WO2014168346A1 - 방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법 - Google Patents

방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법 Download PDF

Info

Publication number
WO2014168346A1
WO2014168346A1 PCT/KR2014/002108 KR2014002108W WO2014168346A1 WO 2014168346 A1 WO2014168346 A1 WO 2014168346A1 KR 2014002108 W KR2014002108 W KR 2014002108W WO 2014168346 A1 WO2014168346 A1 WO 2014168346A1
Authority
WO
WIPO (PCT)
Prior art keywords
bladder cancer
methylation
pcr
nucleic acid
methylated
Prior art date
Application number
PCT/KR2014/002108
Other languages
English (en)
French (fr)
Inventor
안성환
오태정
Original Assignee
(주)지노믹트리
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)지노믹트리 filed Critical (주)지노믹트리
Publication of WO2014168346A1 publication Critical patent/WO2014168346A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers

Definitions

  • the present invention relates to a method for detecting the methylation of the CpG island region of the bladder cancer biomarker gene in order to provide information necessary for the diagnosis of bladder cancer or bladder cancer progression stage, more specifically, the promoter region in the bladder cancer transformed cells
  • the present invention relates to a method for detecting bladder cancer characterized by identifying promoter methylation of a bladder cancer specific marker gene that is methylated.
  • Bladder cancer is the most common cancer of the urinary tract and has been found to be relatively common. It is known that smoking and various chemicals (dyed paints such as leather, air pollutants, artificial sweeteners, nitrates) are absorbed into the body and excreted in the urine to stimulate the bladder wall to cause cancer.
  • cystoscopy in which a catheter (conduit) is pushed into the bladder to remove and examine a suspected tissue, is a relatively invasive method.
  • bladder cancer diagnosis method is to use a method to cut a part of the body, it is difficult to diagnose bladder cancer early.
  • Bladder cancers are classified as superficial or invasive cancers according to the involvement of the bladder muscle layer. On average, about 30% of patients are invasive bladder cancers. Therefore, in order to increase the survival of patients, early diagnosis is the best method when the lesion range is small. The development of bladder cancer-specific biomarkers with high sensitivity, high sensitivity, and specificity is urgently needed.
  • DNA methylation mainly occurs in the cytosine of CpG island of the promoter region of a specific gene, thereby binding of transcription factors.
  • MSP methylation specific PCR
  • methylation of the promoter CpG islands directly causes carcinogenesis or causes secondary changes in carcinogenesis, tumor suppressor genes, DNA repair genes, and cell cycles in many cancers are controversial. It has been confirmed that the expression of these genes is blocked due to hyper-methylation of regulatory genes. In particular, it is known that hypermethylation occurs at the promoter region of specific genes at an early stage of cancer development.
  • promoter methylation of tumor-related genes is an important indicator of cancer, which can be used in many ways, including diagnosis and early diagnosis of cancer, prediction of carcinogenic risk, prediction of cancer prognosis, follow-up of treatment, and prediction of response to chemotherapy.
  • attempts have been actively made to investigate the promoter methylation of tumor-related genes in blood, sputum, saliva, feces, and urine and use them in various cancer treatments (Esteller, M. et al., Cancer Res ., 59:67). , 1999; Sanchez-Cespedez, M. et al., Cancer Res ., 60: 892, 2000; Ahlquist, DA et al., Gastroenterol ., 119: 1219, 2000).
  • the present inventors have made efforts to develop a method for effectively diagnosing bladder cancer, and as a result, by measuring the methylation degree using a promoter of methylation-related gene that is specifically methylated in bladder cancer cells, the bladder cancer can be diagnosed. It was confirmed that the present invention was completed.
  • An object of the present invention is to provide a method for detecting methylation of the CpG island region of the bladder cancer biomarker gene in order to provide information necessary for the diagnosis of bladder cancer or bladder cancer progression stage.
  • the present invention comprises the steps of (a) separating the DNA from the clinical sample; And (b) detecting methylation of the CpG island region of the bladder cancer biomarker gene selected from the group consisting of PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 and SYCP2L in the isolated DNA.
  • the method includes detecting methylation of the CpG island region of the bladder cancer biomarker gene.
  • the invention also amplifies fragments comprising methylated CpG islands of bladder cancer biomarker genes selected from the group consisting of PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 and SYCP2L .
  • the present invention provides a kit for diagnosing bladder cancer or bladder cancer progression, comprising a PCR primer pair and a sequencing primer for pyro sequencing the PCR product amplified by the primer pair.
  • the present invention also provides fragments and hives comprising methylation sites of CpG islands of bladder cancer biomarker genes selected from the group consisting of PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 and SYCP2L . It provides a nucleic acid chip for diagnosing bladder cancer or bladder cancer progression step comprising a probe that can be re-aligned.
  • FIG. 1 shows a comparative analysis of CpG microarrays using bladder cancer georgette origin DNA for the discovery of bladder cancer specific methylation gene according to the present invention.
  • Figure 2 shows the discovery process of bladder cancer specific methylation gene through CpG microarray data normalization according to the present invention.
  • Figure 3 shows the results of measuring the methylation degree of the bladder cancer specific methylation gene discovered in the present invention by the pyro sequencing method.
  • Figure 4 shows the methylation degree, sensitivity and specificity of bladder cancer tissues of 11 bladder cancer biomarker genes according to the present invention.
  • Figure 5 shows the methylation degree, sensitivity and specificity of the urine cells of the seven bladder cancer biomarker genes according to the present invention.
  • the present invention comprises the steps of (a) separating the DNA from the clinical sample; And (b) detecting methylation of the CpG island region of the bladder cancer biomarker gene selected from the group consisting of PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 and SYCP2L in the isolated DNA.
  • the present invention relates to a method for detecting methylation of a CpG island region of a bladder cancer biomarker gene in order to provide information necessary for diagnosis of bladder cancer or bladder cancer progression.
  • methylated biomarker gene of the present invention As a screening method of the methylated biomarker gene of the present invention, not only bladder cancer but also various methylated genes can be found at various stages of dysplasia progressing to bladder cancer, and the selected genes are screened for bladder cancer, risk assessment, prediction, disease identification, and disease. It can also be used for stage diagnosis and selection of treatment targets.
  • Identifying genes methylated in bladder cancer and at various stages of abnormality enables early and accurate diagnosis of bladder cancer, and can identify new targets for establishing and treating methylation lists using multiple genes.
  • methylation data according to the present invention will be able to establish a more accurate bladder cancer diagnosis system in conjunction with other non-methylated associated biomarker detection methods.
  • the step may be hypermethylation.
  • the nucleic acid may be methylated at the regulatory site of a gene.
  • methylation starts from the outside of the regulatory region of the gene and proceeds to the inside, detection of methylation at the outside of the regulatory region enables early diagnosis of genes involved in cellular transformation.
  • the CpG island region of the bladder cancer biomarker gene may have a nucleotide sequence selected from SEQ ID NOs: 1-11.
  • the step (b) is characterized in that the methylation is detected based on the presence or absence of nucleotide sequence changes of the result of the amplification using a primer capable of amplifying a fragment including the CpG island of the bladder cancer biomarker gene. can do.
  • the methylation detection is PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, quantitative PCR, DNA chip, pyro It can be carried out by a method selected from the group consisting of sequencing and bisulfite sequencing, the clinical sample of the present invention can use tissue, cells, blood, plasma and urine, etc. from a suspected cancer patient or a diagnosis target.
  • the invention provides a fragment comprising a methylated CpG island of a bladder cancer biomarker gene selected from the group consisting of PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 and SYCP2L It relates to a bladder cancer or bladder cancer progression diagnostic kit containing a PCR primer pair for amplification and a sequencing primer for pyro sequencing the PCR product amplified by the primer pair.
  • a bladder cancer or bladder cancer progression diagnostic kit containing a PCR primer pair for amplification and a sequencing primer for pyro sequencing the PCR product amplified by the primer pair.
  • the fragment containing the methylated CpG island of the bladder cancer biomarker gene may be characterized by having a nucleotide sequence selected from SEQ ID NOs: 1-11.
  • kits of the invention are a compartmentalized carrier means for holding a sample, a first container containing an agent that sensitively cleaves unmethylated cytosine, a second container containing a primer for amplifying CpG containing nucleic acid, and a cut or not cut
  • One or more containers including a third container containing means for detecting the presence of a nucleic acid that has not been found. Primers used according to the invention are used as primers to detect whether methylation has occurred on the genome.
  • cell growth abnormality (dysplasia) of bladder tissue present in a specimen may be diagnosed:
  • the method includes determining the methylation status of one or more nucleic acids isolated from the sample, wherein the methylation step of the one or more nucleic acids is compared to the methylation step of the nucleic acid isolated from the sample without cell growth abnormality (dysplasia) of the bladder tissue. It can be characterized by.
  • the methylation gene marker can be used for early diagnosis of cells likely to form bladder cancer.
  • a gene identified to be methylated in cancer cells is methylated in cells that appear clinically or morphologically normal, the cells that appear to be normal are in progress of cancer. Therefore, bladder cancer specific genes in cells that appear to be normal can confirm methylation, thereby allowing early diagnosis of bladder cancer.
  • the invention comprises methylation sites of CpG islands of bladder cancer biomarker genes selected from the group consisting of PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 and SYCP2L
  • the present invention relates to a nucleic acid chip for diagnosing bladder cancer or bladder cancer progression, comprising a fragment and a probe capable of hybridization.
  • the methylation site of the CpG island of the bladder cancer biomarker gene may have a nucleotide sequence selected from SEQ ID NOs: 1-11.
  • the method includes contacting a sample comprising one or more nucleic acids isolated from a sample with an agent capable of determining one or more methylation states.
  • the method comprises identifying the methylation status of one or more sites in one or more nucleic acids, wherein the methylation status of the nucleic acid is identical to the methylation status of the same site in a nucleic acid of a sample that does not have cell growth potential abnormalities of the bladder tissue (dysplasia progression). It may be characterized by a difference.
  • the probe may be characterized by including a base sequence capable of hybridizing with a fragment containing CpG of the promoter region of the bladder cancer biomarker gene, which is complementary to the CpG of the bladder cancer biomarker promoter.
  • transformed bladder cancer cells can be identified by examining methylation of marker genes using the kit or nucleic acid chip.
  • bladder cancer may be diagnosed by examining methylation of a marker gene using the kit or nucleic acid chip.
  • the possibility of progression to bladder cancer can be diagnosed by examining methylation of the marker gene using the kit or nucleic acid chip using a sample showing a normal phenotype.
  • the sample can use solid or liquid tissue, cells, urine, serum or plasma.
  • the methylation measurement method is PCR, methylation specific PCR (realization methylation specific PCR), real time methylation specific PCR (PCR), methylation-specific PCR, quantitative PCR, pyro sequencing and It may be characterized in that it is selected from the group consisting of bisulfite sequencing, the clinical sample may be characterized in that the tissue, cells, blood or urine from a suspected cancer patient or diagnostic subject.
  • the method for detecting whether the gene is promoter methylated includes the following steps: (a) separating the sample DNA from the clinical sample; (b) amplifying the separated DNA using a primer capable of amplifying a fragment including a CpG island of a bladder cancer biomarker gene; And (c) determining whether the promoter is methylated based on the presence or absence of the production of the amplified product in step (b).
  • the possibility of development of bladder cancer can be evaluated by examining the methylation frequency of genes that are specifically methylated in bladder cancer and determining the methylation frequency of tissues with the possibility of bladder cancer progression.
  • cell transformation is characterized from one form to another, such as from normal to abnormal, from non-tumor to tumorous, from undifferentiated to differentiation, from stem cells to non-stem cells. It means to change. Additionally, the transformation can be recognized by the morphology, phenotype, biochemical properties, etc. of the cell.
  • the "early confirmation" of cancer is to discover the possibility of cancer before metastasis, preferably before morphological changes are observed in sample tissue or cells.
  • “early identification” of cell transformation refers to the possibility of transformation occurring at an early stage before the cell is transformed.
  • “Hypermethylation” in the present invention means methylation of CpG islands.
  • sample or “sample sample” means a wide range of samples including all biological samples obtained from individuals, body fluids, cell lines, tissue cultures, etc., depending on the type of assay being performed. Methods of obtaining bodily fluids and tissue biopsies from mammals are commonly known. Preferred source is biopsy of the bladder.
  • a biomarker gene that is methylated is screened when the cell or tissue is transformed or when the cell is changed to another form.
  • transformed cells means that the shape of the cell or tissue is changed from one form to another, such as abnormal form, non-tumorigenic tumor, and undifferentiated form into differentiation.
  • genomic DNA was isolated from cancer tissue of bladder cancer patients and normal tissues connected thereto.
  • genomic DNA was reacted with MBD2bt binding to methylated DNA, and then methylated DNA binding to MBD2bt protein was isolated.
  • normal DNA derived from Cy3 bladder cancer patient derived DNA was labeled with Cy5, and then hybridized to a human CpG microarray to be methylated between normal tissue and bladder cancer tissue.
  • the eleven genes with the greatest degree of difference were selected as biomarkers.
  • pyro sequencing was performed to further confirm whether the 11 biomarkers were methylated.
  • the present invention provides a biomarker for diagnosing bladder cancer.
  • normal cells refers to cells that do not exhibit abnormal cell morphology or changes in cytological properties.
  • Tumor cells refer to cancer cells, and “non-tumor” cells refer to cells that are part of the diseased tissue but are not considered tumor sites.
  • the present invention is based on the discovery of an association between bladder cancer and promoter site hypermethylation of bladder cancer biomarker genes.
  • the methylation stage of one or more nucleic acids isolated from a sample can be determined to early diagnose cell growth abnormalities of the bladder tissue of the sample.
  • the methylation step of the one or more nucleic acids may be compared with the methylation status of one or more nucleic acids isolated from a specimen that does not have cell growth potential of bladder tissue.
  • the nucleic acid is preferably a CpG-containing nucleic acid such as a CpG island.
  • the diagnostic kit and nucleic acid chip of the present invention it is possible to diagnose abnormalities in cell growth of bladder tissue of a sample, including determining methylation of a bladder cancer biomarker gene isolated from the sample.
  • a virulent sample is a sample that does not yet have cell growth abnormalities, but has or has increased cell growth abnormalities.
  • the present invention provides a method for diagnosing abnormality in cell growth of bladder tissue of a sample comprising contacting a sample containing the nucleic acid of the sample with an agent capable of determining the methylation state of the sample and confirming methylation of the nucleic acid. to provide.
  • nucleic acid or “nucleic acid sequence” means oligonucleotides, nucleotides, polynucleotides or fragments, single stranded or double stranded genomic origin or synthetic genomic origin or synthesis of DNA or RNA, sense or antisense strands.
  • DNA or RNA of origin peptide nucleic acid (PNA) or DNA amount or RNA quantity material of natural or synthetic origin. If the nucleic acid is RNA, it is apparent to those skilled in the art that, instead of deoxynucleotides A, G, C, and T, it is replaced with ribonucleotides A, G, C, and U, respectively.
  • the CpG island is a CpG rich site in the nucleic acid sequence.
  • any nucleic acid in the purified or unpurified form of the present invention may be used, and any nucleic acid containing or suspected of containing a nucleic acid sequence containing a target site (eg, a CpG-containing nucleic acid) may be used.
  • a nucleic acid site that can be differentially methylated is a CpG island, which is a nucleic acid sequence having a high CpG density compared to other dinucleotide CpG nucleic acid sites. Doublet CpG is only 20% probable in vertebrate DNA as predicted by the ratio of G * C base pairs. At certain sites, the density of double CpG is ten times higher than at other sites in the genome.
  • the CpG islands have an average G * C ratio of about 60%, with an average DNA G * C ratio of 40%.
  • CpG islands are typically about 1 to 2 kb in length and there are about 45,000 CpG islands in the human genome.
  • CpG islands start upstream of the promoter and extend to the transcriptional site downstream. Methylation of CpG islands in promoters usually inhibits expression of genes.
  • the CpG islands may also surround the 3 'region of the gene coding region, as well as the 5' region of the gene coding region. Therefore, CpG islands are found at several sites, including upstream of a coding sequence of a regulatory region comprising a promoter region, a coding region (eg exon region), downstream of a coding region, eg, an enhancer region and an intron. do.
  • the CpG-containing nucleic acid is DNA.
  • the method of the present invention may apply for example a sample containing DNA or RNA containing DNA and mRNA, wherein the DNA or RNA may be single stranded or double stranded, or DNA-RNA hybrids. It may be characterized by the contained sample.
  • Nucleic acid mixtures may also be used.
  • the specific nucleic acid sequence to be detected may be a fraction of a large molecule, and from the outset the specific sequence may exist in the form of isolated molecules that make up the entire nucleic acid sequence.
  • the nucleic acid sequence need not be nucleic acid present in pure form, and the nucleic acid may be a small fraction in a complex mixture, such as containing whole human DNA.
  • Nucleic acids included in the sample used to measure the degree of methylation of nucleic acids contained in the sample or used to detect methylated CpG islands are described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY., 1989). It can be extracted by various methods described in.
  • the nucleic acid may comprise a regulatory site, which is a DNA site that encodes information or regulates transcription of the nucleic acid.
  • the regulatory site comprises at least one promoter.
  • a “promoter” is the minimum sequence necessary to direct transcription and can regulate cell type specific, tissue specific or inducible by an external signal or agent in a promoter-dependent gene.
  • the promoter is located at the 5 'or 3' site of the gene. Nucleic acid numbers of all or part of a promoter site can be applied to measure methylation of CpG island sites. Methylation of the target gene promoter proceeds from outside to inside. Therefore, the early stages of cell turnover can be detected by analyzing methylation outside of the promoter region.
  • the nucleic acid isolated from the sample is obtained by biological sample of the sample. If you want to diagnose bladder cancer or the progression of bladder cancer, the nucleic acid should be separated from the bladder tissue with a scrap or biopsy. Such samples may be obtained by various medical procedures known in the art.
  • the degree of methylation of the nucleic acid of the sample obtained from the sample is measured in comparison to the same nucleic acid portion of the sample having no cell growth abnormality of the bladder tissue.
  • Hypermethylation refers to the presence of methylated alleles in one or more nucleic acids. Samples without cell growth abnormality of the bladder tissue did not show methylation alleles when the same nucleic acid was tested.
  • the present invention describes early detection of bladder cancer and utilizes bladder cancer specific gene methylation. Methylation of bladder cancer specific genes also occurred in tissues near the tumor site. Therefore, early detection of bladder cancer can confirm the presence or absence of methylation of bladder cancer-specific genes in all samples including liquid or solid tissue.
  • the sample includes, but is not limited to, tissue, cells, urine, serum or plasma.
  • the present invention can be used individually as a diagnostic or predictive marker, or a combination of several marker genes in the form of a panel display, and several marker genes can be used to improve reliability and efficiency through an overall pattern or a list of methylated genes. It can confirm that it improves.
  • the genes identified in the present invention can be used individually or as a set of genes in which the genes mentioned in this example are combined. Alternatively, genes can be ranked, weighted, and selected for the level of likelihood of developing cancer, depending on the number and importance of the genes methylated together. Such algorithms belong to the present invention.
  • PCR primers corresponding to the sites where the 5'-CpG-3 'nucleotide sequence exists were prepared for the converted nucleotide sequence after bisulfite treatment.
  • PCR primers corresponding to methylation and two types of primers corresponding to unmethylated were prepared.
  • the PCR product is made by using the primer corresponding to the methylated sequence when methylated.
  • the PCR product is produced by using a primer corresponding to unmethylation. Methylation can be qualitatively confirmed by agarose gel electrophoresis.
  • Real-time methylation-specific PCR converts the methylation-specific PCR method into a real-time measurement method. After treating bisulfite with genomic DNA, a PCR primer for methylation is designed and real-time PCR is performed using these primers. To do. At this time, there are two methods of detection using a TanMan probe complementary to the amplified base sequence and a method of detection using Sybergreen. Thus, real-time methylation specific PCR can selectively quantitate only methylated DNA.
  • a standard curve was prepared using an in vitro methylated DNA sample, and for standardization, a gene without a 5'-CpG-3 'sequence in the base sequence was amplified with a negative control group and quantitatively analyzed for methylation.
  • the pyro sequencing method is a method of converting the bisulfite sequencing method into quantitative real-time sequencing. Similar to bisulfite sequencing, the genomic DNA was converted by bisulfite treatment, and PCR primers corresponding to sites without the 5'-CpG-3 'sequencing were prepared. After treating genomic DNA with bisulfite, it was amplified by the PCR primers, and real-time sequencing was performed using the sequencing primers. Quantitative analysis of cytosine and thymine at the 5′-CpG-3 ′ site indicated the methylation degree as the methylation index.
  • methylated DNA-specific binding proteins when a protein that specifically binds to methylated DNA is mixed with DNA, only methylated DNA can be selectively separated because the protein specifically binds to methylated DNA. . After genomic DNA was mixed with methylated DNA specific binding proteins, only methylated DNA was selectively isolated. These isolated DNAs were amplified using a PCR primer corresponding to a promoter site, and then methylated by agarose electrophoresis.
  • methylation can also be determined by quantitative PCR.
  • Methodhylated DNA separated by methylated DNA-specific binding proteins can be labeled with a fluorescent dye and hybridized to DNA chips having complementary probes to measure methylation.
  • the methylated DNA specific binding protein is not limited to McrBt.
  • Detection of differential methylation can be accomplished by contacting the nucleic acid sample with a methylation sensitive restriction endonuclease that cleaves only unmethylated CpG sites.
  • the samples were contacted with isochimers of methylation sensitive restriction endonucleases that cleave both methylated and unmethylated CpG sites, thereby cleaving the methylated nucleic acids.
  • Specific primers were added to the nucleic acid sample and the nucleic acid was amplified by conventional methods. If there is an amplification product in the sample treated with the methylation sensitive restriction endonuclease, and there is no amplification product in the isomerized sample of the methylation sensitive restriction endonuclease that cleaves both methylated and unmethylated CpG sites , Methylation occurred in the analyzed nucleic acid site. However, no amplification products were present in the samples treated with methylation sensitive restriction endonucleases, and the amplification products were also found in the samples treated with isosomeomers of methylation sensitive restriction endonucleases that cleave both methylated and unmethylated CpG sites. Existence means that no methylation occurs in the analyzed nucleic acid site.
  • methylation sensitive restriction endonuclease is a restriction enzyme that contains CG at the recognition site and has activity when C is methylated compared to when C is not methylated (eg, SmaI).
  • Non-limiting examples of methylation sensitivity limiting endonucleases include MspI, HpaII, BssHII, BstUI and NotI . The enzymes may be used alone or in combination.
  • Other methylation sensitivity limiting endonucleotides include, but are not limited to, for example, SacII and EagI .
  • Primers of the invention are constructed to have “alternatively” complementarities with each strand of the locus to be amplified and, as described above, include the appropriate G or C nucleotides. This means that the primers have sufficient complementarity to hybridize with the corresponding nucleic acid strands under the conditions for carrying out the polymerization.
  • the primer of the present invention is used in the amplification process, which is an enzymatic continuous reaction in which the target locus, such as PCR, increases to an exponential number through many reaction steps. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus, and the other primer (sense primer) has homology to the positive (+) strand.
  • the chain is stretched by enzymes and reactants such as DNA polymerase I (Klenow) and nucleotides, resulting in newly synthesized + and-strands containing the target locus sequence.
  • the newly synthesized target locus is also used as a template, and the cycle of denaturation, primer annealing and chain extension repeats exponential synthesis of the target locus sequence.
  • the product of the continuous reaction is an independent double stranded nucleic acid having an end corresponding to the end of the specific primer used in the reaction.
  • the amplification reaction is preferably a PCR that is commonly used in the art.
  • alternative methods such as real-time PCR or linear amplification with isothermal enzymes can also be used, and multiplex amplification reactions can also be used.
  • detecting nucleic acids containing methylated CpG include contacting a sample containing nucleic acid with an agent that modifies unmethylated cytosine and amplifying the CpG-containing nucleic acid of the sample using CpG-specific oligonucleotide primers. It includes.
  • the oligonucleotide primer may be characterized by detecting the methylated nucleic acid by distinguishing the modified methylated and unmethylated nucleic acid.
  • the amplification step is optional and desirable but not necessary.
  • the method relies on a PCR reaction that distinguishes between modified (eg, chemically modified) methylated and unmethylated DNA. Such methods are disclosed in US Pat. No. 5,786,146, which is described in connection with bisulfite sequencing for the detection of methylated nucleic acids.
  • the nucleic acid amplification product can be hybridized with a known gene probe immobilized on a solid support (substrate) to detect the presence of the nucleic acid sequence.
  • a “substrate” is a mixture means comprising a substance, structure, surface or material, abiotic, synthetic, inanimate, planar, spherical or specific binding, flat surface material, hybridization or enzyme recognition site Or many other recognition sites beyond the vast majority of other recognition sites or numerous other molecular species composed of surfaces, structures or materials.
  • Such substrates include, for example, semiconductors, (organic) synthetic metals, synthetic semiconductors, insulators and dopants; Metals, alloys, elements, compounds and minerals; Synthesized, degraded, etched, lithographic, printed and microfabricated slides, devices, structures and surfaces; Industrial, polymers, plastics, membranes, silicones, silicates, glass, metals and ceramics; Wood, paper, cardboard, cotton, wool, cloth, woven and non-woven fibers, materials and fabrics, but are not limited thereto.
  • membranes are known in the art to have adhesion to nucleic acid sequences.
  • Specific and non-limiting examples of such membranes include membranes for gene expression detection, such as nitrocellulose or polyvinylchloride, diaotized paper and commercially available membranes such as GENESCREENTM, ZETAPROBETM (Biorad) and NYTRANTM. have. Beads, glass, wafers and metal substrates are also included. Methods of attaching nucleic acids to such objects are well known in the art. Alternatively, screening can also be performed in the liquid phase.
  • nucleic acid hybridization reactions the conditions used to achieve stringent specific levels vary depending on the nature of the nucleic acid being hybridized. For example, the length of the nucleic acid region to be hybridized, degree of homology, nucleotide sequence composition (eg, GC / AT composition ratio), and nucleic acid type (eg, RNA, DNA) select hybridization conditions. Is considered. Further considerations are whether the nucleic acid is immobilized, for example, in a filter or the like.
  • Examples of very stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2X SSC / 0.1% SDS at room temperature (low stringency conditions); 0.2X SSC / 0.1% SDS at 42 ° C. (conditions with moderate stringency); 0.1X SSC at 68 ° C. conditions with high stringency.
  • the washing process can be carried out using one of these conditions, for example a condition with high stringency, or each of the above conditions, each 10-15 minutes in the order described above, all or all of the conditions described above. Some iterations can be done. However, as described above, the optimum conditions vary with the particular hybridization reaction involved and can be determined experimentally. In general, conditions of high stringency are used for hybridization of critical probes.
  • Probes are labeled so that they can be detected, for example, with radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Proper labeling of such probes is a technique well known in the art and can be carried out by conventional methods.
  • Kits of the invention include a compartmentalized carrier means for holding a sample, a first container containing an agent that sensitively cleaves unmethylated cytosine, a second container containing a primer for amplifying CpG containing nucleic acid, and a cleaved or uncleaved nucleic acid.
  • One or more containers including a third container containing means for detecting the presence.
  • Primers used according to the invention are used as primers to detect whether methylation has occurred on the genome.
  • the carrier means is suitable for containing one or more containers, such as bottles, tubes, each container containing independent components used in the method of the invention.
  • containers such as bottles, tubes
  • each container containing independent components used in the method of the invention.
  • a vessel containing methylation sensitive restriction endonucleases can be configured as one vessel.
  • One or more containers may contain primers that have homology with important nucleic acid locus.
  • one or more of the containers may contain isoxisomers of methylation sensitive restriction enzymes.
  • cancer tissues from 10 surgical tissues of bladder cancer patients (Chungnam National University Human Resource Bank; stage 1 stage 6 cases, stage 1 case 1, stage 3 case 1, stage 2 Example) and 500 ng of genomic DNA of normal finding tissue (Chungnam University Hospital Human Resource Bank) was ultrasonically crushed (Vibra Cell, SONICS) to produce genomic DNA fragments of about 200 to 300 bp.
  • MBD methyl binding domain
  • 500 ng of genomic DNA isolated from the tissues of the normalized and bladder carcinoma of the ultrasound was combined reaction solution (10 mM Tris-HCl, pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 3 mM MgCl 2, 0.1% Triton-X100, After reacting for 20 minutes at 4 ° C. under 5% glycerol and 25 mg / ml BSA), the resultant was washed three times using 500 ⁇ l of a binding reaction solution containing 700 mM NaCl, followed by QiaQuick PCR purification of methylated DNA bound to MBD2bt.
  • the kit was isolated using QIAGEN, USA.
  • the methylated DNA bound to the MBD2bt was amplified using a genome amplification kit (Sigma, USA, Cat. No. WGA2), and then 4 ⁇ g of the amplified genomic DNA was prepared using BioPrime Total Genomic Labeling system I (Invitrogen Corp. , USA) was used to label Cy5.
  • Standard comparative DNA was prepared to indirectly compare the degree of methylation between normal and bladder cancer patients. Standard DNA was homogenously mixed with genomic DNA of five bladder normal tissues (Biochain, USA) used for methylation analysis and amplified using a genome amplification kit (Sigma, USA, Cat. No. WGA2).
  • biomarker candidate genes analyzed by the above method is shown in Table 1.
  • MethPrimer http://itsa.ucsf.edu/ ⁇ urolab/methprimer/index1.html
  • MethPrimer http://itsa.ucsf.edu/ ⁇ urolab/methprimer/index1.html
  • PCR and sequencing primers for performing pyro sequencing for the 11 genes were designed using the PSQ assay design program (Biotage, USA). PCR and sequencing primers for methylation measurement of each gene are shown in Table 2 below.
  • PCR reaction solution (20 ng genomic DNA converted to bisulfite, 5 ⁇ l of 10X PCR buffer (Enzynomics, Korea), 5 units of Taq polymerase (Enzynomics, Korea), 4 ⁇ l of 2.5 mM dNTP (Solgent, Korea), 2 ⁇ l of PCR primer) 10 pmole / ⁇ l)
  • PCR reaction solution 20 ng genomic DNA converted to bisulfite, 5 ⁇ l of 10X PCR buffer (Enzynomics, Korea), 5 units of Taq polymerase (Enzynomics, Korea), 4 ⁇ l of 2.5 mM dNTP (Solgent, Korea), 2 ⁇ l of PCR primer) 10 pmole / ⁇ l)
  • Amplification of the PCR product was confirmed
  • pyro sequencing was performed using the PSQ96MA system (Biotage, USA). After the pyro sequencing, the degree of methylation was measured by calculating the methylation index. The methylation index was calculated by calculating the average rate of cytosine binding at each CpG site.
  • Example 2 five normal bladder tissue genomic DNAs (Biochain, USA), five bladder cancers, were examined to verify whether they can be used as biomarkers for bladder cancer diagnosis using hypermethylated biomarkers in bladder cancer cell lines. Methylation assays were performed on selected biomarkers using conjunctive normal findings (Chungnam University Hospital Human Resources Bank) and 10 bladder cancer tissues (Chungnam University Hospital Human Resources Bank). The methylation assay was performed by the method described in Example 2 using the pyro sequencing method.
  • Example 3 As shown in Example 3, among the biomarkers hypermethylated in bladder cancer tissues, 7 biomarkers having excellent sensitivity and specificity for diagnosing bladder cancer and relatively low methylation levels in normal tissues were reselected to bladder cancers in urine. Biomarkers selected from 11 normal urine cell DNA (Chungnam University Hospital Human Resource Bank) and 16 bladder cancer patient urine cell genomic DNA (Chungnam University Hospital Human Resource Bank) specimens were tested to verify their use as diagnostic biomarkers. Methylation assay was performed. The methylation assay was performed by the method described in Example 2 using the pyro sequencing method.
  • the sensitivity of each of the seven genes was excellent, ranging from 60.0% to 90.0% and specificity from 90.0% to 100%.
  • bladder cancer can be diagnosed at an early transformation stage, and thus early diagnosis is possible, and bladder cancer can be diagnosed more accurately and quickly than conventional methods.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 방광암 또는 방광암 진행단계의 진단에 필요한 정보를 제공하기 위하여, 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 방법에 관한 것으로, 보다 구체적으로는, 방광암 형질전환 세포에서 프로모터 부위가 특이적으로 메틸화되는 방광암 특이적 마커 유전자의 프로모터 메틸화를 확인하는 것을 특징으로 하는 방광암의 검출방법에 관한 것이다. 본 발명에 따르면, 방광암을 초기 형질전환 단계에서 진단할 수 있어 조기 진단이 가능하고, 통상적인 방법보다 정확하고 빠르게 방광암을 진단할 수 있다.

Description

방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법
본 발명은 방광암 또는 방광암 진행단계의 진단에 필요한 정보를 제공하기 위하여, 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 방법에 관한 것으로, 보다 구체적으로는, 방광암 형질전환 세포에서 프로모터 부위가 특이적으로 메틸화되는 방광암 특이적 마커 유전자의 프로모터 메틸화를 확인하는 것을 특징으로 하는 방광암의 검출방법에 관한 것이다.
방광암은 비뇨기계 암 중 가장 흔한 암으로서, 발생 원인이 비교적 많이 밝혀졌다. 주로 흡연이나 여러 가지 화학 물질(가죽 등의 염색 도료, 대기 오염 물질, 인공 감미료, 질산염)이 체내에 흡수되었다가 소변으로 배설되어 나오면서 방광 벽을 자극하여 암을 유발시키는 것으로 알려져 있다.
전통적인 방광암 검사로는 소변에서 비정상 세포를 찾아내는 방법을 사용하고 있으나, 이는 정확도가 낮다. 또한, 카테터(도관)를 방광에 밀어 넣어 의심되는 조직을 떼어내 검사하는 방광경 검사는 침습적 방법으로써 비교적 정확도가 높은 편이다.
일반적으로 방광암을 조기에 진단하면 환자의 생존율이 높아지지만, 조기에 방광암을 진단하는 것은 쉽지 않은 실정이다. 현재 사용되고 있는 방광암 진단법은 신체의 일부를 절개하는 방법을 이용하고 있으나, 이는 방광암을 조기에 진단하는데 어려움이 있다.
방광암은 방광근층 침범 여부에 따라 표재성 또는 침윤성 암으로 분류하며, 평균적으로 진단 당시 30% 가량의 환자가 침윤성 방광암에 해당된다. 따라서, 환자의 생존 기간을 늘이려면 병변 범위가 작을 때 조기 진단하는 것이 가장 좋은 방법이므로, 기존의 각종 방광암 진단 방법보다 효율적인 진단 방법, 즉 조기 진단이 가능하고, 대용량으로 검체를 처리할 수 있으며, 민감도 및 특이도가 높은 방광암 특이적 바이오 마커의 개발이 절실히 요구되고 있는 실정이다.
이에, 최근에는 DNA 메틸화 측정을 통하여 암을 진단하는 방법들이 제시되고 있는데, DNA 메틸화는 주로 특정 유전자의 프로모터 부위의 CpG 섬(CpG island)의 시토신(cytosine)에서 일어나고, 그로 인하여 전사 인자의 결합이 방해를 받게 되어 특정 유전자의 발현이 차단되는 것으로서, 종양 억제 유전자의 프로모터 CpG 섬의 메틸화를 검색하는 것이 암 연구에 큰 도움이 되며, 이를 메틸화 특이 PCR(methylation specific PCR, 이하, “MSP”라고 함)이나 자동 염기 분석 등의 방법으로 검사하여 암의 진단과 스크리닝 등에 이용하려는 시도가 활발하게 이루어지고 있다.
프로모터 CpG 섬의 메틸화가 발암을 직접 유발하는지, 또는 발암의 2차적인 변화를 일으키는지에 대해 논란이 있으나, 여러 암에서 종양 억제 유전자(tumor suppressor gene), DNA 수선 유전자(DNA repair gene), 세포 주기 조절 유전자 등이 과메틸화(hyper-methylation)되어 있어 이들 유전자의 발현이 차단되어 있다는 것이 확인되었으며, 특히 암 발생의 초기 단계에서 특정 유전자의 프로모터 부위에 과메틸화가 일어난다는 것이 알려져 있다.
따라서, 종양 관련 유전자의 프로모터 메틸화가 암의 중요한 지표이며, 이를 암의 진단 및 조기 진단, 발암 위험의 예측, 암의 예후 예측, 치료 후 추적 조사, 항암 요법에 대한 반응 예측 등 다방면으로 이용할 수 있다. 실제 혈액이나 객담, 침, 대변, 소변 등에서 종양 관련 유전자의 프로모터 메틸화를 조사하여 각종 암 진료에 사용하려는 시도가 최근 활발하게 이루어지고 있다 (Esteller, M. et al., Cancer Res., 59:67, 1999; Sanchez-Cespedez, M. et al., Cancer Res., 60:892, 2000; Ahlquist, D.A. et al., Gastroenterol., 119:1219, 2000).
이에, 본 발명자들은 방광암을 효과적으로 진단할 수 있는 방법을 개발하고자 예의 노력한 결과, 방광암 세포에서 특이적으로 메틸화되는 메틸화 관련 유전자의 프로모터를 바이오 마커로 이용하여 메틸화 정도를 측정함으로써, 방광암을 진단할 수 있다는 것을 확인하고 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 방광암 또는 방광암 진행단계의 진단에 필요한 정보를 제공하기 위하여, 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 방법을 제공하는데 있다.
본 발명의 다른 목적은 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하기 위한 방광암 또는 방광암 진행단계 진단용 키트 및 핵산 칩을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 (a) 임상샘플에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 단계를 포함하는 방광암 또는 방광암 진행단계의 진단에 필요한 정보를 제공하기 위하여, 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 방법을 제공한다.
또한, 본 발명은 PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 메틸화된 CpG섬을 포함하는 단편을 증폭하기 위한 PCR 프라이머쌍과 상기 프라이머쌍에 의하여 증폭된 PCR 산물을 파이로시퀀싱하기 위한 시퀀싱 프라이머를 함유하는 방광암 또는 방광암 진행단계 진단용 키트를 제공한다.
또한, 본 발명은 PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 CpG 섬의 메틸화 부위를 포함하는 단편과 하이브리다이제이션 할 수 있는 프로브를 포함하는 방광암 또는 방광암 진행단계 진단용 핵산칩을 제공한다.
도 1은 본 발명에 따른 방광암 특이적 메틸화 유전자 발굴을 위한 방광암 조지직 유래 DNA를 이용한 CpG 마이크로어레이 비교분석과정을 나타낸 것이다.
도 2는 본 발명에 따른 CpG 마이크로어레이 데이터 정규화를 통한 방광암 특이적 메틸화 유전자 발굴 과정을 나타낸 것이다.
도 3은 본 발명에서 발굴된 방광암 특이적 메틸화 유전자의 메틸화도를 파이로시퀀싱 방법으로 측정한 결과를 나타낸 것이다.
도 4는 본 발명에 따른 11종의 방광암 바이오마커 유전자의 방광암 조직에서의 메틸화도 및 민감도와 특이도를 나타낸 것이다.
도 5는 본 발명에 따른 7종의 방광암 바이오마커 유전자의 소변세포에서의 메틸화도 및 민감도와 특이도를 나타낸 것이다.
발명의 상세한 설명 및 바람직한 구현예
본 발명은 (a) 임상샘플에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 단계를 포함하는 방광암 또는 방광암 진행단계의 진단에 필요한 정보를 제공하기 위하여, 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 방법에 관한 것이다.
본 발명의 메틸화 바이오 마커 유전자의 선별방법으로 방광암뿐만 아니라, 방광암으로 진행 중인 여러 이형증 단계에서 다양하게 메틸화되는 유전자를 찾아낼 수 있으며, 선별된 유전자는 방광암 스크리닝, 위험성 평가, 예측, 병명 확인, 병의 단계 진단 및 치료 타겟의 선정에도 사용될 수 있다.
방광암 및 여러 단계의 이상에서 메틸화되는 유전자를 확인하는 것은 정확하고 효과적으로 방광암을 조기 진단할 수 있게 하며, 다중 유전자를 사용한 메틸화 목록 확립 및 치료를 위한 새로운 타겟을 확인할 수 있다. 추가로, 본 발명에 따른 메틸화 데이타는 다른 비-메틸화 연관 바이오 마커 검출 방법과 연계하면 더욱 정확한 방광암 진단 시스템을 확립할 수 있을 것이다.
본 발명의 상기 방법으로, 검체로부터 얻어진 하나 이상의 핵산 바이오 마커의 메틸화 단계를 결정하는 것을 포함하는 여러 단계 또는 기(期)의 방광암 진행을 진단할 수 있다. 방광암의 각 단계의 검체에서 분리된 핵산의 메틸화 단계를 방광 조직의 세포 증식성 이상을 갖지 않는 검체로부터 얻어진 하나 이상의 핵산의 메틸화 단계와 비교하여, 검체의 방광암의 특정 단계를 확인할 수 있으며, 상기 메틸화 단계는 하이퍼메틸화일 수 있다.
본 발명의 일례로, 핵산은 유전자의 조절 부위에서 메틸화될 수 있다. 다른 예로, 메틸화는 유전자의 조절 부위의 외곽에서부터 시작되어 내부로 진행되기 때문에, 조절 부위의 외곽에서 메틸화를 검출하는 것으로 세포 형질전환에 관여하는 유전자를 조기 진단할 수 있다.
본 발명에 있어서, 상기 방광암 바이오마커 유전자의 CpG 섬 부위는 서열번호 1~11 에서 선택되는 염기서열을 가지는 것을 특징으로 할 수 있다.
본 발명에 있어서 상기 (b) 단계는 방광암 바이오마커 유전자의 CpG 섬을 포함하는 단편을 증폭할 수 있는 프라이머를 사용하여 증폭한 결과물의 생성 유무 또는 염기서열 변화를 근거로 메틸화를 검출하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 메틸화 검출은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 정량 PCR, DNA 칩, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 방법으로 수행 할 수 있으며, 본 명의 임상 샘플은 암 의심 환자 또는 진단 대상 유래의 조직, 세포, 혈액, 혈장 및 소변 등을 사용할 수 있다.
다른 관점에서, 본 발명은 PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 메틸화된 CpG섬을 포함하는 단편을 증폭하기 위한 PCR 프라이머쌍과 상기 프라이머쌍에 의하여 증폭된 PCR 산물을 파이로시퀀싱하기 위한 시퀀싱 프라이머를 함유하는 방광암 또는 방광암 진행단계 진단용 키트에 관한 것이다.
본 발명에 있어서, 상기 방광암 바이오마커 유전자의 메틸화된 CpG섬을 포함하는 단편은 서열번호 1~11에서 선택되는 염기서열을 가지는 것을 특징으로 할 수 있다.
본 발명의 키트의 일예로는 샘플을 담는 구획된 캐리어 수단, 비메틸화 시토신을 민감하게 절단하는 제제를 함유하는 첫번째 용기, CpG 함유 핵산을 증폭하기 위한 프라이머를 함유하는 두번째 용기 및 절단된 또는 절단되지 않은 핵산의 존재를 검출하는 수단이 함유된 세번째 용기를 포함하는 하나 이상의 용기를 포함한다. 본 발명에 따라 사용되는 프라이머는 게놈상에서 메틸화가 일어났는지의 여부를 검출하는 프라이머로 사용된다.
다른 예로, 본 발명에서는 방광암 바이오마커 유전자의 핵산의 메틸화 상태를 키트 또는 핵산 칩을 이용하여 검출하는 것에 의하여, 검체에 존재하는 방광 조직의 세포 성장성 이상(이형증)을 진단할 수 있다:
본 발명의 진단용 키트 또는 핵산 칩을 이용하면 검체의 방광 조직의 세포 성장성 이상 성향(이형증 진행도)을 결정할 수 있다. 상기 방법은 검체로부터 분리한 하나 이상의 핵산의 메틸화 상태를 결정하는 것을 포함하고, 상기 하나 이상의 핵산의 메틸화 단계는 방광 조직의 세포 성장성 이상 성향(이형증)이 없는 검체로부터 분리한 핵산의 메틸화 단계와 비교하는 것을 특징으로 할 수 있다.
본 발명의 또 다른 실시예에서는 상기 메틸화 유전자 마커를 이용하여 방광암을 형성할 가능성이 있는 세포의 조기 진단이 가능하다. 암세포에서 메틸화된다고 확인된 유전자가 임상적으로 또는 형태학적으로 정상으로 보이는 세포에서 메틸화되면, 상기 정상으로 보이는 세포는 암화가 진행되고 있는 것이다. 그러므로, 정상으로 보이는 세포에서의 방광암 특이적 유전자가 메틸화를 확인함으로, 방광암을 조기 진단할 수 있다.
또 다른 관점에서, 본 발명은 PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 CpG 섬의 메틸화 부위를 포함하는 단편과 하이브리다이제이션 할 수 있는 프로브를 포함하는 방광암 또는 방광암 진행단계 진단용 핵산칩에 관한 것이다.
본 발명에서, 상기 방광암 바이오마커 유전자의 CpG 섬의 메틸화 부위는 서열번호 1~11 에서 선택되는 염기서열을 가지는 것을 특징으로 할 수 있다.
본 발명의 메틸화 마커 유전자를 이용하면, 검체에서 방광 조직의 세포 성장성 이상(이형증진행)을 검출할 수 있다. 상기 방법은 검체로부터 분리한 하나 이상의 핵산을 포함하는 시료를 하나 이상의 메틸화 상태를 결정할 수 있는 제제와 접촉시키는 것을 포함한다. 상기 방법은 하나 이상의 핵산에서 하나 이상의 부위의 메틸화 상태를 확인하는 것을 포함하고, 상기 핵산의 메틸화 상태는 방광 조직의 세포 성장성 이상(이형증 진행)을 가지지 않는 검체의 핵산에서의 동일한 부위의 메틸화 상태와 차이가 있는 것을 특징으로 할 수 있다.
본 발명에서 상기 프로브는 방광암 바이오마커 프로모터의 CpG와는 상보적이면서 동시에 상기 방광암 바이오마커 유전자의 프로모터 부위의 CpG를 포함하는 단편과 하이브리다이제이션할 수 있는 염기서열을 포함하는 것을 특징으로 할 수 있다.
본 발명의 또 다른 실시예에서는 상기 키트 또는 핵산 칩을 이용하여 마커 유전자의 메틸화를 검사하는 것에 의하여 형질전환된 방광암 세포를 확인할 수 있다.
본 발명의 또 다른 실시예에서는 상기 키트 또는 핵산 칩을 이용하여 마커 유전자의 메틸화를 검사하는 것에 의하여 방광암을 진단할 수 있다.
본 발명의 또 다른 실시예에서는 정상 표현형을 나타내는 샘플을 이용하여 상기 키트 또는 핵산 칩을 이용하여 마커 유전자의 메틸화를 검사하는 것에 의하여 방광암으로 진행될 수 있는 가능성을 진단할 수 있다. 상기 샘플은 고체 또는 액체 조직, 세포, 소변, 혈청 또는 플라즈마를 사용할 수 있다.
본 발명에 있어서, 상기 메틸화 측정방법은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 정량 PCR, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 것을 특징으로 할 수 있고, 상기 임상 샘플은 암 의심 환자 또는 진단 대상 유래의 조직, 세포, 혈액 또는 소변인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 유전자의 프로모터 메틸화 여부를 검출하는 방법은 다음 단계를 포함한다: (a) 임상샘플로부터 샘플 DNA를 분리하는 단계; (b) 상기 분리된 DNA를 방광암 바이오마커 유전자의 CpG 섬을 포함하는 단편을 증폭할 수 있는 프라이머를 사용하여 증폭하는 단계; 및 (c) 상기 (b) 단계에서 증폭된 결과물의 생성 유무를 근거로 프로모터의 메틸화 여부를 결정하는 단계.
본 발명의 또 다른 실시예에서는 방광암에서 특이적으로 메틸화되는 유전자의 메틸화 빈도를 검토하고, 방광암 진행 가능성을 가지는 조직의 메틸화 빈도를 정하는 것에 의하여 조직의 방광암으로의 발전 가능성을 평가할 수 있다.
본 발명에서 사용된 “세포 형질전환”은 정상에서 비정상으로, 비-종양성에서 종양성으로, 미분화에서 분화로, 줄기세포에서 비-줄기세포로와 같이 세포의 특징이 한 형태에서 다른 형태로 바뀌는 것을 의미한다. 추가적으로, 상기 형질전환은 세포의 형태, 표현형, 생화학적 성질 등에 의하여 인식될 수 있다.
본 발명에서 암의 “조기 확인”은 전이되기 전에 암의 가능성을 발견하는 것으로, 바람직하게는 검체 조직 또는 세포에서 형태학적 변화가 관찰되기 전에 발견하는 것이다. 추가적으로, 세포 형질전환의 “조기 확인”은 세포가 형질전환되는 형태가 되기 전에 초기 단계에서 형질전환이 일어날 가능성 높은 것을 말한다.
본 발명에서 “하이퍼메틸화”는 CpG 섬의 메틸화를 의미한다.
본 발명에서, “샘플” 또는 “검체 샘플”은 수행되는 분석의 종류에 따라, 개개인, 체액, 세포주, 조직 배양 등에서 얻어지는 모든 생물학적 샘플을 포함하는 폭넓은 범위의 샘플을 의미한다. 포유동물로부터 체액 및 조직 생검을 획득하는 방법은 통상적으로 널리 알려져 있다. 바람직한 소스는 방광의 생검(biopsy)이다.
메틸화 조절 바이오 마커의 스크리닝
본 발명에서는 세포 또는 조직이 형질전환되거나 세포의 형태가 다른 형태로 변화될 때에 메틸화되는 바이오 마커 유전자를 스크리닝하였다. 여기서, "형질전환" 세포는 정상형태가 비정상형태로, 비-종양성이 종양성으로, 미분화형태가 분화형태로 바뀌는 등의 세포 또는 조직의 형태가 다른 형태로 변화되는 것을 의미한다.
본 발명의 일 실시예에서는 방광암 환자의 암조직과 이와 연접한 정상조직으로부터 게놈 DNA를 분리하였다. 게놈 DNA로부터 메틸화된 DNA만을 획득하기 위하여, 상기 게놈 DNA를 메틸화된 DNA에 결합하는 MBD2bt와 반응시킨 후, MBD2bt 단백질에 결합하는 메틸화된 DNA를 분리하였다. 상기 분리된 MBD2bt 단백질에 결합하는 메틸화된 DNA를 증폭한 후, 정상인 유래 DNA는 Cy3으로, 방광암 환자 유래 DNA는 Cy5로 표지한 다음, human CpG 마이크로어레이에 하이브리다이제이션시켜 정상조직과 방광암 조직간 메틸화 정도의 차이가 가장 큰 11개의 유전자를 바이오 마커로 선택하였다.
본 발명에서는 상기 11개의 바이오 마커가 메틸화되었는지 추가로 확인하기 위하여, 파이로시퀀싱을 수행하였다.
즉, 방광암 세포주 RT-4, J82 및 HT1196로부터 전체 게놈 DNA를 분리하여 바이설파이트를 처리한 후, 바이설파이트로 전환된 게놈 DNA를 증폭하였다. 이후, 상기 증폭된 PCR 산물을 파이로시퀀싱을 수행하여 메틸화 정도를 측정하였다. 그 결과, 상기 11개의 바이오 마커 유전자가 모두 메틸화되어 있다는 것을 확인할 수 있었다.
방광암에 대한 바이오 마커
본 발명에서는 방광암 진단을 위한 바이오 마커를 제공한다.
방광암에 대한 바이오 마커-정상세포와의 비교를 위한 암세포의 용도
본 실시예에서, “정상” 세포는 비정상적 세포 형태 또는 세포학적 성질의 변화를 나타내지 않은 세포를 의미한다. “종양”세포는 암 세포를 의미하고, “비종양” 세포는 병증 조직의 일부이지만, 종양 부위는 아니라고 판단되는 세포를 의미한다.
본 발명은 일 관점에서, 방광암과 방광암 바이오마커 유전자의 프로모터부위 하이퍼메틸화 사이의 관련성의 발견에 기반을 둔 것이다.
본 발명의 진단용 키트 및 핵산 칩의 다른 용도로, 검체에서 분리된 하나 이상의 핵산의 메틸화 단계를 결정하여 검체의 방광 조직의 세포 성장성 이상을 조기 진단할 수 있다. 상기 하나 이상의 핵산의 메틸화 단계는 방광 조직의 세포 성장성 이상을 가지고 있지 않은 검체로부터 분리된 하나 이상의 핵산의 메틸화 상태와 비교하는 것을 특징으로 할 수 있다. 핵산은 CpG 섬과 같은 CpG-함유 핵산인 것이 바람직하다.
본 발명의 진단용 키트 및 핵산 칩의 다른 용도로, 검체로부터 분리된 방광암 바이오마커 유전자의 메틸화를 결정하는 것을 포함하는 검체의 방광 조직의 세포 성장성 이상 소양을 진단할 수 있다.
상기 “소양”은 상기 세포 성장성 이상에 걸리기 쉬운 성질을 의미한다. 소양을 가진 검체는 아직은 세포 성장성 이상을 가지고 있지 않지만, 세포 성장성 이상이 존재하거나 존재할 경향이 증가된 검체를 말한다.
본 발명은 다른 관점에서, 검체의 핵산을 포함하는 시료를 시료의 메틸화 상태를 결정할 수 있는 제제와 접촉시키고, 핵산의 메틸화를 확인하는 것을 포함하는 검체의 방광 조직의 세포 성장성 이상을 진단하는 방법을 제공한다.
본 발명의 방법은 검체로부터 분리된 하나 이상의 핵산의 하나 이상의 부위의 메틸화를 결정하는 단계를 포함한다. 여기서, “핵산” 또는 “핵산 서열”이란 올리고뉴클레오티드, 뉴클레오티드, 폴리뉴클레오티드를 의미하거나 이들의 단편, 단일가닥 또는 이중가닥의 게놈 기원 또는 합성 기원의 DNA 또는 RNA, 센스 또는 안티센스 가닥의 게놈 기원 또는 합성 기원의 DNA 또는 RNA, PNA(peptide nucleic acid) 또는 자연 기원 또는 합성 기원의 DNA 양 또는 RNA 양 물질을 말한다. 핵산이 RNA이면, 데옥시뉴클레오티드 A, G, C 및 T를 대신하여, 각각 리보뉴클레오티드 A, G, C 및 U로 대체된다는 것은 당해 분야 통상의 지식을 가진 자에 있어서 자명하다.
서로 다르게 메틸화된 CpG 섬의 존재를 검출할 수 있는 핵산이라면 어떤 것이든 사용할 수 있다. 상기 CpG 섬은 핵산 서열에서 CpG가 풍부한 부위이다.
메틸화(methylation)
본 발명에서의 정제되거나 정제되지 않은 형태의 어떠한 핵산도 사용될 수 있으며, 타겟 부위(예를 들면, CpG-함유 핵산)를 함유하는 핵산 서열을 함유하고 있거나 함유할 것으로 의심되는 어떠한 핵산도 사용될 수 있다. 차별적으로 메틸화될 수 있는 핵산 부위가 CpG 섬이고, 이는 다른 디뉴클레오티드 CpG 핵산 부위와 비교하여 높은 CpG 밀도를 가지는 핵산 서열이다. 이중(doublet) CpG는 G＊C 염기쌍의 비율로 예측하였을 때, 척추동물 DNA에서 단 20% 정도의 확률로 나타난다. 특정 부위에서, 이중 CpG의 밀도는 게놈의 다른 부위와 비교하여 10배나 더 높다. CpG 섬은 평균 G*C 비율이 약 60%로, 보통의 DNA의 G＊C 비율은 평균 40%를 나타낸다. CpG 섬은 전형적으로 약 1~2kb 길이를 가지고, 인간 게놈에는 약 45,000개의 CpG 섬이 존재한다.
여러 유전자에서, CpG 섬은 프로모터의 업스트림(upstream)에서 시작하여, 다운스트림의 전사 부위까지 확장된다. 프로모터에서 CpG 섬의 메틸화는 보통 유전자의 발현을 억제시킨다. CpG 섬은 또한 유전자 코딩 부위의 3’ 부위뿐만 아니라, 유전자 코딩 부위의 5’ 부위를 둘러싸고 있을 수 있다. 그러므로, CpG 섬은 프로모터 부위를 포함하는 조절 부위의 코딩 서열 업스트림, 코딩 부위(예를 들어, 엑손영역), 코딩 부위의 다운스트림, 예를 들면, 인헨서 부위 및 인트론을 포함하는 여러 부위에서 발견된다.
통상적으로, CpG-함유 핵산은 DNA이다. 그러나, 본 발명의 방법은 예를 들면, DNA 또는 DNA와 mRNA를 포함하는 RNA를 함유하는 시료를 적용할 수 있으며, 여기서 DNA 또는 RNA는 단일가닥 또는 이중가닥일 수 있으며, 또는 DNA-RNA 하이브리드를 함유한 시료인 것을 특징으로 할 수 있다.
핵산 혼합물 또한 사용할 수 있다. 검출될 특이적인 핵산 서열은 큰 분자의 분획일 수 있고, 처음부터 특이 서열이 전체 핵산 서열을 구성하는 분리된 분자 형태로 존재할 수 있다. 상기 핵산 서열은 순수한 형태로 존재하는 핵산일 필요는 없으며, 핵산은 전체 인간 DNA가 포함되어 있는 것과 같이 복잡한 혼합물 내의 적은 분획일 수도 있다. 시료에 포함된 핵산의 메틸화 정도를 측정하는 데 사용되거나, 메틸화된 CpG 섬을 검출하는 데 사용되는 시료에 포함된 핵산은 Sambrook 등(Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY., 1989)에 기재된 여러 가지 방법으로 추출될 수 있다.
핵산은 정보를 코드하거나 핵산의 전사를 조절하는 DNA 부위인 조절 부위를 포함할 수 있다. 조절 부위는 적어도 하나의 프로모터를 포함한다. “프로모터”는 전사를 지시하는데 필요한 최소한의 서열이고, 프로모터-의존성 유전자에서 세포 타입 특이적, 조직 특이적 또는 외부 시그널이나 제제에 의한 유도성을 조절할 수 있다. 프로모터는 유전자의 5’ 또는 3’ 부위에 위치한다. 프로모터 부위의 전체 또는 부분의 핵산 수는 CpG 섬 부위의 메틸화를 측정하는데 적용될 수 있다. 타겟 유전자 프로모터의 메틸화는 외곽에서부터 내부로 진행한다. 그러므로, 세포 전환의 초기 단계는 프로모터 부위의 외곽에서의 메틸화를 분석함으로써 검출할 수 있다.
검체로부터 분리된 핵산은 검체의 생물학적 시료에 의하여 얻어진다. 방광암이나 방광암의 진행 단계를 진단하고 싶다면, 스크랩이나 생검으로 방광 조직에서 핵산을 분리하여야 한다. 이러한 시료는 당해 분야에서 알려진 여러 의학적 과정에 의하여 얻어질 수 있다.
본 발명의 한 양태에서, 검체로부터 얻어진 샘플의 핵산의 메틸화 정도는 방광 조직의 세포 성장성 이상이 없는 검체의 동일한 핵산 부분과 비교하여 측정한다. 하이퍼메틸화는 하나 이상의 핵산에서 메틸화된 대립유전자가 존재하는 것을 말한다. 방광 조직의 세포 성장성 이상이 없는 검체는 동일한 핵산을 검사했을 때, 메틸화 대립유전자가 나타나지 않는다.
샘플(sample)
본 발명은 방광암의 조기 확인에 대하여 기술하고 있으며, 방광암 특이적 유전자 메틸화를 이용하고 있다. 방광암 특이적 유전자의 메틸화는 종양 부위의 부근 조직에서도 일어났다. 그러므로, 방광암의 조기 확인 방법은 액체 또는 고체 조직을 포함하는 모든 샘플로 방광암-특이적 유전자의 메틸화의 유무를 확인할 수 있다. 상기 샘플은 조직, 세포, 소변, 혈청 또는 플라즈마를 포함하나, 이에 한정되지는 않는다.
개별 유전자 및 패널
본 발명은 진단 또는 예측 마커로서 각 유전자를 개별적으로 사용하거나, 몇몇 마커 유전자를 조합하여 패널 디스플레이 형태로 하여 사용할 수 있고, 몇몇의 마커 유전자는 전체적인 패턴 또는 메틸화된 유전자의 목록을 통하여 신뢰성 및 효율성을 향상시키는 것을 확인할 수 있다. 본 발명에서 확인된 유전자는 개별적으로, 또는 본 실시예에서 언급된 유전자가 조합된 유전자 세트로 사용될 수 있다. 또는, 유전자들은 함께 메틸화된 유전자의 수 및 그 중요도에 따라 순위를 매길 수 있고, 가중치를 둘 수 있으며, 암으로 발전할 가능성의 수준을 선정할 수 있다. 이러한 알고리즘은 본 발명에 속한다.
메틸화 검출 방법
메틸화 특이 PCR (methylation specific PCR)
지노믹 DNA에 바이설파이트를 처리하면 5’-CpG’-3 부위의 시토신이 메틸화된 경우에는 그대로 시토신으로 남아 있고, 비메틸화된 경우에는 우라실로 변하게 된다. 따라서, 바이설파이트 처리 후 변환된 염기서열을 대상으로 5’-CpG-3’ 염기서열이 존재하는 부위에 해당하는 PCR 프라이머를 제작하였다. 이때 메틸화된 경우에 해당되는 PCR 프라이머와 비메틸화된 경우에 해당하는 두 종류의 프라이머를 제작하였다. 지노믹 DNA를 바이설파이트로 변환시킨 다음, 상기 두 종류의 프라이머를 이용하여 PCR을 하면 메틸화된 경우에는 메틸화된 염기서열에 해당되는 프라이머를 사용한 것에서 PCR 산물이 만들어지게 되고, 반대로 비메틸화인 경우에는 비메틸화에 해당되는 프라이머를 이용한 것에서 PCR 산물이 만들어진다. 메틸화 여부는 아가로즈겔 전기영동방법으로 정성적으로 확인할 수 있다.
실시간 메틸화 특이 PCR (real time methylation specific PCR)
실시간 메틸화 특이 PCR은 메틸화 특이 PCR 방법을 실시간 측정방법으로 전환한 것으로, 지노믹 DNA에 바이설파이트를 처리한 후, 메틸화된 경우에 해당하는 PCR 프라이머를 디자인하고, 이들 프라이머를 이용하여 실시간 PCR을 수행하는 것이다. 이때, 증폭된 염기서열과 상보적인 TanMan 프로브를 이용하여 검출하는 방법과 Sybergreen을 이용하여 검출하는 두 가지 방법이 있다. 따라서, 실시간 메틸화 특이 PCR은 메틸화된 DNA만을 선택적으로 정량 분석할 수 있다. 이때, in vitro methylated DNA 샘플을 이용하여 표준곡선을 작성하고, 표준화를 위하여 염기서열내에 5’-CpG-3’ 서열이 없는 유전자를 음성대조군으로 함께 증폭하여 메틸화 정도를 정량 분석하였다.
파이로시퀀싱
파이로시퀀싱 방법은 바이설파이트 시퀀싱 방법을 정량적인 실시간 시퀀싱으로 변환한 방법이다. 바이설파이트 시퀀싱과 마찬가지로 지노믹 DNA를 바이설파이트를 처리하여 전환시킨 다음, 5’-CpG-3’ 염기서열이 없는 부위에 해당하는 PCR 프라이머를 제작하였다. 지노믹 DNA를 바이설파이트로 처리한 후, 상기 PCR 프라이머로 증폭한 다음, 시퀀싱 프라이머를 이용하여 실시간 염기서열 분석을 수행하였다. 5’-CpG-3’ 부위에서 시토신과 티민의 양을 정량적으로 분석하여 메틸화 정도를 메틸화 지수로 나타내었다.
메틸화 DNA 특이적 결합 단백질을 이용한 PCR 또는 정량 PCR 및 DNA 칩
메틸화 DNA 특이적 결합 단백질을 이용한 PCR 또는 DNA 칩 방법은 메틸화 DNA에만 특이적으로 결합하는 단백질을 DNA와 섞어주게 되면, 메틸화 DNA에만 특이적으로 단백질이 결합하기 때문에 메틸화 DNA만을 선택적으로 분리할 수 있다. 지노믹 DNA를 메틸화 DNA 특이적 결합 단백질과 섞어준 후, 메틸화된 DNA만을 선택적으로 분리하였다. 이들 분리된 DNA를 프로모터 부위에 해당하는 PCR 프라이머를 이용하여 증폭한 후, 아가로즈 전기영동으로 메틸화 여부를 측정하였다.
또한, 정량 PCR 방법으로도 메틸화 여부를 측정할 수 있으며, 메틸화 DNA 특이적 결합 단백질로 분리한 메틸화 DNA는 형광 염료로 표지하여 상보적인 프로브가 집적된 DNA칩에 하이브리디제이션시킴으로써 메틸화 여부를 측정할 수 있다. 여기서 메틸화 DNA 특이적 결합 단백질은 McrBt에 제한되지 않는다.
차별적 메틸화의 검출-메틸화 민감성 제한 엔도뉴클레아제
차별적 메틸화의 검출은 메틸화되지 않은 CpG 부위만을 절단하는 메틸화 민감성 제한 엔도뉴클레아제와 핵산 샘플을 접촉시켜 비메틸화된 핵산을 절단하는 것으로 수행할 수 있다.
별도의 반응으로, 상기 샘플을 메틸화 및 비메틸화 CpG 부위를 모두 절단하는 메틸화 민감성 제한 엔도뉴클레아제의 이소키소머(isochizomer)와 접촉시켜, 메틸화된 핵산을 절단하였다.
특이적 프라이머를 핵산 샘플에 첨가하고, 통상의 방법으로 핵산을 증폭시켰다. 메틸화 민감성 제한 엔도뉴클레아제를 처리한 샘플에서 증폭 산물이 존재하고, 메틸화 및 비메틸화 CpG 부위를 모두 절단하는 메틸화 민감성 제한 엔도뉴클레아제의 이소키소머를 처리한 샘플에서 증폭 산물이 존재하지 않으면, 분석된 핵산 부위에 메틸화가 일어난 것이다. 그러나, 메틸화 민감성 제한 엔도뉴클레아제를 처리한 샘플에서 증폭 산물이 존재하지 않고, 메틸화 및 비메틸화 CpG 부위를 모두 절단하는 메틸화 민감성 제한 엔도뉴클레아제의 이소키소머를 처리한 샘플에서도 증폭 산물이 존재하지 않는다는 것은 분석된 핵산 부위에 메틸화가 일어나지 않은 것이다.
여기서, “메틸화 민감성 제한 엔도뉴클레아제”는 인식 부위에 CG를 포함하고, C가 메틸화되지 않았을 때와 비교하여 C가 메틸화되었을 때 활성을 가지는 제한효소이다 (예를 들면, SmaI). 메틸레이션 민감성 제한 엔도뉴클레아제의 비제한적 예로써, MspI, HpaII, BssHII, BstUI 및 NotI이 포함된다. 상기 효소들은 단독으로 또는 조합하여 사용될 수 있다. 다른 메틸레이션 민감성 제한 엔도뉴클레오티드로는 예를 들어, SacII 및 EagI를 들 수 있으나 이에 한정되는 것은 아니다.
메틸화 민감성 제한 엔도뉴클레아제의 이소키소머는 메틸레이션 민감성 제한 엔도뉴클레아제와 동일한 인식 부위를 갖는 제한 엔도뉴클레아제이지만, 메틸화된 CGs와 비메틸화된 CGs를 모두 절단하며, 예를 들면, MspI를 들 수 있다.
본 발명의 프라이머는 증폭될 로커스의 각 가닥과 “대체적으로” 상보성을 가지도록 제작되고, 상기에서 설명한 바와 같이, 적당한 G 또는 C 뉴클레오티드를 포함한다. 이것은 중합반응을 수행하는 조건에서 프라이머가 대응하는 핵산 가닥과 하이브리다이제이션 되기에 충분한 상보성을 가지는 것을 의미한다. 본 발명의 프라이머는 증폭 과정에 사용되며, 상기 증폭 과정은 예를 들면, PCR과 같은, 타겟 로커스가 많은 반응 단계를 거치면서 기하급수적인 숫자로 증가하는 효소 연속 반응이다. 전형적으로, 한 프라이머(안티센스 프라이머)는 로커스의 네가티브(-) 가닥에 대하여 상동성을 가지고, 나머지 하나의 프라이머(센스 프라이머)는 포지티브(+) 가닥에 대하여 상동성을 가진다. 변성된 핵산에 프라이머가 어닐링되면, DNA 폴리머라아제 I(Klenow) 및 뉴클레오티드와 같은 효소 및 반응물들에 의하여 사슬이 신장되고, 그 결과, 타겟 로커스 서열을 함유하는 + 와 - 가닥이 새롭게 합성된다. 상기 새로이 합성된 타겟 로커스가 주형으로도 사용되어 변성, 프라이머 어닐링 및 사슬 신장의 사이클이 반복되면 타겟 로커스 서열의 기하급수적인 합성이 진행된다. 상기 연속 반응의 산물은 반응에 사용된 특이 프라이머의 말단과 대응하는 말단을 가지는 독립적인 이중가닥 핵산이다.
상기 증폭 반응은 당해 분야에서 보편적으로 사용되고 있는 PCR인 것이 바람직하다. 그러나, 리얼타임 PCR 또는 등온 효소를 사용한 선형증폭과 같은 대체적인 방법도 사용할 수 있으며, 멀티플렉스 증폭 반응 역시 사용할 수 있다.
차별적 메틸화의 검출-바이설파이트 시퀀싱 방법
메틸화 CpG를 함유한 핵산을 검출하는 다른 방법은 핵산을 함유한 시료를 비메틸화 시토신을 변형시키는 제제와 접촉시키는 단계 및 CpG-특이적 올리고뉴클레오티드 프라이머를 사용하여 시료의 CpG-함유 핵산을 증폭시키는 단계를 포함한다. 여기서, 상기 올리고뉴클레오티드 프라이머는 변형된 메틸화 및 비메틸화 핵산을 구별하여 메틸화 핵산을 검출하는 것을 특징으로 할 수 있다. 상기 증폭 단계는 선택적이고, 바람직하지만 필수적인 것은 아니다. 상기 방법은 변형된(예를 들면, 화학적으로 변형된) 메틸화 및 비메틸화 DNA를 구별하는 PCR 반응에 의존하는 것이다. 상기와 같은 방법은 미국특허 5,786,146에 개시되어 있으며, 상기 특허에는 메틸화 핵산의 검출을 위한 바이설파이트(bisulfite) 시퀀싱과 연관하여 기재되어 있다.
기질
타겟 핵산 부위가 증폭되면 핵산 서열의 존재를 검출하기 위하여, 상기 핵산 증폭 산물은 고체 지지체(기질)에 고정된 알려진 유전자 프로브와 하이브리다이제이션될 수 있다.
여기서, “기질”은 물질, 구조, 표면 또는 재료, 비생물학적이고, 합성되고, 무생물, 평면, 구형 또는 특이적 결합, 평편한 표면의 물질을 포함하는 혼합물 수단으로, 하이브리다이제이션 또는 효소 인식 부위 또는 대다수의 다른 인식 부위 또는 표면, 구조 또는 재료로 구성된 수많은 다른 분자 종을 넘어서는 수많은 다른 인식 부위를 포함할 수 있다. 상기 기질은 예를 들면, 반도체, (유기)합성 메탈, 합성 반도체, 인슐레이터 및 도판트; 금속, 합금, 원소, 화합물 및 미네랄; 합성되고, 분해되며, 에칭되고, 리소그라프되며, 프린트되고 마이크로패브리케이트된 슬라이드, 장치, 구조 및 표면; 산업적, 폴리머, 플라스틱, 멤브레인, 실리콘, 실리케이트, 유리, 금속 및 세라믹; 나무, 종이, 카드보드, 면, 울, 천, 직조 및 비직조 섬유, 재료 및 패브릭일 수 있으나, 이에 한정되는 것은 아니다.
몇몇 형태의 멤브레인은 당해 분야에서 핵산 서열에 대하여 부착력을 가진다고 알려져 있다. 이러한 멤브레인의 특이적이고 비제한적인 예로 니트로셀룰로오스 또는 폴리비닐클로라이드, 디아조티즈드(diazotized) 페이퍼 및 GENESCREENTM, ZETAPROBETM(Biorad) 및 NYTRANTM 등의 상업적으로 사용되는 멤브레인과 같이 유전자 발현 검출용 멤브레인을 들 수 있다. 비드, 글래스, 웨이퍼 및 금속 기질도 포함된다. 이러한 목적물에 핵산을 부착시키는 방법은 당해 분야에서 잘 알려져 있다. 이와 다르게, 액체 상에서도 스크리닝을 수행할 수 있다.
하이브리다이제이션 조건
핵산 하이브리다이제이션 반응에서, 엄격한 특정 수준을 달성하기 위하여 사용되는 조건은 하이브리다이즈되는 핵산의 성질에 따라 다양하다. 예를 들면, 하이브리다이제이션되는 핵산 부위의 길이, 상동성 정도, 뉴클레오티드 서열 조성(예를 들면, GC/AT 조성비) 및 핵산 타입(예를 들면, RNA, DNA)등이 하이브리다이제이션 조건을 선택하는데 고려된다. 추가적인 고려 조건은 핵산이 예를 들면, 필터 등에 고정화되어 있는지의 여부이다.
매우 엄격하게 진행되는 조건의 예를 들면 다음과 같다: 실온의 2X SSC/0.1% SDS(하이브리다이제이션 조건); 실온의 0.2X SSC/0.1% SDS(엄격성이 낮은 조건); 42℃에서의 0.2X SSC/0.1% SDS(보통의 엄격성을 가지는 조건); 68℃에서 0.1X SSC(높은 엄격성을 가지는 조건). 세척 과정은 이들 중 한가지 조건을 사용하여 수행할 수 있고, 예를 들면 높은 엄격성을 가지는 조건, 또는 상기 조건을 각각 사용할 수 있으며, 상기 기재된 순서대로 각각 10~15분씩, 상기 기재된 조건을 전부 또는 일부 반복하여 수행할 수 있다. 그러나 상기에 기술한 바와 같이, 최적 조건은 포함된 특별한 하이브리다이제이션 반응에 따라 다양하며, 실험을 통하여 결정할 수 있다. 일반적으로, 중요한 프로브의 하이브리다이제이션에는 높은 엄격성을 가지는 조건이 사용된다.
표지(Label)
중요한 프로브는 검출할 수 있도록 표지되며, 예를 들면 방사선 동위원소, 형광 화합물, 바이오 발광 화합물, 화학 발광 화합물, 금속 킬레이트 또는 효소로 표지될 수 있다. 상기와 같은 프로브를 적당하게 표지하는 것은 당해 분야에서 널리 알려진 기술이며, 통상적인 방법을 통하여 수행할 수 있다.
키트(Kit)
본 발명에 의하면, 검체의 세포 성장성 이상을 검출하는 데 유용한 키트를 제공하고 있다. 본 발명의 키트는 샘플을 담는 구획된 캐리어 수단, 비메틸화 시토신을 민감하게 절단하는 제제를 함유하는 첫번째 용기, CpG 함유 핵산을 증폭하기 위한 프라이머를 함유하는 두번째 용기 및 절단된 또는 절단되지 않은 핵산의 존재를 검출하는 수단이 함유된 세번째 용기를 포함하는 하나 이상의 용기를 포함한다. 본 발명에 따라 사용되는 프라이머는 게놈상에서 메틸화가 일어났는지의 여부를 검출하는 프라이머로 사용된다.
캐리어 수단은 병, 튜브와 같은 하나 이상의 용기를 함유하기에 적합하고, 각 용기는 본 발명의 방법에 사용되는 독립적 구성요소들을 함유한다. 본 발명의 명세서에서, 당해 분야의 통상의 지식을 가진 자는 용기 중의 필요한 제제를 손쉽게 분배할 수 있다. 예를 들면, 메틸화 민감성 제한 엔도뉴클레아제를 함유하는 용기를 하나의 용기로 구성할 수 있다. 하나 이상의 용기는 중요 핵산 로커스와 상동성을 가지는 프라이머를 포함할 수 있다. 또한, 하나 이상의 용기는 메틸화 민감성 제한효소의 이소키소머를 포함할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 방광암 특이적 메틸화 유전자 발굴
방광암에서 특이적으로 메틸화된 바이오 마커를 선별하기 위하여, 방광암환자 10명의 수술조직으로부터 얻은 암 조직 (충남대병원 인체자원은행; 병기 1기 6예, 2기 1예, 3기 1예, 4기 2예) 및 이와 연접하는 정상소견 조직 (충남대병원 인체자원은행)의 게놈 DNA 500ng을 초음파 분쇄(Vibra Cell, SONICS)하여, 약 200~300bp의 게놈 DNA 절편을 제작하였다.
게놈 DNA로부터 메틸화된 DNA만을 획득하기 위하여, 메틸화 DNA에 결합한다고 알려진 메틸바인딩 도메인 (Methyl binding domain; MBD) (Moon et al., American Biotechnology Laboratory, 27 (10): 23-25, 2009)을 사용하였다. 즉, 6X His가 tagging된 MBD2bt 2㎍을 대장균 JM110(한국생명공학연구원 생명자원센터, No. 2638) 게놈 DNA 500ng과 pre-incubation시킨 다음, Ni-NTA 마그네틱 비드 (Qiagen, USA)에 결합시켰다. 여기에 상기 초음파 분쇄된 정상인 및 방광암 환자 조직세포에서 분리한 게놈 DNA 500ng을 결합 반응 용액(10mM Tris-HCl(pH 7.5), 50mM NaCl, 1mM EDTA, 1mM DTT, 3mM MgCl2, 0.1% Triton-X100, 5% 글리세롤, 25㎎/㎖ BSA)하에서 4℃, 20 분간 반응시킨 후, 700mM NaCl이 포함된 결합 반응 용액 500㎕를 이용하여 3회 세척한 다음, MBD2bt에 결합된 메틸화된 DNA를 QiaQuick PCR purification kit(QIAGEN, USA)을 사용하여 분리하였다.
이후, 상기 MBD2bt에 결합된 메틸화된 DNA를 게놈 증폭 키트(Sigma, USA, Cat. No. WGA2)를 이용하여 증폭한 후, 상기 증폭된 게놈 DNA 4㎍을 BioPrime Total Genomic Labeling system I(Invitrogen Corp., USA)을 이용하여 Cy5로 표지하였다. 정상인과 방광암 환자간의 메틸화 정도를 간접적으로 비교하기 위하여 표준비교 DNA를 제작하였다. 표준비교 DNA는 메틸화 분석을 위해 사용한 5예의 방광 정상 조직의 게놈 DNA (Biochain 사, 미국)를 동량으로 혼합하고 이를 DNA를 게놈 증폭 키트(Sigma, USA, Cat. No. WGA2)를 이용하여 증폭한 후, 상기 증폭된 게놈 DNA 4㎍을 BioPrime Total Genomic Labeling system I(Invitrogen Corp., USA)을 이용하여 Cy3로 표지하였다. 상기 표준비교 DNA 및 정상인과 방광암 환자의 DNA 각각을 혼합한 후, 244K human CpG 마이크로어레이(Agilent, USA)에 하이브리다이제이션시켰다 (도 1). 상기 하이브리다이제이션 후, 일련의 세척 과정을 거친 다음. Agilent scanner를 이용하여 스캐닝하였다. 마이크로어레이 이미지로부터 시그날 값의 계산은 Feature Extraction 프로그램 v. 9.5.3.1(Agilent)을 이용하여 정상인과 방광암 환자 시료 간 시그날의 상대적인 강도 차이를 계산하였다.
신뢰할 만한 하이브리다이제이션 시스날을 갖는 프로브들을 선별하기 위하여 GeneSpring 7.3 프로그램 (미국 Agilent 사)을 이용하여 cross gene error model을 적용하여 Cy3 시그날이 총 20개의 array중 최소 16개 array에서 122.3 이상인 70,492개의 프로브들을 신뢰할 만한 시그날을 갖는 프로브들로 선별하였다. 이로부터 방광암에 특이적으로 과메틸화되어 있는 프로브들을 선별하기 위하여 방광암과 연접하고 있는 정상소견조직과 방광암 조직과 비교하여 차별적인 메틸화를 보이는 프로브들을 선별하기 위하여 아노바 테스트 (ANOVA test)를 수행하여 p 값이 0.01 이하인 2,325개의 프로브를 선별하였다. 이로부터 방광암조직에 과메틸화 되어 있는 1,388개의 프로브들을 다시 선별하고, 이중 약 400 bp 이내에 존재하는 2개 이상의 연접한 프로브에서 과메틸화를 동시에 나타내는 11종의 바이오마커 유전자 후보 (C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PACSIN3, PLDXC2, ZNF312, SYCP2L)를 바이오마커후보로 발굴하였다 (도 2).
상기 방법으로 분석한 바이오마커 후보 유전자들 목록은 표 1에 나타내었다. 또한, CpG 마이크로 어레이 분석에서 과메틸화를 보이는 이들 11개의 유전자들의 각 프로브에 해당하는 부위의 염기서열에 대해서 MethPrimer (http://itsa.ucsf.edu/~urolab/ methprimer/index1.html)을 이용하여 CpG islands가 존재하는 것을 확인하였다.
표 1 방광암 진단용 메틸화 바이오 마커 후보유전자 목록
후보유전자 프로브 위치a GenBank No. Description
C1orf104 +335, +747 NM_173639 putative uncharacterized protein RUSC1-AS1
CACNA1B +1275, +1343 NM_000718 calcium channel, voltage-dependent, N type, alpha 1B subunit
IMP-1 -911, -752, -690 NM_006546 insulin-like growth factor 2 mRNA binding protein 1
PDE3A -263, -179 NM_000921 phosphodiesterase 3A, cGMP-inhibited
POU3F4 +664, +833, +907 NM_000307 POU domain, class 3, transcription factor 4; synonyms: BRN4, DFN3, OTF9, BRAIN-4; Homo sapiens POU domain, class 3, transcription factor 4 (POU3F4), mRNA.
SOX3 -399, +15 NM_005634 SRY (sex determining region Y)-box 3
DMC1 +173, +232, +307 NM_007068 meiotic recombination protein DMC1/LIM15 homolog
PACSIN3 -737, -667 NM_016223 syndapin III
PLXDC2 +695, +768 NM_032812 tumor endothelial marker 7-related protein
ZNF312 +2216, +2558, +2986 NM_018008 zinc finger protein Fez-like
SYCP2L +88, +167 NM_194299 synaptonemal complex protein 2-like
a, 전사개시부위 (+1)로부터의 염기서열 거리 (bp)
실시예 2: 방광암 세포주에서의 바이오 마커 후보 유전자의 메틸화 측정
상기 11종 유전자의 메틸화 상태를 추가적으로 확인하기 위하여, 각각의 프로모터에 대해 바이설파이트 시퀀싱을 수행하였다.
바이설파이트(bisulfite)를 이용하여 메틸화되지 않은 시토신을 우라실로 변형하기 위하여, 방광암 세포주 RT-4(한국세포주은행 (KCLB 30002), J82(KCLB 30001) 및 HT1197(KCLB 21473)로부터 전체 게놈 DNA를 분리하여, 그 중 게놈 DNA 200ng에 EZ DNA methylation-Gold kit(Zymo Research, USA)를 이용하여 바이설파이트를 처리하였다. DNA를 바이설파이트로 처리하면, 비메틸화된 시토신은 우라실로 변형되고, 메틸화된 시토신은 변화없이 남게 된다. 상기 바이설파이트가 처리된 DNA를 멸균 증류수 20㎕로 용출시켜 파이로시퀀싱(pyrosequencing)을 수행하였다.
상기 11종의 유전자에 대한 파이로시퀀싱을 수행하기 위한 PCR 및 시퀀싱 프라이머는 PSQ assay design 프로그램(Biotage, USA)을 이용하여 설계하였다. 각 유전자의 메틸화 측정을 위한 PCR 및 시퀀싱 프라이머는 하기 표 2와 같다.
표 2 PCR 프라이머 및 조건
유전자 서열(5’∼3’)a CpG sitesb 증폭산물 크기(bp)
C1orf104 F: GTTTGTTTGGTGAATGTAGGAA (서열번호 12)R: biotin-AAAAAAATAAACATACCRC TATTC (서열번호13)S: AGAGGAAAAGGATGGAGT (서열번호14) +2937, +2955, +2973, +2977(서열번호 2) 151
CACNA1B F: GGTTTAGYGGTGGTTGTTGTA (서열번호15)R: biotin-TTAACRATAATAATAACCAAAA TCATATA (서열번호16)S: GGTGGTTGTTGTATTGGG (서열번호 17) +1208, +1211, +1217(서열번호 3) 132
IMP-1 F: GGATTTYGAAAYGTTATTATTTAATAG (서열번호 18)R: biotin-AACTAAAAACRAAATATCCCAAT (서열번호 19)S: ATTTYGAAAGTTATTATTTAATAG (서열번호 20) -726, -719, -713(서열번호 4) 126
PDE3A F: TGGGAATTTAGTGAAGAG (서열번호21)R: biotin-CCACTATAAACCAACTTATCC CTAACT (서열번호 22)S: GGGTATTTTATATTATGGTAGTG (서열번호 23) +252, +255, +258, +265(서열번호 5) 84
POU3F4 F: AGGGAGTTAGATTAGTATTGATAAGAT (서열번호 24)R: biotin-TAATCCCCTAACCAAATCATTCTTTTCTC (서열번호 25)S: ATTTTTTTAAGTGTTTTAAGTTTGT (서열번호26) +976, +978, +993(서열번호 6) 237
SOX3 F: TAGGTATATAAGGGGTTTAGTTAGA (서열번호 27)R: biotin-ACTTCTCCCACCTAATAAATT CTCTC (서열번호28)S: GTTAGAGTTTAGGTAGATTGT (서열번호29) +4, +13, +32(서열번호 7) 81
DMC1 F: GAGGGGGGTAAGTGGTAAAAA (서열번호 30)R: biotin-TCCCTCAAAATCACTAAAATTCCT (서열번호31)S: GGGGTAAGTGGTAAAAA (서열번호 32) +157, +164, +168, +185, +189(서열번호 8) 165
PACSIN3 F: GAGGAGGGAGAAGGGATTTAT (서열번호 33)R: biotin-TCCACCCCCTTTATCAATCT (서열번호34)S: GGGAGAAGGGATTTATTTAG (서열번호 35) -699, -686, -681(서열번호 1) 82
PLXDC2 F: GAGTGTGGTAAGTTGTAAAGAGAGT (서열번호36)R: biotin-AACCCRAAAACCTTTATAAATA (서열번호 37)S: AGTTGTAAAGAGAGTTTTAG (서열번호 38) +1437, +1444, +1449, +1459, +1461, +1468(서열번호 9) 128
ZNF312 F: AAGAGGGATTTGGAGAGAGAA (서열번호 39)R: biotin-TCTCAATACACCCAACCTACATAC (서열번호 40)S: GATTTGGAGAGAGAAGG (서열번호 41) +2397, +2410, +2412, +2416(서열번호 10) 140
SYCP2L F: TTGGGYGGGGAAGTAGGA (서열번호 42)R: biotin-AACCCTTCRAAAATCACTCA (서열번호 43)S: GGAAGTAGGAGAGGG (서열번호 44) +240, +244, +248, +263, +266(서열번호 11) 111
a: Y = T or C; R = A or G
b: 전사개시점 (+1)으로부터의 거리 (bp)
상기의 바이설파이트로 전환된 게놈 DNA 20ng을 PCR로 증폭하였다. PCR 반응 용액(바이설파이트로 전환된 게놈 DNA 20ng, 10X PCR buffer(Enzynomics, Korea) 5㎕, Taq polymerase(Enzynomics, Korea) 5units, 2.5mM dNTP(Solgent, Korea) 4㎕, PCR 프라이머 2㎕(10 pmole/㎕))을 95℃에서 5분 동안 처리한 후, 95℃에서 40초, 60℃에서 45초, 72℃에서 40초로 총 45회 실시한 다음, 72℃에서 5분 동안 반응시켰다. 상기 PCR 산물의 증폭 여부는 2.0% 아가로오스젤을 사용한 전기영동으로 확인하였다.
상기 증폭된 PCR 산물에 PyroGold 시약(Biotage, USA)을 처리한 후, PSQ96MA 시스템(Biotage, USA)을 이용하여 파이로시퀀싱을 수행하였다. 상기 파이로시퀀싱 후, 메틸화 지수(methylation index)를 계산함으로써 메틸화 정도를 측정하였다. 메틸화 지수는 각 CpG 부위에서 시토신이 결합하는 평균율을 구하여 계산하였다.
도 3은 11종의 바이오 마커의 방광암 세포주에서의 메틸화 정도를 파이로시퀀싱 방법을 이용하여 정량적으로 나타낸 것이다. 그 결과, 상기 11종의 바이오 마커 유전자 모두가 최소 1개 이상의 세포주에서 높은 수준으로 메틸화되어 있는 것을 확인하였다.
실시예 3: 방광암 조직에서의 11종 바이오마커 유전자의 메틸화 측정
실시예 2에서 나타난 바와 같이, 방광암 세포주에서 과메틸화되어 있는 바이오마커를 이용하여 방광암 진단용 바이오마커로 사용할 수 있는지 검증하기 위하여, 5예의 정상 방광조직 게놈 DNA (Biochain 사, 미국), 5예의 방광암과 연접한 정상소견 조직 (충남대 병원 인체자원은행) 그리고 10예의 방광암 조직 (충남대병원 인체자원은행) 임상 검체를 이용하여 선발된 바이오마커에 대하여 메틸화 어세이를 수행하였다. 메틸화 어세이는 파이로시퀀싱 방법을 사용하여 실시예 2에 기재된 방법으로 수행하였다.
그 결과, 11종의 유전자 전부가 정상 방광조직에 비하여 방광암 조직에서 메틸화 수준이 매우 높은 것으로 확인되었다 (도 4). 이상의 결과로 볼 때 이들 11종의 유전자들은 방광암을 진단하기 위한 바이오마커로서의 유용성이 있음을 확인하였다. 또한 11종 각 유전자의 방광암 진단에 대한 능력을 평가하기 위하여 ROC 분석 (MedCalc 프로그램, 벨기에)을 수행하고 민감도 및 특이도를 계산하였다 (표 3).
표 3 11종 바이오마커 유전자의 방광암 진단에 대한 민감도 및 특이도
바이오마커 민감도(％) 특이도(％) P value
C1orf104 90.0 100 0.0001
CACNA1B 90.0 100 0.0001
IMP-1 90.0 100 0.0001
PDE3A 70.0 100 0.0001
POU3F4 100 100 0.0001
SOX3 100 100 0.0001
DMC1 100 100 0.0001
PACSIN3 70.0 100 0.0001
PLXDC2 60.0 100 0.0001
ZNF312 100 100 0.0001
SYCP2L 100 100 0.0001
11종 각 유전자의 특이도를 100％로 고정하였을 때 민감도는 60.0％~100％로 다양하게 나타났다.
실시예 4: 방광암 소변세포에서의 7종 바이오마커 유전자의 메틸화 측정
실시예 3에서 나타난 바와 같이, 방광암 조직에서 과메틸화되어 있는 바이오마커중 방광암 진단에 대한 민감도 및 특이도가 우수하고 정상조직에서 메틸화 수준이 상대적으로 낮은 7종의 바이오마커를 다시 선별하여 소변대상 방광암 진단용 바이오마커로 사용할 수 있는지 검증하기 위하여, 11예의 정상인 소변세포 DNA (충남대 병원 인체자원은행) 그리고 16예의 방광암환자 소변세포 게놈 DNA (충남대 병원 인체자원은행) 검체를 이용하여 선발된 바이오마커에 대하여 메틸화 어세이를 수행하였다. 메틸화 어세이는 파이로시퀀싱 방법을 사용하여 실시예 2에 기재된 방법으로 수행하였다.
그 결과, 7종의 유전자 전부가 정상 방광조직에 비하여 방광암 조직에서 메틸화 수준이 매우 높은 것으로 확인되었다 (도 5). 이상의 결과로 볼 때 이들 7종의 유전자들은 소변세포를 대상으로 방광암을 진단하기 위한 바이오마커로서의 유용성이 있음을 확인하였다. 또한 7종 각 유전자의 방광암 진단에 대한 능력을 평가하기 위하여 ROC 분석 (MedCalc 프로그램, 벨기에)을 수행하고 민감도 및 특이도를 계산하였다 (표 4).
표 4 7종 바이오마커 유전자의 방광암 진단에 대한 민감도 및 특이도
바이오마커 민감도(％) 특이도(％) P value
IMP-1 70.0 100 0.0001
POU3F4 60.0 100 0.0001
SOX3 100 100 0.0001
DMC1 90.0 100 0.0001
PACSIN3 75.0 90.0 0.0001
ZNF312 80.0 100 0.0001
SYCP2L 80.0 90.9 0.0001
7종 각 유전자들의 민감도는 60.0％~90.0％ 그리고 특이도는 90.0％~100％로 우수하게 나타났다.
이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명에 따르면, 방광암을 초기 형질전환 단계에서 진단할 수 있어 조기 진단이 가능하고, 통상적인 방법보다 정확하고 빠르게 방광암을 진단할 수 있다.
전자파일 첨부하였음,

Claims (9)

  1. 다음 단계를 포함하는 방광암 또는 방광암 진행단계의 진단에 필요한 정보를 제공하기 위하여, 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 방법:
    (a) 임상샘플에서 DNA를 분리하는 단계; 및
    (b) 상기 분리된 DNA에서 PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L 으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 단계.
  2. 제1항에 있어서, 상기 방광암 바이오마커 유전자의 CpG 섬 부위는 서열번호 1~11 에서 선택되는 염기서열을 가지는 것을 특징으로 하는 방광암 또는 방광암 진행단계의 검출방법.
  3. 제1항에 있어서, (b) 단계는 방광암 바이오마커 유전자의 CpG 섬을 포함하는 단편을 증폭할 수 있는 프라이머를 사용하여 증폭한 결과물의 생성 유무 또는 염기서열 변화를 근거로 메틸화를 검출하는 것을 특징으로 하는 방광암 또는 방광암 진행단계의 검출방법.
  4. 제1항에 있어서, 상기 메틸화 검출은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 정량 PCR, DNA 칩, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 방법에 의해 수행되는 것을 특징으로 하는 방광암 또는 방광암 진행단계의 검출방법.
  5. 제1항에 있어서, 상기 임상 샘플은 암 의심 환자 또는 진단 대상 유래의 조직, 세포, 혈액, 혈장 및 소변으로 구성된 군에서 선택되는 것임을 특징으로 하는 방광암 또는 방광암 진행단계의 검출방법.
  6. PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L 으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 메틸화된 CpG섬을 포함하는 단편을 증폭하기 위한 PCR 프라이머쌍과 상기 프라이머쌍에 의하여 증폭된 PCR 산물을 파이로시퀀싱하기 위한 시퀀싱 프라이머를 함유하는 방광암 또는 방광암 진행단계 진단용 키트.
  7. 제6항에 있어서, 상기 방광암 바이오마커 유전자의 메틸화된 CpG섬을 포함하는 단편은 서열번호 1~11에서 선택되는 염기서열을 가지는 것을 특징으로 하는 방광암 또는 방광암 진행단계 진단용 키트.
  8. PACSIN3, C1orf104, CACNA1B, IMP-1, PDE3A, POU3F4, SOX3, DMC1, PLDXC2, ZNF312 및 SYCP2L 으로 구성된 군에서 선택되는 방광암 바이오마커 유전자의 CpG 섬의 메틸화 부위를 포함하는 단편과 하이브리다이제이션 할 수 있는 프로브를 포함하는 방광암 또는 방광암 진행단계 진단용 핵산칩.
  9. 제8항에 있어서, 상기 방광암 바이오마커 유전자의 CpG 섬의 메틸화 부위는 서열번호 1~11에서 선택되는 염기서열을 가지는 것을 특징으로 하는 방광암 또는 방광암 진행단계 진단용 핵산칩.
PCT/KR2014/002108 2013-04-10 2014-03-13 방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법 WO2014168346A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020130039323A KR101573467B1 (ko) 2013-04-10 2013-04-10 방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법
KR10-2013-0039323 2013-04-10

Publications (1)

Publication Number Publication Date
WO2014168346A1 true WO2014168346A1 (ko) 2014-10-16

Family

ID=51689719

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/002108 WO2014168346A1 (ko) 2013-04-10 2014-03-13 방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법

Country Status (2)

Country Link
KR (1) KR101573467B1 (ko)
WO (1) WO2014168346A1 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104450893A (zh) * 2014-11-20 2015-03-25 兰州百源基因技术有限公司 一种用于检测膀胱癌的探针组及基因芯片
CN110373462A (zh) * 2019-06-06 2019-10-25 宽盈医疗科技(上海)有限公司 膀胱癌诊断系统和检测尿液中目的基因甲基化水平的方法
CN113755564A (zh) * 2021-09-22 2021-12-07 成都大学附属医院 一种多基因联合甲基化检测方法及其应用
CN115786502A (zh) * 2022-07-14 2023-03-14 武汉艾米森生命科技有限公司 检测目标区域的甲基化水平的试剂在制备膀胱癌的诊断产品中的应用

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101995835B1 (ko) 2018-09-20 2019-07-08 대한민국 Elovl5 유전자를 이용한 제2형 당뇨병 진단용 조성물 및 방법
KR102066712B1 (ko) 2018-12-10 2020-02-17 충북대학교 산학협력단 방광암의 예후를 예측하기 위한 조성물 및 이를 이용하여 방광암의 예후를 예측하기 위해 필요한 정보를 제공하는 방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090056921A (ko) * 2007-11-30 2009-06-03 (주)지노믹트리 방광암 특이적 메틸화 마커 유전자를 이용한 방광암 진단용키트 및 칩
US20090175844A1 (en) * 2005-02-10 2009-07-09 Oncotherapy Science Inc. Method of diagnosing bladder cancer
WO2012116019A1 (en) * 2011-02-22 2012-08-30 Brown University Compositions and methods for detecting bladder cancer
US20120230952A1 (en) * 2011-03-11 2012-09-13 Woonbok Chung Detection of bladder cancer
US20130041047A1 (en) * 2011-06-01 2013-02-14 Aros Applied Biotechnology As Urinary Methylation Markers for Bladder Cancer

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090175844A1 (en) * 2005-02-10 2009-07-09 Oncotherapy Science Inc. Method of diagnosing bladder cancer
KR20090056921A (ko) * 2007-11-30 2009-06-03 (주)지노믹트리 방광암 특이적 메틸화 마커 유전자를 이용한 방광암 진단용키트 및 칩
WO2012116019A1 (en) * 2011-02-22 2012-08-30 Brown University Compositions and methods for detecting bladder cancer
US20120230952A1 (en) * 2011-03-11 2012-09-13 Woonbok Chung Detection of bladder cancer
US20130041047A1 (en) * 2011-06-01 2013-02-14 Aros Applied Biotechnology As Urinary Methylation Markers for Bladder Cancer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
RAJU KANDIMALLA ET AL.: "Genome-wide Analysis of CpG Island Methylation in Bladder Cancer Identified TBX2, TBX3, GATA2, and ZIC4 as pTa-Specific Prognostic Markers.", EUROPEAN UROLOGY, vol. 61, 2012, pages 1245 - 1256 *
SATISH KALARI ET AL.: "Identification of driver and passenger DNA methylation in cancer by epigenomic analysis.", ADVANCES IN GENETICS., vol. 70, 2010, pages 277 - 308 *
WOONBOK CHUNG ET AL.: "Biomarkers in Urine Sediments Detection of Bladder Cancer Using Novel DNA Methylation.", CANCER EPIDEMIOLOLOGY, BIOMARKERS AND PREVENTION., vol. 20, 2011, pages 1483 - 1491 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104450893A (zh) * 2014-11-20 2015-03-25 兰州百源基因技术有限公司 一种用于检测膀胱癌的探针组及基因芯片
CN110373462A (zh) * 2019-06-06 2019-10-25 宽盈医疗科技(上海)有限公司 膀胱癌诊断系统和检测尿液中目的基因甲基化水平的方法
CN113755564A (zh) * 2021-09-22 2021-12-07 成都大学附属医院 一种多基因联合甲基化检测方法及其应用
CN115786502A (zh) * 2022-07-14 2023-03-14 武汉艾米森生命科技有限公司 检测目标区域的甲基化水平的试剂在制备膀胱癌的诊断产品中的应用
CN115786502B (zh) * 2022-07-14 2023-08-01 武汉艾米森生命科技有限公司 检测目标区域的甲基化水平的试剂在制备膀胱癌的诊断产品中的应用

Also Published As

Publication number Publication date
KR101573467B1 (ko) 2015-12-01
KR20140122529A (ko) 2014-10-20

Similar Documents

Publication Publication Date Title
WO2009113771A1 (ko) 폐암특이적 메틸화 마커 유전자를 이용한 폐암 검출방법
WO2011055916A2 (ko) 장암 진단을 위한 장암 특이적 메틸화 마커 유전자의 메틸화 검출방법
WO2014073785A1 (ko) 위용종 및 위암 특이적 메틸화 마커 유전자를 이용한 위용종 및 위암의 검출방법
KR101074841B1 (ko) 방광암 특이적 메틸화 마커 유전자를 이용한 방광암 진단용키트 및 칩
WO2012070861A2 (ko) 위암 진단을 위한 위암 특이적 메틸화 바이오마커
WO2014168346A1 (ko) 방광암 특이적 후성유전적 마커 유전자를 이용한 방광암의 검출방법
WO2012081928A2 (ko) 장암 진단을 위한 장암 특이적 메틸화 마커 ｇｐｍ６ａ 유전자의 메틸화 검출방법
WO2015023146A1 (ko) 전암병변의 검출방법
US9670551B2 (en) Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene
WO2011132989A2 (ko) 자궁경부암 진단용 메틸화 마커
US9670552B2 (en) Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene
KR20130103110A (ko) 간암 특이적 과메틸화 ＣｐＧ 서열을 이용한 간암의 검출방법
KR101387663B1 (ko) 방광암 특이적 메틸화 마커 유전자를 이용한 방광암 검출방법
WO2018194280A1 (ko) SDC2(Syndecan 2) 유전자의 메틸화 검출방법
WO2011049322A2 (ko) 유방암 진단을 위한 유방암 특이적 메틸화 마커 유전자의 메틸화 검출방법
KR101145406B1 (ko) 장암 진단을 위한 장암 특이적 메틸화 마커 유전자의 메틸화 검출방법
WO2024144237A1 (ko) 폐암 특이적 메틸화 마커 유전자를 이용한 폐암 검출 방법
WO2024144235A1 (ko) 폐암 특이적 메틸화 마커 유전자를 이용한 폐암 검출 방법
WO2020256293A1 (ko) Sdc2 유전자의 메틸화 검출방법
KR101200552B1 (ko) 방광암 특이적 메틸화 마커 유전자를 이용한 방광암 진단용 키트 및 칩
KR101200537B1 (ko) 방광암 특이적 메틸화 마커 유전자를 이용한 방광암 진단용 키트 및 칩
KR101142130B1 (ko) 유방암 특이적 메틸화 마커 유전자를 이용한 유방암의 검출방법
WO2023132626A1 (ko) 특정 유전자의 cpg 메틸화 변화를 이용한 전립선암 진단용 조성물 및 이의 용도
KR101191947B1 (ko) 유방암 특이적 메틸화 마커 유전자를 이용한 유방암의 검출방법
KR101136505B1 (ko) 장암 진단을 위한 장암 특이적 메틸화 마커 유전자의 메틸화 검출방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14782945

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14782945

Country of ref document: EP

Kind code of ref document: A1