WO2015188933A1 - Methods and means for enhancing rna production - Google Patents

Methods and means for enhancing rna production Download PDF

Info

Publication number
WO2015188933A1
WO2015188933A1 PCT/EP2015/001164 EP2015001164W WO2015188933A1 WO 2015188933 A1 WO2015188933 A1 WO 2015188933A1 EP 2015001164 W EP2015001164 W EP 2015001164W WO 2015188933 A1 WO2015188933 A1 WO 2015188933A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
rna
optimized
mix
bioreactor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2015/001164
Other languages
English (en)
French (fr)
Inventor
Aniela WOCHNER
Tilmann Roos
Thomas Ketterer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Curevac SE
Original Assignee
Curevac AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=51033109&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2015188933(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to BR112016026980-2A priority Critical patent/BR112016026980B1/pt
Priority to ES15738263T priority patent/ES2727776T3/es
Priority to PL15738263T priority patent/PL3155129T3/pl
Priority to KR1020167035028A priority patent/KR102459599B1/ko
Priority to AU2015273933A priority patent/AU2015273933B2/en
Priority to MX2016016170A priority patent/MX382298B/es
Priority to CN201580031536.2A priority patent/CN106661621B/zh
Priority to RU2017100044A priority patent/RU2738753C2/ru
Application filed by Curevac AG filed Critical Curevac AG
Priority to EP18001012.6A priority patent/EP3521456B1/en
Priority to US15/317,579 priority patent/US10837039B2/en
Priority to EP15738263.1A priority patent/EP3155129B1/en
Priority to SG11201608605QA priority patent/SG11201608605QA/en
Priority to JP2016572447A priority patent/JP6748579B2/ja
Priority to CA2945629A priority patent/CA2945629C/en
Publication of WO2015188933A1 publication Critical patent/WO2015188933A1/en
Anticipated expiration legal-status Critical
Priority to US17/071,279 priority patent/US20210040526A1/en
Priority to US18/582,620 priority patent/US20240218412A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M21/00Bioreactors or fermenters specially adapted for specific uses
    • C12M21/18Apparatus specially designed for the use of free, immobilized or carrier-bound enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M23/00Constructional details, e.g. recesses, hinges
    • C12M23/44Multiple separable units; Modules
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M29/00Means for introduction, extraction or recirculation of materials, e.g. pumps
    • C12M29/04Filters; Permeable or porous membranes or plates, e.g. dialysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M29/00Means for introduction, extraction or recirculation of materials, e.g. pumps
    • C12M29/14Pressurized fluid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M29/00Means for introduction, extraction or recirculation of materials, e.g. pumps
    • C12M29/18External loop; Means for reintroduction of fermented biomass or liquid percolate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M41/00Means for regulation, monitoring, measurement or control, e.g. flow regulation
    • C12M41/26Means for regulation, monitoring, measurement or control, e.g. flow regulation of pH
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M41/00Means for regulation, monitoring, measurement or control, e.g. flow regulation
    • C12M41/30Means for regulation, monitoring, measurement or control, e.g. flow regulation of concentration
    • C12M41/32Means for regulation, monitoring, measurement or control, e.g. flow regulation of concentration of substances in solution
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M41/00Means for regulation, monitoring, measurement or control, e.g. flow regulation
    • C12M41/48Automatic or computerized control
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Definitions

  • the present invention relates inter alia to a method for synthesizing an RNA molecule of a given sequence, as well as to reactors for performing said method.
  • RNA-based therapeutics include niRNA molecules encoding antigens for use as vaccines (Fotin- Mleczek et al. 2012. J. Gene Med. 14(6):428-439).
  • RNA molecules for replacement therapies, e.g. providing missing proteins such as growth factors or enzymes to patients (Kariko et al., 2012. Mol. Ther. 20(5):948-953; Kormann et al.,. 2012. Nat. Biotechnol. 29(2): 154-157).
  • noncoding immunostimulatory RNA molecules WO2009/095226
  • other noncoding RNAs such as micro RNAs and long noncoding RNAs is considered (Esteller, 201 1. Nat. Rev. Genet. 12(12):861-74).
  • RNA stability RNA stability and translation efficiency.
  • the 5' cap structure and the 3' poly(A) tail are important features for the efficient translation of mRNA and protein synthesis in eukaryotic cells.
  • Newly synthesized mRNAs are modified with a cap structure when the transcript reaches a length of 20 to 30 nucleotides.
  • the 5' terminal nucleotide pppN is converted to 5' GpppN by a bi-functional capping enzyme containing both RNA 5'- triphosphatase and guanylyltransferase activities.
  • the GpppN part is methylated by a second enzyme with (guanine-7)-methyltransferase activity to form the monomethylated m7GpppN type 0 cap structure.
  • the type 0 cap is then converted to an m7GpppN type 1 structure in the nucleus by 2'-0-methylation (Tcherepanova et al., 2008. BMC Mol. Biol. 9:90).
  • Short RNA molecules can be synthesized by chemical methods whereas long RNAs are typically produced by in vitro transcription reactions containing a suitable DNA template with a bacteriophage-derived promoter, an RNA polymerase, for example bacteriophage SP6, T3 or T7 RNA polymerase and ribonucleoside triphosphates (NTPs).
  • RNA polymerase for example bacteriophage SP6, T3 or T7 RNA polymerase and ribonucleoside triphosphates (NTPs).
  • NTPs ribonucleoside triphosphates
  • capping occurs concurrently with the initiation of transcription (co- transcriptional capping).
  • a dinucleotide cap analog such as m7G(5')ppp(5')G (m7G) is to be added to the reaction mixture.
  • the DNA template is usually designed in such a way that the first nucleotide transcribed is a guanosine.
  • the cap analog directly competes with GTP for incorporation as initial nucleotide (start nucleotide), and is incorporated as readily as any other nucleotide (WO2006/004648).
  • a molar excess of the cap analog over GTP is typically used (e.g.
  • RNA yield is typically limited to about 1 mg/ml (WO2006/004648).
  • Vaccinia Virus Capping Enzyme possesses all three enzymatic activities necessary to synthesize a m7G cap structure (RNA 5' -triphosphatase, guanylyltransferase, and guanine-7-methyltransferase).
  • GTP GTP
  • the VCE reaction yields RNA caps in the correct orientation.
  • a type 1 cap can be created by adding a second Vaccinia enzyme, 2' O methyltransferase, to the capping reaction (Tcherepanova et al., 2008. BMC Mol. Biol. 9:90). It has been reported that RNA transcribed in vitro by phage polymerases can contain multiple contaminants, including double-stranded RNA molecules generated by self- complementary 3 ' extension and short RNA molecules produced by abortive transcription initiation events.
  • RNA molecules synthesized by T7 RNA polymerase during run-off transcription of linearized DNA templates can be longer than the coded RNA (Triana-Alonso et al., 1995, JBC; 270(1 1): 6298-6307).
  • the RNA polymerase can bind a transcript to the template site and the 3 '-end of the transcript to the product site and extend it, if the 3 '-end is not part of a stable secondary structure (self-complementary 3' extension). This effect seems to be especially sensitive to the UTP concentration and a reduction exclusively of the UTP concentration leads to faithful transcription. However, lowering the UTP concentration can also affect the RNA yield.
  • RNA contains a poly(A) tail
  • an excess of unincorporated UTP in the transcription reaction can result in RNA-template dependent incorporation of uridine nucleotides opposite of the poly-A-sequence, resulting in double-stranded RNA molecules which can activate the innate immune response and decrease protein synthesis (Kariko et al., 201 1 , Nucleic Acids Res.; 39(21): el42).
  • RNA molecules In addition to the desired full-length RNA molecule, in vitro transcription reactions can also yield smaller oligoribonucleotides which are the result of abortive transcription initiation events (Milligan, et al., 1987. Nucleic Acid Res. 15(21): 8783-8798).
  • abortive (premature) transcripts are short RNA molecules prematurely released from the ternary complex consisting of RNA polymerase, DNA template, and nascent RNA chain.
  • most abortive transcripts are two to eight nucleotides in length and are formed due to abortive cycling during initiation.
  • an increase in abortive transcription was observed when NTP concentrations are lower than approximately 2 mM (Kern et al., 1999. Biotechnol. Prog. 15, 174-184).
  • Abortive transcripts are undesirable because their synthesis consumes valuable NTPs and reduces the yield of full-length product.
  • RNA molecules As active pharmaceutical ingredients the production of RNA molecules as active pharmaceutical ingredients must be efficient in terms of yield, quality, safety and costs, especially when RNA is produced at a large scale and full-length or full-length capped RNA molecules are required.
  • Several approaches were described for increasing the production of RNA molecules by in vitro transcription. The use of high NTP concentrations is expected to increase the yield of RNA molecules.
  • the adjustment of the ratio of the cap analog to GTP has been suggested.
  • Standard nucleotide concentrations for in vitro transcription reactions typically range from 1.5 to 16 mM (Milligan, et al., 1987. Nucleic Acid Res. 15(21): 8783-8798; Sampson & Uhlenbeck, 1988. Proc. Natl. Acad. Sci. USA 85(4): 1033-7; Cunningham & Ofengand 1990. Biotechniques 9(6):713-4; Weitzmann et al. 1990, Nucleic Acids Res. 18(12):3515- 20; Gurevich et al., 1991. Anal. Biochem. 195(2):207- 13). NTP concentrations up to 40 mM have been reported to be possible if Mg ++ concentrations are adjusted accordingly, resulting in increased RNA yield (US5256555).
  • T7 High Yield RNA synthesis kit New England Biolabs, Ipswich, MA, USA
  • TranscriptAidTM T7 High Yield Transcription kit Thermo Scientific, Waltham, MA, USA
  • MEGAscript® High Yield Transcription Kit Life Technologies, Carlsbad, CA, USA
  • AmpliCap-MaxTM T7 High Message Maker kit Epicentre, Madison, WI, USA.
  • high total NTP working concentrations of 30 to 40 mM are suggested for standard transcription reactions.
  • GTP concentrations range between 1.5 mM and 2 mM GTP.
  • Yields per 20 ⁇ reaction are indicated as 40-50 ⁇ g RNA, corresponding to 2-2.5 mg/ml, with approximately 80% capped RNA transcripts (New England Biolabs, Capped RNA synthesis (E2040), https://www.neb. com/protocols/l/Ol/Ol/capped-rna- synthesis-e2040).
  • yields of capped RNA have been increased by supplementing the reaction with the competing nucleotide (GTP, or ATP in case A-cap is used) in such a way that a ratio between 1 : 1 and 1 :50 GTP to cap analog is maintained.
  • GTP competing nucleotide
  • In vitro transcription reactions are typically performed as batch reactions in which all components are combined and then incubated to allow the synthesis of RNA molecules until the reaction terminates.
  • fed-batch reactions were developed to increase the efficiency of the in vitro transcription reaction (Kern et al., 1997. Biotechnol. Prog. 13, 747-756; Kern et al., 1999. Biotechnol. Prog. 15, 174-184).
  • all components are combined, but then additional amounts of some of the reagents are added over time (e.g. NTPs and magnesium) to maintain constant reaction conditions.
  • the fed- batch strategy yielded a 100% improvement in RNA per unit of RNA polymerase or DNA template for a very short 38 base pair DNA template. This method was only used for the synthesis of non-capped RNA molecules with a triphosphate at the 5' terminus.
  • RNA molecules by in vitro transcription
  • the use of a bioreactor (transcription reactor) for the synthesis of RNA molecules by in vitro transcription has been reported (WO 1995/08626).
  • the bioreactor is configured such that reactants are delivered via a feed line to the reactor core and RNA products are removed by passing through an ultrafiltration membrane (having a nominal molecular weight cut-off, e.g., 100,000 daltons) to the exit stream.
  • the yield of capped RNA molecules from in vitro transcription reactions mainly dependents on two factors, the total NTP concentration available for incorporation into the RNA molecule and the cap analog:GTP ratio.
  • GTP concentrations are usually reduced compared to the other NTPs. This fact limits the possible transcription yield, especially for templates with high GC-content.
  • the present invention relates inter alia to a method for synthesizing an RNA molecule of a given sequence, comprising the following steps: a) determining the fraction (1) for each of the four nucleotides G, A, C and U in said RNA molecule, and b) synthesizing said RNA molecule by in vitro transcription in a sequence- optimized reaction mix, wherein said sequence-optimized reaction mix comprises the four ribonucleotides GTP, ATP, CTP and UTP, wherein the fraction (2) of each of the four ribonucleotides in the sequence-optimized reaction mix corresponds to the fraction (1 ) of the respective nucleotide in said RNA molecule, a buffer, a DNA template, and an RNA polymerase.
  • the present invention also relates to a bioreactor for synthesizing RNA molecules of a given sequence, the bioreactor having a reaction module for carrying out in vitro RNA transcription reactions in a sequence-optimized reaction mix, a capture module for temporarily capturing the transcribed RNA molecules, and a control module for controlling the infeed of components of the sequence-optimized reaction mix into the reaction module, wherein the reaction module comprises a filtration membrane for separating nucleotides from the sequence-optimized reaction mix, and the control of the infeed of components of the sequence-optimized reaction mix by the control module is based on a measured concentration of separated nucleotides.
  • a 5' cap is typically a modified nucleotide, particularly a guanine nucleotide, added to the 5' end of an RNA molecule.
  • the 5' cap is added using a 5'-5'-triphosphate linkage.
  • a 5 ' cap may be methylated, e.g. m7GpppN, wherein N is the terminal 5' nucleotide of the nucleic acid carrying the 5' cap, typically the 5 '-end of an RNA.
  • the naturally occurring 5' cap is m7GpppN.
  • 5 'cap structures include glyceryl, inverted deoxy abasic residue (moiety), 4 ',5' methylene nucleotide, l-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha- nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety, 3 '-3 '-inverted abasic moiety, 3 '-2 '-inverted nucleotide moiety, 3 '-
  • Particularly preferred 5' cap structures are CAPl (methylation of the ribose of the adjacent nucleotide of m7G), CAP2 (methylation of the ribose of the 2 nd nucleotide downstream of the m7G), CAP3 (methylation of the ribose of the 3 rd nucleotide downstream of the m7G), CAP4 (methylation of the ribose of the 4 th nucleotide downstream of the m7G),
  • a 5' cap structure may be formed by a cap analog.
  • a cap analog refers to a non-extendable di-nucleotide that has cap functionality which means that it facilitates translation or localization, and/or prevents degradation of the RNA molecule when incorporated at the 5' end of the RNA molecule.
  • Non-extendable means that the cap analog will be incorporated only at the 5 'terminus because it does not have a 5' triphosphate and therefore cannot be extended in the 3' direction by a template-dependent RNA polymerase.
  • Cap analogs include, but are not limited to, a chemical structure selected from the group consisting of m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analog (e.g., m2,7GpppG), trimethylated cap analog (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogs (e.g., m7Gpppm7G), or anti reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (Stepinski et al., 2001. RNA 7(10): 1486-95). Examples of cap analogs are shown in Table 1.
  • cap analogs are G[5']ppp[5']G, m 7 G[5']ppp[5']G, m3 2 ' 2 ' 7 G[5']ppp[5']G, m 2 7 ' 3, - 0 G[5']ppp[5']G (3'-ARCA), m 2 7 ' 2' -°GpppG (2'-ARCA), m 2 7 - 2' -°GppspG Dl ( ⁇ -S-ARCA Dl) and m 2 7 ' 2' -°GppspG D2 ( ⁇ -S-ARCA D2).
  • nucleic acid means any DNA- or RNA-molecule and is used synonymous with polynucleotide. Furthermore, modifications or derivatives of the nucleic acid as defined herein are explicitly included in the general term “nucleic acid”. For example, peptide nucleic acid (PNA) is also included in the term “nucleic acid”.
  • PNA peptide nucleic acid
  • a monocistronic RNA may typically be an RNA, preferably an mRNA, that comprises only one open reading frame.
  • An open reading frame in this context is a sequence of several nucleotide triplets (codons) that can be translated into a peptide or protein.
  • Bi-/multicistronic RNA RNA, preferably mRNA, that typically may have two (bicistronic) or more (multicistronic) open reading frames (ORF).
  • An open reading frame in this context is a sequence of several nucleotide triplets (codons) that can be translated into a peptide or protein.
  • Immunostimulatory RNA in the context of the invention may typically be a RNA that is able to induce an innate immune response.
  • An isRNA usually does not have an open reading frame and thus does not provide a peptide- antigen but elicits an innate immune response, e.g. by binding to pathogen-associated molecular patterns (PAMP) receptors (e.g. Toll-like-receptor (TLR) or other intracellular RNA sensors (e.g. RIG-I, MDA-5 or P R).
  • PAMP pathogen-associated molecular patterns
  • Nucleotide analogs are nucleotides structurally similar (analog) to naturally occurring nucleotides which include phosphate backbone modifications, sugar modifications, or modifications of the nucleobase.
  • Nucleic acid synthesis Nucleic acid molecules used according to the invention as defined herein may be prepared using any method known in the art, including synthetic methods such as e.g. solid phase synthesis, in vivo propagation (e.g. in vivo propagation of viruses), as well as in vitro methods, such as in vitro transcription reactions.
  • the RNA molecule is prepared by in vitro transcription of a corresponding DNA molecule.
  • This DNA template preferably comprises a suitable promoter, e.g. a T7 or SP6 promoter, for in vitro transcription, which is followed by the desired nucleotide sequence coding for the RNA molecule to be prepared and a termination signal for in vitro transcription.
  • the DNA molecule, which forms the template of the at least one RNA of interest may be prepared by fermentative proliferation and subsequent isolation as part of a plasmid which can be replicated in bacteria. Plasmids which may be mentioned as suitable for the present invention are e.g.
  • pGEM ® series e.g. pGEM ® -l (GenBank accession number X65300; from Promega) and pSP64 (GenBank accession number X65327); cf. also Mezei and Storts, Purification of PCR Products, in: Griffin and Griffin (ed.), PCR Technology: Current Innovation, CRC Press, Boca Raton, FL, 2001.
  • RNA is the usual abbreviation for ribonucleic acid. It is a nucleic acid molecule, i.e. a polymer consisting of nucleotides. These nucleotides are usually adenosine- monophosphate, uridine-monophosphate, guanosine-monophosphate and cytidine- monophosphate monomers which are connected to each other along a so-called backbone.
  • the backbone is formed by phosphodiester bonds between the sugar, i.e. ribose, of a first and a phosphate moiety of a second, adjacent monomer.
  • the specific succession of the monomers is called the RNA-sequence.
  • RNA messenger RNA
  • mRNA messenger RNA
  • Processing of the premature RNA comprises a variety of different posttranscriptional modifications such as splicing, 5'- capping, polyadenylation, export from the nucleus or the mitochondria and the like. The sum of these processes is also called maturation of mRNA.
  • the mature messenger RNA usually provides the nucleotide sequence that may be translated into an amino acid sequence of a particular peptide or protein.
  • a mature mRNA comprises a 5' cap, a 5'UTR, an open reading frame, a 3'UTR and a poly(A) sequence.
  • an mRNA may also be an artificial molecule, i.e. a molecule not occurring in nature. This means that the mRNA in the context of the present invention may, e.g., comprise a combination of a 5'UTR, open reading frame, 3'UTR and poly(A) sequence, which does not occur in this combination in nature.
  • Self-replicating RNA are delivery vectors based on alphaviruses which have been developed from Semliki Forest virus (SFV), Sindbis (SIN) virus, and Venezuelan equine encephalitis (VEE) virus.
  • Alphaviruses are single stranded RNA viruses in which heterologous genes of interest may substitute for the alphavirus' structural genes.
  • the replicon RNA is packaged into replicon particles (RP) which may be used for gene therapy purposes or genetic vaccination (see for example Vander Veen et ai , 2012. Alphavirus replicon vaccines. Animal Health Research Reviews, p. 1-9).
  • the genomic viral RNA After entry into the host cell, the genomic viral RNA initially serves as an mRNA for translation of the viral nonstructural proteins (nsPs) required for initiation of viral RNA amplification.
  • RNA replication occurs via synthesis of a full-length minus-strand intermediate that is used as the template for synthesis of additional genome-length RNAs and for transcription of a plus-strand subgenomic RNA from an internal promoter.
  • Such RNA may then be considered as self-replicating RNA, since the non-structural proteins responsible for replication (and transcription of the heterologous genes) are still present in such replicon.
  • alphavirus vectors are referred to as "replicons.”
  • Sequence of a nucleic acid molecule The sequence of a nucleic acid molecule is typically understood to be the particular and individual order, i.e. the succession of its nucleotides.
  • Open reading frame An open reading frame (ORF) in the context of the invention may typically be a sequence of several nucleotide triplets which may be translated into a peptide or protein.
  • An open reading frame preferably contains a start codon, i.e. a combination of three subsequent nucleotides coding usually for the amino acid methionine (ATG or AUG), at its 5 '-end and a subsequent region which usually exhibits a length which is a multiple of 3 nucleotides.
  • an ORF is preferably terminated by a stop codon (e.g., TAA, TAG, TGA). Typically, this is the only stop codon of the open reading frame.
  • an open reading frame in the context of the present invention is preferably a nucleotide sequence, consisting of a number of nucleotides that may be divided by three, which starts with a start codon (e.g. ATG or AUG) and which preferably terminates with a stop codon (e.g., TAA, TGA, or TAG or UAA, UAG, UGA, respectively).
  • the open reading frame may be isolated or it may be incorporated in a longer nucleic acid sequence, for example in a vector or an mRNA.
  • An open reading frame may also be termed "protein coding region" or "coding region”.
  • Sequence-optimized reaction mix A reaction mix for use in an in vitro transcription reaction of an RNA molecule of a given sequence comprising the four nucleoside triphosphates (NTPs) GTP, ATP, CTP and UTP, wherein the fraction (2) of each of the four nucleoside triphosphates (NTPs) in the sequence-optimized reaction mix corresponds to the fraction (1) of the respective nucleotide in said RNA molecule, a buffer, a DNA template, and an RNA polymerase. If a ribonucleotide is not present in said RNA molecule, the corresponding nucleoside triphosphate is also not present in the sequence- optimized reaction mix.
  • NTPs nucleoside triphosphates
  • Sequence-optimized nucleoside triphosphate (NTP) mix A mixture of nucleoside triphosphates (NTPs) for use in an in vitro transcription reaction of an RNA molecule of a given sequence comprising the four nucleoside triphosphates (NTPs) GTP, ATP, CTP and UTP, wherein the fraction (2) of each of the four nucleoside triphosphates (NTPs) in the sequence-optimized nucleoside triphosphate (NTP) mix corresponds to the fraction (1) of the respective nucleotide in said RNA molecule.
  • modified nucleoside triphosphate refers to chemical modifications comprising backbone modifications as well as sugar modifications or base modifications. These modified nucleoside triphosphates are also termed herein as (nucleotide) analogs.
  • the modified nucleoside triphosphates as defined herein are nucleotide analogs/modifications, e.g. backbone modifications, sugar modifications or base modifications.
  • a backbone modification in connection with the present invention is a modification, in which phosphates of the backbone of the nucleotides are chemically modified.
  • a sugar modification in connection with the present invention is a chemical modification of the sugar of the nucleotides.
  • a base modification in connection with the present invention is a chemical modification of the base moiety of the nucleotides.
  • nucleotide analogs or modifications are preferably selected from nucleotide analogs which are applicable for transcription and/or translation.
  • modified nucleosides and nucleotides which may be used in the context of the present invention, can be modified in the sugar moiety.
  • the 2' hydroxyl group (OH) can be modified or replaced with a number of different "oxy" or "deoxy” substituents.
  • R H, alkyl, cycloalkyl, ary
  • “Deoxy” modifications include hydrogen, amino (e.g. NH 2 ; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino, or amino acid); or the amino group can be attached to the sugar through a linker, wherein the linker comprises one or more of the atoms C, N, and O.
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a modified nucleotide can include nucleotides containing, for instance, arabinose as the sugar.
  • the phosphate backbone may further be modified in the modified nucleosides and nucleotides.
  • the phosphate groups of the backbone can be modified by replacing one or more of the oxygen atoms with a different substituent.
  • the modified nucleosides and nucleotides can include the full replacement of an unmodified phosphate moiety with a modified phosphate as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters.
  • Phosphorodithioates have both non-linking oxygens replaced by sulfur.
  • the phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylene-phospho nates) .
  • modified nucleosides and nucleotides which may be used in the present invention, can further be modified in the nucleobase moiety.
  • nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine and uracil.
  • nucleosides and nucleotides described herein can be chemically modified on the major groove face.
  • the major groove chemical modifications can include an amino group, a thiol group, an alkyl group, or a halo group.
  • the nucleotide analogs/modifications are selected from base modifications, which are preferably selected from 2-amino-6-chloropurineriboside-5 '-triphosphate, 2-Aminopurine-riboside-5'- triphosphate; 2-aminoadenosine-5 '-triphosphate, 2'-Amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5 '-triphosphate, 2-thiouridine-5'-triphosphate, 2'-Fluorothymidine-5'- triphosphate, 2'-0-Methyl inosine-5'-triphosphate 4-thiouridine-5'-triphosphate, 5- aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine- 5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-Bromo-2'-deoxycytidine
  • nucleotides for base modifications selected from the group of base-modified nucleotides consisting of 5- methylcytidine-5 '-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'- triphosphate, and pseudouridine-5'-triphosphate.
  • modified nucleosides include pyridin-4-one ribonucleoside, 5-aza- uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1 -carboxymethyl- pseudouridine, 5-propynyl-uridine, 1 -propynyl-pseudouridine, 5-taurinomethyluridine, 1- taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, l-taurinomethyl-4-thio- uridine, 5-methyl-uridine, 1 -methyl-pseudouridine, 4-thio- 1 -methyl-pseudouridine, 2-thio- 1-methyl-pseudouridine, 1 -methyl- 1-deaza-pseud
  • modified nucleosides include 5-aza-cytidine, pseudoisocytidine, 3- methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5- hydroxymethylcytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4- thio- 1 -methyl -pseudoisocytidine, 4-thio-l -methyl- 1-deaza-pseudoisocytidine, 1 -methyl- 1- deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebula
  • modified nucleosides include 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2- aminopurine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1- methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis- hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyla
  • modified nucleosides include inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7- deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl- guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, I-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine.
  • the nucleotide can be modified on the major groove face and can include replacing hydrogen on C-5 of uracil with a methyl group or a halo group.
  • a modified nucleoside is 5'-0-(l-Thiophosphate)-Adenosine, 5'-0-(l-Thiophosphate)-Cytidine, 5'-0-(l-Thiophosphate)-Guanosine, 5'-0-(l- Thiophosphate)-Uridine or 5'-0-(l-Thiophosphate)-Pseudouridine.
  • the modified nucleotides include nucleoside modifications selected from 6-aza-cytidine, 2-thio-cytidine, a-thio-cytidine, Pseudo-iso-cytidine, 5- aminoallyl-uridine, 5-iodo-uridine, Nl -methyl -pseudouridine, 5,6-dihydrouridine, -thio- uridine, 4-thio-uridine, 6-aza-uridine, 5 -hydroxy- uridine, deoxy-thymidine, 5-methyl- uridine, Pyrrolo-cytidine, inosine, a-thio-guanosine, 6-methyl-guanosine, 5-mefhyl- cytdine, 8-oxo-guanosine, 7-deaza-guanosine, Nl -me hyl-adenosine, 2-amino-6-Chloro- purine, N6-methyl-2-a
  • Yield also referred to as a reaction yield, is the amount of product obtained in a chemical or enzymatic reaction.
  • the absolute yield can be given as the weight in grams or in moles (molar yield).
  • the relative yield, fractional yield, or percentage yield, which serve to measure the effectiveness of a synthetic procedure, are calculated by dividing the amount of the obtained product by the theoretical yield (the unit of measure for both must be the same).
  • the actual yield refers to the amount of the product obtained in a chemical reaction.
  • Theoretical yield is the maximum amount of product that can be produced in a perfectly efficient chemical or enzymatic reaction. In reality, most reactions are not perfectly efficient - the reaction's actual yield is usually less than the theoretical yield. The theoretical yield is calculated based on the molar amount of the limiting reactant, taking into account the stoichiometry of the reaction. For the calculation it is usually assumed that there is only one reaction involved.
  • RNA yield The RNA yield is the amount of RNA product obtained in an in vitro transcription reaction.
  • the RNA yield can be expressed as the RNA concentration (g/ml or mol/1). Multiplication of the RNA concentration with the reaction volume gives the absolute amount of RNA (in grams or moles).
  • Actual RNA yield The actual RNA yield is the experimentally determined amount of RNA product in an in vitro transcription reaction at a defined time point, e.g. the yield after completion of the reaction.
  • Theoretical RNA yield is the maximal possible RNA yield based on the available NTPs in the in vitro transcription reaction.
  • NTPs ATP, GTP, CTP, UTP
  • ATP, GTP, CTP, UTP typically the nucleotide which corresponds to the most frequent nucleotide in the RNA sequence becomes the limiting factor.
  • sequence-optimized transcription reaction using a sequence-optimized NTP mix for the RNA sequence of interest none of the individual nucleotides becomes the limiting factor.
  • RNA yield the amount of each NTP (in mol) present at the start of the transcription reaction is divided by the number of the respective nucleotide present in the sequence of the RNA molecule resulting in the possible number of RNA molecules which can be synthesized (in mol). Multiplying by the molecular mass of the RNA yields the theoretical RNA yield in mass units (gram).
  • concentrations of each NTP typically the NTP which corresponds to the most frequent nucleotide in the RNA sequence becomes the limiting factor.
  • no NTP will become the limiting factor because all types of NTPs are present at the same ratio as the corresponding nucleotides in sequence of the RNA molecule.
  • % RNA yield (actual RNA yield)/(theoretical RNA yield) * 100
  • the present invention relates to a method for synthesizing an RNA molecule of a given sequence, comprising the following steps: a) determining the fraction (1) for each of the four nucleotides G, A, C and U in said RNA molecule, and b) synthesizing said RNA molecule by in vitro transcription in a sequence- optimized reaction mix, wherein said sequence-optimized reaction mix comprises the four ribonucleoside triphosphates (NTPs) GTP, ATP, CTP and UTP, wherein the fraction (2) of each of the four ribonucleoside triphosphates (NTPs) in the reaction mix corresponds to the fraction (1) of the respective nucleotide in said RNA molecule, a buffer, a DNA template, and an RNA polymerase.
  • NTPs ribonucleoside triphosphates
  • GTP, ATP, CTP and UTP are represented at a fraction which corresponds to the fraction of said nucleotides G, A, C and U occurring in said RNA sequence.
  • sequence-optimized in vitro transcription reactions it is envisaged that the four NTPs are consumed to the same extent and transcription continues until the NTPs are used up, thus wasting less material.
  • RNA contains a poly(A) tail
  • an excess of unincorporated UTP in the transcription reaction can result in RNA-template dependent incorporation of uridine nucleotides opposite of the poly-A-sequence, resulting in double- stranded RNA molecules which can activate the innate immune response and decrease protein synthesis (Kariko et al., 201 1 , Nucleic Acids Res.; 39(21): el42).
  • NTPs ribonucleoside triphosphates
  • the fraction (1) of each of the four nucleotides G, A, C and U in said RNA molecule is determined. This can be performed by any method known in the art, e.g. by simple counting of the number of nucleotides or by using computer-based methods.
  • the fraction (1) of each of the nucleotides can then be expressed by any suitable term, including number, percentage, mole fraction or molar percent.
  • the mole fraction or molar fraction (xj) is defined as the amount of a constituent (expressed in moles), n,, divided by the total amount of all constituents in a mixture, ntot. The sum of all the mole fractions is equal to 1.
  • the same concept expressed with a denominator of 100 is the mole percent or molar percentage (mol%).
  • said RNA molecule is synthesized by in vitro transcription in a sequence-optimized reaction mix, wherein said sequence-optimized reaction mix comprises the four ribonucleoside triphosphates (NTPs) GTP, ATP, CTP and UTP or analogs thereof, and wherein the fraction (2) of each of the four ribonucleoside triphosphates (NTPs) in the sequence-optimized reaction mix corresponds to the fraction (1) of the respective nucleotide in said RNA molecule.
  • NTPs ribonucleoside triphosphates
  • step b) of the method of the invention comprises the steps of bl) preparing a sequence-optimized ribonucleoside triphosphate (NTP) mix comprising the four ribonucleoside triphosphates (NTPs) GTP, ATP, CTP and UTP, wherein the fraction (2) of each of the four ribonucleoside triphosphates (NTPs) in the sequence-optimized ribonucleoside triphosphate (NTP) mix corresponds to the fraction (1) of the respective nucleotide in said RNA molecule, and b2) synthesizing said RNA molecule by in vitro transcription in a sequence- optimized reaction mix comprising the sequence-optimized ribonucleoside triphosphate (NTP) mix of step (bl), a buffer, a DNA template, and an RNA polymerase.
  • NTP sequence-optimized ribonucleoside triphosphate
  • a sequence-optimized ribonucleoside triphosphate (NTP) mix is prepared based on the determination of fraction (1), which is then added to the reaction mix. All definitions indicated above with respect to the sequence-optimized reaction mix, and especially those made with respect to the issue "fraction (1) corresponds to fraction (2)" also apply to the sequence-optimized ribonucleoside triphosphate (NTP) mix.
  • RNA molecule does not contain all nucleotides G, A, C, and U, respectively, the same will also apply to the sequence-optimized ribonucleoside triphosphate (NTP) mix and to the sequence-optimized reaction mix.
  • NTP sequence-optimized ribonucleoside triphosphate
  • fraction (1) corresponds to fraction (2)
  • fraction (2) means that the fraction of the ribonucleoside triphosphates (NTPs) in the sequence-optimized NTP mix or in the sequence-optimized reaction mix has been adapted to the fraction of the nucleotides in the RNA molecule.
  • NTPs ribonucleoside triphosphates
  • fraction (1) corresponds to fraction (2)
  • fraction (2) is in the range of fraction (1), e.g. that fraction (1) and fraction (2) differ by not more than 25%, 20%, 15%, 10 %, 7 %, 5 % or by a value between 0.1 % and 5 %.
  • fraction (2) is preferably in the range of fraction (1), e.g. fraction (1) and fraction (2) differ by not more than 25%, 20%, 15%, 10 %, 7 %, 5 % or by a value between 0.1 % and 5 %.
  • a start nucleotide is added to the sequence- optimized NTP mix or to the sequence-optimized reaction mix before the start of the in vitro transcription.
  • a start nucleotide is a nucleotide which corresponds to the first nucleotide of said RNA molecule (+1 position).
  • the start nucleotide may be especially added to increase the initiation rate of the RNA polymerase.
  • Said start nucleotides are also known in the art and include a nucleoside monophosphate, a nucleoside diphosphate, a nucleoside triphosphate.
  • the start nucleotide can be a mononucleotide, a dinucleotide or a trinucleotide.
  • the start nucleotide is preferably GTP or GMP.
  • said start nucleotide is a dinucleotide. In an even more preferred embodiment the start nucleotide is a cap analog.
  • the cap analog is selected from the group consisting of G[5']ppp[5']G, m 7 G[5']ppp[5']G, m 3 2>2 - 7 G[5']ppp[5']G, m 2 7 ' 3' -°G[5']ppp[5']G (3'- ARCA), m 2 7>2' -°GpppG (2'-ARCA), m 2 7 ' 2'"0 GppspG Dl ( ⁇ -S-ARCA Dl) and m 2 7 ' 2 " °GppspG D2 ( ⁇ -S-ARCA D2).
  • the start nucleotide corresponding to the first nucleotide of said RNA molecule is added in excess compared to the fraction of that nucleotide in said RNA molecule which is found at the first position of said RNA molecule.
  • the start nucleotide is added with an initial concentration in the range of about 1 to 20 mM, 1 to 17.5 mM, 1 to 15 mM, 1 to 12.5 mM, 1 to 10 mM, 1 to 7.5 mM, 1 to 5 mM or 1 to 2.5 mM. Even more preferred the start nucleotide is added with an initial concentration of about 5 to 20 mM or 7.5 to 17.5 mM.
  • the first nucleotide of the RNA molecule is G
  • the start nucleotide is a cap analog of G
  • the corresponding ribonucleoside triphosphate is GTP.
  • the cap analog is present in the reaction mix in an excess, in comparison to GTP.
  • the cap analog is added with an initial concentration in the range of about 1 to 20 mM, 1 to 17.5 mM, 1 to 15 mM, 1 to 12.5 mM, 1 to 10 mM, 1 to 7.5 mM, 1 to 5 mM or 1 to 2.5 mM. Even more preferred the cap analog is added with an initial concentration of about 5 to 20 mM, 7.5 to 20 mM, 10 to 20 mM or 12.5 to 20 mM.
  • NTPs ribonucleoside triphosphates
  • RNA-dependent RNA polymerase e.g. T7, T3 or SP6 RNA polymerase
  • RNase ribonuclease
  • MgCl 2 which supplies Mg 2+ as a co-factor for the polymerase
  • a buffer to maintain a suitable pH value which can also contain antioxidants and polyamines such as spermidine at optimal concentrations.
  • the sequence-optimized reaction mix used for the inventive method for synthesizing an RNA molecule of a given sequence comprises a buffer selected from the group consisting of 4-(2-hydroxyethyl)-l- piperazineethanesulfonic acid (HEPES) and tris(hydroxymethyl)aminomethane (Tris).
  • HEPES 4-(2-hydroxyethyl)-l- piperazineethanesulfonic acid
  • Tris tris(hydroxymethyl)aminomethane
  • the buffer is used at a concentration from 10 to 100 mM, 10 to 75 mM, 10 to 50 mM, 10 to 40 mM, 10 to 30 mM or 10 to 20 mM.
  • the pH value of the buffer can be adjusted with, for example, NaOH, KOH or HC1.
  • the buffer has a pH value from 6 to 8.5, from 6.5 to 8.0, from 7.0 to 7.5, even more preferred 7.5.
  • a buffer selected from the group consisting of 80 mM HEPES/KOH, pH 7.5 and 40 mM Tris/HCl, pH 7.5.
  • the RNA polymerase comprised in the sequence-optimized reaction mix is selected from the group consisting of T3, T7 and SP6 RNA polymerase.
  • the concentration of the RNA polymerase is from about 1 to 100 nM, 1 to 90 nM, 1 to 80 nM, 1 to 70 nM, 1 to 60 nM, 1 to 50 nM, 1 to 40 nM, 1 to 30 nM, 1 to 20 nM, or about 1 to 10 nM. Even more preferred, the concentration of the RNA polymerase is from about 10 to 50 nM, 20 to 50 nM, or 30 to 50 nM. Most preferred is a RNA polymerase concentration of about 40 nM. In this context a concentration of 500 to 10000 U/ml of the RNA polymerase is preferred.
  • the concentration of the DNA template comprised in the sequence-optimized reaction mix is in a range from about 1 to 50 nM, 1 to 40 nM, 1 to 30 nM, 1 to 20 nM, or about 1 to 10 nM. Even more preferred the concentration of the DNA template is from about 10 to 30 nM. Most preferred the concentration of the DNA template is about 20 nM.
  • a concentration of the DNA template of about 1 to 200 ⁇ g/ml and more preferably of about 10 to 100 ⁇ g/ml, and most preferably of about 20 to 50 g/ml (e.g. 25 or 50 ⁇ g/ml).
  • the sequence-optimized reaction mix comprises pyrophosphatase.
  • the concentration of the pyrophosphatase is from about 1 to 20 units/ml, 1 to 15 units/ml, 1 to 10 units/ml, 1 to 5 units/ml, or 1 to 2.5 units/ml. Even more preferred the concentration of the pyrophosphatase is about 1 unit/ml or is about 5 units/ml.
  • the sequence-optimized reaction mix comprises Mg ++ ions.
  • the Mg ++ ions are provided in the form of MgCl 2 or Mg(OAc) 2 .
  • the initial free Mg ++ concentration is from about 1 to 100 mM, 1 to 75 mM, 1 to 50 mM, 1 to 25 mM, or 1 to 10 mM. Even more preferred the initial free Mg ++ concentration is from about 10 to 30 mM or about 15 to 25 mM. Most preferred is an initial free Mg ++ concentration of about 24 mM.
  • the sequence-optimized reaction mix comprises a reducing agent to keep the RNA polymerase in its active state.
  • the reducing agent is selected from the group consisting of dithiothreitol (DTT), dithioerythritol (DTE), Tris(2-carboxyethyl)phosphine (TCEP) and ⁇ -mercaptoethanol.
  • DTT dithiothreitol
  • DTE dithioerythritol
  • TCEP Tris(2-carboxyethyl)phosphine
  • concentration of the reducing reagent is from about 1 to 50 mM, 1 to 40 mM, 1 to 30 mM, or 1 to 20 mM, or 1 to 10 mM. Even more preferred the concentration of the reducing reagent is from 10 to 50 mM or 20 to 40 mM. Most preferred is a sequence- optimized reaction mix comprising 40 mM of DTT.
  • the sequence-optimized reaction mix comprises a polyamine.
  • the polyamine is selected from the group consisting of spermine and spermidine.
  • the concentration of the polyamine is from about 1 to 25 mM, 1 to 20 mM, 1 to 15 mM, 1 to 10 mM, 1 to 5 mM, or about 1 to 2.5 mM. Even more preferred the concentration of the polyamine is about 2 mM. Most preferred is a sequence-optimized reaction mix comprising 2 mM of spermidine.
  • the sequence-optimized reaction mix comprises a ribonuclease inhibitor.
  • the concentration of the ribonuclease inhibitor is from about 1 to 500 units/ml, 1 to 400 units/ml, 1 to 300 units/ml, 1 to 200 units/ml, or 1 to 100 units/ml. Even more preferred the concentration of the ribonuclease inhibitor is about 200 units/ml.
  • the initial total NTP concentration in the sequence-optimized NTP mix or sequence-optimized reaction mix is less than 20 mM, less than 15 mM, less than 10 mM, less than 7.5 mM, less than 5.0 mM or less than 2.5 mM.
  • the term initial total nucleotide concentration means the total concentration of NTPs, e.g. the sum of the concentrations of ATP, GTP, CTP and/or UTP, present initially in the sequence-optimized NTP mix or sequence-optimized reaction mix when the various components of the sequence-optimized reaction mix have been assembled in the final volume for carrying out the in vitro transcription reaction.
  • the nucleotides will be incorporated into the RNA molecule and consequently the concentration of the total nucleotides will be progressively reduced from its initial value.
  • An important aspect of the present invention is that the use of a sequence-optimized NTP mix or sequence-optimized reaction mix leads to an increased efficiency of RNA synthesis even at low initial total nucleotide concentrations (e.g. at 2 mM). By contrast, it has previously been suggested that for an increased RNA yield high concentrations of total nucleotides, in the order of 12 mM to 40 mM, are necessary (US6586218).
  • NTPs ribonucleoside triphosphates
  • GTP ribonucleoside triphosphates
  • ATP ribonucleoside triphosphate
  • CTP CTP
  • UTP sequence-optimized reaction mix
  • NTPs ribonucleoside triphosphates
  • the monovalent cation is selected from the group consisting of Li + , Na + , K + , NH 4 + or tris(hydroxymethyl)-aminomethane (Tris).
  • Tris tris(hydroxymethyl)-aminomethane
  • the divalent cation is selected from the group consisting of Mg ++ , Ba ++ and Mn ++ .
  • the NTP counter ion is tris(hydroxymethyl)-aminomethane (Tris).
  • Tris tris(hydroxymethyl)-aminomethane
  • Bacteriophage RNA polymerases are known to be sensitive to salt inhibition. The negative impact of high NaCl concentrations on RNA yields has been described (e.g. Kern & Davis, 1997. Biotechnol. Prog., 13, 747-756; US 6,586,218 B2). High concentrations of Na-NTPs, especially as consequence when pursuing a NTP feeding strategy, could therefore result in decreased RNA yields.
  • This limitation can be circumvented by using Tris-nucleotides, because the RNA polymerase activity is less affected by high Tris concentrations compared to high Na concentrations. As shown in Example 5 and Figure 12, the RNA yield is more sensitive to the addition of Na compared to Tris.
  • modified nucleoside triphosphates can also be used in in vitro transcription reactions, e.g. to enhance the stability of the RNA.
  • part or all of the UTP in a sequence-optimized NTP mix or in a sequence- optimized reaction mix can be replaced by pseudo-UTP.
  • a part or all of at least one ribonucleoside triphosphate in the sequence-optimized NTP mix or in the sequence-optimized reaction mix is replaced by a modified nucleoside triphosphate.
  • said modified nucleoside triphosphate is selected from the group consisting of pseudouridine-5' -triphosphate, 1 - methylpseudouridine-5'-triphosphate, 2-thiouridine-5 '-triphosphate, 4-thiouridine-5'- triphosphate and 5-methylcytidine-5 '-triphosphate.
  • the numbers and fractions as defined above reflect the initial conditions present in the sequence-optimized reaction mix or in the sequence-optimized NTP mix before the start of the transcription.
  • the sequence-optimized reaction mix in the course of the in vitro transcription is supplemented with the sequence- optimized ribonucleoside triphosphate (NTP) mix as defined herein.
  • NTP ribonucleoside triphosphate
  • the fresh sequence-optimized NTP mix is added in such a way that the desired ratio of the cap analog to the corresponding nucleotide e.g. GTP (e.g. 4: 1) is maintained.
  • the fresh sequence-optimized NTP mix is added at the end of the in vitro transcription reaction, when all nucleotides in the sequence-optimized reaction mix are consumed.
  • the ratio of the remaining cap analog to the freshly added corresponding nucleotide e.g. GTP (e.g. 4: 1) can be approximately maintained because close to 100% of the cap analog remains at the end of the transcription reaction because only one cap analog can be incoporporated per RNA molecule.
  • the sequence-dependent incorporation of NTPs also allows monitoring of the progress of the in vitro transcription reaction.
  • the progress of the in vitro transcription reaction can be monitored by separating the unincorporated nucleotides from the in vitro transcription reaction and measuring the absorbance at 260 nm.
  • the reason is that the decrease in the total concentration of all four NTPs directly correlates with the amount of RNA synthesized. This approach would not be possible as straightforwardly if a standard NTP mix with the same ratio of nucleoside triphosphates is used.
  • a decrease in absorption at 260 nm can directly be translated into RNA molecules produced if NTPs are separated from RNA and DNA to avoid interference, e.g.
  • Spectroscopic methods for nucleic acid quantification include traditional absorbance measurements (Kolitz et al., 2013. Methods Enzymol. 530:331-6) and more sensitive fluorescence techniques using fluorescent dyes such as ethidium bromide and a fuorometer with a suitable excitation wavelength (e.g. 302 or 546 nm) (Gallagher, 201 1. Current Protocols in Molecular Biology. 93:A.3D.1-A.3D.14). Consequently, in a preferred embodiment of the invention, the synthesizing of said RNA molecule by in vitro transcription is followed by separating and quantifying the unincorporated NTPs.
  • RNA molecule is selected from the group consisting of non-coding and coding RNA molecules.
  • a non-coding RNA (ncRNA) molecule is a functional RNA molecule that is not translated into a peptide or protein.
  • Non-coding RNA molecules include highly abundant and functionally important RNAs such as transfer RNA (tRNA) and ribosomal RNA (rRNA), as well as RNAs such as snoRNAs, microRNAs, siRNAs, snRNAs, exRNAs, and piRNAs and the long ncRNAs that include examples such as Xist and HOT AIR (Esteller, 2011. Nat. Rev. Genet. 12(12):861-74).
  • non-coding RNA molecules include immunostimulatory RNA (isRNA) molecules.
  • the immunostimulatory RNA may be a linear single-stranded RNA. Even more preferred, the immunostimulatory RNA may be a long linear single-stranded non-coding RNA. In this context it is particularly preferred that the isRNA carries a triphosphate at its 5 '-end.
  • the immunostimulatory RNA may comprise any RNA sequence known to be immunostimulatory, including, without being limited thereto, RNA sequences representing and/or encoding ligands of TLRs, preferably selected from human family members TLRl to TLR10 or murine family members TLRl to TLRl 3, more preferably selected from human family members TLRl to TLR10, even more preferably from TLR7 and TLR8, ligands for intracellular receptors for RNA (such as RIG-I, MDA-5 or PKR) (Meylan and Tschopp, 2006. Mol. Cell 22, 561-569), or any other immunostimulatory RNA sequence.
  • RNA sequences representing and/or encoding ligands of TLRs preferably selected from human family members TLRl to TLR10 or murine family members TLRl to TLRl 3, more preferably selected from human family members TLRl to TLR10, even more preferably from TLR7 and TLR8, ligands for intracellular receptors for RNA (such
  • immunostimulatory RNA molecules may include any other RNA capable of eliciting an innate immune response.
  • an immunostimulatory RNA may include ribosomal RNA (rRNA), transfer RNA (tRNA), messenger RNA (mRNA), and viral RNA (vPvNA).
  • rRNA ribosomal RNA
  • tRNA transfer RNA
  • mRNA messenger RNA
  • vPvNA viral RNA
  • the immunostimulatory RNA is a non-coding RNA.
  • Such an immunostimulatory RNA may comprise a length of 1000 to 5000, of 500 to 5000, of 5 to 5000, or of 5 to 1000, 5 to 500, 5 to 250, of 5 to 100, of 5 to 50 or of 5 to 30 nucleotides.
  • such immunostimulatory RNA molecules consist of or comprise RNA of formula (I):
  • G is guanosine (guanine), uridine (uracil) or an analog of guanosine (guanine) or uridine (uracil), preferably guanosine (guanine) or an analog thereof;
  • X is guanosine (guanine), uridine (uracil), adenosine (adenine), thymidine (thymine), cytidine (cytosine), or an analog of these nucleotides (nucleosides), preferably uridine (uracil) or an analog thereof;
  • the RNA molecule according to formula (I) may be selected from e.g. the following sequence: GGGAGAAAGCUCAAGCUUAUCCAAGUAGGCUGGUCACCUGUACAACGUAGC CGGUAUUUUUUUUUUUUUUUUUUUUUUUUUUUUUGACCGUCUCAAGGUCCAAGUUAGU CUGCCUAUAAAGGUGCGGAUCCACAGCUGAUGAAAGACUUGUGCGGUACGG UUAAUCUCCCCUUUUUUUUUUUUUUUUUUUUAGUAAAUGCGUCUACUGAA UCCAGCGAUGAUGCUGGCCCAGAUCUUCGACCACAAGUGCAUAUAGUAGUC AUCGAGGGUCGCCUUUUUUUUUUUUUUUUUUUUAGUAAAUCGAGGGUCGCCUUUUUUUUUUUUUUUUUUUAGUAGUC AUCGAGGGUCGCCUUUUUUUUUU
  • a coding RNA is a functional RNA molecule that can be translated into a peptide or protein.
  • the coding RNA molecule comprises at least one open reading frame coding for at least one peptide or protein.
  • the coding RNA molecule can comprise one (monocistronic), two (bicistronic) or more (multicistronic) open reading frames (ORF).
  • the coding RNA molecule can be a messenger RNA (rnRNA) molecule, viral RNA molecule or self- replicating RNA molecule (replicon).
  • rnRNA messenger RNA
  • viral RNA molecule viral RNA molecule
  • replicon self- replicating RNA molecule
  • the RNA molecule is an mRNA.
  • said RNA molecule is longer than 100 nucleotides. It is equally preferred that the RNA has a length between 100 and 15.000 nucleotides, 100 and 12.500 nucleotides, , 100 and 10.000 nucleotides, 100 and 7.500 nucleotides, 100 and 5.000 nucleotides, 100 and 2.500 nucleotides, 100 and 1.500 nucleotides, or 100 and 1.000 nucleotides.
  • said synthesizing of an RNA molecule of a given sequence is performed as a large scale synthesis.
  • the term "large scale” refers to a reaction yield of said RNA molecule in the order of milligram quantities, preferably of at least one gram.
  • the in vitro transcription reaction is carried out in a bioreactor, also referred to as a transcription reactor or RNA reactor for large-scale synthesis of RNA. Therefore, the bioreactor can be adapted to carry out the above described method of the present invention.
  • a bioreactor for synthesizing RNA molecules of a given sequence preferably on a large scale
  • is a modularly designed in vitro transcription reactor system comprising a reaction module for carrying out in vitro RNA transcription reactions in a sequence-optimized reaction mix, a capture module for temporarily capturing the transcribed RNA molecules, and a control module for controlling the infeed of components of the sequence-optimized reaction mix into the reaction module.
  • the reaction module comprises a filtration membrane for separating nucleotides from the reaction mix, and the control of the infeed of the components of the sequence-optimized reaction mix by the control module is based on a measured concentration of separated nucleotides.
  • bioreactor or transcription reactor refers to a chamber or test tube or column wherein an in vitro transcription reaction is carried out under specified conditions.
  • the bioreactor may be thermally regulated to maintain accurately a specific temperature, usually between 4 and 40 °C.
  • the bioreactor may be configured with an inflow or feed line and an exit port.
  • the bioreactor may be a stirred-cell with provision for variable rates of stirring.
  • the bioreactor comprises a filtration membrane for separating nucleotides from the reaction mix, in particular for separating nucleotides and other low molecular weight components from the sequence-optimized reaction mix.
  • a filtration membrane in such a flow system, for example an ultrafiltration membrane, is used for separation of high molecular weight components, such as e.g. proteins and/or polynucleotides, from low molecular weight components, such as nucleotides.
  • the filtration membrane serves to selectively retain the immobilized DNA template, the RNA polymerase and the synthesized RNA molecules in the reactor core of the reaction module whereas smaller molecules such as nucleotides (NTPs) can pass the filtration membrane into a separate smaller compartment of the reaction module, i.e. the filtration compartment.
  • the nucleotide concentration can then be measured, for example, by spectroscopic analysis in the separated fluid containing the low molecular weight components.
  • the nucleotide concentration can be measured by an online HPLC system.
  • the application of a sequence-optimized NTP mix in this reactor system allows the real-time measurement of the nucleotide concentration during the in vitro transcription reaction to monitor the progress of the in vitro transcription reaction.
  • Suitable filtration membranes can consist of various materials known to a person skilled in the art (van de Merbel, 1999. J. Chromatogr. A 856(1 -2):55-82).
  • membranes may consist of regenerated or modified cellulose or of synthetic materials.
  • the latter include polysulfone (PSU), polyacrylo-nitrile (PAN), polymethylmethacrylate (PMMA), mixtures of polyarylether-sulfones, polyvinylpyrrolidone and polyamide (Polyamix.RTM.).
  • the polysulfones include polyethersulfone [poly(oxy-l,4- phenylsulfonyl-l ,4-phenyl), abbreviated PES].
  • polyethersulfone may be utilized as a semipermeable membrane for the use according to the disclosure.
  • PES membranes include increased hydrophilicity (and/or the improved wettability of the membrane with water) compared to PSU membranes.
  • the wettability of PES membranes can, for example, be further increased by the inclusion of the water-soluble polymer polyvinylpyrrolidone.
  • a filtration membrane is usually characterized by its molecular weight cut-off (MWCO) value, i.e. a specific size limitation, which is defined as the molecular mass of the smallest compound, which is retained for more than 90%.
  • MWCO molecular weight cut-off
  • the filtration membrane of the bioreactor of the present invention may have a MWCO in a range from 10 to 100 kDa, 10 to 75 kDa, 10 to 50 kDa, 10 to 25 kDA or 10 to 15 kDa. Even more preferred, the filtration membrane has a MWCO in a range of approximately 10 to 50 kDa.
  • the filtration membrane is selected from the group of regenerated cellulose, modified cellulose, polysulfone (PSU), polyacrylonitrile (PAN), polymethylmethacrylate (PMMA), polyvinyl alcohol (PVA) and polyarylethersulfone (PAES).
  • the bioreactor comprises a DNA template immobilized on a solid support as basis for the RNA transcription reaction.
  • the immobilization of the DNA template allows the repeated usage of the template and reduces the contamination of the RNA product by residual DNA.
  • the immobilization makes the use of DNAse dispensable for the removal of the DNA template from the final RNA product.
  • the DNA template which is preferably immobilized on a solid support in the reaction core of the reaction module, can represent a chemically synthesized DNA molecule, an isolated DNA restriction fragment, a plasmid or an amplified DNA molecule, for example by an amplification process such as the polymerase chain reaction (PCR).
  • the DNA template can be a double-stranded duplex or a unit that comprises a double-stranded promoter region upstream of a single-stranded RNA coding region.
  • the DNA template may be modified with a ligand for immobilization to a solid support at the 5' end, the 3' end, or at an internal nucleotide of a DNA strand.
  • the term "solid support” relates to every undissolved support being able to immobilize a DNA molecule on its surface.
  • the solid support may be selected from the group consisting of agarose, modified agarose, sepharose, polystyrene, latex, cellulose, and ferro- or ferrimagnetic particles.
  • the immobilization of the DNA template on the solid support can be via a covalent linkage or a non-covalent linkage.
  • the immobilization of the DNA template occurs through a non-covalent linkage.
  • the immobilization of a DNA template to a solid support can occur through a non-covalent biotin-streptavidin interaction.
  • the non-coding strand of the DNA template can be modified with a 5'-terminal biotin group which functions to immobilize the DNA strand to a solid support matrix comprising streptavidin protein.
  • the complementary RNA-coding strand of the DNA template can remain non-immobilized. It is also possible to immobilize DNA templates to solid supports through other types of non-covalent linkages, e.g., poly(A)-poly(T), and poly(G)-poly(C) interactions. Equally preferred, the immobilization of the DNA template occurs through a covalent linkage, e.g., ester linkage or derivative thereof.
  • the solid support can contain active groups such as NHS, carbodimide etc.
  • the DNA molecule can be coupled to the solid support by direct coupling (e.g. using functional groups such as amino- , sulfhydryl-, carboxyl-, hydroxyl-, aldehyde-, and ketone groups).
  • the linkage to the solid support material may involve spacers to optimize the spatial separation of the DNA template from the support.
  • the spacer may be provided by insertion of additional nucleotides at the 5' end of the DNA template.
  • the capture module of the bioreactor comprises a resin/solid phase to capture the transcribed R A molecules and to separate the transcribed RNA molecules from other soluble components of the sequence- optimized transcription reaction mix.
  • the capture module comprises means for purifying the captured transcribed RNA molecules, e.g. by a washing process or the like.
  • the capture module comprises means for eluting the captured transcribed RNA molecules, preferably by means of an elution buffer.
  • the bioreactor further comprises a reflux module for returning the residual filtrated sequence-optimized reaction mix, i.e. the other soluble components of the sequence-optimized transcription reaction mix besides the transcribed RNA molecules, to the reaction module from the capture module after capturing the transcribed RNA molecules, preferably wherein the means for returning the residual filtrated sequence-optimized reaction mix is a pump.
  • the reflux module preferably comprises immobilized enzymes, such as pyrophosphatase, or resin to capture disruptive components, such as phosphate.
  • the bioreactor comprises at least one ion-selective electrode.
  • the term 'ion-selective electrode' relates to a transducer (e.g. a sensor) that converts the activity of a specific ion dissolved in a solution into an electrical potential, wherein the electrical potential may be measured, for instance, by using a volt meter or a pH meter.
  • the term 'ion-selective electrode' as used herein comprises a system, which comprises or consists of a membrane having selective permeability, wherein the membrane typically separates two electrolytes.
  • An ion-selective electrode as used herein typically comprises a sensing part, which preferably comprises a membrane having selective permeability and a reference electrode.
  • the membrane is typically an ion-selective membrane, which is characterized by different permeabilities for different types of ions.
  • the at least one ion-selective electrode of the bioreactor comprises a membrane selected from the group consisting of a glass membrane, a solid state membrane, a liquid based membrane, and a compound membrane.
  • the bioreactor as described herein comprises at least one ion- selective electrode, wherein the at least one ion-selective electrode comprises or consists of a system comprising a membrane, preferably a membrane as described herein, more preferably an electrochemical membrane, having different permeabilities for different types of ions, wherein the membrane, preferably a membrane as described herein, more preferably an electrochemical membrane, preferably separates two electrolytes.
  • the membrane comprises or consists of a layer of a solid electrolyte or an electrolyte solution in a solvent immiscible with water. The membrane is preferably in contact with an electrolyte solution on one or both sides.
  • the ion-selective electrode comprises an internal reference electrode. Such internal reference electrode may be replaced in some embodiments, for example by a metal contact or by an insulator and a semiconductor layer.
  • An ion-selective electrode permits highly sensitive, rapid, exact and non-destructive measurement of ion activities or ion concentrations in different media. Apart from direct measurements of ion activities or ion concentrations they can serve, in particular by using a calibration curve, for continuous monitoring of concentration changes, as elements for control of dosage of agents or as very accurate indicator electrodes in potentiometric titrations.
  • the bioreactor comprises at least one ion-selective electrode, preferably as described herein, for measuring the concentration of one or more types of ions in at least one compartment of the bioreactor.
  • the at least one ion- selective electrode may be used to measure the concentration of one or more types of ions in a reaction module, a control module or a reflux module of the bioreactor.
  • the at least one ion-selective electrode is used for measuring the concentration of one or more types of ions in the reaction module, more preferably in the reaction core or in the filtration compartment.
  • the at least one ion-selective electrode may be comprised in a sensor unit of the bioreactor, preferably as defined herein.
  • the ion-selective electrode may be located in the bioreactor itself, on the bioreactor or outside of the bioreactor (e.g. connected to the bioreactor by a bypass).
  • the phrase 'the bioreactor comprises at least one ion-selective electrode' may thus refer to a situation, where the at least one ion-selective electrode is a part of the bioreactor, or to a situation, where the at least one ion-selective electrode is a separate physical entity with respect to the bioreactor, but which is used in connection with the bioreactor.
  • the bioreactor comprises at least one ion-selective electrode, preferably as described herein, for measuring the concentration of one or more types of ions in a liquid comprised in at least one compartment of the bioreactor, wherein the ion is preferably selected from the group consisting of H + , Na + , K + , Mg 2+ , Ca 2+ , CI " and P0 4 3 ⁇
  • the bioreactor comprises at least one ion-selective electrode, preferably as described herein, which is connected to a potentiometer, preferably a multi-channel potentiometer (for instance, a CITSens Ion Potentiometer 6-channel, high- resolution; C-CIT Sensors AG, Switzerland).
  • a potentiometer preferably a multi-channel potentiometer (for instance, a CITSens Ion Potentiometer 6-channel, high- resolution; C-CIT Sensors AG, Switzerland).
  • the bioreactor comprises at least one ion-selective electrode, wherein the at least one ion-selective electrode is preferably a tube electrode, more preferably selected from the group consisting of a Mg 2+ selective tube electrode, a Na + selective tube electrode, a CI " selective tube electrode, a P0 4 3" selective tube electrode, a pH-selective tube electrode and a Ca 2+ selective tube electrode, preferably used in connection with a potentiometer.
  • a tube electrode more preferably selected from the group consisting of a Mg 2+ selective tube electrode, a Na + selective tube electrode, a CI " selective tube electrode, a P0 4 3" selective tube electrode, a pH-selective tube electrode and a Ca 2+ selective tube electrode, preferably used in connection with a potentiometer.
  • the bioreactor comprises at least one ion-selective electrode, wherein the at least one ion-selective electrode is preferably selected from the group consisting of a CITSens Ion Mg 2+ selective mini-tube electrode, a CITSens Ion Na + selective mini-tube electrode, a CITSens Ion CI " selective mini-tube electrode, a CITSens Ion P0 4 3" selective mini-tube electrode, a CITSens Ion pH-selective mini-tube electrode and a CITSens Ion Ca selective mini-tube electrode (all from C-CIT Sensors AG, Switzerland), preferably in connection with a potentiometer, more preferably with a multi-channel ptentiometer, such as a CITSens Ion Potentiometer 6-channel, high- resolution (C-CIT Sensors AG, Switzerland).
  • a CITSens Ion Mg 2+ selective mini-tube electrode preferably a CITSens Ion Na + selective mini-tube electrode,
  • Ion-selective electrodes have numerous advantages for practical use. For example, they do not affect the tested solution, thus allowing non-destructive measurements. Furthermore, ion-selective electrodes are mobile, suitable for direct determinations as well as titration sensors, and cost effective. The major advantage of the use of an ion-selective electrode in a bioreactor (e.g. a transcription reactor) is the possibility to measure in situ without sample collection and in a non-destructive manner.
  • a bioreactor e.g. a transcription reactor
  • the bioreactor, or more precisely the control module of the bioreactor comprises a sensor unit for the analysis of critical process parameters, such as pH- value, conductivity and nucleotide concentration in the sequence-optimized reaction mix.
  • the sensor unit of the bioreactor comprises a sensor, such as an UV flow cell for UV 260/280nm, for the real-time measurement of the nucleotide concentration during the in vitro transcription reaction.
  • the sensor of the sensor unit measures the nucleotide concentration, as a process parameter, by photometric analysis.
  • the bioreactor comprises a control module.
  • Data collection and analyses by the control module allows the control of the integrated pump system (actuator) for repeated feeds of components of the sequence- optimized NTP mix or components of the sequence-optimized reaction mix, e.g. buffer components, RNA polymerase or nucleotides. Tight controlling and regulation allows to perform the in vitro transcription reaction under an optimal steady-state condition resulting in high product yield.
  • control module controls the addition of the sequence- optimized ribonucleoside triphosphate (NTP) mix to the sequence-optimized reaction mix, preferably wherein said bioreactor comprises an actuator for addition of the sequence- optimized ribonucleoside triphosphate (NTP) mix to the sequence-optimized reaction mix.
  • the actuator can also add other reaction components of the sequence-optimized reaction mix, such as a buffer components, or Mg ++ , to the in vitro transcription reaction mix.
  • the bioreactor operates in a semi-batch mode or in a continuous mode.
  • semi-batch refers to the operation of the in vitro transcription reaction as a repetitive series of transcription reactions.
  • reaction is allowed to proceed for a finite time at which point the product is removed, new reactants added, and the complete reaction repeated.
  • continuous-flow refers to a reaction that is carried out continually in a bioreactor core with supplemental reactants constantly added through an input feed line and products constantly removed through an exit port.
  • a continuous-flow reactor controls reagent delivery and product removal through controlled device flow rates, which is advantageous for reactions with reagent limitations and inhibitory products.
  • the present invention relates to an RNA molecule obtainable by the inventive method as disclosed herein.
  • the RNA obtained by the inventive method is characterized by a reduced immunostimulatory activity in comparison to RNA obtained by prior art methods, in particular as compared to RNA obtained by an in vitro transcription method, wherein the NTP mix is not optimized with respect to the transcript sequence, such as a method using a standard equimolar NTP mix.
  • the present invention also relates to the use of a sequence-optimized ribonucleoside triphosphate (NTP) mix optimized for an RNA molecule of a given sequence for the synthesis of said RNA molecule. All definitions and specific embodiments relating to the sequence-optimized ribonucleoside triphosphate (NTP) mix made above with respect to the method of the invention also apply to said use of the invention.
  • NTP sequence-optimized ribonucleoside triphosphate
  • the sequence-optimized NTP mix has been optimized by a method comprising the steps of: a) determining the fraction (1) of each of the four nucleotides G, A, C and U in said RNA molecule, and b) preparing the sequence-optimized ribonucleoside triphosphate (NTP) mix comprising the four ribonucleoside triphosphates (NTPs)GTP, ATP, CTP and UTP, wherein the fraction (2) of each of the four ribonucleoside triphosphates in the sequence-optimized ribonucleoside triphosphate (NTP) mix corresponds to the fraction (1) of the respective nucleotide in said RNA molecule.
  • NTP sequence-optimized ribonucleoside triphosphate
  • the present invention also relates to a sequence-optimized ribonucleoside triphosphate (NTP) mix for the synthesis of an RNA molecule of a given sequence comprising the four nucleoside triphosphates GTP, ATP, CTP and UTP, wherein the fraction (2) of each of the four nucleoside triphosphates in the sequence-optimized ribonucleoside triphosphate (NTP) mix corresponds to the fraction (1) of the respective nucleotide in said RNA molecule.
  • the present invention also relates to a kit comprising a sequence- optimized ribonucleoside triphosphate (NTP) mix optimized for an RNA molecule of a given sequence as defined above.
  • the sequence-optimized NTP mix can be provided in one tube containing all four types of NTPs (GTP, ATP, CTP and UTP) or each NTP in a separate tube. All definitions or specific embodiments made above with respect to the method of the invention also apply to said kit of the invention.
  • Figure 1 G/C optimized mRNA sequence of R1871 coding for Homo sapiens prostate stem cell antigen (HsPSCA), which corresponds to SEQ ID NO: 1.
  • HsPSCA Homo sapiens prostate stem cell antigen
  • Figure 2 G/C optimized mRNA sequence of R2988 coding for Photinus pyralis luciferase (PpLuc), which corresponds to SEQ ID NO: 2.
  • Figure 3 G/C optimized mRNA sequence of R 1626 coding for Homo sapiens Mucin- 1 signal peptide/epidermal growth factor receptor/Mucin-1 fusion protein (EGFR/Mucin-1), which corresponds to SEQ ID NO: 3.
  • Figure 4 Non-coding immunostimulatory RNA sequence of R2025, which corresponds to SEQ ID NO: 4.
  • FIG. 5 RNA yields over time for mRNA encoding HsPSCA (R1871) and
  • EGFR/Mucin-1 R1626. mRNAs were synthesized by in vitro transcription as shown in Example 1.
  • RNA yield of standard transcription reactions reaches after about 30 minutes a plateau of approx. 1.4 mg/ml RNA for the 5337 nucleotide long RNA encoding EGFR/Mucin-1 (R1626) and of approx. 1.8 mg/ml RNA for the 589 nucleotide long RNA encoding HsPSCA (Rl 871).
  • RNA yield of sequence-optimized transcription reactions is significantly higher compared to standard transcription reactions. After 60 minutes (R1626) and 120 minutes (R1871) both RNAs reach a similar plateau of approximately 3.9 mg/ml RNA. Mean and standard deviation of triplicates are shown.
  • Figure 6 Comparison of RNA yields obtained from using standard and sequence- optimized nucleotide (CapNTP) mixes for mRNA encoding HsPSCA (R1871), Luciferase (PpLuc, R2988) and EGFR/Mucin-1 (R1626). The experiment was performed as described in Example 1 (reaction time 5 hours).
  • CapNTP standard and sequence- optimized nucleotide
  • RNA yields for the three different RNA molecules of different lengths are roughly the same for each type of transcription reaction. However, different yields are obtained depending on the nucleotide mix used for the in vitro transcription.
  • RNAs were cleaved with the hammerhead ribozyme HHNUH2d as described in example 2 and the resulting RNA fragments were separated by denaturing polyacrylamide gel electrophoresis (dPAGE).
  • dPAGE denaturing polyacrylamide gel electrophoresis
  • Figure 9 Comparison of theoretical and actual RNA yields for the noncoding immunostimulatory RNA R2025 using standard (equal) and sequence- optimized (seqopt) NTP mixes in the presence of additional nucleotides (13.45 mM total NTP concentration; 13.45 mM cap or GTP for equal mixes (4-fold excess over GTP); 1 1.2 mM cap or GTP for sequence-optimized NTP mixes (4-fold excess over GTP)).
  • White bars actual yields.
  • Black bars theoretical yields. The experiments were performed as described in Example 4. Mean and standard deviation of triplicates are shown.
  • Figure 10 Comparison of theoretical and actual RNA yields for the mRNA encoding Homo sapiens prostate stem cell antigen (HsPSCA) (R1871) using standard (equal) and sequence-optimized NTP ratios in the presence of additional nucleotides (13.45 mM total NTP concentration; 13.45 mM cap or GTP for equal mixes (4-fold excess over GTP); 13.7 mM cap or GTP for sequence- optimized NTP mixes (4-fold excess over GTP)).
  • White bars actual yields.
  • Black bars theoretical yields. The experiments were performed as described in Example 4.
  • Figure 11 Transcription efficiencies using sequence-optimized NTP mixes of Na-NTPs or Tris-NTPs, in the presence of respective added salts (NaCl; Tris/HCl, pH7.5). The experiment was performed as described in Example 5.
  • Figure 12 Monitoring of the progress of the sequence-optimized transcription reaction by measuring the amount of produced RNA and the consumption of nucleotide mix. The experiment was performed as described in Example 6.
  • the mRNA was synthesized by in vitro transcription using total NTP concentrations of 4 mM and 13.45 mM of the PpLuc sequence-optimized NTP mix in the presence of varying concentrations of cap analog. The experiment was performed as described in Example 7.
  • B Relative RNA yield [%].
  • Figure 14 RNA yields for mRNA encoding Homo sapiens prostate stem cell antigen
  • HsPSCA Homo sapiens prostate stem cell antigen
  • the mRNA was synthesized by in vitro transcription using total NTP concentrations of 13.45 mM of the HsPSCA sequence-optimized NTP mix to which GTP start nucleotide was added up to a concentration of 20 mM. The experiment was performed as described in Example 8.
  • the mRNA was synthesized by in vitro transcription using total NTP concentrations of 13.45 mM of the PpLuc sequence-optimized NTP mix to which GTP start nucleotide was added up to a concentration of 20 mM. The experiment was performed as described in Example 8.
  • A Actual RNA yield [mg/ml].
  • B Relative RNA yield [%].
  • Figure 17 RNA yields for mRNA encoding EGFR/Mucin-1 (R1626) depending on GTP start nucleotide concentration.
  • the mRNA was synthesized by in vitro transcription using total NTP concentrations of 13.45 mM of the EGFR/Mucin-1 sequence-optimized NTP mix to which GTP start nucleotide was added up to a concentration of 20 mM. The experiment was performed as described in Example 8.
  • A Actual RNA yield [mg/ml].
  • B Relative RNA yield [%].
  • FIG. 18 Bioreactor in a schematic illustration, including modules for continuous or semi-batch process, with resin-immobilized linear DNA as template for the transcription reaction.
  • RNA yields over time for mRNA encoding HA (Example 1 1).
  • the RNA yield at different time points is shown for RNA obtained by in vitro transcription in a bioreactor using a standard NTP mix (TS(1)), by sequence-optimized transcription in a bioreactor without feed (TS(2)), by sequence-optimized transcription in a bioreactor with feed (TS(3)), or by sequence-optimized transcription in a bioreactor with reduced T7 RNA polymerase concentration and reduced template concentration (TS(4)), respectively.
  • TS(1) standard NTP mix
  • TS(2) sequence-optimized transcription in a bioreactor without feed
  • TS(3) sequence-optimized transcription in a bioreactor with feed
  • TS(4) reduced template concentration
  • Figure 22 Surface expression of the HA protein as determined by using flow cytometric analysis (Example 1 1).
  • the geometric mean of fluorescence intensity (GMFI) was determined for cells transfected with RNA obtained by in vitro transcription in a bioreactor using a standard NTP mix (TS(1)), by sequence- optimized transcription in a bioreactor without feed (TS(2)), by sequence- optimized transcription in a bioreactor with feed (TS(3)), or by sequence- optimized transcription in a bioreactor with reduced T7 RNA polymerase concentration and reduced template concentration (TS(4)), respectively.
  • TS(1) standard NTP mix
  • TS(2) sequence- optimized transcription in a bioreactor without feed
  • TS(3) sequence- optimized transcription in a bioreactor with feed
  • TS(4) reduced template concentration
  • FIG. 23 Immunostimulation by RNA synthesized by in vitro transcription in a bioreactor using a standard NTP mix (TS(1)), by sequence-optimized transcription in a bioreactor without feed (TS(2)), by sequence-optimized transcription in a bioreactor with feed (TS(3)), or by sequence-optimized transcription in a bioreactor with reduced T7 RNA polymerase concentration and reduced template concentration (TS(4)), respectively. Cytokine and chemokine levels in cell supernatants were measured as described in Example 1 1.
  • HsPSCA Homo sapiens prostate stem cell antigen
  • PpLuc Photinus pyralis Luciferase
  • EGFR/Mucin-1 Mucin- 1 signal peptide/epidermal growth factor receptor/Mucin- 1 fusion protein
  • a vector for in vitro transcription was constructed containing a T7 promoter followed by a sequence coding for the above mentioned proteins.
  • the constructs were prepared by modifying the wild type coding sequence by introducing a GC-optimized sequence for stabilization, followed by a stabilizing sequence derived from the alpha-globin-3'-UTR (muag (mutated alpha-globin-3'-UTR)), a stretch of 64 adenosines (poly-A-sequence), a stretch of 30 cytosines (poly-C-sequence), and a histone stem loop.
  • a vector for in vitro transcription was constructed containing a T7 promoter followed by the sequence encoding an immunostimulatory RNA (R2025), which does not encode a protein.
  • RNA constructs and their nucleotide compositions are listed in Table 1 and Table 2, respectively.
  • Table 1 RNAs
  • the standard transcription reaction volume was 20 ⁇ .
  • 1 ml reactions were set up.
  • Linearized DNA plasmid templates (50 ⁇ g/ml) were transcribed at 37°C for three hours (or as indicated) in 80 mM HEPES/KOH, pH 7.5, 24 mM MgCl 2 , 2 mM spermidine, 40 mM DTT, 5 U/ml pyrophosphatase (Thermo Fisher Scientific), 200 U/ml Ribolock RNase inhibitor (Thermo Fisher Scientific), 5000 U/ml T7 RNA polymerase (Thermo Fisher Scientific).
  • NTPs Ribonucleoside triphosphates
  • RNAs were precipitated in 2.86 M LiCl in a 3.45-fold reaction volume for 16 hours at - 20°C, followed by centrifugation (30 minutes, 16.000 g, 4°C). Pellets were washed in five transcription reaction volumes of 75% ethanol (invert tubes, centrifuge 5 minutes, 16.000 g, 4°C), dried and re-dissolved in 2.5 transcription reaction volumes H 2 0.
  • PvNA yields were determined via absorbance measurement at 260 nm using a NanoDrop® Spectrophotometer.
  • RNA produced was converted to the number of molecules produced by dividing by the molecular mass. Multiplying by the number of the respective nucleotide present in the sequence yielded the incorporated nucleotides. To determine the remaining nucleotides (in %) at the end of the transcription reaction, this number was divided by the number of nucleotides available, according to:
  • Equation (1) r . RNA vteitf * -number of NTP i-n niRNA . _ _
  • RNA yield indicates the number of molecules produced per reaction (nmol).
  • the NTP starting concentration [NTP (start)] is indicated in mM, the reaction volume in ⁇ .
  • NTPs available at the beginning of the reaction were multiplied by the percentage of remaining NTPs at the end of a transcription reaction (see above) according to:
  • NTP (remaining) [mM] NTP (start) ⁇ rnM ⁇ ⁇ * NTP (remaining) ⁇ %] 3. Standard in vitro transcription in the presence of cap analog
  • RNAs using cap analog standard transcription was carried out with 5.8 mM m7G(5 ' )ppp(5 ')G cap analog, 4 mM ATP, 4 mM CTP, 4 mM UTP, and 1.45 mM GTP (all Thermo Fisher Scientific) (see Table 3).
  • the cap analog and GTP were used at a ratio of 4: 1.
  • Table 4 Amount of nucleotides remaining at the end of standard transcription reactions (after 2.5 hours, in percent of nucleotides at the start of the reaction)
  • RNA transcripts in a standard transcription The typical yield of RNA transcripts in a standard transcription is about 1.5 mg/ml reaction. 4.
  • Cap analog and NTP concentrations were doubled compared to standard transcription conditions, so that reactions were carried out in 1 1.6 mM m7G(5')ppp(5 ' )G cap analog, 8 mM ATP, 8 mM CTP, 8 mM UTP, and 2.9 mM GTP (all Thermo Fisher Scientific) (see Table 3).
  • the cap analog and GTP were used at a ratio of 4: 1.
  • Table 7 Amount of nucleotides remaining at the end of 2xCapNTP transcription reactions (after 2.5 hours, in percent of nucleotides at the start of the reaction)
  • the typical yield of a transcription using double concentrations of cap analog and NTPs about 3 mg/ml reaction.
  • NTPs ribonucleoside triphosphates
  • Table 9 Amount of nucleotides remaining at the end of sequence-optimized transcription (after 2.5 hours, in percent of nucleotides at the start of the reaction)
  • RNA yield of a transcription using sequence-optimized cap analog and NTPs is about 3.9 mg/ml reaction. ). Sequence-optimized in vitro transcription in the presence of cap analog with NTP feed
  • NTPs ribonucleoside triphosphates
  • Table 11 Amount of nucleotides remaining at the end of sequence-optimized transcription with NTP feed (after 5h, in percent of nucleotides at the start of the reaction)
  • RNA yield of a transcription using sequence-optimized cap analog and NTPs followed by NTP feed is around 6.75 mg/ml reaction.
  • RNA transcription was carried out in the presence of 4 mM of each ATP, GTP, CTP and UTP (all Thermo Fisher Scientific). Non-capped RNAs were used as control in the capping analysis assay ( Figure 7). 8. Enzymatic capping of mRNA
  • Enyzmatic capping was performed using the ScriptCapTM m 7 G Capping System (Cellscript, Madison, WI, USA) according to the manufacturer's instructions.
  • 60 ⁇ g of non-capped RNAs were heat-denatured (10 minutes, 65 °C) in a volume of 68.5 ⁇ and immediately cooled on ice (5 minutes).
  • reaction components lx ScriptCap Capping buffer, 1 mM GTP, 0.1 mM SAM, 1000 U/ml ScripGuard RNase Inhibitor, 400 U/ml ScriptCap Capping Enzyme
  • RNAs were precipitated in 2.86 M LiCl in a 3.45-fold reaction volume for 16 hours at -20°C, followed by centrifugation (30 minutes, 16.000 g, 4°C). Pellets were washed in 0.5 reaction volumes 75% ethanol (invert, centrifuge 5 minutes, 16000 g, 4°C), dried and re-dissolved in H 2 0. Enzymatically capped RNAs were used as control in the capping analysis assay ( Figure 7).
  • RNA yield of standard and sequence-optimized in vitro transcription reactions was determined at defined time points for up to two hours as described above (paragraph 2).
  • RNA yield of standard transcription reactions reaches a plateau of about 1.4 mg/ml for the 5337 nucleotide long RNA encoding EGFR/Mucin-1 (R1626) and of about 1.8 mg/ml for the 589 nucleotide long RNA encoding HsPSCA (R1871).
  • RNA yield of sequence-optimized transcription reactions is significantly higher compared to standard transcription reactions. After 60 minutes (R1626) and 120 minutes (R1 26), respectively, both RNAs reach a similar plateau of approximately 3.9 mg/ml.
  • RNA yields for the three different RNA molecules of different length are roughly the same for each type of transcription reaction after five hours.
  • Standard transcription yields about 1.5 mg/ml RNA, transcription with a twofold concentrated Cap-NTP mix (2xCapNTP) about 3.0 mg/ml RNA, sequence-optimized transcription about 3.9 mg/ml RNA and sequence-optimized transcription with NTP feed about 6.75 mg/ml RNA.
  • sequence-optimized transcription reaction results in an about threefold increase in RNA yield compared to standard transcription reactions. This yield can be further increased by about twofold by supplementing the reaction with NTP (NTP feed).
  • Equation (4)
  • In vitro transcription reactions can be performed by replacing one or more of the four nucleotides ATP, GTP, CTP and UTP by nucleotide analogs.
  • modified NTPs are pseudouridine (psU or ⁇ ) triphosphate and 5-methylcytidine (5mC) triphosphate.
  • the percentage of the modified nucleotide in the mix can be varied from 0% to 100% of the natural nucleotide that it replaces.
  • modified nucleotides such as pseudouridine (psU) triphosphate in sequence-optimized nucleotide mixes, UTP was replaced by 10%, and 100% pseudouridine triphosphate. In a control reaction, 100% UTP was used. Sequence-optimized in vitro transcription in the presence of cap analog
  • NTPs ribonucleoside triphosphates
  • the actual RNA yield for R2025 can be increased for sequence-optimized NTP mixes compared to standard NTP mixes (equal NTP mix).
  • the actual RNA yield for the mRNA encoding Homo sapiens prostate stem cell antigen (HsPSCA; R1871) can be increased for sequence- optimized NTP mixes compared to standard NTP mixes (equal NTP mix).
  • NTP counter ions The impact of NTP counter ions on RNA yield was investigated using mRNA encoding Homo sapiens Mucin- 1 signal peptide/epidermal growth factor receptor/Mucin- 1 fusion protein (EGFR/Mucin- 1 , R1626) as example. Transcription reactions were assembled as described in Example 1, Section 2, using sequence-optimized NTP ratios and a total NTP concentration of 13.45 mM. NTPs contained either Na + or Tris + (both Thermo Scientific) as counter ions. In addition, Na-NTP reactions were supplemented with different concentrations of NaCl, Tris-NTP reactions with Tris/HCl. After 2.5 hours of reaction time, the RNAs were purified and their concentration was determined as described in Example 1, Section 2.
  • RNA yield for Homo sapiens Mucin- 1 signal peptide/epidermal growth factor receptor/Mucin- 1 fusion protein (EGFR/Mucin- 1, R1626) using a sequence-optimized NTP mix remained roughly the same up to a concentration of 150 mM Tris-HCl.
  • the RNA yield started to decline at NaCl concentrations above 75 mM.
  • the negative impact of high NaCl concentrations on RNA yields has been described (e.g. Kern et al., 1997. Biotechnol. Prog., 13, 747-756; US 6,586,218 B2).
  • HsPSCA Homo sapiens prostate stem cell antigen
  • R1871 Homo sapiens prostate stem cell antigen
  • Cap analog was present in a 4: 1 excess over GTP.
  • a 20 ⁇ sample was taken, the RNA purified and its absorbance at 260 nm determined as described in Example 1, Section 2.
  • a second sample of 40 ⁇ was taken at the same time point and was filtered through a Microcon YM10 device (Merck Millipore, Darmstadt, Germany) (16000*g, 5 minutes, 17°C).
  • the use of a sequence-optimized ribonucleotide mix allows measuring the progress of the in vitro transcription reaction by determining the remaining total nucleotide concentration at defined time points.
  • the decrease in total NTP concentration directly correlates with the amount of synthesized RNA.
  • the progress of the transcription reaction can be accurately determined as a function of measured total NTP concentration at a given time point and calculating the moles of NTPs consumed. Based on this information it becomes possible to calculate the amount of synthesized RNA.
  • Transcription reactions were assembled as described in Example 1, section 2, and were carried out at total NTP concentrations of 2 mM, 4 mM, and 13.45 mM NTPs as indicated in Figures 14 and 15.
  • the NTPs were distributed according to the sequence of the produced RNA as described in Example 1 , section 5 (sequence-optimized ribonucleotide mix for PpLuc and HsPSCA).
  • the reactions were performed at various concentrations (0, 0.25, 2.0, 10, 16 and 20 mM) of the CAP analog (m7G(5 ')ppp(5 ')G) as indicated in Figures 14 and 15.
  • the actual RNA yield for PpLuc mRNA increases with higher cap analog concentrations.
  • the actual RNA yield is higher for the total NTP concentration of 13.45 mM compared to 4 mM.
  • Figure 13B shows that the relative RNA yield for PpLuc mRNA increases up to a cap analog concentration of approximately 16 mM.
  • the increase in relative RNA yield is stronger for the low NTP concentration (4 mM) than for the high NTP concentration (13.45 mM).
  • the actual RNA yield for HsPSCA mRNA increases with higher Cap analog concentrations.
  • the actual RNA yield is higher for the total NTP concentration of 13.45 mM compared to 4 mM and 2 mM.
  • Figure 14B shows that the relative RNA yield for HsPSCA mRNA increases up to a cap analog concentration of approximately 16 mM. The strongest increase of the relative RNA yield is observed for the lowest NTP concentration tested (2 mM).
  • Example 8 RNA yields for sequence-optimized nucleotide mixes as a function of GTP start nucleotide concentration
  • Transcription reactions were assembled as described in Example 1, section 2, and were carried out at a total NTP concentration of the sequence-optimized nucleotide mix of 13.45 mM for P625, PI 040 and P532.
  • NTPs were distributed according to the sequence of the produced RNA as described in Example 1, section 5 (sequence-optimized ribonucleotide mix for PpLuc, HsPSCA and EGFR/Mucin-1). The reactions were performed by adding defined concentrations (0, 0.25, 2.0, 10, 16 and 20 mM ) of GTP start nucleotide to the sequence-optimized NTP mix as indicated in Figures 16 to 18.
  • FIG. 18 shows a preferred embodiment of a bioreactor 1 in accordance with the present invention in a schematic illustration. From Figure 18, the modular structure of the bioreactor 1 becomes evident.
  • the bioreactor 1 consists of several bioreactor modules 2, 3, 4, 5.
  • Reaction module 1 is a reaction vessel used for a continuous or semi-batch process for synthesizing RNA molecules of a given sequence.
  • the reaction module 2 contains resin-immobilized DNA used as a template for the RNA transcription reaction.
  • the immobilization of the DNA allows a repeated usage of the template and reduces the contamination of the desired RNA product by any kind of residual DNA.
  • the immobilization of the DNA template supersedes the use of the enzyme DNAse for terminal DNA digestion.
  • the produced RNA molecules can be released batch by batch or continuously into the capture module 3.
  • the capture module 3 contains a resin/solid phase to capture the RNA molecules and to separate the RNA from other soluble components of the transcription reaction. Thereafter, the RNA molecules can be dispensed from the bioreactor 1 by means of an exit line or the like (not shown) to a receiving unit or the like, in which further RNA elution and purification can be carried out.
  • a washing fluid and/or elution buffer can be provided to the capture module 3 by means of a respective wash and buffer tank 31 connected to the transfer area between reaction module 2 and capture module 3.
  • an ultrafiltration membrane 21 for separation of high molecular weight components, such as proteins and polynucleotides, from low molecular weight components, such as nucleotides, is provided in the reaction module 2.
  • the membrane separates a reaction core
  • the feed of nucleotides, buffer components and/or enzymes into reaction module 2 from a feed tank 24 can be controlled and regulated by means of a feed pump 43, which allows performing the RNA transcription reaction in an optimal steady - state condition yielding high transcriptional performance.
  • a sensor unit 41 is provided for measuring reaction parameters in the reaction mix.
  • the sensor unit 41 at least comprises a sensor for photometric analysis, such as an UV flow cell for UV 260/280nm, in the filtrated fluid containing the low molecular weight components, which filtrated fluid is extracted from the filtration compartment 23, circulated by a recirculation pump 25 and returned into the filtration compartment 23.
  • the sensor of the sensor unit 41 is provided in order to achieve real-time monitoring of the filtrated fluid inside the filtration compartment 23.
  • the application of a sequence- optimized ribonucleotide mix in the bioreactor 1 enables a real-time measurement of the nucleotide concentration in the filtration compartment 23 during the RNA transcription reaction in the reaction core 22 of reaction module 2.
  • the sensor unit 41 is part of control module 4, which further comprises a controller 42 and an actuator in the form of feed pump 43.
  • the sensor unit 41 and the feed pump 43 are connected to the controller 42 in order to provide measurement signals to and receive instruction signals from the controller 42.
  • other critical process parameters such as a pH- value of the filtrated fluid, or a conductivity of the filtrated fluid can be analyzed by further suitable sensors of the sensor unit 41.
  • Data collection and analyses by the controller 42 usually in the form of a computer based system or the like, allows the control of the feed pump 43 as an actuator for repeated feeds of nucleotides, buffer components and/or enzymes into the reaction module 2, as well as the control of further pumps in the bioreactor 1 in order to adjust key process parameters in optimal steady-state reaction conditions.
  • the bioreactor 1 of the preferred embodiment further comprises a reflux module 5 connected to the capture module 3, which reflux module 5 collects unused raw materials, such as nucleotides and enzymes, and recirculates the same back into the reaction module 2 by means of a reflux pump 51.
  • the reflux module 5 contains immobilized enzymes, such as pyrophosphatase, or resin to capture disruptive components, such as phosphate or the like.
  • Example 10 Immunostimulatory activity of RNA molecules
  • the immunostimulatory properties of RNA molecules synthesized with a sequence-optimized NTP mix and a standard equimolar NTP mix were compared. Immunostimulation was determined by measuring cytokine and chemokine levels in the supernatants of cells transfected with mRNA. Standard and sequence-optimized in vitro transcription reactions for Luciferase mRNA (pPluc) were performed as described in Example 1.
  • HeLa cells were seeded at a density of 4xl0 5 cells per well in a 6- well plate in 2 ml HeLa cell culture medium consisting of Gibco ® RPMI 1640 medium supplemented with 25 mM HEPES, 2 mM L-Glutamine and 100 IU/ml penicillin/streptomycin (all Lonza, Basel, Switzerland) and 10% fetal calf serum (Perbio Science, Bonn, Germany).
  • the cells were transfected with 2 ⁇ g of RNA or water-for-injection (WFI) as negative control using Lipofectamine ® 2000 (Life Technologies, Darmstadt, Germany, catalog no. 1 1668-027).
  • WFI water-for-injection
  • RNA was each diluted in Opti-MEM ® medium (Life Technologies), combined in a ratio of RNA: Lipofectamine ® of 1 : 1.5 and incubated for 20 minutes at room temperature.
  • the negative control contained WFI instead of RNA mixed with Lipofectamine ® .
  • the cells were washed once with 2 ml Gibco ® RPMI 1640 medium supplemented with 25 mM HEPES and 2 mM L- Glutamine (serum free and penicillin/streptomycin free medium) and 2 ml of the serum free and penicillin/streptomycin free medium was added to the cells followed by the addition of 0.5 ml RNA: Lipofectamine ® transfection mix. After incubation for 4 hours at 37°C and 5% C02, the medium containing the transfection mix was replaced by 2 ml of HeLa cell culture medium.
  • CBA Cytometric Bead Array
  • the levels of secreted IL-6, CXCL10 and CCL5 were lower for the RNA synthesized with the sequence-optimized NTP mix compared to the same RNA synthesized with a standard equimolar NTP mix indicating a lower immunostimulatory activity of the RNA resulting from the sequence-optimized NTP mix.
  • Example 11 In vitro transcription in a bioreactor
  • a DNA vector for in vitro transcription (PI 140) was prepared by insertion of the following elements into a DNA vector (pCV32(KanR)):
  • RNA construct is characterized by the following nucleotide composition:
  • the plasmid PI 140 was linearized using the following conditions:
  • reaction was incubated for 3 h at 37°C. Subsequently a phenol/chloroform extraction and an isopropanol precipitation were performed.
  • the same total NTP concentration of 13.45 mM as used in the standard transcription reaction is used for sequence-optimized transcription.
  • the fourfold amount of GTP is used for the Cap analog.
  • RNA concentration was measured by determining the absorption at 260 nm after LiCl precipitation.
  • the transcription reaction was incubated for 3h at 37°C.
  • the transcription reaction was incubated for 1.5 h at 37°C.
  • the transcription reaction was incubated for 1.5 h at 37°C.
  • HeLa cells were seeded at a density of 4xl0 5 per well in a 6-well plate in 2 ml HeLa cell culture medium consisting of Gibco® RPMI 1640 medium supplemented with 25 mM HEPES, 2 mM L-Glutamine and 100 IU/ml penicillin/streptomycin (all Lonza, Basel, Switzerland) and 10% fetal calf serum (Perbio Science, Bonn, Germany).
  • the cells were transfected with different concentrations of 2 g RNA or water-for-injection (WFI) as negative control using Lipofectamine® 2000 (Life Technologies, Darmstadt, Germany, catalog no.1 1668-027).
  • RNA Lipofectamine reagent and RNA were each diluted in Opti-MEM® medium (Life Technologies), combined in a ratio of RNA: Lipofectamine of 1 : 1.5 and incubated for 20 min at room temperature. Negative control contained WFI instead of RNA mixed with Lipofectamine2000.
  • the cells were washed once with 2 ml Gibco® RPMI 1640 medium supplemented with 25 mM HEPES and 2 mM L-Glutamine (serum- and penicillin/streptomycin free medium), 2 ml of the serum- and penicillin/streptomycin-free medium was added to the cells following by the addition of 0.5 ml RNA: Lipofectamine transfection mix. Upon incubation for 4 h at 37°C and 5% C0 2 , the medium containing the transfection mix was removed and 2 ml of the HeLa cell culture medium were added.
  • HA protein Surface expression of the HA protein was determined using flow cytometric analysis.
  • Adherent HeLa cells were washed once with 1ml PBS and harvested using trypsin-free detach buffer (40mM Tris HC1 pH 7,5; 150mM NaCl, ImM EDTA). The cells were incubated with mouse monoclonal anti-HA (H1N1) antibody (Immune Technology, New York, USA) followed by a secondary anti-mouse FITC-conjugated antibody (Sigma- Aldrich, Taufkirchen, Germany). The cells were measured on a BD FACS Canto and analyzed using FlowJo Software Version 10.6. Statistical analysis was performed using Graph Pad Prism Software, Version 5.01. Results:
  • RNA transcribed in a sequence-optimized reaction mix resulted in a higher expression of the encoded HA protein than RNA transcribed under standard conditions (Fig. 22, TS(1)).
  • IL-6, CXCLIO and CCL5 were measured in cell-free supernatants by cytometric bead array (CBA) according to the manufacturer's instructions (BD Biosciences) using the following kits:
  • RNA transcribed under standard conditions (Fig. 23, TSl) induced higher levels of the cytokines IL-6, CXCLIO and CCL5 in Hela cells compared to RNAs transcribed in a sequence-optimized reaction mix (Fig. 23, TS2, TS3, TS4).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Sustainable Development (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Clinical Laboratory Science (AREA)
  • Computer Hardware Design (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/EP2015/001164 2014-06-10 2015-06-10 Methods and means for enhancing rna production Ceased WO2015188933A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
CA2945629A CA2945629C (en) 2014-06-10 2015-06-10 Methods and means for enhancing rna production
ES15738263T ES2727776T3 (es) 2014-06-10 2015-06-10 Método para mejorar la producción de ARN
PL15738263T PL3155129T3 (pl) 2014-06-10 2015-06-10 Sposób zwiększania wytwarzania RNA
KR1020167035028A KR102459599B1 (ko) 2014-06-10 2015-06-10 Rna생산을 증진하는 방법 및 수단
AU2015273933A AU2015273933B2 (en) 2014-06-10 2015-06-10 Methods and means for enhancing RNA production
MX2016016170A MX382298B (es) 2014-06-10 2015-06-10 Métodos y medios para aumentar la producción de arn.
CN201580031536.2A CN106661621B (zh) 2014-06-10 2015-06-10 用于增强rna产生的方法和工具
RU2017100044A RU2738753C2 (ru) 2014-06-10 2015-06-10 Способы и средства повышения продуктивности рнк
EP18001012.6A EP3521456B1 (en) 2014-06-10 2015-06-10 Methods and means for enhancing rna production
BR112016026980-2A BR112016026980B1 (pt) 2014-06-10 2015-06-10 Método para sintetizar uma molécula de rna de uma dada sequência
SG11201608605QA SG11201608605QA (en) 2014-06-10 2015-06-10 Methods and means for enhancing rna production
EP15738263.1A EP3155129B1 (en) 2014-06-10 2015-06-10 Method for enhancing rna production
US15/317,579 US10837039B2 (en) 2014-06-10 2015-06-10 Methods and means for enhancing RNA production
JP2016572447A JP6748579B2 (ja) 2014-06-10 2015-06-10 Rna生成を強化する方法及び手段
US17/071,279 US20210040526A1 (en) 2014-06-10 2020-10-15 Methods and means for enhancing rna production
US18/582,620 US20240218412A1 (en) 2014-06-10 2024-02-20 Methods and means for enhancing rna production

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP2014001577 2014-06-10
EPPCT/EP2014/001577 2014-06-10

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/317,579 A-371-Of-International US10837039B2 (en) 2014-06-10 2015-06-10 Methods and means for enhancing RNA production
US17/071,279 Continuation US20210040526A1 (en) 2014-06-10 2020-10-15 Methods and means for enhancing rna production

Publications (1)

Publication Number Publication Date
WO2015188933A1 true WO2015188933A1 (en) 2015-12-17

Family

ID=51033109

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/001164 Ceased WO2015188933A1 (en) 2014-06-10 2015-06-10 Methods and means for enhancing rna production

Country Status (15)

Country Link
US (3) US10837039B2 (cg-RX-API-DMAC7.html)
EP (2) EP3155129B1 (cg-RX-API-DMAC7.html)
JP (1) JP6748579B2 (cg-RX-API-DMAC7.html)
KR (1) KR102459599B1 (cg-RX-API-DMAC7.html)
CN (1) CN106661621B (cg-RX-API-DMAC7.html)
AU (1) AU2015273933B2 (cg-RX-API-DMAC7.html)
BR (1) BR112016026980B1 (cg-RX-API-DMAC7.html)
CA (1) CA2945629C (cg-RX-API-DMAC7.html)
ES (1) ES2727776T3 (cg-RX-API-DMAC7.html)
MX (1) MX382298B (cg-RX-API-DMAC7.html)
PL (1) PL3155129T3 (cg-RX-API-DMAC7.html)
PT (1) PT3155129T (cg-RX-API-DMAC7.html)
RU (1) RU2738753C2 (cg-RX-API-DMAC7.html)
SG (1) SG11201608605QA (cg-RX-API-DMAC7.html)
WO (1) WO2015188933A1 (cg-RX-API-DMAC7.html)

Cited By (75)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017191264A1 (en) 2016-05-04 2017-11-09 Curevac Ag Nucleic acid molecules and uses thereof
WO2018053209A1 (en) 2016-09-14 2018-03-22 Modernatx, Inc. High purity rna compositions and methods for preparation thereof
WO2018115525A1 (en) 2016-12-23 2018-06-28 Curevac Ag Lassa virus vaccine
WO2018115527A2 (en) 2016-12-23 2018-06-28 Curevac Ag Mers coronavirus vaccine
WO2018115507A2 (en) 2016-12-23 2018-06-28 Curevac Ag Henipavirus vaccine
WO2018167320A1 (en) 2017-03-17 2018-09-20 Curevac Ag Rna vaccine and immune checkpoint inhibitors for combined anticancer therapy
WO2018211038A1 (en) 2017-05-17 2018-11-22 Curevac Ag Method for determining at least one quality parameter of an rna sample
EP3090060B1 (en) 2013-12-30 2019-02-20 CureVac AG Methods for rna analysis
WO2019038332A1 (en) 2017-08-22 2019-02-28 Curevac Ag VACCINE AGAINST BUNYAVIRUS
WO2019092153A1 (en) 2017-11-08 2019-05-16 Curevac Ag Rna sequence adaptation
WO2019115635A1 (en) 2017-12-13 2019-06-20 Curevac Ag Flavivirus vaccine
WO2019193183A2 (en) 2018-04-05 2019-10-10 Curevac Ag Novel yellow fever nucleic acid molecules for vaccination
WO2020002525A1 (en) 2018-06-27 2020-01-02 Curevac Ag Novel lassa virus rna molecules and compositions for vaccination
WO2020002598A1 (en) 2018-06-28 2020-01-02 Curevac Ag Bioreactor for rna in vitro transcription
WO2020128031A2 (en) 2018-12-21 2020-06-25 Curevac Ag Rna for malaria vaccines
WO2020185811A1 (en) * 2019-03-11 2020-09-17 Modernatx, Inc. Fed-batch in vitro transcription process
WO2020254535A1 (en) 2019-06-18 2020-12-24 Curevac Ag Rotavirus mrna vaccine
WO2021028439A1 (en) 2019-08-14 2021-02-18 Curevac Ag Rna combinations and compositions with decreased immunostimulatory properties
WO2021156267A1 (en) 2020-02-04 2021-08-12 Curevac Ag Coronavirus vaccine
WO2021229217A1 (en) * 2020-05-12 2021-11-18 Cranfield University A method and modular apparatus for the synthesis of rna-based therapeutics
WO2021239880A1 (en) 2020-05-29 2021-12-02 Curevac Ag Nucleic acid based combination vaccines
GB2597436A (en) * 2020-05-12 2022-02-02 Univ Cranfield A method and apparatus for RNA synthesis
WO2022023559A1 (en) 2020-07-31 2022-02-03 Curevac Ag Nucleic acid encoded antibody mixtures
US11248223B2 (en) 2015-12-23 2022-02-15 Curevac Ag Method of RNA in vitro transcription using a buffer containing a dicarboxylic acid or tricarboxylic acid or a salt thereof
WO2022043551A2 (en) 2020-08-31 2022-03-03 Curevac Ag Multivalent nucleic acid based coronavirus vaccines
WO2022049093A1 (en) 2020-09-01 2022-03-10 CureVac RNA Printer GmbH Manufacturing device for a pharmaceutical product
WO2022112498A1 (en) 2020-11-27 2022-06-02 CureVac RNA Printer GmbH A device for preparing a dna product by means of capillary polymerase chain reaction
WO2022122689A1 (en) * 2020-12-09 2022-06-16 BioNTech SE Rna manufacturing
WO2022137133A1 (en) 2020-12-22 2022-06-30 Curevac Ag Rna vaccine against sars-cov-2 variants
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
WO2022162027A2 (en) 2021-01-27 2022-08-04 Curevac Ag Method of reducing the immunostimulatory properties of in vitro transcribed rna
WO2022200575A1 (en) 2021-03-26 2022-09-29 Glaxosmithkline Biologicals Sa Immunogenic compositions
EP4107733A1 (en) * 2020-02-18 2022-12-28 Translate Bio, Inc. Improved processes for in vitro transcription of messenger rna
EP3521456B1 (en) 2014-06-10 2023-01-04 CureVac Manufacturing GmbH Methods and means for enhancing rna production
WO2023275217A1 (en) * 2021-06-30 2023-01-05 Etherna Immunotherapies Nv Method for rna manufacturing
US11560562B2 (en) * 2017-02-27 2023-01-24 Translate Bio, Inc. Large-scale synthesis of messenger RNA
WO2023007019A1 (en) 2021-07-30 2023-02-02 CureVac SE Cap analogs having an acyclic linker to the guanine derivative nucleobase
WO2023025404A1 (en) * 2021-08-24 2023-03-02 BioNTech SE In vitro transcription technologies
WO2023073228A1 (en) 2021-10-29 2023-05-04 CureVac SE Improved circular rna for expressing therapeutic proteins
US11661634B2 (en) 2015-05-08 2023-05-30 CureVac Manufacturing GmbH Method for producing RNA
US11667910B2 (en) 2015-05-29 2023-06-06 CureVac Manufacturing GmbH Method for producing and purifying RNA, comprising at least one step of tangential flow filtration
WO2023144330A1 (en) 2022-01-28 2023-08-03 CureVac SE Nucleic acid encoded transcription factor inhibitors
EP4227319A1 (en) 2018-04-17 2023-08-16 CureVac SE Novel rsv rna molecules and compositions for vaccination
WO2023166425A1 (en) 2022-03-01 2023-09-07 Crispr Therapeutics Ag Methods and compositions for treating angiopoietin-like 3 (angptl3) related conditions
WO2023180904A1 (en) 2022-03-21 2023-09-28 Crispr Therapeutics Ag Methods and compositions for treating lipoprotein-related diseases
US11786590B2 (en) 2015-11-09 2023-10-17 CureVac SE Rotavirus vaccines
WO2023227608A1 (en) 2022-05-25 2023-11-30 Glaxosmithkline Biologicals Sa Nucleic acid based vaccine encoding an escherichia coli fimh antigenic polypeptide
US11920148B2 (en) 2017-02-22 2024-03-05 Crispr Therapeutics Ag Compositions and methods for gene editing
WO2024068545A1 (en) 2022-09-26 2024-04-04 Glaxosmithkline Biologicals Sa Influenza virus vaccines
WO2024084089A1 (en) 2022-10-21 2024-04-25 BioNTech SE Methods and uses associated with liquid compositions
WO2024089638A1 (en) 2022-10-28 2024-05-02 Glaxosmithkline Biologicals Sa Nucleic acid based vaccine
WO2024089229A1 (en) 2022-10-28 2024-05-02 CureVac SE Improved formulations comprising lipid-based carriers encapsulating rna
GB202404607D0 (en) 2024-03-29 2024-05-15 Glaxosmithkline Biologicals Sa RNA formulation
WO2024160936A1 (en) 2023-02-03 2024-08-08 Glaxosmithkline Biologicals Sa Rna formulation
WO2024160895A1 (en) 2023-01-31 2024-08-08 CureVac SE Cap analogs with 5'-terminal acyclic guanosine derivative
WO2024171052A1 (en) 2023-02-14 2024-08-22 Glaxosmithkline Biologicals Sa Analytical method
WO2024223724A1 (en) 2023-04-27 2024-10-31 Glaxosmithkline Biologicals Sa Influenza virus vaccines
WO2024223728A1 (en) 2023-04-27 2024-10-31 Glaxosmithkline Biologicals Sa Influenza virus vaccines
US20240368654A1 (en) * 2021-06-07 2024-11-07 University Of Massachusetts Apparatus and method for continuous production of rna
WO2024235451A1 (en) 2023-05-16 2024-11-21 CureVac RNA Printer GmbH Improved rna in vitro transcription using dna beads
WO2024245907A1 (en) 2023-05-26 2024-12-05 CureVac SE Cancer antigens
WO2025022290A1 (en) 2023-07-21 2025-01-30 Crispr Therapeutics Ag Modulating expression of alas1 (5'-aminolevulinate synthase 1) gene
US12227549B2 (en) 2016-05-04 2025-02-18 CureVac SE RNA encoding a therapeutic protein
WO2025103803A1 (en) 2023-11-13 2025-05-22 CureVac SE Immunotherapy against neuronal and brain tumors
US12329811B2 (en) 2021-01-11 2025-06-17 Modernatx, Inc. Seasonal RNA influenza virus vaccines
WO2025132839A1 (en) 2023-12-21 2025-06-26 Glaxosmithkline Biologicals Sa Influenza virus vaccines
EP4136248A4 (en) * 2020-04-16 2025-07-23 Natures Toolbox Inc IN VITRO MANUFACTURE AND PURIFICATION OF THERAPEUTIC MRNA
GB2637389A (en) * 2023-11-24 2025-07-23 Univ Sheffield In vitro transcription method
WO2025181704A2 (en) 2024-02-27 2025-09-04 Crispr Therapeutics Ag Rt editing compositions and methods
WO2025186726A1 (en) 2024-03-05 2025-09-12 Crispr Therapeutics Ag Modulating expression of agt (angiotensinogen) gene
US12428577B2 (en) 2021-05-14 2025-09-30 Modernatx, Inc. Methods of monitoring in vitro transcription of mRNA and/or post-in vitro transcription processes
WO2025109302A3 (en) * 2023-11-24 2025-10-02 The University Of Sheffield In vitro transcription method
US12529047B1 (en) 2021-12-21 2026-01-20 Modernatx, Inc. mRNA quantification methods
US12600998B2 (en) 2020-10-15 2026-04-14 Translate Bio, Inc. Large scale synthesis of messenger RNA
US12618060B2 (en) 2021-03-15 2026-05-05 CureVac SE Nucleic acid molecules

Families Citing this family (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012019630A1 (en) 2010-08-13 2012-02-16 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded protein
WO2012116714A1 (en) 2011-03-02 2012-09-07 Curevac Gmbh Vaccination in elderly patients
RU2013154295A (ru) 2011-06-08 2015-07-20 Шир Хьюман Дженетик Терапис, Инк. КОМПОЗИЦИИ ЛИПИДНЫХ НАНОЧАСТИЦ И СПОСОБЫ ДЛЯ ДОСТАВКИ мРНК
WO2013120497A1 (en) 2012-02-15 2013-08-22 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded therapeutic protein
WO2013120499A1 (en) 2012-02-15 2013-08-22 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly (a) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen
MX362981B (es) 2012-03-27 2019-02-28 Curevac Ag Moleculas artificiales de acido nucleico para la expresion mejorada de proteina o peptido.
US9974845B2 (en) 2013-02-22 2018-05-22 Curevac Ag Combination of vaccination and inhibition of the PD-1 pathway
BR112015022855A2 (pt) 2013-03-14 2017-11-07 Shire Human Genetic Therapies composições e método para produção de um anticorpo in vitro
EP3388834B1 (en) 2013-03-15 2020-04-15 Translate Bio, Inc. Synergistic enhancement of the delivery of nucleic acids via blended formulations
BR112016003361A2 (pt) 2013-08-21 2017-11-21 Curevac Ag vacina do vírus sincicial respiratório (rsv)
BR112016001192A2 (pt) 2013-08-21 2017-08-29 Curevac Ag Vacina contra a raiva
AU2014310935B2 (en) 2013-08-21 2019-11-21 CureVac SE Combination vaccine
WO2015062738A1 (en) 2013-11-01 2015-05-07 Curevac Gmbh Modified rna with decreased immunostimulatory properties
SG11201604198YA (en) 2013-12-30 2016-07-28 Curevac Ag Methods for rna analysis
CA2927254C (en) 2013-12-30 2023-10-24 Curevac Ag Artificial nucleic acid molecules
CA2935878C (en) 2014-03-12 2023-05-02 Curevac Ag Combination of vaccination and ox40 agonists
US10369216B2 (en) 2014-04-01 2019-08-06 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
PT4023755T (pt) 2014-12-12 2023-07-05 CureVac SE Moléculas de ácido nucleico artificiais para uma expressão melhorada de proteína
EP4353257A3 (en) 2015-04-13 2024-08-07 CureVac Manufacturing GmbH Method for producing rna compositions
EP4026568A1 (en) 2015-04-17 2022-07-13 CureVac Real Estate GmbH Lyophilization of rna
ES2897823T3 (es) 2015-04-30 2022-03-02 Curevac Ag Poli(N)polimerasa inmovilizada
WO2016184822A1 (en) 2015-05-15 2016-11-24 Curevac Ag Prime-boost regimens involving administration of at least one mrna construct
EP3297682B1 (en) 2015-05-20 2021-07-14 CureVac AG Dry powder composition comprising long-chain rna
WO2016184575A1 (en) 2015-05-20 2016-11-24 Curevac Ag Dry powder composition comprising long-chain rna
EP3303575B1 (en) 2015-05-29 2022-03-16 CureVac AG Method for adding cap structures to rna using immobilized enzymes
US10501768B2 (en) 2015-07-13 2019-12-10 Curevac Ag Method of producing RNA from circular DNA and corresponding template DNA
WO2017036580A1 (en) 2015-08-28 2017-03-09 Curevac Ag Artificial nucleic acid molecules
US11225682B2 (en) 2015-10-12 2022-01-18 Curevac Ag Automated method for isolation, selection and/or detection of microorganisms or cells comprised in a solution
EP3701963A1 (en) 2015-12-22 2020-09-02 CureVac AG Method for producing rna molecule compositions
US12612654B2 (en) 2016-02-12 2026-04-28 CureVac SE Method for analyzing RNA
SG10201913630YA (en) 2016-02-17 2020-03-30 Curevac Ag Zika virus vaccine
US11920174B2 (en) 2016-03-03 2024-03-05 CureVac SE RNA analysis by total hydrolysis and quantification of released nucleosides
EP3825400B1 (en) 2016-04-08 2024-12-25 Translate Bio, Inc. Multimeric coding nucleic acid and uses thereof
EP3448427A1 (en) 2016-04-29 2019-03-06 CureVac AG Rna encoding an antibody
US12508308B2 (en) 2016-05-04 2025-12-30 CureVac SE Influenza mRNA vaccines
CN109475640B (zh) 2016-06-09 2023-03-10 库瑞瓦格欧洲公司 核酸被运载物的混合载运体
EP3469074B1 (en) 2016-06-13 2020-12-09 Translate Bio, Inc. Messenger rna therapy for the treatment of ornithine transcarbamylase deficiency
WO2018096179A1 (en) 2016-11-28 2018-05-31 Curevac Ag Method for purifying rna
WO2018104540A1 (en) 2016-12-08 2018-06-14 Curevac Ag Rnas for wound healing
EP3551230A1 (en) 2016-12-08 2019-10-16 CureVac AG Rna for treatment or prophylaxis of a liver disease
SG11201906297QA (en) 2017-03-24 2019-10-30 Curevac Ag Nucleic acids encoding crispr-associated proteins and uses thereof
WO2018191657A1 (en) 2017-04-13 2018-10-18 Acuitas Therapeutics, Inc. Lipids for delivery of active agents
US12474242B2 (en) * 2017-04-21 2025-11-18 The Board Of Trustees Of The Leland Stanford Junior University Exposome tracker for environmental health
WO2018195404A1 (en) * 2017-04-21 2018-10-25 The Board Of The Trustees Of The Leland Stanford Junior University Ultra-sensitive and universal species detection pipeline for next generation sequencing data
SG11201911430PA (en) 2017-07-04 2020-01-30 Curevac Ag Novel nucleic acid molecules
US11001868B2 (en) * 2017-08-11 2021-05-11 Global Life Sciences Solutions Operations UK Ltd Cell-free protein expression using double-stranded concatameric DNA
US11167043B2 (en) 2017-12-20 2021-11-09 Translate Bio, Inc. Composition and methods for treatment of ornithine transcarbamylase deficiency
CN111511928A (zh) 2017-12-21 2020-08-07 库瑞瓦格股份公司 偶联到单一支持物或标签的线性双链dna和用于制备所述线性双链dna的方法
TW202039534A (zh) 2018-12-14 2020-11-01 美商美國禮來大藥廠 KRAS變體mRNA分子
SG11202106666UA (en) 2018-12-21 2021-07-29 Curevac Ag Methods for rna analysis
US12359248B2 (en) 2019-04-24 2025-07-15 University Of Massachusetts Enzymatic methods to generate high yields of sequence specific RNAs with extreme precision
US11578348B2 (en) 2019-04-24 2023-02-14 The University Of Massachusetts Enzymatic methods to generate high yields of sequence specific rna with extreme precision
CN114901360A (zh) 2019-12-20 2022-08-12 库瑞瓦格股份公司 用于递送核酸的新型脂质纳米颗粒
US11241493B2 (en) 2020-02-04 2022-02-08 Curevac Ag Coronavirus vaccine
US12194089B2 (en) 2020-02-04 2025-01-14 CureVac SE Coronavirus vaccine
EP4208549A4 (en) 2020-09-04 2025-04-16 Verve Therapeutics, Inc. Compositions and methods for capping RNAs
CN116802267A (zh) 2020-10-23 2023-09-22 斯宾德尔生物科技公司 用于rna合成的组合物和方法
CN114717230B (zh) * 2021-01-05 2024-09-03 麦塞拿治疗(香港)有限公司 成纤维细胞生长因子mRNA的无细胞和无载体体外RNA转录方法和核酸分子
CN114717229B (zh) * 2021-01-05 2024-09-10 麦塞拿治疗(香港)有限公司 治疗性mRNA的无细胞和无载体体外RNA转录方法和核酸分子
TWI814499B (zh) * 2021-07-22 2023-09-01 中央研究院 用以連續製備及分析rna的裝置以及利用該裝置來合成rna的方法
CN116554995A (zh) * 2023-05-11 2023-08-08 北京沃森创新生物技术有限公司 mRNA连续体外转录反应系统和连续转录方法
WO2025035110A1 (en) * 2023-08-10 2025-02-13 Linearx, Inc. Compositions and methods for in vitro transcription
EP4574990A1 (en) * 2023-12-22 2025-06-25 Nederlandse Organisatie voor toegepast-natuurwetenschappelijk Onderzoek TNO Methods and systems for producing peptides and proteins
US12492420B2 (en) 2024-03-29 2025-12-09 New England Biolabs, Inc. Compositions, kits, and methods for in vitro transcription
WO2025217602A1 (en) * 2024-04-12 2025-10-16 Sartorius Bioanalytical Instruments, Inc. Systems and methods for rna transcription
WO2026015876A1 (en) * 2024-07-12 2026-01-15 Arcturus Therapeutics, Inc. Improved methods for in vitro transcription

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5256555A (en) 1991-12-20 1993-10-26 Ambion, Inc. Compositions and methods for increasing the yields of in vitro RNA transcription and other polynucleotide synthetic reactions
WO1995008626A1 (en) 1993-09-20 1995-03-30 The Regents Of The University Of Colorado Strategy for the production of rna from immobilized templates
WO2004022574A2 (de) * 2002-09-04 2004-03-18 Artus-Gesellschaft Für Molekularbiologische Diagnostik Und Entwicklung Mbh Verbesserte verfahren zur synthese von nukleinsäuren
WO2006004648A1 (en) 2004-06-29 2006-01-12 Ambion, Inc. Methods and compositions for preparing capped rna
US7074596B2 (en) 2002-03-25 2006-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse mRNA cap analogues
WO2008016473A2 (en) 2006-07-28 2008-02-07 Applera Corporation Dinucleotide mrna cap analogs
WO2008077592A1 (en) 2006-12-22 2008-07-03 Curevac Gmbh Method for purifying rna on a preparative scale by means of hplc
WO2008157688A2 (en) 2007-06-19 2008-12-24 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse phosphorothioate analogs of the messenger rna cap
WO2009095226A2 (en) 2008-01-31 2009-08-06 Curevac Gmbh Nucleic acids of formula (i) (nuglxmgnnv)a and derivatives thereof as an immunostimulating agent/adjuvant
WO2009149253A2 (en) 2008-06-06 2009-12-10 Uniwersytet Warszawski Mrna cap analogs
WO2011015347A1 (en) 2009-08-05 2011-02-10 Biontech Ag Vaccine composition comprising 5'-cap modified rna
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
WO2013059475A1 (en) 2011-10-18 2013-04-25 Life Technologies Corporation Alkynyl-derivatized cap analogs, preparation and uses thereof

Family Cites Families (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5434079A (en) 1993-02-12 1995-07-18 The United States Of America As Represented By The Department Of Health And Human Services Apparatus and process for continuous in vitro synthesis of proteins
ES2340499T3 (es) 2001-06-05 2010-06-04 Curevac Gmbh Arnm de antigeno tumoral estabilizado con un contenido de g/c aumentado.
DE10162480A1 (de) 2001-12-19 2003-08-07 Ingmar Hoerr Die Applikation von mRNA für den Einsatz als Therapeutikum gegen Tumorerkrankungen
DE10229872A1 (de) 2002-07-03 2004-01-29 Curevac Gmbh Immunstimulation durch chemisch modifizierte RNA
WO2005003395A1 (en) 2003-07-02 2005-01-13 Caliper Life Sciences, Inc. Method for amplifying and detecting nucleic acids in microfluidic devices under continuous and non-continuous flow conditions
DE10335833A1 (de) 2003-08-05 2005-03-03 Curevac Gmbh Transfektion von Blutzellen mit mRNA zur Immunstimulation und Gentherapie
DE102004042546A1 (de) 2004-09-02 2006-03-09 Curevac Gmbh Kombinationstherapie zur Immunstimulation
DE102005023170A1 (de) 2005-05-19 2006-11-23 Curevac Gmbh Optimierte Formulierung für mRNA
PL2578685T3 (pl) 2005-08-23 2020-01-31 The Trustees Of The University Of Pennsylvania Rna zawierający zmodyfikowane nukleozydy i sposoby jego zastosowania
DE102006035618A1 (de) 2006-07-31 2008-02-07 Curevac Gmbh Nukleinsäure der Formel (I): GlXmGn, insbesondere als immunstimulierendes Adjuvanz
DE102007001370A1 (de) 2007-01-09 2008-07-10 Curevac Gmbh RNA-kodierte Antikörper
WO2009030254A1 (en) 2007-09-04 2009-03-12 Curevac Gmbh Complexes of rna and cationic peptides for transfection and for immunostimulation
WO2009046739A1 (en) 2007-10-09 2009-04-16 Curevac Gmbh Composition for treating prostate cancer (pca)
WO2009046738A1 (en) 2007-10-09 2009-04-16 Curevac Gmbh Composition for treating lung cancer, particularly of non-small lung cancers (nsclc)
WO2010037408A1 (en) 2008-09-30 2010-04-08 Curevac Gmbh Composition comprising a complexed (m)rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof
US20110053829A1 (en) 2009-09-03 2011-03-03 Curevac Gmbh Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US20120208242A1 (en) * 2009-10-21 2012-08-16 Riboxx Gmbh Method and RNA Reactor for Exponential Amplification of RNA
WO2011069529A1 (en) 2009-12-09 2011-06-16 Curevac Gmbh Mannose-containing solution for lyophilization, transfection and/or injection of nucleic acids
KR101761388B1 (ko) 2010-07-30 2017-07-25 큐어백 아게 트랜스펙션 및 면역 자극을 위한 이황화-크로스링크된 양이온 성분 및 핵산의 복합체
WO2012019630A1 (en) 2010-08-13 2012-02-16 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded protein
WO2012089225A1 (en) 2010-12-29 2012-07-05 Curevac Gmbh Combination of vaccination and inhibition of mhc class i restricted antigen presentation
WO2012116715A1 (en) 2011-03-02 2012-09-07 Curevac Gmbh Vaccination in newborns and infants
WO2012113413A1 (en) 2011-02-21 2012-08-30 Curevac Gmbh Vaccine composition comprising complexed immunostimulatory nucleic acids and antigens packaged with disulfide-linked polyethyleneglycol/peptide conjugates
WO2012116714A1 (en) 2011-03-02 2012-09-07 Curevac Gmbh Vaccination in elderly patients
US9388373B2 (en) 2011-03-08 2016-07-12 University Of Maryland Baltimore County Microscale bioprocessing system and method for protein manufacturing
RU2013154295A (ru) 2011-06-08 2015-07-20 Шир Хьюман Дженетик Терапис, Инк. КОМПОЗИЦИИ ЛИПИДНЫХ НАНОЧАСТИЦ И СПОСОБЫ ДЛЯ ДОСТАВКИ мРНК
WO2013003475A1 (en) * 2011-06-27 2013-01-03 Cellscript, Inc. Inhibition of innate immune response
EP2623121A1 (en) 2012-01-31 2013-08-07 Bayer Innovation GmbH Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen
WO2013113325A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Negatively charged nucleic acid comprising complexes for immunostimulation
WO2013113326A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen
WO2013120500A1 (en) 2012-02-15 2013-08-22 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded tumour antigen
WO2013120499A1 (en) 2012-02-15 2013-08-22 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly (a) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen
WO2013120498A1 (en) 2012-02-15 2013-08-22 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded allergenic antigen or an autoimmune self-antigen
WO2013120497A1 (en) 2012-02-15 2013-08-22 Curevac Gmbh Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded therapeutic protein
WO2013143700A2 (en) 2012-03-27 2013-10-03 Curevac Gmbh Artificial nucleic acid molecules comprising a 5'top utr
SG11201405542UA (en) 2012-03-27 2014-10-30 Curevac Gmbh Artificial nucleic acid molecules
MX362981B (es) 2012-03-27 2019-02-28 Curevac Ag Moleculas artificiales de acido nucleico para la expresion mejorada de proteina o peptido.
WO2013151665A2 (en) * 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of proteins associated with human disease
WO2013174409A1 (en) 2012-05-25 2013-11-28 Curevac Gmbh Reversible immobilization and/or controlled release of nucleic acid containing nanoparticles by (biodegradable) polymer coatings
US9974845B2 (en) 2013-02-22 2018-05-22 Curevac Ag Combination of vaccination and inhibition of the PD-1 pathway
MY174677A (en) 2013-08-21 2020-05-06 Curevac Ag Composition and vaccine for treating lung cancer
KR102354389B1 (ko) 2013-08-21 2022-01-20 큐어백 아게 Rna―암호화된 단백질의 발현을 증가시키는 방법
AU2014310935B2 (en) 2013-08-21 2019-11-21 CureVac SE Combination vaccine
RU2016109938A (ru) 2013-08-21 2017-09-26 Куревак Аг Композиция и вакцина для лечения рака предстательной железы
BR112016003361A2 (pt) 2013-08-21 2017-11-21 Curevac Ag vacina do vírus sincicial respiratório (rsv)
BR112016001192A2 (pt) 2013-08-21 2017-08-29 Curevac Ag Vacina contra a raiva
WO2015062738A1 (en) 2013-11-01 2015-05-07 Curevac Gmbh Modified rna with decreased immunostimulatory properties
SG11201604198YA (en) 2013-12-30 2016-07-28 Curevac Ag Methods for rna analysis
CN111304231A (zh) 2013-12-30 2020-06-19 库瑞瓦格股份公司 人工核酸分子
CA2927254C (en) 2013-12-30 2023-10-24 Curevac Ag Artificial nucleic acid molecules
CA2935878C (en) 2014-03-12 2023-05-02 Curevac Ag Combination of vaccination and ox40 agonists
US10369216B2 (en) 2014-04-01 2019-08-06 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
EP3155129B1 (en) 2014-06-10 2019-01-16 CureVac AG Method for enhancing rna production
PT4023755T (pt) 2014-12-12 2023-07-05 CureVac SE Moléculas de ácido nucleico artificiais para uma expressão melhorada de proteína
EP3233113A1 (en) 2014-12-16 2017-10-25 CureVac AG Ebolavirus and marburgvirus vaccines
EP3240558A1 (en) 2014-12-30 2017-11-08 CureVac AG Artificial nucleic acid molecules
CN108064176A (zh) 2015-04-22 2018-05-22 库瑞瓦格股份公司 用于治疗肿瘤疾病的含有rna的组合物
WO2016180430A1 (en) 2015-05-08 2016-11-17 Curevac Ag Method for producing rna

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5256555A (en) 1991-12-20 1993-10-26 Ambion, Inc. Compositions and methods for increasing the yields of in vitro RNA transcription and other polynucleotide synthetic reactions
US6586218B2 (en) 1991-12-20 2003-07-01 Ambion, Inc. Compositions and methods for increasing the yields of in vitro RNA transcription and other polynucleotide synthetic reactions
WO1995008626A1 (en) 1993-09-20 1995-03-30 The Regents Of The University Of Colorado Strategy for the production of rna from immobilized templates
US7074596B2 (en) 2002-03-25 2006-07-11 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse mRNA cap analogues
WO2004022574A2 (de) * 2002-09-04 2004-03-18 Artus-Gesellschaft Für Molekularbiologische Diagnostik Und Entwicklung Mbh Verbesserte verfahren zur synthese von nukleinsäuren
WO2006004648A1 (en) 2004-06-29 2006-01-12 Ambion, Inc. Methods and compositions for preparing capped rna
WO2008016473A2 (en) 2006-07-28 2008-02-07 Applera Corporation Dinucleotide mrna cap analogs
WO2008077592A1 (en) 2006-12-22 2008-07-03 Curevac Gmbh Method for purifying rna on a preparative scale by means of hplc
WO2008157688A2 (en) 2007-06-19 2008-12-24 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Synthesis and use of anti-reverse phosphorothioate analogs of the messenger rna cap
WO2009095226A2 (en) 2008-01-31 2009-08-06 Curevac Gmbh Nucleic acids of formula (i) (nuglxmgnnv)a and derivatives thereof as an immunostimulating agent/adjuvant
WO2009149253A2 (en) 2008-06-06 2009-12-10 Uniwersytet Warszawski Mrna cap analogs
WO2011015347A1 (en) 2009-08-05 2011-02-10 Biontech Ag Vaccine composition comprising 5'-cap modified rna
WO2013052523A1 (en) 2011-10-03 2013-04-11 modeRNA Therapeutics Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
WO2013059475A1 (en) 2011-10-18 2013-04-25 Life Technologies Corporation Alkynyl-derivatized cap analogs, preparation and uses thereof

Non-Patent Citations (31)

* Cited by examiner, † Cited by third party
Title
ARNDT-JOVIN ET AL., EUR. J. BIOCHEM., vol. 54, no. 2, 1975, pages 411 - 8
BRUNELLE ET AL., METHODS ENZYMOL., vol. 530, 2013, pages 101 - 14
CUNNINGHAM; OFENGAND, BIOTECHNIQUES, vol. 9, no. 6, 1990, pages 713 - 4
ESTELLER, NAT. REV. GENET, vol. 12, no. 12, 2011, pages 861 - 74
ESTELLER, NAT. REV. GENET., vol. 12, no. 12, 2011, pages 861 - 74
FOTIN-MLECZEK ET AL., J. GENE MED., vol. 14, no. 6, 2012, pages 428 - 439
GALLAGHER, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, vol. 93, 2011
GEALL ET AL., SEMIN. IMMUNOL., vol. 25, no. 2, 2013, pages 152 - 159
GUREVICH ET AL., ANAL. BIOCHEM., vol. 195, no. 2, 1991, pages 207 - 13
J.A. KERN ET AL: "Application of Solution Equilibrium Analysis to in Vitro RNA Transcription", BIOTECHNOLOGY PROGRESS, vol. 13, no. 6, 2 December 1997 (1997-12-02), pages 747 - 756, XP055162001, ISSN: 8756-7938, DOI: 10.1021/bp970094p *
KARIKO ET AL., MOL. THER., vol. 20, no. 5, 2012, pages 948 - 953
KARIKO ET AL., NUCLEIC ACIDS RES., vol. 39, no. 21, 2011, pages E142
KERN ET AL., BIOTECHNOL. PROG, vol. 15, 1999, pages 174 - 184
KERN ET AL., BIOTECHNOL. PROG., vol. 13, 1997, pages 747 - 756
KERN ET AL., BIOTECHNOL. PROG., vol. 15, 1999, pages 174 - 184
KERN; DAVIS, BIOTECHNOL. PROG., vol. 13, 1997, pages 747 - 756
KERRIGAN ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, vol. 24, 2001
KOLITZ ET AL., METHODS ENZYMOL., vol. 530, 2013, pages 331 - 6
KORE ET AL., BIOORG. MED. CHEM., vol. 21, no. 15, 2013, pages 4570 - 4
KORMANN ET AL., NAT. BIOTECHNOL., vol. 29, no. 2, 2012, pages 154 - 157
LAI ET AL., DEVELOPMENT, vol. 121, 1995, pages 2349 - 2360
MEYLAN; TSCHOPP, MOL. CELL, vol. 22, 2006, pages 561 - 569
MEZEI; STORTS: "PCR Technology: Current Innovation", 2001, CRC PRESS, article "Purification of PCR Products"
MILLIGAN ET AL., NUCLEIC ACID RES., vol. 15, no. 21, 1987, pages 8783 - 8798
SAMPSON; UHLENBECK, PROC. NATL. ACAD. SCI. USA, vol. 85, no. 4, 1988, pages 1033 - 7
STEPINSKI ET AL., RNA, vol. 7, no. 10, 2001, pages 1486 - 95
TCHEREPANOVA ET AL., BMC MOL. BIOL., vol. 9, 2008, pages 90
TRIANA-ALONSO ET AL., JBC, vol. 270, no. 11, 1995, pages 6298 - 6307
VAN DE MERBEL, J. CHROMATOGR. A, vol. 856, no. 1-2, 1999, pages 55 - 82
VANDER VEEN ET AL.: "Alphavirus replicon vaccines", ANIMAL HEALTH RESEARCH REVIEWS, 2012, pages 1 - 9, XP009166113, DOI: doi:10.1017/S1466252312000011
WEITZMANN ET AL., NUCLEIC ACIDS RES., vol. 18, no. 12, 1990, pages 3515 - 20

Cited By (118)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3090060B1 (en) 2013-12-30 2019-02-20 CureVac AG Methods for rna analysis
EP3521456B1 (en) 2014-06-10 2023-01-04 CureVac Manufacturing GmbH Methods and means for enhancing rna production
US11661634B2 (en) 2015-05-08 2023-05-30 CureVac Manufacturing GmbH Method for producing RNA
US12221605B2 (en) 2015-05-29 2025-02-11 CureVac Manufacturing GmbH Method for producing and purifying RNA, comprising at least one step of tangential flow filtration
US11760992B2 (en) 2015-05-29 2023-09-19 CureVac Manufacturing GmbH Method for producing and purifying RNA, comprising at least one step of tangential flow filtration
US11667910B2 (en) 2015-05-29 2023-06-06 CureVac Manufacturing GmbH Method for producing and purifying RNA, comprising at least one step of tangential flow filtration
US11834651B2 (en) 2015-05-29 2023-12-05 CureVac Manufacturing GmbH Method for producing and purifying RNA, comprising at least one step of tangential flow filtration
US11786590B2 (en) 2015-11-09 2023-10-17 CureVac SE Rotavirus vaccines
US12318444B2 (en) 2015-11-09 2025-06-03 Cure Vac SE Rotavirus vaccines
US11248223B2 (en) 2015-12-23 2022-02-15 Curevac Ag Method of RNA in vitro transcription using a buffer containing a dicarboxylic acid or tricarboxylic acid or a salt thereof
US12168050B2 (en) 2016-05-04 2024-12-17 CureVac SE Compositions comprising a norovirus nucleic acid and methods of use thereof
EP4477662A2 (en) 2016-05-04 2024-12-18 CureVac SE Nucleic acid molecules and uses thereof
US12514918B2 (en) 2016-05-04 2026-01-06 CureVac SE Nucleic acid molecules and uses thereof
WO2017191264A1 (en) 2016-05-04 2017-11-09 Curevac Ag Nucleic acid molecules and uses thereof
US12527856B2 (en) 2016-05-04 2026-01-20 CureVac SE Artificial RNA molecules encoding a norovirus antigen and uses thereof
US12227549B2 (en) 2016-05-04 2025-02-18 CureVac SE RNA encoding a therapeutic protein
EP4696703A2 (en) 2016-05-04 2026-02-18 CureVac SE Nucleic acid molecules and uses thereof
US12246029B2 (en) 2016-09-14 2025-03-11 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
US20180363019A1 (en) * 2016-09-14 2018-12-20 Modernatx, Inc. High purity rna compositions and methods for preparation thereof
US10653712B2 (en) * 2016-09-14 2020-05-19 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
JP7566710B2 (ja) 2016-09-14 2024-10-15 モデルナティエックス インコーポレイテッド 高純度rna組成物及びその調製のための方法
AU2017326423B2 (en) * 2016-09-14 2023-11-09 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
EP4166666A1 (en) * 2016-09-14 2023-04-19 ModernaTX, Inc. High purity rna compositions and methods for preparation thereof
WO2018053209A1 (en) 2016-09-14 2018-03-22 Modernatx, Inc. High purity rna compositions and methods for preparation thereof
US12233084B2 (en) 2016-09-14 2025-02-25 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
JP2019533476A (ja) * 2016-09-14 2019-11-21 モデルナティーエックス, インコーポレイテッド 高純度rna組成物及びその調製のための方法
US11202793B2 (en) 2016-09-14 2021-12-21 Modernatx, Inc. High purity RNA compositions and methods for preparation thereof
JP2022000458A (ja) * 2016-09-14 2022-01-04 モデルナティーエックス, インコーポレイテッド 高純度rna組成物及びその調製のための方法
EP3512944B1 (en) * 2016-09-14 2022-07-06 ModernaTX, Inc. High purity rna compositions and methods for preparation thereof
CN109937253B (zh) * 2016-09-14 2023-06-30 摩登纳特斯有限公司 高纯度rna组合物及其制备方法
CN109937253A (zh) * 2016-09-14 2019-06-25 摩登纳特斯有限公司 高纯度rna组合物及其制备方法
JP2025032068A (ja) * 2016-09-14 2025-03-11 モデルナティエックス インコーポレイテッド 高純度rna組成物及びその調製のための方法
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
US11865084B2 (en) 2016-12-23 2024-01-09 CureVac SE MERS coronavirus vaccine
WO2018115507A2 (en) 2016-12-23 2018-06-28 Curevac Ag Henipavirus vaccine
WO2018115527A2 (en) 2016-12-23 2018-06-28 Curevac Ag Mers coronavirus vaccine
WO2018115525A1 (en) 2016-12-23 2018-06-28 Curevac Ag Lassa virus vaccine
US11920148B2 (en) 2017-02-22 2024-03-05 Crispr Therapeutics Ag Compositions and methods for gene editing
US11560562B2 (en) * 2017-02-27 2023-01-24 Translate Bio, Inc. Large-scale synthesis of messenger RNA
US20240018514A1 (en) * 2017-02-27 2024-01-18 Translate Bio, Inc. Large-scale synthesis of messenger rna
WO2018167320A1 (en) 2017-03-17 2018-09-20 Curevac Ag Rna vaccine and immune checkpoint inhibitors for combined anticancer therapy
WO2018211038A1 (en) 2017-05-17 2018-11-22 Curevac Ag Method for determining at least one quality parameter of an rna sample
WO2019038332A1 (en) 2017-08-22 2019-02-28 Curevac Ag VACCINE AGAINST BUNYAVIRUS
WO2019092153A1 (en) 2017-11-08 2019-05-16 Curevac Ag Rna sequence adaptation
WO2019115635A1 (en) 2017-12-13 2019-06-20 Curevac Ag Flavivirus vaccine
WO2019193183A2 (en) 2018-04-05 2019-10-10 Curevac Ag Novel yellow fever nucleic acid molecules for vaccination
EP4227319A1 (en) 2018-04-17 2023-08-16 CureVac SE Novel rsv rna molecules and compositions for vaccination
WO2020002525A1 (en) 2018-06-27 2020-01-02 Curevac Ag Novel lassa virus rna molecules and compositions for vaccination
WO2020002598A1 (en) 2018-06-28 2020-01-02 Curevac Ag Bioreactor for rna in vitro transcription
EP4273266A2 (en) 2018-06-28 2023-11-08 CureVac RNA Printer GmbH Bioreactor for rna in vitro transcription
WO2020128031A2 (en) 2018-12-21 2020-06-25 Curevac Ag Rna for malaria vaccines
US12460259B2 (en) 2019-03-11 2025-11-04 Modernatx, Inc. Fed-batch in vitro transcription process
WO2020185811A1 (en) * 2019-03-11 2020-09-17 Modernatx, Inc. Fed-batch in vitro transcription process
WO2020254535A1 (en) 2019-06-18 2020-12-24 Curevac Ag Rotavirus mrna vaccine
WO2021028439A1 (en) 2019-08-14 2021-02-18 Curevac Ag Rna combinations and compositions with decreased immunostimulatory properties
WO2021156267A1 (en) 2020-02-04 2021-08-12 Curevac Ag Coronavirus vaccine
DE202021004130U1 (de) 2020-02-04 2022-10-26 Curevac Ag Coronavirus-Vakzine
DE202021004123U1 (de) 2020-02-04 2022-10-26 Curevac Ag Coronavirus-Vakzine
DE202021003575U1 (de) 2020-02-04 2022-01-17 Curevac Ag Coronavirus-Vakzine
DE112021000012T5 (de) 2020-02-04 2021-11-18 Curevac Ag Coronavirus-Vakzine
EP4147717A1 (en) 2020-02-04 2023-03-15 CureVac SE Coronavirus vaccine
DE112021000012C5 (de) 2020-02-04 2024-11-14 CureVac SE Coronavirus-Vakzine
DE112021000012C9 (de) 2020-02-04 2025-02-06 CureVac SE Coronavirus-Vakzine
EP4107733A1 (en) * 2020-02-18 2022-12-28 Translate Bio, Inc. Improved processes for in vitro transcription of messenger rna
EP4136248A4 (en) * 2020-04-16 2025-07-23 Natures Toolbox Inc IN VITRO MANUFACTURE AND PURIFICATION OF THERAPEUTIC MRNA
GB2597436A (en) * 2020-05-12 2022-02-02 Univ Cranfield A method and apparatus for RNA synthesis
WO2021229217A1 (en) * 2020-05-12 2021-11-18 Cranfield University A method and modular apparatus for the synthesis of rna-based therapeutics
GB2597436B (en) * 2020-05-12 2025-03-26 Makatsoris Charalampos A method and apparatus for RNA synthesis
WO2021239880A1 (en) 2020-05-29 2021-12-02 Curevac Ag Nucleic acid based combination vaccines
WO2022023559A1 (en) 2020-07-31 2022-02-03 Curevac Ag Nucleic acid encoded antibody mixtures
WO2022043551A2 (en) 2020-08-31 2022-03-03 Curevac Ag Multivalent nucleic acid based coronavirus vaccines
WO2022049093A1 (en) 2020-09-01 2022-03-10 CureVac RNA Printer GmbH Manufacturing device for a pharmaceutical product
US12600998B2 (en) 2020-10-15 2026-04-14 Translate Bio, Inc. Large scale synthesis of messenger RNA
EP4729174A2 (en) 2020-11-27 2026-04-22 CureVac Manufacturing GmbH A device for preparing a dna product by means of capillary polymerase chain reaction
WO2022112498A1 (en) 2020-11-27 2022-06-02 CureVac RNA Printer GmbH A device for preparing a dna product by means of capillary polymerase chain reaction
WO2022122689A1 (en) * 2020-12-09 2022-06-16 BioNTech SE Rna manufacturing
WO2022137133A1 (en) 2020-12-22 2022-06-30 Curevac Ag Rna vaccine against sars-cov-2 variants
US11918643B2 (en) 2020-12-22 2024-03-05 CureVac SE RNA vaccine against SARS-CoV-2 variants
US11872280B2 (en) 2020-12-22 2024-01-16 CureVac SE RNA vaccine against SARS-CoV-2 variants
US12329811B2 (en) 2021-01-11 2025-06-17 Modernatx, Inc. Seasonal RNA influenza virus vaccines
WO2022162027A2 (en) 2021-01-27 2022-08-04 Curevac Ag Method of reducing the immunostimulatory properties of in vitro transcribed rna
US12618060B2 (en) 2021-03-15 2026-05-05 CureVac SE Nucleic acid molecules
WO2022200575A1 (en) 2021-03-26 2022-09-29 Glaxosmithkline Biologicals Sa Immunogenic compositions
US12428577B2 (en) 2021-05-14 2025-09-30 Modernatx, Inc. Methods of monitoring in vitro transcription of mRNA and/or post-in vitro transcription processes
US20240368654A1 (en) * 2021-06-07 2024-11-07 University Of Massachusetts Apparatus and method for continuous production of rna
WO2023275217A1 (en) * 2021-06-30 2023-01-05 Etherna Immunotherapies Nv Method for rna manufacturing
WO2023007019A1 (en) 2021-07-30 2023-02-02 CureVac SE Cap analogs having an acyclic linker to the guanine derivative nucleobase
US12305210B2 (en) 2021-08-24 2025-05-20 BioNTech SE In vitro transcription technologies
WO2023025404A1 (en) * 2021-08-24 2023-03-02 BioNTech SE In vitro transcription technologies
WO2023073228A1 (en) 2021-10-29 2023-05-04 CureVac SE Improved circular rna for expressing therapeutic proteins
US12529047B1 (en) 2021-12-21 2026-01-20 Modernatx, Inc. mRNA quantification methods
WO2023144330A1 (en) 2022-01-28 2023-08-03 CureVac SE Nucleic acid encoded transcription factor inhibitors
US12037616B2 (en) 2022-03-01 2024-07-16 Crispr Therapeutics Ag Methods and compositions for treating angiopoietin-like 3 (ANGPTL3) related conditions
WO2023166425A1 (en) 2022-03-01 2023-09-07 Crispr Therapeutics Ag Methods and compositions for treating angiopoietin-like 3 (angptl3) related conditions
WO2023180904A1 (en) 2022-03-21 2023-09-28 Crispr Therapeutics Ag Methods and compositions for treating lipoprotein-related diseases
WO2023227608A1 (en) 2022-05-25 2023-11-30 Glaxosmithkline Biologicals Sa Nucleic acid based vaccine encoding an escherichia coli fimh antigenic polypeptide
WO2024068545A1 (en) 2022-09-26 2024-04-04 Glaxosmithkline Biologicals Sa Influenza virus vaccines
WO2024083345A1 (en) 2022-10-21 2024-04-25 BioNTech SE Methods and uses associated with liquid compositions
WO2024084089A1 (en) 2022-10-21 2024-04-25 BioNTech SE Methods and uses associated with liquid compositions
US12186389B2 (en) 2022-10-28 2025-01-07 Glaxosmithkline Biologicals Sa Nucleic acid base vaccine against emerging SARS-CoV-2 variants
WO2024089229A1 (en) 2022-10-28 2024-05-02 CureVac SE Improved formulations comprising lipid-based carriers encapsulating rna
WO2024089638A1 (en) 2022-10-28 2024-05-02 Glaxosmithkline Biologicals Sa Nucleic acid based vaccine
WO2024160895A1 (en) 2023-01-31 2024-08-08 CureVac SE Cap analogs with 5'-terminal acyclic guanosine derivative
WO2024160936A1 (en) 2023-02-03 2024-08-08 Glaxosmithkline Biologicals Sa Rna formulation
WO2024171052A1 (en) 2023-02-14 2024-08-22 Glaxosmithkline Biologicals Sa Analytical method
WO2024223728A1 (en) 2023-04-27 2024-10-31 Glaxosmithkline Biologicals Sa Influenza virus vaccines
WO2024223724A1 (en) 2023-04-27 2024-10-31 Glaxosmithkline Biologicals Sa Influenza virus vaccines
WO2024235451A1 (en) 2023-05-16 2024-11-21 CureVac RNA Printer GmbH Improved rna in vitro transcription using dna beads
WO2024245907A1 (en) 2023-05-26 2024-12-05 CureVac SE Cancer antigens
WO2025022290A1 (en) 2023-07-21 2025-01-30 Crispr Therapeutics Ag Modulating expression of alas1 (5'-aminolevulinate synthase 1) gene
WO2025103803A1 (en) 2023-11-13 2025-05-22 CureVac SE Immunotherapy against neuronal and brain tumors
GB2637389A (en) * 2023-11-24 2025-07-23 Univ Sheffield In vitro transcription method
WO2025109302A3 (en) * 2023-11-24 2025-10-02 The University Of Sheffield In vitro transcription method
WO2025132839A1 (en) 2023-12-21 2025-06-26 Glaxosmithkline Biologicals Sa Influenza virus vaccines
WO2025181704A2 (en) 2024-02-27 2025-09-04 Crispr Therapeutics Ag Rt editing compositions and methods
WO2025186726A1 (en) 2024-03-05 2025-09-12 Crispr Therapeutics Ag Modulating expression of agt (angiotensinogen) gene
WO2025202360A1 (en) 2024-03-29 2025-10-02 Glaxosmithkline Biologicals Sa Rna formulation
GB202404607D0 (en) 2024-03-29 2024-05-15 Glaxosmithkline Biologicals Sa RNA formulation

Also Published As

Publication number Publication date
ES2727776T3 (es) 2019-10-18
MX382298B (es) 2025-03-12
RU2017100044A (ru) 2018-07-18
JP2017517266A (ja) 2017-06-29
EP3521456A1 (en) 2019-08-07
RU2017100044A3 (cg-RX-API-DMAC7.html) 2018-09-20
US20240218412A1 (en) 2024-07-04
EP3521456B1 (en) 2023-01-04
PT3155129T (pt) 2019-05-16
CN106661621B (zh) 2020-11-03
CN106661621A (zh) 2017-05-10
BR112016026980B1 (pt) 2022-05-03
KR102459599B1 (ko) 2022-10-26
US10837039B2 (en) 2020-11-17
BR112016026980A2 (pt) 2017-10-31
US20170114378A1 (en) 2017-04-27
CA2945629A1 (en) 2015-12-17
JP6748579B2 (ja) 2020-09-02
EP3155129A1 (en) 2017-04-19
EP3155129B1 (en) 2019-01-16
AU2015273933A1 (en) 2016-11-03
CA2945629C (en) 2023-08-22
US20210040526A1 (en) 2021-02-11
MX2016016170A (es) 2017-03-28
SG11201608605QA (en) 2016-12-29
AU2015273933B2 (en) 2021-02-11
PL3155129T3 (pl) 2019-09-30
RU2738753C2 (ru) 2020-12-16
KR20170010797A (ko) 2017-02-01

Similar Documents

Publication Publication Date Title
US20240218412A1 (en) Methods and means for enhancing rna production
US20230313268A1 (en) Methods for rna analysis
US20220119795A1 (en) Method of rna in vitro transcription using a buffer containing a dicarboxylic acid or tricarboxylic acid or a salt thereof
EP3317424B1 (en) Method for analysis of an rna molecule
US20190049414A1 (en) Method for analyzing by-products of rna in vitro transcription
EP3423595A1 (en) Rna analysis by total hydrolysis
WO2017009376A1 (en) Method of producing rna from circular dna and corresponding template dna
EP3090060B2 (en) Methods for rna analysis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15738263

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2945629

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2015738263

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015738263

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2015273933

Country of ref document: AU

Date of ref document: 20150610

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016026980

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: MX/A/2016/016170

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2016572447

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15317579

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20167035028

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017100044

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112016026980

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20161117