돌연변이, 및 0% 돌연변이로 수행하였다. 검출한계 실험 결과 10% 돌연변이까지 검출 가능한 것을 확인하였다(도 16a,b,c 참조).
실시예 7: 민감도 검증
혼합조성물 2의 민감도를 검증하기 위하여, Fragment analysis와 Sanger sequencing으로 검증된 환자 검체(총 57명)를 대상으로 FCMA 시행하여 비정상적 곡선이 관찰됨을 확인하였다. 민감도 검증은 3회 반복시행하며 원인 유전자의 돌연변이별로 각각 시행하였다(표 7 참조).
| 유전자 | 돌연변이 | 질환 |
| JAK2 (n=27) | V617F | PV (n=20) |
| 그 외 엑손12 돌연변이 | PV (n=6), PMF (n=1) | |
| MPL (n=6) | W515L/K | ET (n=3) |
| PMF (n=3) | ||
| CALR (n=24) | 유형1 | ET (n=9), PMF (n=1) |
| 유형2 | ET (n=8), PMF (n=2) | |
| 그 외 엑손9 돌연변이 | ET (n=4) |
실험 결과, JAK2 V617F 돌연변이 결과는 27개 시료 모두에 대하여 대립유전자 특이 중합효소연쇄반응법(allele specific real-time PCR) 결과와 모두 일치하였다.
MPL W515L/K 돌연변이 결과는 3개 일치, 2개는 위음성이었으나, 대립유전자 특이 중합효소연쇄반응법(allele specific real-time PCR) 결과를 확인한 결과 돌연변이 양이 10% 미만으로 검출한계 이하였다. Tm 값이 기존 설정값과 상이한 검체 1개가 있어 염기서열 분석한 결과 MPL W515S로 확인되었다.
CALR type 1/2 돌연변이는 20개 일치, 2개 위양성, 2개 위음성이었다. 위양성 검체는 그 외 엑손9 돌연변이였으며, 유형1 돌연변이 프로브 위치를 일부 포함하는 결손으로 확인되어 type1 돌연변이로 검출된 것으로 판단되었다. 위음성 검체는 염기서열 분석결과, c.1105_1156del52과 c.1131_1151delinsGTGCCTCCTCCTGGAGG 으로 각각 52bp 결손과 4bp 결손으로 확인되었다. 이에 대하여 fragment analysis 결과 상 type1 결손(c.1092_1143del52)와 정상야생형 간 PCR 산물 크기 차이가 정확히 일치하여 잘못 해석할 수 있으며, type2 삽입(c.1154_1155insTTGTC) 와 정상야생형 간 PCR 산물 크기 차이(5bp)와 유사하여 혼동할 수 있을 것으로 예상된다. 그러나 염기서열분석 상 CALR type1과 typ2 돌연변이가 아닌 것으로 확인되어 본 발명품이 fragment analysis보다 우수한 것으로 판단된다 (표 8 및 도 17a, b 참조).
| 구분 | 기존 검사결과 | FMCA 검사결과 |
| CALR 위양성 | c.1092_1138del47 | 유형1 돌연변이(c.1092_1143del52) |
| c.1099_1132del34 | 유형1 돌연변이 (c.1092_1143del52) | |
| CALR 위음성 | 유형 1 돌연변이(c.1092_1143del52) : 52bp 차이 | c.1105_1156del52 : 52bp 차이(염기서열확인) |
| 유형 2 돌연변이(c.1154_1155insTTGTC) : 5bp 차이 | c.1131_1151delinsGTGCCTCCTCCTGGAGG : 4bp 차이(염기서열확인) |
따라서, 혼합조성물 2를 사용한 FMCA 검사의 민감도를 검증한 결과, 검출한계 10% 이상의 검체에서 real-time PCR 및 fragment analysis 검사결과(기존 검사결과)와 모두 일치함을 확인하였다.
실시예
8: 특이도 검증
혼합조성물 2의 특이도를 검증하기 위하여 야생형 DNA 96개를 대상으로 FCMA 수행한 결과, 비정상 곡선이 관찰되지 않음을 확인하였다(도 18 참조). 특이도 검증은 3회 시행하며 원인 유전자의 돌연변이별로 각각 시행하였다.
실시예 9: 다중검출 검증
같은 원인 유전자의 환자 DNA를 혼합하여 같은 채널에서 다중 검출이 가능함을 확인하였다(도 19). 다중검출 검증은 3회 반복하여 원인 유전자별로, JAK2 V617F 염기치환이 다른 돌연변이 혼합하여 검사, MPL W515L과 W515K 돌연변이 혼합하여 검사, CALR type 1과 type 2를 혼합하여 검사를 각각 수행하였다. 실험 결과는 도 19에 도시하였다.
다른 원인 유전자의 환자 DNA를 혼합하여 다른 채널에서 다중 검출이 가능함도 확인하였다(도 20a,b). 다중검출 검증은 3회 반복하여 각각 수행하였다. 구체적으로, JAK2 V617F 돌연변이와 MPL W515L/K 돌연변이 혼합하여 검사, JAKV V617F 돌연변이와 CALR type 1/2를 혼합하여 검사, MPL W515L/K 돌연변이와 CALR type 1/2를 혼합하여 검사를 수행하였다.
6개 원인 유전자 돌연변이 환자 DNA를 혼합하여 6개 돌연변이의 동시 검출이 가능함을 확인하였다(도 21a,b,c). 다중검출 검증은 3회 반복수행하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
Claims (26)
- BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이를 다중검출할 수 있도록 제작된, 서열번호 7 내지 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브.
- 제1항에 있어서,상기 BCR/ABL 음성 골수증식종양 관련 유전자는 야누스 티로신키나제 2(JAK2), 트롬보포이에틴 수용체(MPL) 및 칼레티큘린(CALR) 중에서 선택된 어느 하나 이상인 것을 특징으로 하는 펩티드 핵산 프로브.
- 제1항에 있어서,상기 유전자 변이는 (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (v) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (vi) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), (vii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46), 및 (viii) 칼레티큘린 유전자의 c.1154_1155insTTGTC 염기삽입(K385fs*47) 중에서 선택된 어느 하나 이상인 것을 특징으로 하는 펩티드 핵산 프로브.
- 제3항에 있어서,상기 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F)은 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환에 의한 것을 특징으로 하는 펩티드 핵산 프로브.
- 제3항에 있어서,상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L)은 c.1544G>T염기치환에 의한 것을 특징으로 하는 펩티드 핵산 프로브.
- 제3항에 있어서,상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K)은 c.1543_1544delinsAA 염기치환에 의한 것을 특징으로 하는 펩티드 핵산 프로브.
- 제1항에 있어서,상기 펩티드 핵산 프로브는 양 말단에 리포터(reporter) 및 소광자(quencher)가 결합되어 있는 것을 특징으로 하는 펩티드 핵산 프로브.
- 제7항에 있어서,상기 리포터는 FAM(6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6- carboxy-4,7-dichlorofluorescein) 및 Cy5로 이루어진 군 중에서 선택되는 것을 특징으로 하는 펩티드 핵산 프로브.
- 제7항에 있어서,상기 소광자는 TAMRA(6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 및 Dabcyl로 이루어진 군 중에서 선택되는 것을 특징으로 하는 펩티드 핵산 프로브.
- 제1항 내지 제9항 중 어느 한 항의 펩티드 핵산 프로브를 포함하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물.
- 제10항에 따른 유전자 변이 다중검출용 조성물을 유효성분으로 포함하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출 키트.
- BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이를 다중검출할 수 있도록 제작된 조성물로서,(i) 서열번호 7 및 9로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 10으로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액; 또는(ii) 서열번호 7 및 10으로 표시되는 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제1용액과, 서열번호 8 및 9로 표시된 염기서열 및 상기 염기서열에 상보적인 염기서열로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 펩티드 핵산 프로브를 포함하는 제2용액으로 구성되고,상기 제1용액과 제2용액은 혼합되지 않은 상태로 존재하여, 이를 각각 또는 순차적으로 대상 DNA 시료와 접촉하여 반응시킬 수 있도록 구성된 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물.
- 상기 제1용액에 포함되는 펩티드 핵산 프로브는 야누스 티로신키나제 2(JAK2) 및 칼레티큘린(CALR) 유전자 중 하나 이상에 상보적으로 결합하고,상기 제2용액에 포함되는 펩티드 핵산 프로브는 트롬보포이에틴 수용체(MPL) 및 칼레티큘린(CALR) 유전자 중 하나 이상에 상보적으로 결합하는 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물.
- 제12항에 있어서,상기 제1용액은 (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), 및 (ii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46) 또는 c.1154_1155insTTGTC 염기삽입(K385fs*47)으로 이루어진 군에서 선택된 어느 하나 이상의 유전자 변이를 검출하고,상기 제2용액은 (i) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), 및 (v) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46) 또는 c.1154_1155insTTGTC 염기삽입(K385fs*47)로 이루어진 군에서 선택된 어느 하나 이상의 유전자 변이를 검출하는 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물.
- 제14항에 있어서,(i) 상기 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F)은 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환에 의한 것,(ii) 상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L)은 c.1544G>T염기치환에 의한 것, 또는(iii) 상기 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K)은 c.1543_1544delinsAA 염기치환에 의한 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출용 조성물.
- 제12 내지 제15항중 어느 한 항의 유전자 변이 다중검출용 조성물을 유효성분으로 포함하는 BCR/ABL 음성 골수증식종양 관련 다중 유전자 변이 다중검출 키트.
- BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이 부분을 특이적으로 증폭할 수 있도록 제작된, 서열목록 1 내지 6으로 이루어진 군에서 선택된 어느 하나 이상의 서열을 포함하는 프라이머.
- 대상 DNA 시료에 제1항 내지 제9항 중 어느 한 항의 펩티드 핵산 프로브를 첨가하여 혼성화시키는 단계;상기 혼성화된 산물을 온도를 변화시키면서 융해시켜 융해곡선을 얻는 단계; 및상기 얻어진 융해곡선을 변이 유전자의 표준 융해온도와 비교하는 단계를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 제18항에 있어서,상기 혼성화시키는 단계는, 대상 시료를 프라이머와 혼합하여 PCR을 수행하여 증폭하는 단계를 수행한 다음, 상기 증폭 산물에 펩티드 핵산 프로브를 첨가하여 혼성화시키는 단계를 수행하는 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 대상 DNA 시료에 제12항 내지 제15항 중 어느 한 항의 유전자 변이 다중검출용 조성물을 첨가하되, 상기 제1용액 및 제2용액을 각각 또는 순차적으로 첨가하여 혼성화시키는 단계;상기 혼성화된 산물을 온도를 변화시키면서 융해시켜 융해곡선을 얻는 단계; 및상기 얻어진 융해곡선을 변이 유전자의 표준 융해온도와 비교하는 단계를 포함하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 제20항에 있어서,상기 혼성화시키는 단계는, 대상 시료를 프라이머와 혼합하여 PCR을 수행하여 증폭하는 단계를 수행한 다음, 상기 증폭 산물에 유전자 변이 다중검출용 조성물을 첨가하여 혼성화시키는 단계를 수행하는 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 제19항 또는 제21항에 있어서,상기 프라이머는 BCR/ABL 음성 골수증식종양 관련 유전자에 상보적으로 결합하여 유전자 변이 부분을 특이적으로 증폭할 수 있도록 제작된, 서열목록 1 내지 6으로 이루어진 군에서 선택된 어느 하나 이상의 서열을 포함하는 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 제18항 또는 제20항에 있어서,상기 방법에 의하여 검출하는 유전자 변이는, (i) 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F), (ii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L), (iii) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K), (iv) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 아르기닌으로 치환(MPL W515R), (v) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 알라닌으로 치환(MPL W515A), (vi) 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 세린으로 치환(MPL W515S), (vii) 칼레티큘린 유전자의 c.1092_1143del52 염기결손(L367fs*46), 및 (viii) 칼레티큘린 유전자의 c.1154_1155insTTGTC 염기삽입(K385fs*47) 중에서 선택된 어느 하나 이상인 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 제23항에 있어서,상기 방법에 의하여 검출하는 야누스 티로신키나제 2 유전자의 617 위치의 아미노산 발린의 페닐알라닌으로 치환(JAK2 V617F) 변이는 c.1849G>T 또는 c.1849_1851delinsTTT 염기치환인 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 제23항에 있어서,상기 방법에 의하여 검출하는 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 류신으로 치환(MPL W515L) 변이는 c.1544G>T염기치환인 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
- 제23항에 있어서,상기 방법에 의하여 검출하는 트롬보포이에틴 수용체 유전자의 515 위치의 아미노산 트립토판의 라이신으로 치환(MPL W515K) 변이는 c.1543_1544delinsAA 염기치환인 것을 특징으로 하는 BCR/ABL 음성 골수증식종양 관련 유전자 변이 다중검출 방법.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/775,591 US11028428B2 (en) | 2015-11-11 | 2016-06-03 | Peptide nucleic acid probe for multiplex detection of BCR/ABL negative myeloproliferative neoplasm-associated gene mutations |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20150158056 | 2015-11-11 | ||
| KR10-2015-0158056 | 2015-11-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017082503A1 true WO2017082503A1 (ko) | 2017-05-18 |
Family
ID=58695685
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/005927 Ceased WO2017082503A1 (ko) | 2015-11-11 | 2016-06-03 | Bcr/abl 음성 골수증식종양 관련 유전자변이 다중검출용 펩티드핵산 프로브, 이를 포함하는 유전자변이 다중검출 조성물, 다중검출 키트 및 유전자변이 다중검출방법 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US11028428B2 (ko) |
| KR (1) | KR101953092B1 (ko) |
| WO (1) | WO2017082503A1 (ko) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107904290A (zh) * | 2017-11-09 | 2018-04-13 | 上海赛安生物医药科技股份有限公司 | Pdgfra基因突变检测体系及其试剂盒 |
| CN108949971A (zh) * | 2017-05-23 | 2018-12-07 | 曹国君 | 钙网蛋白基因1型突变检测用封闭pna探针 |
| CN112410407A (zh) * | 2020-12-04 | 2021-02-26 | 李建新 | 同时检测两种或三种mpn致病基因突变的引物组以及包含该引物组的试剂盒 |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111471768B (zh) * | 2020-04-15 | 2023-12-26 | 内蒙古医科大学附属医院(内蒙古自治区心血管研究所) | 用于检测jak2 v617f及calr第九外显子基因突变的pcr引物组及试剂盒 |
| WO2023070122A1 (en) * | 2021-10-23 | 2023-04-27 | Strm.Bio Incorporated | Gene editing to treat myeloproliferative neoplasms |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1932038A (zh) * | 2006-09-27 | 2007-03-21 | 北京大学人民医院 | 检测JAK2V617F突变的方法及其专用引物与TaqMan-MGB探针 |
| KR20120068992A (ko) * | 2009-10-30 | 2012-06-27 | 아크레이 가부시키가이샤 | Mpl 유전자 다형 검출용 프로브 및 그 용도 |
| KR20140091944A (ko) * | 2013-01-14 | 2014-07-23 | 주식회사 시선바이오머티리얼스 | 내부컨트롤 및 리포터 및 소광자가 결합된 pna 프로브를 이용한 용융곡선 분석방법, 이를 이용한 표적핵산 검출방법 및 표적핵산 검출 키트 |
| WO2015036599A1 (en) * | 2013-09-16 | 2015-03-19 | Cemm - Forschungszentrum Für Molekulare Medizin Gmbh | Mutant calreticulin for the diagnosis of myeloid malignancies |
| JP2015070808A (ja) * | 2013-10-03 | 2015-04-16 | 学校法人順天堂 | Jak2変異遺伝子の検出方法 |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004074447A2 (en) | 2003-02-18 | 2004-09-02 | Applera Corporation | Compositions and methods for multiplex analysis of polynucleotides |
| CN101403010B (zh) * | 2008-11-13 | 2011-08-17 | 北京大学人民医院 | 一种用于检测骨髓增殖性疾病mplw515k突变的试剂盒及其专用引物与探针 |
| WO2011069004A1 (en) | 2009-12-04 | 2011-06-09 | Quest Diagnostics Investments Incorporated | Mpl mutations in jak2 v617f negative patients with myeloproliferative disease |
| KR20120119571A (ko) * | 2011-04-22 | 2012-10-31 | 주식회사 파나진 | Pna 기반의 실시간 pcr 클램핑을 이용한 jak2 v617f 돌연변이 검출 방법 및 키트 |
| KR101367776B1 (ko) | 2012-03-20 | 2014-02-27 | 김학성 | 지게차 캐빈의 도어 장치 및 그 제조방법 |
-
2016
- 2016-06-03 KR KR1020160069392A patent/KR101953092B1/ko active Active
- 2016-06-03 WO PCT/KR2016/005927 patent/WO2017082503A1/ko not_active Ceased
- 2016-06-03 US US15/775,591 patent/US11028428B2/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1932038A (zh) * | 2006-09-27 | 2007-03-21 | 北京大学人民医院 | 检测JAK2V617F突变的方法及其专用引物与TaqMan-MGB探针 |
| KR20120068992A (ko) * | 2009-10-30 | 2012-06-27 | 아크레이 가부시키가이샤 | Mpl 유전자 다형 검출용 프로브 및 그 용도 |
| KR20140091944A (ko) * | 2013-01-14 | 2014-07-23 | 주식회사 시선바이오머티리얼스 | 내부컨트롤 및 리포터 및 소광자가 결합된 pna 프로브를 이용한 용융곡선 분석방법, 이를 이용한 표적핵산 검출방법 및 표적핵산 검출 키트 |
| WO2015036599A1 (en) * | 2013-09-16 | 2015-03-19 | Cemm - Forschungszentrum Für Molekulare Medizin Gmbh | Mutant calreticulin for the diagnosis of myeloid malignancies |
| JP2015070808A (ja) * | 2013-10-03 | 2015-04-16 | 学校法人順天堂 | Jak2変異遺伝子の検出方法 |
Non-Patent Citations (1)
| Title |
|---|
| KIM, B. H. ET AL.: "JAK2 V617F, MPL, and CALR Mutations in Korean Patients with Essential Thrombocythemia and Primary Myelofibrosis", JOURNAL OF KOREAN MEDICAL SCIENCE, vol. 30, no. 7, pages 882 - 888, XP055381457 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949971A (zh) * | 2017-05-23 | 2018-12-07 | 曹国君 | 钙网蛋白基因1型突变检测用封闭pna探针 |
| CN107904290A (zh) * | 2017-11-09 | 2018-04-13 | 上海赛安生物医药科技股份有限公司 | Pdgfra基因突变检测体系及其试剂盒 |
| CN112410407A (zh) * | 2020-12-04 | 2021-02-26 | 李建新 | 同时检测两种或三种mpn致病基因突变的引物组以及包含该引物组的试剂盒 |
Also Published As
| Publication number | Publication date |
|---|---|
| US20180355414A1 (en) | 2018-12-13 |
| US11028428B2 (en) | 2021-06-08 |
| KR101953092B1 (ko) | 2019-06-13 |
| KR20170055400A (ko) | 2017-05-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017122896A1 (ko) | 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법 | |
| WO2013041031A1 (zh) | 一种基因拷贝数变异的检测方法 | |
| WO2018174318A1 (ko) | 양기능성 pna 프로브를 이용한 융해곡선 분석방법, 및 이를 이용한 현미부수체 불안정성의 진단방법 및 현미부수체 불안정성 진단용 키트 | |
| WO2015126078A1 (ko) | 핵산과 신호 프로브의 비대칭 등온증폭을 이용한 핵산의 검출방법 | |
| Begemann et al. | Use of multilocus methylation-specific single nucleotide primer extension (MS-SNuPE) technology in diagnostic testing for human imprinted loci | |
| KR101953092B1 (ko) | Bcr/abl 음성 골수증식종양 관련 유전자변이 다중검출용 펩티드핵산 프로브, 이를 포함하는 유전자변이 다중검출 조성물, 다중검출 키트 및 유전자변이 다중검출방법 | |
| WO2017122897A1 (ko) | 참돔 이리도바이러스병 원인바이러스의 검출용 유전자 마커, 및 이를 이용한 원인바이러스의 검출 방법 | |
| WO2020096248A1 (ko) | 폐암 조직 내 세포 유래 돌연변이를 검출하기 위한 프로브 제조 및 검출 방법 | |
| WO2014168346A1 (ko) | 방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법 | |
| WO2023085783A1 (ko) | 결핵균 검출 및 약물 내성 확인을 위한 유전자 증폭용 조성물 및 이의 용도 | |
| CN104611422A (zh) | 一种检测大肠杆菌耐氟喹诺酮类gyrA、parC基因点突变方法 | |
| WO2021118288A1 (ko) | 대립 유전자의 구분성을 높이는 pcr 방법 및 pcr 킷트 | |
| WO2015190655A1 (ko) | 아토피 피부염 진단을 위한 필라그린 유전자 돌연변이 검출방법 | |
| WO2012064035A2 (ko) | Pna 기반의 실시간 pcr 클램핑을 이용한 bcr-abl 융합 유전자의 돌연변이 검출 방법 및 키트 | |
| WO2020145711A1 (ko) | Egfr 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트 | |
| Li et al. | SNPscan as a high-performance screening tool for mutation hotspots of hearing loss-associated genes | |
| WO2011136462A1 (ko) | 증폭억제시발체를 이용하는 유전자 돌연변이 검출 방법 | |
| WO2013105801A1 (ko) | 만성 골수성 백혈병 융합 유전자형 타이핑용 프로브, 프라이머 및 이의 이용방법 | |
| WO2020145715A1 (ko) | Tert 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트 | |
| WO2021172653A1 (ko) | 단일 표적 유전자의 유전적 변이 실시간 검출용 단일핵산 및 이를 이용한 검출 방법 | |
| WO2019132581A1 (ko) | 유방암 및 난소암 등 암 진단용 조성물 및 이의 용도 | |
| CN107326064A (zh) | 基因倒位突变检测方法 | |
| US20190112640A1 (en) | Method for mapping spinal muscular atrophy (“sma”) locus and other complex genomic regions using molecular combing | |
| WO2020145734A1 (ko) | Braf 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트 | |
| WO2020145762A1 (ko) | Jak2 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16864429 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16864429 Country of ref document: EP Kind code of ref document: A1 |