WO2015032755A1 - Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia - Google Patents

Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia Download PDF

Info

Publication number
WO2015032755A1
WO2015032755A1 PCT/EP2014/068619 EP2014068619W WO2015032755A1 WO 2015032755 A1 WO2015032755 A1 WO 2015032755A1 EP 2014068619 W EP2014068619 W EP 2014068619W WO 2015032755 A1 WO2015032755 A1 WO 2015032755A1
Authority
WO
WIPO (PCT)
Prior art keywords
virus
newcastle disease
ndv
disease virus
attenuated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2014/068619
Other languages
English (en)
French (fr)
Inventor
Xing Chen
Danielle CARROLL
Matthew Mccourt
Mark GALINSKI
Hong Jin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MedImmune Ltd
Original Assignee
MedImmune Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES14761317T priority Critical patent/ES2708755T3/es
Priority to MX2016002771A priority patent/MX367768B/es
Priority to CA2922071A priority patent/CA2922071C/en
Priority to PL14761317T priority patent/PL3041490T3/pl
Priority to HRP20190250TT priority patent/HRP20190250T1/hr
Priority to EP14761317.8A priority patent/EP3041490B1/en
Priority to SI201431082T priority patent/SI3041490T1/sl
Priority to CN201480048630.4A priority patent/CN106163532B/zh
Priority to HK17105137.4A priority patent/HK1231393A1/zh
Priority to US14/916,102 priority patent/US10519426B2/en
Priority to DK14761317.8T priority patent/DK3041490T3/en
Priority to SM20190094T priority patent/SMT201900094T1/it
Priority to MEP-2019-40A priority patent/ME03345B/me
Priority to KR1020217012332A priority patent/KR102310692B1/ko
Priority to RS20190176A priority patent/RS58332B1/sr
Application filed by MedImmune Ltd filed Critical MedImmune Ltd
Priority to KR1020167008307A priority patent/KR102285894B1/ko
Priority to AU2014317215A priority patent/AU2014317215C1/en
Priority to EA201690425A priority patent/EA039404B1/ru
Priority to JP2016537333A priority patent/JP6557234B2/ja
Priority to EP22160157.8A priority patent/EP4101457A1/en
Priority to LTEP14761317.8T priority patent/LT3041490T/lt
Priority to EP18188565.8A priority patent/EP3508209B1/en
Priority to PL18188565T priority patent/PL3508209T3/pl
Publication of WO2015032755A1 publication Critical patent/WO2015032755A1/en
Anticipated expiration legal-status Critical
Priority to CY20191100170T priority patent/CY1121993T1/el
Priority to AU2019204419A priority patent/AU2019204419B2/en
Priority to US16/684,241 priority patent/US11471499B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/768Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/155Paramyxoviridae, e.g. parainfluenza virus
    • A61K39/17Newcastle disease virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/53Colony-stimulating factor [CSF]
    • C07K14/535Granulocyte CSF; Granulocyte-macrophage CSF
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C12N7/04Inactivation or attenuation; Producing viral sub-units
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16141Use of virus, viral particle or viral elements as a vector
    • C12N2710/16143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18132Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18133Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18141Use of virus, viral particle or viral elements as a vector
    • C12N2760/18143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Newcastle disease virus is an avian virus causing a contagious bird disease affecting many domestic and wild avian species. Exposure of humans to infected birds (e.g. , in poultry processing plants) can cause mild conjunctivitis and influenza-like symptoms, but NDV otherwise poses no hazard to human health and most people are seronegative for NDV. Based on viral pathogenicity in chickens, NDV pathogenicity is classified as high
  • the Select Agents and Toxin List includes biological agents having the potential to pose a severe threat to human and animal health, to plant health, or to animal and plant products
  • NDV Naturally occurring forms of NDV have been used in clinical studies as an immunotherapeutic and virotherapeutic biologic. NDV shows promise as an anticancer agent because of the virus' ability to selectively kill human tumor cells with limited toxicity to normal cells. However, due to the reclassification of NDV as a select agent, the development of NDV as an anti-cancer agent has failed to progress. Other oncolytic viruses have shown considerable promise in clinical trials. To facilitate the development of NDV as a cancer therapy, new forms of the virus are required. Ideally, such new forms would retain their ability to target tumor cells, but would no longer cause disease in birds.
  • the present invention features compositions and methods for the treatment of neoplasia.
  • the invention generally provides an attenuated Newcastle disease virus (NDV) having an F protein cleavage site of NDV LaSota strain or glycoprotein B (gB) of cytomegalovirus (CMV) (SI 16).
  • NDV Newcastle disease virus
  • gB glycoprotein B
  • CMV cytomegalovirus
  • the modified F protein cleavage sequence has one of the following sequence modifications SI 16: i n H-N-R- T-K-S/F 117 ; S116K: i n H-N-K-T-K-S/F 117 ;S116M: m H-N-R-M-K-S/F 117 ;S116KM: i n H-N- K-M-K-S/F-I 118 ;or Rl 16: H1 H-N-R-T-K-R/F-I 118 .
  • the attenuated virus strain is a modified 73T strain.
  • the attenuated NDV virus is r73T-Rl 16 virus.
  • the virus has an increased HN-L intergenic region.
  • the HN-L intergenic region is a non-coding sequence between at least about 50-300 amino nucleotides in length.
  • the non-coding sequence is derived from a paramyxoviruses type -1 (APMV-1), a respiratory syncytial virus (RSV) or a random sequence.
  • APMV-1 paramyxoviruses type -1
  • RSV respiratory syncytial virus
  • the HN and L intergenic non- coding sequence is 60, 102, 144, 198, or 318 nt in length.
  • the virus has one or more heterologous polynucleotide sequences inserted at the P-M junction and/or the HN-L junction. In further embodiments the virus has two or more heterologous polynucleotide sequences, wherein at least one heterologous polynucleotide sequence is inserted at the P-M junction and at least one is inserted at the HN-L junction.
  • the heterologous polynucleotide sequence is a transgene encoding a polypeptide that enhances the oncolytic properties of the virus. In yet another embodiment the transgene encodes a cytokine, cell surface ligand, and/or chemokine.
  • the cytokine is selected from the group consisting of GM-CSF, IL-2, IL-21, IL- 15, IL-12, and IL-12p70.
  • the cytokine is human GM-CSF.
  • the heterologous polynucleotide sequence is a transgene encoding a detectable moiety.
  • the expression level of the detectable moiety correlates with virus replication.
  • the F and HN genes of NDV are replaced by corresponding extracellular domains of canine Parainfluenza virus 5 (PIV 5) or pigeon paramyxovirus type 1 (PPMV-1).
  • the virus is 73T- Rl 16i-hGM-CSF.
  • the attenuated virus has a Mean death time in eggs (MDT) of greater than 90hr or about 90-156 hours.
  • MDT Mean death time in eggs
  • the attenuated virus has an intracerebral pathogenicity index between about 0-0.7.
  • the attenuated virus has an intracerebral pathogenicity index of about 0.
  • the attenuated virus has less than about 15% cytotoxicity in HT1080 cells.
  • the attenuated virus selectively kills tumor cells with killing efficiency at least 10 or 15%. In another embodiment the tumor cell killing efficiency in between about 75%-100%.
  • Another aspect of the invention generally features a method of selectively killing tumor cells, involving contacting a tumor cell with the attenuated Newcastle disease virus described herein.
  • the tumor cell is a cell of a cancer of bladder, ovarian, brain, pancreas, prostate, sarcoma, lung, breast, cervical, liver, head and neck, gastric, kidney, melanoma, lymphoma, leukemia, thyroid, colon, and melanoma cancer cells.
  • the method involves administering to the subject an effective amount of an attenuated Newcastle disease virus described herein.
  • the attenuated Newcastle disease virus is delivered systemically,
  • virus is administered at a dose of about 10 7 pfu to about 10 9 pfu. In additional embodiments the virus is administered intravenously at a dose of about 10 9 pfu to about 10 11 pfu.
  • the subject has a cancer selected from the group consisting of bladder, ovarian, brain, pancreas, prostate, sarcoma, lung, breast, cervical, liver, head and neck, gastric, kidney, melanoma, lymphoma, leukemia, thyroid, colon, and melanoma cancer.
  • the invention generally features a method of treating a neoplasia in a subject that has developed an anti-NDV immune response, the method involving administering to the subject an effective amount of an attenuated chimeric Newcastle disease virus described herein, wherein the virus is a chimeric virus comprising a F and/or HN gene of a canine Parainfluenza virus 5 (PIV 5) or Pigeon paramyxovirus type 1 (PPMV-1), wherein the chimeric Newcastle disease virus is antigenically distinct from NDV.
  • the method increases the level of oncolytic viruses present in the subject relative to the level of oncolytic viruses present in a control subject that has developed an anti-NDV immune response, but that is not receiving a chimeric Newcastle disease virus.
  • Attenuated Newcastle disease virus is meant a Newcastle disease virus that selectively kills tumor cells but that does not pose a threat to poultry.
  • an attenuated Newcastle disease virus has an ICPI less than about 0.4 or 0.7. In other embodiments, attenuated Newcastle disease virus has an ICPI of between about 0 and 0.1.
  • heterologous polynucleotide sequence is meant a recombinant polynucleotide that is not present in the wild- type condition.
  • detectable label is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
  • useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens.
  • agent any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
  • alteration or “change” is meant an increase or decrease.
  • An alteration may be by as little as 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, or by 40%, 50%, 60%, or even by as much as 70%, 75%, 80%, 90%, or 100%.
  • an antibody refers to a polypeptide or group of polypeptides that are comprised of at least one binding domain that is formed from the folding of polypeptide chains having three-dimensional binding spaces with internal surface shapes and charge distributions complementary to the features of an antigenic determinant of an antigen.
  • An antibody typically has a tetrameric form, comprising two identical pairs of polypeptide chains, each pair having one "light” and one "heavy” chain. The variable regions, or variable chain polypeptides, of each light/heavy chain pair form an antibody binding site.
  • mAb refers to monoclonal antibody.
  • Antibodies of the invention comprise without limitation whole native antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab', single chain V region fragments (scFv), fusion polypeptides, and unconventional antibodies.
  • biological sample is meant a sample obtained from a subject including a sample of biological tissue or fluid origin, obtained or collected in vivo or in situ.
  • a biological sample includes any cell, tissue, fluid, or other material derived from an organism.
  • capture reagent is meant a reagent that specifically binds a nucleic acid molecule or polypeptide to select or isolate the nucleic acid molecule or polypeptide.
  • Clinical aggressiveness is meant the severity of the neoplasia. Aggressive neoplasia are more likely to metastasize than less aggressive neoplasia. While conservative methods of treatment are appropriate for less aggressive neoplasia, more aggressive neoplasia require more aggressive therapeutic regimens.
  • the terms “determining”, “assessing”, “assaying”, “measuring” and “detecting” refer to both quantitative and qualitative determinations, and as such, the term “determining” is used interchangeably herein with “assaying,” “measuring,” and the like. Where a quantitative determination is intended, the phrase “determining an amount” of an analyte and the like is used. Where a qualitative and/or quantitative determination is intended, the phrase “determining a level" of an analyte or “detecting” an analyte is used.
  • subject refers to an animal which is the object of treatment, observation, or experiment.
  • a subject includes, but is not limited to, a mammal, including, but not limited to, a human or a non-human mammal, such as a non- human primate, murine, bovine, equine, canine, ovine, or feline.
  • An alteration may be by 5%, 10%, 25%, 30%, 50%, 75%, or even by 100%.
  • Periodic patient monitoring includes, for example, a schedule of tests that are administered daily, bi-weekly, bi-monthly, monthly, bi- annually, or annually.
  • severity of neoplasia is meant the degree of pathology. The severity of a neoplasia increases, for example, as the stage or grade of the neoplasia increases.
  • Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double- stranded nucleic acid molecule. By “hybridize” is meant pair to form a double- stranded molecule between complementary polynucleotide sequences (e.g. , a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g. , Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).
  • stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate.
  • Low stringency hybridization can be obtained in the absence of organic solvent, e.g. , formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide.
  • Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, more preferably of at least about 37° C, and most preferably of at least about 42° C.
  • Varying additional parameters, such as hybridization time, the concentration of detergent, e.g. , sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art.
  • Various levels of stringency are accomplished by combining these various conditions as needed.
  • hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS.
  • hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 ⁇ g/ml denatured salmon sperm DNA (ssDNA).
  • hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1 % SDS, 50% formamide, and 200 .mu.g/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
  • wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature.
  • stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate.
  • Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C
  • wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS.
  • wash steps will occur at 42° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS.
  • wash- steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS.
  • Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
  • substantially identical is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein).
  • a reference amino acid sequence for example, any one of the amino acid sequences described herein
  • nucleic acid sequence for example, any one of the nucleic acid sequences described herein.
  • such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95%, 96%, 97%, 98%, or even 99% or more identical at the amino acid level or nucleic acid to the sequence used for comparison.
  • Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;
  • BLAST program may be used, with a probability score between e "3 and e "100 indicating a closely related sequence.
  • substantially pure means that a species of interest is the
  • a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present.
  • a substantially pure composition will comprise more than about 80 percent of all macromolecular species present in the composition, more preferably more than about 85%, 90%, 95%, and 99%.
  • the species of interest is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.
  • the terms "treat,” treating,” “treatment,” and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated. Thus, a successful treatment may prolong the survival of a patient or alleviate an undesirable symptom.
  • the terms "prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.
  • a dose refers to a single administration of a therapeutic composition. Dosage refers to the amount of a therapeutically active molecule in a dose.
  • a treatment regimen refers to the dosage, schedule, and mode of administration of one or more doses.
  • a cycle refers to a repeatable unit of one or more doses within a treatment regimen. In some treatment regimens dosages are uniform for each dose. In other treatment regimens, the dosages may not be uniform. For example, one or more loading doses may be used to raise the concentration of a therapeutic molecule to a desired level in a patient.
  • Loading doses may be followed by one or more maintenance doses, generally comprising lower dosages (for example one half or less of a loading dose) which are sufficient to maintain a desired concentration of a therapeutic molecule in a patient.
  • One or more tapering doses may be used to gradually reduce the concentration of a therapeutic molecule in a patient.
  • binds is meant a compound (e.g. , antibody) that recognizes and binds a molecule (e.g. , polypeptide), but which does not substantially recognize and bind other molecules.
  • a compound e.g. , antibody
  • molecule e.g. , polypeptide
  • the term "about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, 0.5%, 0.1 %, 0.05%, or 0.01 % of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.
  • the terms "comprises,” “comprising,” “containing,” “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “includes,” “including,” and the like; “consisting essentially of or “consists essentially” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.
  • An exemplary nucleotide sequence of full-length NDV virus 73T is: tacgtataatacgactcactatagggaccaaacagagaatccgtaggttacgataaaaggcgaaggagca
  • An exemplary nucleotide sequence of wt F protein is, wherein the underlined sequence denotes the nucleotide sequence of the F protein cleavage site: atgggccccagaccttctaccaagaacccagcacctatgatgctgactgtccgggtcgcgctggtactgagttgcatctgtccggcaa actccattgatggcaggcctcttgcggctgcaggaattgtggtaacaggagacaaagcagtcaacatatacacctcatcccagacagg atcaatcatagttaagctcctcccaaacctgcccaaggataaggaggcatgtgcgaaagcccccttggatgcatacaacaggacattg accactttgctcacccccttggtgactctatccgtaggatacaagagtct
  • An exemplary nucleotide sequence of mouse GM-CSF is:
  • An exemplary nucleotide sequence of human GM-CSF is:
  • An exemplary amino acid sequence of human GM-CSF is:
  • Figure 1 depicts the construction of NDV 73T antigenomic cDNA strain 73T.
  • NDV sequences in GenBank were aligned to obtain consensus sequences to design DNA oligonucleotides for RT-PCR of the viral RNA.
  • Six subgenomic cDNA fragments generated by high-fidelity RT-PCR were assembled in the pUC19 vector. The full length cDNA of
  • NDV 73T was designated as p73T.
  • the nucleotide and deduced amino acid sequence of the F protein cleavage site (FPCS) in the 73T were modified as that of the NDV LaSota strain (lentogenic, lento) and gB of cytomegalovirus (CMV) (SI 16). The double slash indicates the site of cleavage of the F protein.
  • the 73T strain cDNA plasmid contains a 27 nucleotide (nt) T7 RNA polymerase promoter at 5 'end and a 189 nt containing HDV antigenome ribozyme sequence and a T7 RNA polymerase transcription-termination signal at the 3 ' end.
  • nt 27 nucleotide
  • gB glycoprotein B
  • Figures 2A and 2B depict insertion of transgene cassette(s) into the NDV 73T genome.
  • Figure 2A shows the insertion of a transgene at the P-M junction.
  • An Afel restriction site was introduced at nt 3148 in the subclone plasmid containing SacII-Pmll fragment.
  • cDNAs encoding codon-optimized human or mouse granulocyte-macrophage colony-stimulating factor (GM-CSF) or interleukin 2 (IL-2).
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • IL-2 interleukin 2
  • the inserted gene cassette contains the gene end (GE; 5'-TTAAGAAAAAA -3'), intergenic nucleotide (T), the gene start sequence (GS; 5'-ACGGGTAGA -3') and open reading frame (ORF) of the transgene.
  • GE gene end
  • T intergenic nucleotide
  • GS gene start sequence
  • ORF open reading frame
  • ten nucleotides (5'- cgccgccacc-3') were inserted upstream of the initiation site to introduce a Kozak sequence.
  • the SacII-Pmll fragment from the resulting plasmid was shuffled into plasmid r73T and named as p73T-Pl .
  • Figure 2A shows the insertion of a transgene at the HN-L junction between the HN ORF and the gene end signal (GE) sequence of HN, an Afel restriction site was introduced at nt 8231 in the plasmid containing the Agel-Xbal fragment.
  • the gene cassette was generated by PCR using a pair of phosphate sense and antisense primers (Table 3) and inserted into Afel site.
  • the Agl-Xbal fragment from the resulting plasmid was shuffled into plasmid p73T, yielding p73T-HNl .
  • the full length (FL) 73T cDNA containing the transgene at P-M or HN-L junction was designated as p73T-Pl or p73T-HNl , respectively.
  • Figure 2B shows the insertion of two transcriptional cassettes to the P-M junction.
  • An Afel site was introduced at the end of the ORF of GM-CSF (nt 3619).
  • the IL-2 ORF was amplified using a pair of phosphate sense and antisense primers containing the GE and GS sequences and inserted at the Afel site.
  • the SacII-Pmll fragment from the resulting plasmid including GM-CSF and IL-2 transcriptional cassettes was swapped back into plasmid r73T, yielding p73T-P2.
  • Figures 3A-3C show the recovery of infectious recombinant NDV strain 73T (r73T) with modified FPCS and depict F protein cleavage and fusion activity in vitro.
  • Figure 3A shows how NDV 73T NP, P, L and antigenic cDNA (p73T-lento or p73T-Sl 16) were cloned under the control of the T7 RNA polymerase promoter and terminator. The four plasmids were co-transfected into an RNA polymerase expressing cell line. The recovered viruses were designated as r73T-lento or r73T-Sl 16.
  • the r73T- lento and r73T-Sl 16 were passaged in Vero cells with media with and without trypsin supplement.
  • the growth of r73T-lento is trypsin dependent whereas r73T-S116 can grow in medium without trypsin supplement.
  • r73T-Sl 16 with and without hGM-CSF at P-M junction were further passaged for 10 passages in Vero and human fibrosarcoma HT1080 cells at MOI 0.01 in media without supplement of trypsin.
  • NDV F or HN genes For construction of plasmid co-expressing two transgenes, GFP and NDV F or HN genes, the protein open reading frames of NDV F or HN gene were amplified by PCR and cloned into plasmid pVitro2-neo-MCS (Invitrogen) under the control of the cytomegalovirus (CMV) promoter. 293T cells were seeded at 5 xlO 5 cell/well on 6 well plate for transfection the next day.
  • Figure 3B depicts cells transfected with 2 ⁇ g of NDV F plasmid DNA for one day and harvested in protein lysis buffer for Western blot analysis using anti-NDV F specific polyclonal antiserum.
  • FIG. 3C shows the cells that were cotransfected with different F plasmid with wt HN plasmid and that were examined for fusion formation by florescent microscope. The wt F protein was most efficient in fusion formation.
  • Figure 4 is a table summarizing characteristics of r73T-lento and r73T-Sl 16 derivatives.
  • a All viruses contain hGM-CSF at the P-M junction.
  • b The amino acids in the FPCS that are different from FPCS-S116 are underlined.
  • 0 Plaque formation in Vero cells without trypsin in the overlay after 36 hrs incubation and visualized under xlO magnification.
  • d Mean death time in eggs (MDT).
  • ICPI intracerebral pathogenicity index
  • the ICPI assay was performed at National Veterinary Service Laboratories (NVSL) (Ames, Iowa).
  • Figures 5A and 5B depict strategies to attenuate r73T-R116 virus virulence in chicken.
  • Figure 5A depicts insertion of transgenes at the P-M junction (1) and HN-L junction (2), and extension of the HN-L intergenic region by insertion of non-coding sequence (3). Insertion of the trans gene cassette at P-M junction is the same as that shown in Figure 2A.
  • the 2nd transgene cassette contains the L gene start sequence (GS; 5'- ACGGGTAGA-3'), open reading frame (ORF) of the transgene, sequences from 3' untranslated region of the L gene (in italics) and the L gene end sequence (GE; 5'- TT A AG AAA AAA- 3') ⁇
  • the non-coding sequences used for extending the HN-L junction were taken from paramyxoviruses type -1 (APMV- 1), respiratory syncytial virus (RSV) or random sequence which does not have sequence identity or homology with known sequences.
  • the insertion sequence can be in the range of 60-318 nt. Insertion of a 2nd transgene at HN-L allows the virus to express two transgenes (e.g. , hGM-CSF and GFP).
  • Figure 5B depicts sequences that were inserted at the HN-L junction.
  • Figure 6A is a table summarizing characteristics of r73T-R116 derivatives.
  • a All viruses contain hGM-CSF at the P-M junction.
  • MDT Mean death time in eggs
  • ICPI intracerebral pathogenicity index
  • the ICPI assay was performed at National Veterinary Service Laboratories (NVSL) (Ames, Iowa).
  • the amniotic fluid was harvested after incubation at 37 °C for 72 hrs.
  • the infectious titer was determined in Vero cells by plaque assay.
  • Figures 6B-6E are graphs showing the growth kinetics of recombinant NDV in DF-1 and Vero cells.
  • DF-1 and Vero cells in six- well plates were infected with each indicated virus at a multiplicity of infection (m.o.i.) of 5.0 (single cycle, Figures 6B and 6C) or 0.001 (multi cycle, Figures 6C and 6D).
  • the infected cell culture supernatants were collected at 10 hour intervals until 50 hours post infection, and virus titers were determined by plaque assay.
  • Figures 6F and 6G show viral RNA and protein synthesis in DF-1 cells.
  • DF-1 cells were infected with each virus as indicated at m.o.i of 5.0, incubated for 20 h, total intracellular RNAs were extracted for Northern blot analysis (Figure 6F) and a second set of infected cells were examined for protein synthesis by Western blotting ( Figure 6G).
  • the RNAs were separated by electrophoresis in a formaldehyde agarose gel, transferred onto nitrocellulose membranes, and hybridized with biotin labeled RNA probes specific to the HN, NP, P, and L genes. A positive RNA probe in the L gene was used to detect viral genomic RNA.
  • the total proteins were separated on SDS-PAGE and blotted with anti-NP, F, HN and L serum.
  • the total proteins loaded on the gel were detected by an actin-specific antibody.
  • Recombinant NDV Rl 16i with 198 nt insertion between the HN and L intergenic sequence had an overall reduced RNA and protein synthesis in the DF-1 cells.
  • Figures 6H and 61 depict viral RNA and protein synthesis in Vero cells.
  • Figure 6H shows Northern blot analysis of RNA synthesis. Vero cells were infected with the viruses at m.o.i of 5.0, incubated for 20 h, total intracellular RNAs were extracted. The RNAs were separated by electrophoresis in a formaldehyde agarose gel, transferred onto nitrocellulose membranes, and hybridized with biotin labeled RNA probes specific to the NP and L genes or a positive sense L gene RNA to detect genomic RNA.
  • Figure 61 depicts Western blot analysis of viral protein synthesis in infected Vero cells.
  • the total proteins were separated on SDS-PAGE, transferred to nitrocellulose membrane and blotted with anti-NP, F, HN and L serum.
  • the total proteins loaded on the gel were detected by an actin-specific antibody.
  • the Rl 16i viruses with 198nt insertion had reduced genomic RNA, but greatly increased NP mRNA compared to SI 16 and wt NDV.
  • the L mRNA level was too low to tell the difference.
  • the proteins upstream of the L gene were upregulated but the L protein level was reduced in Vero cells.
  • Figures 6J and 6K show comparison of protein synthesis in infected DF-1 and Vero cells at low multiplicity of infection by Western blot analysis.
  • DF-1 and Vero cells were infected with each virus as indicated at m.o.i of 0.001, incubated for 72 h and harvested in protein lysis buffer. The total proteins were separated on SDS-PAGE, transferred to nitrocellulose membrane and blotted with anti-NP, F, HN and L serum. The proteins loaded on the gel were detected by an antibody against actin. The level of L protein was reduced in both cell lines, however, the proteins upstream of the L gene was down regulated in DF-1 cells but upregulated in Vero cells.
  • Figures 6L shows viral protein synthesis in infected human cells compared to DF-1 cells.
  • Human HT1080, Hela cells and DF-1 cells were infected with each virus as indicated at m.o.i of 5.0, incubated for 20 h and harvested in protein lysis buffer. The proteins were separated on SDS- PAGE, transferred to nitrocellulose membrane and blotted with anti-HN and anti-L serum.
  • the HN protein expression of Rl 16i with 198nt insertion between the HN and L junction is increased in HT1080 and Hela cells, but decreased in DF-1 cells.
  • the L protein was decreased in all three cell lines infected with R116i-198 or 198RSV.
  • Figure 7 are graphs depicting the growth kinetics of r73T viruses in embryonated chicken eggs.
  • growth kinetic studies were performed in eggs. Chicken embryonated eggs were infected with 100, 1000, 10,000 or 100,000 PFU/egg of indicated viruses and incubated for 2, 3 or 4 days (73T wt, top left; Rl 16, top right; R116i-318, middle left; R116i-198-RSV, middle right; R116i-198-random, bottom left; S116-KM, bottom right).
  • the allantoic fluid was harvested and viral titers were determined by FFA. Inoculation of 100 FFU/egg had low titer on day 1, but reach peak titer on day 2.
  • the virus with RSV-198nt insertion was a top oncolytic virus candidate in terms of growth properties in eggs.
  • Figure 8 are graphs depicting the growth kinetics of r73T viruses in Vero cells.
  • the viruses were also evaluated in sero-free Vero cell clone 51D11, a proprietary cell line generated by Medlmmune. All the viruses replicated similarly well under both moi conditions (0.001, top; 0.0001, bottom).
  • the modification of 73T FPCS and intergenic insertion in the HN-L junction of Rl 16 did not affect virus growth in Vero cells.
  • Figures 9A-9D show that r73T viruses selectively replicate in tumor cells and have cytotoxicity for tumor cells, compared to non-neoplastic cells. Data were obtained after infection with r73T derivatives at different dose ranging from 1 to 100,000 PFU for 72 hour.
  • Figure 9A is a graph showing the evaluation of rT3T and its derivatives for cell killing in human fibrosarcoma HT1080 relative to untreated control cells. In HT1080 cancer cells, the virus with lentogenic FPCS had the least killing, SI 16 at the FPCS was intermediate, and viruses with Rl 16 at FPCS had cell killing as efficient as r73T wt virus.
  • Figure 9B is a graph showing the evaluation of rT3T and its derivatives for cell killing in normal human skin fibroblast CCD 1122Sk cells relative to untreated control cells.
  • all viruses did not kill the cells as efficiently as the cancer cells, with reduction of killing efficiency of ⁇ 100-fold. Regardless of the FPCS sequences, all the viruses had similar killing in normal cells, likely due to a single cycle of replication (no virus spread).
  • Figure 9C is a table showing the cell killing efficiency in cancer and normal cells, expressed as 50% effective concentration (EC 50 ) interpolated from the dose response curve using Prism 6.0.
  • the Rl 16 derivative had a similar EC 50 value as r73T wt with an EC 50 of 10 PFU, indicating that the modification of FPCS did not affect virus replication in cancer cells and cell killing efficiency.
  • Figure 9D is a graph showing replication of the viruses in the HT1080 and CCD1122SK cells at MOI 0.01 at day 3 post infection. All viruses preferentially replicated in cancer cells than in normal cells, with a difference of about 1.5-2.0 logs.
  • Figures 10A and 10B are graphs showing r73T derivatives are effective in tumor regression upon local and systemic administration.
  • an HT1080 xenograft model was established by injecting HT1080 cells at a concentration of 5 x 10 6 cells/0, lml subcutaneously into Balb/C athymic nude mice at age of 5-6 week old.
  • Figure 10A is a graph showing the effect of Rl 16i-318-hGM-CSF administered
  • mice intratumorally to immunodeficient mice carrying human tumor xenografts. Tumor growth rate was compared between the treatment and the control groups. The tumor regressions induced by the two routes of administration were both significantly different from the control group.
  • Figure 10B is a graph comparing the oncolytic activities of r73T derivatives in the HT1080 xenografts by IV injection of 1 x 10 8 PFU.
  • Two doses of r73T derivatives were capable of inducing significant tumor regression with varying degrees of effectiveness.
  • r73T-lento was the least effective in tumor regression whereas r73T wt was the most effective in tumor regression.
  • r73T-lento had a similar effect as the SI 16 virus, although SI 16 virus has a 10-fold lower EC 50 in the in vitro cell killing (see Figure 9A).
  • mice received either PBS or 1 x 10 8 PFU of r73T-hGM-CSF-lento (lento) or r73T-hGM-CSF-S116K113M114 (SI 16 KM) or r73T-hGM-CSF-R116i-318 nt APMV-N (Rl 16i) or r73T-hGM-CSF (r73T wt) administered by IV. Tumor size was measured every 3-4 days. * P ⁇ 0.05, un-paired student T test. The data show that r73T derivatives had anti-tumor activity in vivo when delivered either systemically or intratumorally to immunodeficient mice carrying human tumor xenografts.
  • FIGS 11A-G depict the tissue biodistribution of r73T derivatives following intravenous delivery and the effect of mouse versus human GM-CSF on tumor growth inhibition. To determine if the oncolytic NDV virus selectively replicates in tumor tissues and viral clearance, virus distribution in different organs was determined.
  • Figure 11A is a graph depicting quantification of virus in tissues by plaque assay in Vero cells.
  • Virus in organs was only detected on day 1 (virus was not detected in ovary at all time points, data not shown) and virus load in tumor tissues was ⁇ 100-fold higher than lungs and spleens. The presence of virus in tumor persisted for at least 8 days, indicating that the virus selectively replicated in tumor tissues.
  • Figure 1 IB is a graph depicting quantification of GM-CSF expressed by virus in tissues by ELISA assay of hGM-CSF transgene expression. Consistent with the viral replication data obtained by plaque assay, the level of hGM-CSF was the highest and lasted more than 8 days in the tumor tissue. These data demonstrated that the NDV virus effectively replicated in tumor tissue and that the transgene was effectively delivered to local tumor tissue.
  • Figure 11C depicts graphs showing the effect of mGM-CSF expression on tumor growth inhibition in HT1080 xenograft mouse tumor model.
  • Athymic nude mice at 5-6 weeks old in groups of seven were implanted subcutaneously (s.c.) with 5 x 10 6 HT1080 cells in the right flank.
  • the tumor were injected with a single dose of 1 x 10 8 pfu rNDV, Rl 16i-198RSV with mGM-CSF or hGM- CSF.
  • the tumor size was measured every 3-4 days.
  • Rl 16i-198RSV with mGM-CSF was less potent in tumor growth inhibition than hGM-CSF transgene.
  • no difference in tumor growth inhibition was observed for SI 16 with either hGM-CSF or mGM-CSF.
  • Figure 11 D depicts graphs showing the effect of mGM-CSF on virus clearance from tumors in HT1080 xenograft mouse tumor model.
  • Athymic nude mice in groups of three were implanted subcutaneously (s.c.) with 5 x 10 6 HT1080 cells into the right flank. When tumors reached a volume of 180 mm 3 (day 10), the mice were intravenously treated with one dose of 1 x 10 8 pfu of Rl 16i-198RSV or SI 16KM. The tumors were collected on day 4 or 7 and viral titers in the tumor tissue were determined by plaque assay. Both Rl 16i-198RSV and SI 16KM with either mGM-CSF or hGM-CSF had comparable titer on day 4.
  • Figure 1 IE depicts a graph showing the effect of Rl 16i-198RSV or SI 16KM infection on immune cell infiltration into tumors in HT1080 xenograft mouse tumor model.
  • Athymic nude mice in groups of three were implanted subcutaneously (s.c.) with 5 x 10 6 HT1080 cells into the right flank. When tumors reached a volume of 180 mm 3 (day 10), the mice were intravenously treated with one dose of 1 x 10 8 pfu of virus as indicated. The tumors were collected on day 4 and the tissues were processed for neutrophil, NK cells and macrophage staining by FACS analysis.
  • R116i-198RSV with mGM-CSF had more immune cell infiltration.
  • Figure 1 IF depicts a table showing that cytokines and chemokines were up-regulated in HT1080 xenograft mouse tumor model.
  • Athymic nude mice in groups of three were implanted subcutaneously (s.c.) with 5 x 10 6 HT1080 cells into the right flank.
  • the tumors reached a volume of 180 mm 3 (day 10)
  • the mice were intravenously treated with one dose of 1 x 10 8 pfu of Rl 16i-198RSV or SI 16KM with hGM-CSF or mGM-CSF.
  • the tumors were collected on day 4 and the tissues were processed for levels of cytokines and chemokines by Luminex analysis.
  • Virus infection induced cytokines and chemokines production in the local tumor tissues their levels varied based on virus backbone and human or mouse GM-CSF.
  • Figure 11G depicts a graph showing that Rl 16i-198RSV-hGM-CSF and Rl 16i- 318APMV-hGM-CSF were comparable in tumor growth inhibition in HT1080 xenograft mouse tumor model.
  • Athymic nude mice in groups of seven were implanted subcutaneously (s.c.) with 5 x 10 6 HT1080 cells into the right flank.
  • s.c. subcutaneously
  • HT1080 cells into the right flank.
  • a single dose of virus at 1 x 10 8 pfu was injected intra- tumorally.
  • the tumor size was measured every 3-4 days and graphed.
  • the insertion length of 198 and 318nt did not affect R116i oncolytic activity.
  • Figures 12A and Figure 12B depict construction of antigenome cDNA of 73T containing chimeric F and/or HN genes and their characterization and Figure 12C compares function of RNA polymerase complex activity.
  • Viral surface glycoproteins are important antigens for immunogenicity and virulence in chickens.
  • F and/or HN genes of NDV were replaced by the corresponding extracellular (ecto) domains of other paramyxoviruses which are not virulent in chickens individually or in combination.
  • Parainfluenza virus 5 (PIV 5) is a canine paramyxovirus and does not cause diseases in human, and pigeon paramyxovirus type 1 (PPMV-1) has been show to be nonvirulent in chickens.
  • Figure 12A shows that F and/or HN glycoprotein ectodomains of the full-length antigenomic NDV 73T cDNAs were replaced with those of PPMV-1 and/or PIV5.
  • NDV, PIV5, and PPMV-1 sequences are indicated with colored boxes as blue, purple or green, respectively.
  • the amino acid lengths of individual proteins or protein domains are indicated.
  • Figure 12B is a table showing characterization of 73T derivatives containing chimeric F and/or HN genes. Plaque formation in Vero, relative HT1080 cell killing and MDT were performed as described previously. Chimeric viruses, except for PVI-5 F-HN, were recovered and grew in the cells in the absence of exogenous trypsin.
  • PPMV-1 F-HN or F chimeric viruses had MDT value of 79 and 84 hr, respectively, indicating potential virulence in chickens. Both PPMI-1 chimeric virus killed HT1080 cells efficiently at levels of 71 and 61%. PIV5-F chimera did not grow in eggs and was not virulent in chickens, but killed HT1080 cells at 47%. Serum cross reactivity between the NDV and PPMV-1 or PIV5 chimeras was examined by neutralization assay using the serum collected from mice that were IV administrated with 2 doses of 1 x 10 8 PFU of r73T-Rl 16i.
  • r73T virus can be neutralized by the NDV-infected serum (titer 960) whereas the PPMV-1 and PIV5 chimera were not neutralized (titer ⁇ 4), confirming no cross reactivity between NDV and PPMV-1 or PIV5.
  • the chimeric viruses with distinct antigenicity could be to boost oncolytic viruses in patients for whom anti-NDV immune responses have developed during prior NDV treatment.
  • Figure 12C shows the comparison of NDV RNA polymerase activity with other paramyxoviruses by mini-genome assay.
  • the T7 expressing cells were transfected with the three plasmids expressing the NP, P, L proteins of NDV and the plasmid encoding the NDV anti-minigenomic cDNA encoding the GFP gene using Lipofectamine 2000, or the plasmids encoding N, P, L genes of measles virus (MV) or respiratory syncytial virus (RSV) and respective RSV or MV GFP anti-minigenome cDNA plasmid.
  • MV measles virus
  • RSV respiratory syncytial virus
  • Figures 13 A and B show cancer cell line sensitivity to rNDV variants. Cancer cell lines from various tissues of origin were infected with NDV SI 16 or NDV Rl 16i at an MOI of 0.1 and cell viability was assessed 72hrs post infection using Cell Titre Glo. Sensitivity to NDV is defined as greater than 30% cell killing at 72hrs post infection.
  • Figure 13A depicts a graph of percentage of NDV sensitive human cancer cell lines across a minimum of 16 broad indications. Numbers of cell lines within each group are indicated numerically and in the table.
  • Figure 13B depicts a graph of sensitivity of 22 cancer cell lines to NDV variants. % cell kill is determined as a percentage of untreated control cells.
  • Figure 14 are graphs showing permissivity of cancer cell lines to recNDV GM CSF . Cell killing of Rl 16i-GM-CSF in representative tumor cell lines are presented in Figure 14.
  • Figures 15 A-F are graphs showing that NDV derivatives inhibit tumor growth in different mouse cancer models.
  • Figures 15 A and 15B are graphs showing recNDV GM CSF strains inhibit tumor growth in syngeneic mouse melanoma model (B16F10 AP3).
  • Each virus was dosed intravenously (i.v) at 2xl0 7 pfu twice on days 11 and 14; intraperitoneally (i.p) at 2xl0 7 pfu twice on days 11 and 14; or intratumorally (i.t) once at 1. lxlO 7 pfu on day 11.
  • the groups treated with Rl 16-hGM-SCF or mGM-SCF by the three routes of administration had slower rate of tumor growth compared to the untreated group. Tumor inhibition rates were statistically significant from the control group.
  • Figure 15B shows an efficacy study in B16F10 syngeneic murine melanoma model with intratumoural administration of lx 10 8 pfu of SI 16 NDV variants. Tumour growth inhibition is shown on the left panel and individual animal measurements are shown on the middle panel and a survival plot is shown on the right.
  • Figure 15C shows that NDV has potent anti-tumour activity in immune-competent mouse CT26 colorectal tumour model.
  • Figure 15C provides an efficacy study in CT26 syngeneic murine colorectal model with intratumoural administration of lx 10 8 pfu of Rl 16 NDV variant encoding human GM-CSF. Tumour growth inhibition is shown on the right panel and IHC analysis of the remaining tumour is shown on the right hand side with H&E and NDV staining. Necrotic areas, evidence of multinucleated syncytia and viable areas of tumours are indicated.
  • Figures 15D-F depict tumor growth inhibition in ovarian xenograft model.
  • Athymic nude mice at were implanted subcutaneously (s.c.) with Ovcar4 cells in the right flank. When tumors reached a volume of 100 mm 3 mice were randomized into treatment groups.
  • Figurel6 is a table summarizing characteristics of NDV constructs. Plaque formation in Vero cells without trypsin in the overlay after 36 hrs incubation and visualized under xlO magnification. Cytotoxicity effect of the viruses on human fibrosarcoma HT1080 cells after infection at multiplicities of infection (MOI) of 0.01 at 72 hours postinfection. The relative percentage of surviving cells is determined by comparing each sample with untreated cells that were considered 100% viable. Data presented in the table are relative percentage of dead cells. Pathogenicity of NDV in 1 -day-old pathogen- free chicks by the intracerebral pathogenicity index (ICPI). The ICPI assay was performed at National Veterinary Service Laboratories (NVSL) (Ames, Iowa).
  • ICPI intracerebral pathogenicity index
  • Figure 17 is a graph showing that NDV produced from eggs and human cell lines exhibited different sensitivity to complement mediated inactivation.
  • Human serum with confirmed complement (C) activity (Sigma, St. Louis, MO) was serially diluted with PBS and incubated with 100 pfu of NDV for 1 hour at 37°C prior to infecting Vero cells for plaque assay. Following incubation at 37°C for 6 days, the plaques were visualized by crystal violet staining and scored.
  • the virus grown in embryonated chicken eggs was mostly inactivated by serum diluted at 1:10 to 1 :40.
  • the 293-grown virus was more resistant to C than egg-grown virus, approximately 40% infectivity was retained at serum concentration of 1:40.
  • the Hela- grown virus was most resistant to C mediated viral inactivation. Approximately 90% live virus was infectious at serum concentration of 1:40.
  • Figures 18A and 18B are Western blots showing comparisons of RCA protein levels in 293 and Hela cells and in viruses produced from these two cell lines.
  • Figure 18A equal amount of 293 and Hela S3 cells were loaded onto the SDS-PAGE for Western blot. Hela cells contained higher levels of hCD46, hCD55 and hCD59 proteins than 293 cells.
  • Figure 18B shows a Western blot that was performed to examine protein amounts in virus from infected 293 or Hela cells. Uninfected cells (mock) were served as controls. The three CD molecules were detected in viruses from the infected Hela cells at levels higher than those from 293 cells.
  • Figure 19 shows evaluation of membrane bound C regulators (RCA) proteins in C mediated viral inactivation.
  • the cDNA encoding hCD55, hCD59 and hCD46 was synthesized by Origene (Rockville, MD) or Genscript (Piscataway, NJ). Each gene cassette was inserted into the P-N intergenic region of NDV antigenomic cDNA and recombinant viruses were generated by reverse genetics. The recombinant viruses were amplified in eggs and purified by 15-60% sucrose gradient and viral band was pelleted by ultracentrifugation. Expression of each RCA protein by recombinant NDV was confirmed by Western blotting.
  • Figure 20 is a graph showing that CD55 is a major RCA protein for preventing C inactivation of NDV.
  • NDV with hCD46, hCD55 or hCD59 were amplified in eggs, purified by sucrose gradient, incubated with human plasma diluted from 1 : 10 to 1 :40 for 1 hour and viral infectivity was examined by plaque assay in Vero cells.
  • NDV with hCD55 produced in eggs had similar resistance to C compared to NDV produced in Hela cells, approximately 65% viable viruses at plasma concentration of 1 :20 and -80% viable virus at plasma concentration of 1 :40.
  • hCD46 appeared to slightly or marginally improve viral resistance to C mediated inactivation, approximately 20% more viable virus when incubating with 1 :40 diluted human plasma compared to NDV control. No difference was detected at lower plasma dilution.
  • the invention features compositions comprising an attenuated Newcastle disease virus and methods of using that virus for the treatment of neoplasia.
  • the invention is based, at least in part, on the discovery of an oncolytic NDV with reduced chicken virulence.
  • NDV 73T strain was derived from NDV MK-107, which is a commercial poultry vaccine (mesogenic) first marketed in 1948.
  • the NDV MK-107 strain was maintained through 73 passages in Ehrlich ascites tumor cells (Cassel et ah , Cancer. 1965 Jul;18:863-8).
  • NDV MK-107 was used in a series of Ph I and Ph II clinical studies in the 1970's.
  • NDV MK-107 was also used in the 1980's as an immunotherapeutic to treat late stage melanoma patients (Cassel et ah , Cancer.
  • the recombinant NDV 73T strain includes certain genetic modifications.
  • the F protein cleavage sequence was altered and the length of the HN-L intergenic sequence was increased .
  • the modified virus can be used to express a transgene(s) of interest.
  • the NDV 73T strain includes a transgene encoding a polypeptide that enhances the oncolytic properties of recombinant NDV.
  • the NDV 73T strain includes a transgene encoding a biomarker that provides a read-out useful to monitor virus replication. If desired, NDV 73T strain can be modified to incorporate additional genetic information that disrupts the normal transcriptional polarity of the standard genome and is expected to further reduce viral virulence in chickens.
  • the invention provides a recombinant Newcastle Disease Virus (NDV) generated using reverse genetics to reduce its pathogenesis in chickens while maintaining its selective cancer cell killing ability, and methods of producing such a virus.
  • NDV Newcastle Disease Virus
  • the invention also provides for the construction and use of NDV as a viral vector to deliver and express heterologous gene products for enhanced cancer treatment.
  • the transgenes encoding exemplary therapeutic agents that can be delivered by NDV are described herein below.
  • novel NDV viral constructs expressing granulocyte macrophage-colony stimulating factor (GM-CSF) selectively killed cancer cells, but did not kill normal cells.
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • the invention provides for the insertion of specific transgene(s) into a recombinant attenuated NDV vector and the efficient expression of the encoded protein in a tumor environment.
  • the Newcastle disease virus is an enveloped virus containing a linear, single- strand, nonsegmented, negative sense RNA genome.
  • the negative-sense, single- stranded genome of NDV encodes a RNA-directed RNA polymerase, a fusion (F) protein, a hemagglutinin-neuraminidase (HN) protein, a matrix protein, a phosphoprotein and a nucleoprotein.
  • the genomic RNA contains genes in the following order: 3 '-NP-P-M-F-HN-L. The organization of the NDV RNA genome is described in greater detail herein below.
  • the genomic RNA also contains a leader sequence at the 3' end.
  • the structural elements of the virion include the virus envelope which is a lipid bilayer derived from the cell plasma membrane.
  • the fusion glycoprotein (F), which is an integral membrane protein, is first produced as an inactive precursor, then cleaved post-translationally to produce two disulfide linked polypeptides.
  • the active F protein is involved in penetration of NDV into host cells by facilitating fusion of the viral envelope with the host cell plasma membrane.
  • the matrix protein (M) is involved with viral assembly, and interacts with both the viral membrane as well as the nucleocapsid proteins.
  • the main protein subunit of the nucleocapsid is the nucleocapsid protein (NP) which confers helical symmetry on the capsid.
  • NP nucleocapsid protein
  • P phosphoprotein
  • L L protein
  • the phosphoprotein (P) which is subject to phosphorylation, is thought to play a regulatory role in transcription, and may also be involved in methylation, phosphorylation and polyadenylation.
  • the L gene which encodes an RNA-dependent RNA polymerase, is required for viral RNA synthesis together with the P protein.
  • the L protein which takes up nearly half of the coding capacity of the viral genome, is the largest of the viral proteins, and plays an important role in both transcription and replication.
  • RNA viruses including NDV
  • NDV negative-strand RNA virus
  • the negative-strand genome can not be translated directly into protein, but must first be transcribed into a positive-strand (mRNA) copy. Therefore, upon entry into a host cell, the genomic RNA alone cannot synthesize the required RNA-dependent RNA polymerase.
  • the L, P and NP proteins must enter the cell along with the genome upon infection.
  • NDV Newcastle disease virus
  • the first products of replicative RNA synthesis are complementary copies (i.e. , plus-polarity) of NDV genome RNA (cRNA). These plus-stranded copies (anti- genomes) differ from the plus-strand mRNA transcripts in the structure of their termini. Unlike mRNA transcripts, the anti-genomic cRNAs are not capped and methylated at the 5' termini, and are not truncated and polyadenylated at the 3' termini. The cRNAs are coterminal with their negative strand templates and contain all the genetic information in each genomic RNA segment in the complementary form. The cRNAs serve as templates for the synthesis of NDV negative- strand viral genomes (vRNAs).
  • vRNAs NDV negative- strand viral genomes
  • vRNAs NDV negative strand genomes
  • cRNAs antigenomes
  • Viruses are known to exert oncolytic effects on tumor cells and the use of oncolytic viruses as therapeutic agents has been reported. Some effort has been done to use non-human viruses exhibiting medium to high pathogenicity for their natural hosts in the treatment of cancer patients.
  • the present invention discloses methods for inducing regression of tumors in human subjects, the methods utilize a modified mesogenic strain of Newcastle disease virus (NDV) with modified F protein cleavage site, which is non-pathogenic to poultry
  • the disclosed methods provide safe, effective and reliable means to induce regression of a tumor in an individual in need thereof. These methods overcome the drawbacks of using pathogenic strains of viruses for human therapy.
  • the present invention provides a method for inducing regression of a tumor in a subject, the method comprises the step of administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a lentogenic oncolytic strain of NDV.
  • the lentogenic oncolytic strain of NDV is NDV r73T-Rl 16.
  • Oncolytic viruses are capable of exerting a cytotoxic or killing effect in vitro and in vivo to tumor cells with little or no effect on normal cells.
  • the term "oncolytic activity" refers to the cytotoxic or killing activity of a virus that targets tumor cells.
  • the oncolytic activity exerted by a lentogenic strain of NDV e.g. , r73T-R116
  • NDV lentogenic strain of NDV
  • NDV is capable of specifically differentiating cancer cells from normal, healthy cells.
  • results have indicated that several oncogenes (H-ras, N-ras, and N-myc) which are known to confer malignant behavior to cancer cells, enhance the susceptibility of cells to killing by NDV.
  • H-ras, N-ras, and N-myc which are known to confer malignant behavior to cancer cells, enhance the susceptibility of cells to killing by NDV. See, Lorence, R. M., Reichard, K. W., Cascino, C. J. et al. (1992) Proc. Am. Assoc. Cancer Res., 33, 398; Reichard, K. W., Lorence, R. M., Cascino, C. J., et al. (1992) Surg. Forum, 43, 603-606.
  • vitamin A retinoic acid
  • cytotoxic effects under in vitro or in vivo conditions can be detected by various means as known in the art, for example, by inhibiting cell proliferation, by detecting tumor size using gadolinium enhanced MRI scanning, by radiolabeling of a tumor, and the like.
  • clonal virus can be produced according to any method available to the skilled artisan.
  • clonal virus can be produced by limiting dilution or by plaque purification.
  • the virus employed in the invention may be prepared by a variety of methods.
  • NDV may be prepared in 8 to 10 day old fertilized chicken eggs (obtained from SPAFAS, Inc., Roanoke, 111.). Methods of isolating the virus are known in the art and are described, for example, by Weiss, S. R. & Bratt, M. A. (1974) J. Virol, 13, 1220-1230. This method is further described in Example #1 below. Using this isolation method, NDV may be obtained which is about 90-95% pure.
  • the virus may be prepared in an in vitro cell culture.
  • the cell culture comprises mammalian cells, and more preferably, cells can be used for virus manufacture such as Vero cells.
  • the viruses will be purified by chromatograph or other appropriate methods.
  • the cells may be anchorage-dependent or anchorage-independent.
  • Cell culture techniques that may be employed in the virus preparation are known in the art and may include use of stationary culture flasks with large surface areas or roller-type flasks.
  • the type of culture system selected can support relatively large numbers of cells.
  • a bioreactor process will be deployed whereas the cells are grown in microcarrier beads for virus infection and production.
  • Cell culture mediums that can be employed in the virus production are known to those skilled in the art.
  • the medium typically includes a nutrient source, antibiotic(s) and albumin or a serum source that contains growth factor(s). It is within the skill in the art to select particular mediums and medium constituents suitable for the cells employed in the culture.
  • trypsin is included in the growth media. In other embodiments, trypsin is not included.
  • Culture conditions typically include incubation at a desired temperature (such as 37° C), as well as selected concentrations of oxygen and carbon dioxide.
  • a desired temperature such as 37° C
  • concentrations of oxygen and carbon dioxide selected from various concentrations.
  • the particular culture conditions selected can be determined in accordance with the cells employed in the culture, and determination of such conditions is within the skill in the art.
  • the cells are placed in the culture vessel and allowed to incubate and grow under the selected culture conditions.
  • anchorage-dependent cells are allowed to grow to confluence or peak growth.
  • the time required for growth will vary depending upon the size of the initial cell inoculum added to the culture vessel and doubling time of the cell line being employed.
  • about 3xl0 3 to about 3xl0 5 cells are plated per cm 2 and grown for one to five days.
  • the medium is removed from the cells (for adherent cells, by aspiration of the culture medium; for cells grown in suspension, by centrifugation of the cell suspension and aspiration of the cell supernatant) and the virus (after reconstitution) is added to the cells in a minimal volume of medium or saline solution (such as Hank's Balanced Salt Solution, Gibco) to prevent dehydration.
  • this volume ranges from about 10 to about 2500 microliter per cm 2 culture vessel surface area or 10 5 cells.
  • the preferred dilution of virus inoculum ranges from about 0.001 to about 10 infectious units per cell, the optimal ratio depending on the particular virus and cell line.
  • the virus is then grown from about 1 to 7 days, the length of time being primarily determined by the residual survival of the cell line. For NDV, the optimal time of harvest is 1 to 5 days after virus inoculation.
  • the virus can then be harvested by either removing the supernatant and replacing it with fresh medium or fresh medium with fresh cells at 12 to 48 hour intervals or freeze- thawing the cells to release virus in the supernatant.
  • the supernatant can then be centrifuged and ultracentrifuged to recover the virus in relatively pure form or by chromatography methods.
  • the purity of the viral preparation may be tested by protein determination and/or by electrophoresis.
  • the virus can then be added to a pharmaceutically-acceptable carrier, described further below.
  • NDV Newcastle disease virus
  • Treatment generally begins at a hospital so that the doctor can observe the therapy's effects closely and make any adjustments that are needed.
  • the duration of the therapy depends on the kind of cancer being treated, the age and condition of the patient, the stage and type of the patient's disease, and how the patient's body responds to the treatment.
  • Drug administration may be performed at different intervals (e.g. , daily, weekly, or monthly). Therapy may be given in on-and-off cycles that include rest periods so that the patient's body has a chance to build healthy new cells and regain its strength.
  • the therapy can be used to slow the spreading of the cancer, to slow the cancer's growth, to kill or arrest cancer cells that may have spread to other parts of the body from the original tumor, to relieve symptoms caused by the cancer, or to prevent cancer in the first place. Cancer growth is uncontrolled and progressive, and occurs under conditions that would not elicit, or would cause cessation of, multiplication of normal cells.
  • treatment with a composition of the invention may be combined with therapies for the treatment of proliferative disease (e.g. , radiotherapy, surgery, or chemotherapy).
  • therapies for the treatment of proliferative disease e.g. , radiotherapy, surgery, or chemotherapy.
  • a virus of the invention for the treatment of tumors may be by any suitable means that results in a concentration of the therapeutic that, combined with other components, is effective in preventing, ameliorating, or reducing tumors.
  • the agent may be contained in any appropriate amount in any suitable carrier substance, and is generally present in an amount of 1-95% by weight of the total weight of the composition.
  • the composition may be provided in a dosage form that is suitable for parenteral (e.g. , subcutaneously, intravenously, intramuscularly, or
  • compositions may be formulated according to conventional pharmaceutical practice (see, e.g. , Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988- 1999, Marcel Dekker, New York).
  • compositions according to the invention may be formulated to release the active compound substantially immediately upon administration or at any predetermined time or time period after administration.
  • controlled release formulations which include (i) formulations that create a substantially constant concentration of the drug within the body over an extended period of time; (ii) formulations that after a predetermined lag time create a substantially constant concentration of the drug within the body over an extended period of time; (iii) formulations that sustain action during a predetermined time period by maintaining a relatively, constant, effective level in the body with concomitant minimization of undesirable side effects associated with fluctuations in the plasma level of the active substance (sawtooth kinetic pattern); (iv) formulations that localize action by, e.g.
  • controlled release compositions adjacent to or in a sarcoma
  • formulations that allow for convenient dosing such that doses are administered, for example, once every one or two weeks
  • formulations that target proliferating neoplastic cells by using carriers or chemical derivatives to deliver the therapeutic agent to a sarcoma cell.
  • controlled release formulations obviate the need for frequent dosing during the day to sustain the plasma level at a therapeutic level.
  • controlled release is obtained by appropriate selection of various formulation parameters and ingredients, including, e.g. , various types of controlled release compositions and coatings.
  • the therapeutic is formulated with appropriate excipients into a pharmaceutical composition that, upon administration, releases the therapeutic in a controlled manner. Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, molecular complexes, nanoparticles, patches, and liposomes.
  • a composition of the invention may be administered within a pharmaceutically- acceptable diluent, carrier, or excipient, in unit dosage form.
  • Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the compounds to patients suffering from a disease that is caused by excessive cell proliferation. Administration may begin before the patient is symptomatic.
  • administration may be parenteral, intravenous, intraarterial, subcutaneous, intratumoral, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intrahepatic, intracapsular, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, suppository, or oral administration.
  • therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
  • a composition of the invention is desirably administered intravenously or is applied to the site of the needed apoptosis event (e. g. , by inj ection) .
  • Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene- polyoxypropylene copolymers may be used to control the release of the compounds.
  • parenteral delivery systems for delivering agents include ethylene- vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
  • the formulations can be administered to human patients in therapeutically effective amounts ⁇ e.g. , amounts which prevent, eliminate, or reduce a pathological condition) to provide therapy for a disease or condition.
  • therapeutically effective amounts e.g. , amounts which prevent, eliminate, or reduce a pathological condition
  • the preferred dosage of a composition of the invention is likely to depend on such variables as the type and extent of the disorder, the overall health status of the particular patient, the formulation of the compound excipients, and its route of administration.
  • Human dosage amounts for any therapy described herein can initially be determined by extrapolating from the amount of compound used in mice, as a skilled artisan recognizes it is routine in the art to modify the dosage for humans compared to animal models.
  • the dosage may vary from between about 10 7 pfu to about 10 11 pfu; or from about 10 8 pfu to about 10 10 pfu or from about 10 9 pfu to about 10 11 pfu In other embodiments this dose may be about 10 7 pfu, 10 8 pfu, 10 9 pfu, 10 10 pfu, 10 11 pfu.
  • a dosage amount may be adjusted upward or downward, as is routinely done in such treatment protocols, depending on the results of the initial clinical trials and the needs of a particular patient.
  • neoplasia After a subject is diagnosed as having neoplasia a method of treatment is selected. In neoplasia, for example, a number of standard treatment regimens are available. The marker profile of the neoplasia is used in selecting a treatment method. In one embodiment, neoplasia cells that are responsive to cell killing by NDV (e.g. , r73T-Rl 16).
  • NDV e.g. , r73T-Rl 16
  • Aggressive therapeutic regimens typically include one or more of the following therapies: surgical resection, radiation therapy, or chemotherapy. Assays for measuring cell viability
  • Agents useful in the methods of the invention include those that induce neoplastic cell death and/or reduce neoplastic cell survival, i.e. , viability.
  • Cell viability can be assayed using a variety of methods, including MTT (3-(4,5- dimethylthiazolyl)-2,5-diphenyltetrazolium bromide) (Barltrop, Bioorg. & Med. Chem. Lett. l : 611, 1991 ; Cory et al, Cancer Comm. 3, 207-12, 1991 ; Paull J. Heterocyclic Chem. 25, 911, 1988). Assays for cell viability are also available commercially.
  • MTT 3-(4,5- dimethylthiazolyl)-2,5-diphenyltetrazolium bromide
  • These assays include but are not limited to CELLTITER-GLO® Luminescent Cell Viability Assay (Promega), which uses lucif erase technology to detect ATP and quantify the health or number of cells in culture, and the CellTiter-Glo® Luminescent Cell Viability Assay, which is a lactate dehyrodgenase (LDH) cytotoxicity assay (Promega).
  • CELLTITER-GLO® Luminescent Cell Viability Assay Promega
  • LDH lactate dehyrodgenase
  • Candidate compounds that induce or increase neoplastic cell death ⁇ e.g., increase apoptosis, reduce cell survival) are also useful as anti-neoplasm therapeutics.
  • Assays for measuring cell apoptosis are known to the skilled artisan. Apoptotic cells are characterized by characteristic morphological changes, including chromatin condensation, cell shrinkage and membrane blebbing, which can be clearly observed using light microscopy. The biochemical features of apoptosis include DNA fragmentation, protein cleavage at specific locations, increased mitochondrial membrane permeability, and the appearance of phosphatidylserine on the cell membrane surface. Assays for apoptosis are known in the art.
  • Exemplary assays include TUNEL (Terminal deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling) assays, caspase activity (specifically caspase-3) assays, and assays for fas-ligand and annexin V.
  • Commercially available products for detecting apoptosis include, for example, Apo-ONE® Homogeneous Caspase-3/7 Assay, FragEL TUNEL kit
  • Neoplastic cells have a propensity to metastasize, or spread, from their locus of origination to distant points throughout the body.
  • Assays for metastatic potential or invasiveness are known to the skilled artisan. Such assays include in vitro assays for loss of contact inhibition (Kim et al. , Proc Natl Acad Sci U S A. 101 : 16251-6, 2004), increased soft agar colony formation in vitro (Zhong et al , Int J Oncol. 24(6): 1573-9, 2004), pulmonary metastasis models (Datta et al , In vivo, 16:451-7, 2002) and Matrigel-based cell invasion assays ( Hagemann et al. Carcinogenesis.
  • In vivo screening methods for cell invasiveness are also known in the art, and include, for example, tumorigenicity screening in athymic nude mice.
  • a commonly used in vitro assay to evaluate metastasis is the Matrigel-Based Cell Invasion Assay (BD Bioscience, Franklin Lakes, NJ).
  • mice are injected with neoplastic human cells.
  • the mice containing the neoplastic cells are then injected (e.g. , intraperitoneally) with vehicle (PBS) or candidate compound daily for a period of time to be empirically determined.
  • Mice are then euthanized and the neoplastic tissues are collected and analyzed for levels of NDV, NDV polypeptides, and/or NDV markers (e.g. , a transgene encoding a detectable moiety) using methods described herein.
  • PBS vehicle
  • NDV markers e.g. , a transgene encoding a detectable moiety
  • NDV NDV polypeptides
  • NDV marker levels mRNA or protein expression relative to control levels are expected to be efficacious for the treatment of a neoplasm in a subject (e.g. , a human patient).
  • the effect of a candidate compound on tumor load is analyzed in mice injected with a human neoplastic cell.
  • the neoplastic cell is allowed to grow to form a mass.
  • the mice are then treated with a candidate compound or vehicle (PBS) daily for a period of time to be empirically determined.
  • Mice are euthanized and the neoplastic tissue is collected.
  • the mass of the neoplastic tissue in mice treated with the selected candidate compounds is compared to the mass of neoplastic tissue present in corresponding control mice.
  • kits for the treatment or prevention of sarcoma includes a therapeutic or prophylactic composition containing an effective amount of an NDV (e.g. , r73T-Rl 16) in unit dosage form.
  • the kit includes a therapeutic or prophylactic composition containing an effective amount of NDV (e.g. , r73T-R116) in unit dosage form.
  • the kit comprises a sterile container which contains a therapeutic or prophylactic composition; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
  • an antibody of the invention is provided together with instructions for administering an NDV (e.g. , r73T-Rl 16) to a subject having or at risk of developing neoplasia.
  • the instructions will generally include information about the use of the composition for the treatment or prevention of neoplasia.
  • the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for treatment or prevention of neoplasia or symptoms thereof; precautions; warnings; indications; counter-indications; overdosage information; adverse reactions; animal pharmacology; clinical studies; and/or references.
  • the instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.
  • Example 1 Assembly of antigenome cDNA of NDV strain 73T.
  • cDNA Six subgenomic cDNA fragments generated by high-fidelity RT-PCR were assembled in the pUC19 vector.
  • the full length cDNA of NDV 73T was designated as p73T.
  • the nucleotide and deduced amino acid sequences of the F protein cleavage site (FPCS) in 73T were modified to that of the NDV LaSota strain (lentogenic, lento) or glycoprotein B (gB) of cytomegalovirus (CMV) (SI 16) ( Figure 1; double slash indicates the site of cleavage of the F protein).
  • the cDNA was completely sequenced to confirm the viral sequence.
  • F protein cleavage site Wt: ggg agg aga cag aaa cgc ttt; Lento: ggg ggg aga cag gaa cgc ctt; SI 16: cat aat aga acg aaa tec ttt; S116KM: cat aat aaa atg aaa tec ttt; R116: cat aat aga acg aaa cgc ttt.
  • Example 2. Transgene insertion into NDV 73T genome.
  • Transgenes were inserted into p73T at two locations: at the intergenic sequences between P and M or at the intergenic sequences between the HN and L junctions ( Figure 2A).
  • Construction of p73T cDNA containing a transgene at the P-M or HN-L junctions was performed by inserting the transgene cassette into Afel sites created between the P and M genes (nt 3148) or between the HN and L genes (nt 8231).
  • the inserted gene cassette contains the gene end (GE; 5'- TTAAGAAAAAA -3'), intergenic nucleotide (T), gene start sequence (GS; 5'- ACGGGTAGA -3'), and open reading frame (ORF) of the transgene.
  • GE gene end
  • T intergenic nucleotide
  • GS gene start sequence
  • ORF open reading frame
  • ten nucleotides (5'- cgccgcccacc-3') were inserted upstream of the initiation site to introduce a Kozak sequence.
  • the full length (FL) 73T cDNA containing the transgene at P-M or HN-L junction was designated as p73T-Pl or p73T-HNl , respectively.
  • p73T-Pl-HNl Full-length cDNA containing two separate transgenes at P-M and HN-L junctions in a single genome were constructed and designated as p73T-Pl-HNl ( Figure 2B).
  • an Afel site was introduced at the end of ORF the first transgene (#1) (nt 3169).
  • the 2 nd transgene ORF was PCR amplified with primers containing GE and GS sequences and inserted at the Afel site.
  • the antigenomic cDNA containing two transgene cassettes the P-M junction was designated as p73T-P2.
  • the NDV 73T NP, P, L proteins and antigenic cDNA were cloned under the control of the T7 RNA polymerase promoter and terminator.
  • the four plasmids were co-transfected into an RNA polymerase expressing cell line ( Figure 3A).
  • the recovered viruses were designated as r73T- lento or r73T-S l 16.
  • the r73T-lento and r73T- S l 16 were passaged in Vero cells with media with and without trypsin supplement.
  • the growth of r73T- lento is trypsin dependent whereas r73T-S l 16 can grow in medium without trypsin supplement.
  • F protein cleavage sequences in r73T-Sl 16, with and without hGM-CSF at the P-M junction, were assessed.
  • the 73T-S 1 16 strains were further passaged for 10 passages in Vero and human fibrosarcoma HT1080 cells at MOI 0.01 in media without supplement of trypsin. Mutations in the FPCS (R113K and/or Q114M) appeared at passage 7.
  • the SI 16R mutation was detected at passage 9.
  • the F, HN and transgene were sequenced and no additional mutations were found.
  • Example 4 Characterization of the recombinant 73T strain with different F protein cleavage sequences.
  • Recombinant 73T strain with novel modified F protein cleavage sequences included the following sequences:
  • the recombinant 73T strains with different FPCS were characterized with regard to MDT, ICPI, relative HT1080 cell killing, replication in Vero cells, and replication in eggs (Figure 4).
  • r73T-lento was engineered to contain the FPCS of the non-virulent strain LaSota. Replication of LaSota virus in the tissue cultures is trypsin dependent, as F protein cannot be cleaved. r73T-lento forms tiny plaques in Vero cells without trypsin supplement, indicating that the F protein is not cleaved and virus cannot spread efficiently from cell-to-cell.
  • r73- lento replicated at a low level in Vero cells (7.5 x 10 3 pfu/ml), but efficiently in eggs with endogenous trypsin-like enzyme (5.7 x 10 8 pfu/ml).
  • MDT mean death time
  • ICPI intracerebral pathogenicity index
  • r73T-Sl 16 can form relatively large plaques, and reaches a titer of 4.4 x 10 6 pfu/ml in Vero cells. This was comparable to the titers obtained when r73T-Sl 16 was grown in Vero cells supplemented with trypsin. This data indicated that the fusion protein cleavage site (FPCS) of r73T-Sl 16 can be cleaved without exogenous trypsin in tissue cultures. It was not virulent in chickens and showed 31 % cell killing in HT1080 cells. r73T-S116 was examined for its genetic stability by in vitro cell passage.
  • FPCS fusion protein cleavage site
  • r73T-Sl 16 mutant viruses were constructed by reverse genetics and evaluated. Except for r73T-Rl 16, r73T-Sl 16 and its derivatives were similar to the parental S 116 in that these mutant viruses were not virulent in chickens and were capable of similar levels of HT1080 cell killing. HT1080 cell killing was between 29%-31% for the single mutation and 48% for the double mutations.
  • the plaque size of Ml 14 and Kl 13M114 were significantly larger than SI 16.
  • Ther73T-Rl 16 mutant acquired one amino acid change at residue 116 (SI 16R) in the FPCS.
  • the Rl 16 next to the cleavage site is known to be important for efficient cleavage of the F protein.
  • r73T-R116 formed large plaques in Vero cells, grew to similar titers with and without trypsin supplement, and efficiently killed HT1080 cells (80%).
  • R116 increased chicken virulence as shown by the MDT assay (72, 80 hrs). Although the ICPI value (0.65) was ⁇ 0.7 in one test, it is preferable to further reduce its chicken virulence.
  • Example 5 r73T-R116 derivatives have reduced chicken virulence.
  • Virus can be engineered to express a transgene at the P-M junction (1) a 2 nd transgene at the HN-L junction (2) and an increased HN-L intergenic region that is extended by insertion of non-coding sequence (3) ( Figure 5A).
  • Figure 5A The same design for insertion of a transgene cassette at P-M junction as in Figure 2A is used here.
  • the 2 nd transgene cassette contains the L gene start sequence (GS; 5 '-ACGGGTAGA -3'), open reading frame (ORF) of the transgene, sequences from 3' untranslated region of the L gene (highlighted in italics) and the L gene end sequence (GE; 5'-TTAAGAAAAAA -3') ⁇
  • the non-coding sequence used to increase the HN-L junction were taken from paramyxoviruses type -1 (APMV-1), respiratory syncytial virus (RSV) or random sequence which does not have homology with any known sequence.
  • the insertion can be in the range of 60-318 nt. Insertion of a 2 nd transgene at HN-L allowed the virus to express two transgenes, such as hGM-CSF and GFP. Inserted sequences at the HN-L junction are listed ( Figure 5B).
  • Example 6 Modification of r73T-R116 and characterization of r73T-R116 derivatives.
  • r73T-Rl 16 virus was modified to increase the HN and L intergenic sequence by insertion of sequences of various lengths.
  • r73T-R116 derivatives were evaluated for infectivity by examining plaque formation and replication in cells and eggs; for avian pathogenicity by examining MDT and ICPI, and for tumor cell killing (Figure 6A).
  • Intergenic insertions of 318nt from APMV, 198nt from RSV and 198 random sequences indeed reduced virulence in chickens, with MDT >156hr and ICPI of 0.27, 0.0375 and 0, respectively.
  • a long insertion (random 198 nt) had an increased effect on reducing virulence than a short insertion (random 60 nt).
  • the insertion of 144, 102 and 60nt had some virulence in chickens, but MDT times were shorter.
  • ICPI values for the insertion of 144, 102 and 60nt were 0.74, 0.51 and 0.78, respectively.
  • Example 7 Growth kinetics of r73T viruses in eggs and Vero cells.
  • Rl 16i-318-APMV insertion also had a lower peak titer of ⁇ 7 logs.
  • SI 16 constructed by reverse genetics had no reduction in virus production in eggs. Therefore, among the R116 derivatives, the virus with RSV-198nt insertion was a top candidate of oncolytic virus in terms of growth properties in eggs.
  • the viruses were also evaluated in sero-free Vero cell clone 51D11, a proprietary cell line generated by Medlmmune. All the viruses replicated well under both MOI conditions (0.001 and 0.0001) ( Figure 8). The modification of 73T FPCS and intergenic insertion in the HN-L junction of Rl 16 did not affect virus growth in Vero cells.
  • Example 8 Selective cell killing of r73T and derivatives in cancer cells compared to the normal cells.
  • rT3T and its derivatives were evaluated for their cell killing in human fibrosarcoma HT1080 compared to normal human skin fibroblast CCD1122Sk cells, relative to untreated control cells ( Figures 9A and 9B). Data were obtained after infection with r73T derivatives at different doses ranging from 1 to 100,000 PFU for 72 nr.
  • the virus with lentogenic FPCS had the least killing
  • SI 16 at the FPCS was intermediate
  • virus with Rl 16 at FPCS had cell killing as efficient as r73T wt virus.
  • cell killing of all viruses was not as efficient as that for cancer cells. The reduction in killing efficiency was ⁇ 100-fold.
  • Example 9 r73T derivatives had anti-tumor activity in vivo when delivered either systemically or intratumorally to immunodeficient mice carrying human tumor xenografts.
  • HT1080 xenograft model was established by injecting the HT1080 cells at a concentration of 5 x 10 6 cells/0, lml subcutaneously into Balb/C athymic nude mice at age of 5-6 week old.
  • hGM-CSF has no cross reactivity in mouse, this study was not geared to assess the transgene effect, but the oncolytic capability of various r73T constructs.
  • mice received a sing le dose of either PBS or 2 x 10 7 Pfu of r73T- hGM-CSF-R116i-198 administered intratumorally (IT) or 1 x 10 8 PFU administered intravenously (IV) via tail vein injection. Tumor size was measured every 3-4 days. As presented in Figure 10A, r73T-Rl 16i could induce significant tumor regression when it was either administrated by IV or IT. The amount of tumor regression induced by the two routes was comparable, and was significantly different from the control group.
  • r73T-lento was the least effective whereas r73T wt was the most effective in tumor regression.
  • r73T-lento had similar effect as the SI 16 virus although SI 16 virus had 10-fold lower EC so for in vitro cell killing ( Figure 9A).
  • r73T-R116i-318 was as potent as 73T wt in inhibition of tumor growth until 9 days post the 2 nd dose (day 19 post tumor implantation), the tumor grew back in Rl 16i treated mice, but not in the 73T wt treated group.
  • r73T derivatives had anti-tumor activity in vivo when delivered either systemically or intratumorally to immunodeficient mice carrying human tumor xenografts.
  • the efficient cleavage of the F protein is important for virus replication in vitro and in vivo.
  • the viruses with the Rl 16 at the FPCS were more potent in cell killing in vitro and in vivo.
  • Example 10 Tissue biodistribution of r73T derivative following intravenous delivery.
  • virus The presence of virus was quantified by plaque assay in Vero cells, and hGM-CSF transgene expression was measured by ELISA assay.
  • Virus replication in tumor and organs were assessed on day 1, 4 and 8 post infection. Virus was only detected in organs on day 1 (no virus was detected in ovary at all time points) and virus load in tumor tissues was -100- fold higher than lungs and spleens (Figure 11 A). The presence of virus in tumor persisted for at least 8 days, indicating that the virus selectively replicated in tumor tissues. Consistent with the viral replication data, the level of hGM-CSF was the highest and lasted more than 8 days ( Figure 1 IB). These data demonstrated that the NDV virus can effectively replicate in tumor tissue and deliver the transgene to the local tumor tissue effectively.
  • Example 11 Antigenome cDNA of 73T containing chimeric F and/or HN gene.
  • Viral surface glycoproteins are important antigens for immunogenicity and virulence in chickens. Strategies were explored to replace the F and HN genes of NDV by the corresponding extracellular (ecto) domains of other paramyxoviruses which are not virulent in chickens individually or in combination.
  • Parainfluenza virus 5 (PIV 5) is a canine paramyxovirus and does not cause diseases in human.
  • Pigeon paramyxovirus type 1 (PPMV- 1) has been shown to be nonvirulent in chickens with an ICPI of 0.025, as previously reported, and is antigenically distinct from NDV (Dortmans et al, Veterinary Microbiology, 2010, vo.
  • PIV5-F chimera did not grow in eggs and was not virulent in chickens, and killed HT1080 cells at 47%. Serum cross reactivity between the NDV and PPMV-1 or PIV5 chimeras was examined by neutralization assay using the serum collected from mice that received two intravenous doses of 1 x 10 8 PFU of r73T-Rl 16i. The r73T virus was neutralized with the NDV-infected serum (titer 960) whereas the PPMV-1 and PIV5 chimera were not neutralized (titer ⁇ 4). This result confirmed that there was no cross reactivity between NDV and PPMV-1 or PIV5. Chimeric viruses with distinct antigenicities have the potential to serve as boosting oncolytic viruses for the patients that have developed anti-NDV immune responses during prior NDV treatment.
  • Example 12 Cancer cells sensitive to NDV were identified by cell panel screening.
  • FIG. 13 A and 13B provide an overview of the sensitivity by tumor type. Haematological cancer cell lines (leukemia and lymphoma) were relatively insensitive to NDV oncolysis whereas a majority of the melanoma, ovarian and pancreatic cell lines tested were sensitive to NDV.
  • the cells derived from the indicated cancer tissues were examined for cell killing by recombinant NDV 73T with Rl 16 at the FPCS and human GM-CSF. The number of the cells that showed greater than 50% killing by the virus infection at moi of 0.1 and total cell lines screened are indicated.
  • Example 13 r73T derivatives had tumor killing and/or tumor growth inhibiting activity in syngeneic melanoma model.
  • SI 16-RD NDV encoding human or murine GM- CSF was tested for efficacy in refined B16F10 syngeneic model ( Figure 15A and 15B).
  • lx 10 8 pfu was infected intratumorally for 3 doses and there were a minimum of 8 mice per group.
  • Significant tumor growth inhibition is demonstrated with >80% tumor growth inhibition ( Figure 15B).
  • Short term tumor regression was achieved with repeat intratumoral (i.t.) dosing, which also led to a significant increase in survival time 18 days for control relative to 42 days in treated group. Cessation of treatment after 3 doses was followed by tumor re-growth.
  • NDV variants Rl 16i and SI 16 encoding hGM-CF or mGM-CSF respectively were tested for efficacy in the mouse syngeneic immune competent CT26 colorectal tumor model.
  • Each virus was dosed with 1x10 s PFU of virus intra-tumorally for 4 doses. Tumors were a minimum of 100 mm 3 before dosing commenced. All animals treated with virus demonstrated potent anti-tumor activity as a monotherapy. With 11/12 animals tumor free following treatment with Rl 16 encoding human GM-CSF which is a 92% complete response rate.
  • Figure 15C shows NDV has potent anti-tumor activity in immune-competent mouse CT26 colorectal tumor model.
  • NDV variants Ros 16i and SI 16 encoding hGM-CF or mGM-CSF respectively were tested for efficacy in the mouse syngeneic immune competent CT26 colorectal tumor model.
  • Each virus was dosed with lxlO 8 PFU of virus intra- tumorally for 4 doses. Tumors were a minimum of 100mm 3 before dosing commenced. All animals treated with virus
  • FIGS 15D-F show that multiple dosing with rNDV Rl 16i caused tumor growth inhibition and drove immune cell recruitment into ovarian cancer (OVCAR4) xenograft model.
  • OVCAR4 ovarian cancer xenograft model
  • This model is slow growing and has gross pathology pronounced of human ovarian tumors with a poorly differentiated cell morphology and large ascetic like fluid filled areas.
  • mice were randomized to receive 8 doses of Rl 16i NDV encoding either mouse or human GM-CSF or PBS as a control. Only the product from the murine gene sequence would be bioactive in the mouse model.
  • Example 14 NDV viruses induced tumor regression.
  • 73T-R116i-hGM-CSF and 73T-R116i-mGM-CSF were evaluated for oncolytic effect in the B16 melanoma model.
  • the study evaluated virus tolerability in the B 16 mouse. Each virus was dosed at 2xl0 7 pfu twice on days 11 and 14 intravenously (i.v) or intraperitoneally (i.p), or once on Day 11 at l. lxlO 7 pfu intratumorally (i.t).
  • the groups treated with Rl 16- hGM-SCF or mGM-SCF by three different routes of administration had slower rate of tumor growth compared to the untreated group (Figure 15A). Each group included 3 mice. The tumor inhibition rates were statistically significant from the control group.
  • r73T derivatives of the invention had advantageously low avian pathogenicity, high oncolytic activity, and replicated to high titers in chicken eggs. Based on these results, viruses of the invention are useful to induce tumor regression and enhance cancer patient treatment outcomes (Figure 16).
  • transgenes include the following:
  • Cytokines or engineered variants of cytokines such as GM-CSF, IL-2, IL- 21 , IL-15, IL-12 and IL-12p70
  • Flt3 B. l (CD80), CD137L, CXCL10 (IP-10), CCL5, CXCL9.
  • Myc inhibitor Omomyc.
  • Transgenes for in vivo imaging purposes such as Sodium iodide symporter (NlS)-mediated radiovirotherapy for
  • tumor killing including, but not limiting to, inhibitors of cell cycle progression, inhibition of anti-apoptotic proteins, enhacenment of pro- apoptotoic proteins, inhibition of key oncogenic drivers of malignant transformation.
  • These may include transgenic delivery of proteins following selective NDV replication in tumor cells, the production of selective or broad activity siRNA, the delivery of miRNA or the inhibition of selected miRNA (6)
  • Tumor antigens such as E6, E7, cancer testis antigens, oncofetal antigens, artificial or overexpressed proteins as novel tumor antigens either alone or in combination with other transgenes. (7)
  • Antibodies or recombinant fusion proteins that target immunomodulatory proteins to either block negative regulation or provide an agonistic signal to enhance T-cell function may include but are not limited to; PD-L1, CTLA4, CD-137 (4-1BB), OX40, GITR, TBI- 3, CD73, PD- 1 , HVEM, and LIGHT.
  • Example 15 Cancer therapy involving administration of oncolytic NDV in combination with immune modulatory mAb.
  • NDV oncolytic virus can be administered concurently or sequentially with therapeutic antibodies or agonistic fusion proteins where appropriate (e.g. anti-PD-Ll , anti-CTLA4, anti- OX40, anti-GITR, anti-TIM-3, anti-PD-1 and anti-ICOS).
  • Preclinical data are generated that establish the most effective dose and schedule of molecules that enhance the activity of NDV in tumor models in combination with the novel NDV constructs described herein.
  • Transgenes may be inserted into recombinant NDV for expression either singly or in combination to deliver multiple modes of activity, e.g. , to enhance the tumor cell death induced by the novel variants of NDV.
  • Increasing the release of tumor cell antigens combined with an immunomodulatory approach has the potential to increase the adaptive immune response to these liberated tumor antigens.
  • Example 16 F protein cleavage efficiency and fusion activity were reduced in F protein with R, S or S-KM mutation at the F protein cleavage site.
  • the F protein plasmid was transfected into 293 cells to examine F protein cleavage.
  • the F and HN plasmids were cotransfected to examine fusion activity in the transient assay as both the F and HN proteins are required for fusion formation ( Figures 3B and 3C).
  • Wt F protein was cleaved by host protease more efficiently than the F protein with R, S or S-KM mutation at the F protein cleavage site, very little F protein cleavage product (Fl) was detected in F with the S cleavage site and no cleavage product was detected in lentogenic F plasmid transfected cells.
  • the F protein of R and S construct has an N- linked glycosylation site (NXT) at the cleavage site resulting in the slower migrating mobility on the SDS-PAGE than lento and S-KM as the KM mutation abolished the glycosylation site.
  • NXT N- linked glycosylation site
  • Example 17 r73T-R116i virus with 198nt insertion exhibited slower growth and differential RNA and protein synthesis profile in DF-1 cells compared to Vero cells.
  • Rl 16i virus with 198nt inserted between the HN-L junction exhibited slower growth kinetics in chicken DF- 1 cells under high moi condition as shown in Figures 6B and 6D.
  • the growth difference of Rl 16i with 198nt insertion was reduced compared to the wt and the R virus that does not have the inergenic insertion at the earlier time points of infection (10-20h). In Vero cells, the growth difference among these viruses was not very apparent ( Figures 6C and 6E).
  • RNA and protein synthesis were further compared in human cell lines, human fibrosarcoma HT1080 and Hela cells, and DF-1 cells (Figure 6L). These data confirmed that Rl 16 ⁇ -198 or 198RSV had differential expression, the upstream RNA and protein synthesis increased while the L protein expression was down regulated. These data explained why Rl 16 ⁇ -198 or 198RSV viruses replicated well in the mammalian cell lines such as Vero, human HT1080 and Hela cells but did not grow well in embryonated chicken eggs and chicken DF-1 cells. It also provided basis of reduced chicken pathogenicity of these Rl 16i viruses as demonstrated by their low intra-cerebral pathogenicity index (ICPI) value.
  • ICPI intra-cerebral pathogenicity index
  • Example 18 Mouse GM-CSF transgene expression had lower tumor growth inhibition efficacy than human GM-CSF transgene expression in R116i-198RSV, but not in S116- KM.
  • Figure 11C compared contribution of the mGM-CSF with hGM-CSF transgene expression on oncolytic activity of Rl 16i-198RSV and SI 16-KM in HT1080 xenograft mouse tumor model.
  • hGM-CSF transgene does not cross react with mGM-CSF and it was therefore used as the control.
  • the mGM-CSF transgene in Rl 16i-198 administered intra-tumorally had lower efficacy in tumor growth inhibition compared to hGM-CSF. Similar tumor growth inhibition of mGM-CSF and hGM-CSF was observed for SI 16 virus.
  • Viral titers in viral treated tumors were determined by plaque assay (Figure 1 ID).
  • Figure 11 G showed similar tumor growth inhibition activity of R 116i with 198 or 318 nt inserted between the HN-L junction containing the same hGM-CSF transgene in the HT1080 xenograft mouse tumor model.
  • the 318 nucleotide insertion in the HN-L junction did not reduce viral oncolytic virus activity.
  • the complement (C) system is a major defense system against microbial invasion in the host.
  • Membrane bound C regulators (RCA) include 4 well characterized molecules: hCD46, hCD55, hCD59 and hCD35. Their main function is to protect human cells against autologous complement attack without affecting the role of C in eliminating foreign agents.
  • These RCA proteins are host species-specific.
  • NDV used for viral therapy in the past was generally produced in embryonated chicken eggs. It is expected that NDV oncolytic virus administered by intravenous injection to cancer patients might be cleared rapidly, therefore reducing effective viral dosing. Since enveloped viruses produced from human cells incorporate RCA proteins during their egress from the infected cells, it is therefore desirable to produce NDV in human cell culture to reduce C mediated viral lysis or inactivation.
  • hCD55, hCD59 or hCD46 transgene was inserted into NDV genome by reverse genetics and recombinant viruses expressing each of the three RCA proteins were produced. Western blot analysis showed that each of these RCA proteins was expressed by virus and incorporated into virions ( Figure 19).
  • hCD55 was determined to be the major RCA protein conferring to C inactivation function ( Figure 20).
  • the virus expressing hCD55 produced in eggs with hCD55 incorporated into virions was most resistant to C mediated inactivation, which is very close to the viruses produced in Hela cells.
  • hCD46 had marginal improvement in terms of viral resistant to C inactivation and hCD59 did not have detectable role in C regulation.
  • Hela cells are considered the cell line of choice for viral production.
  • the following cell lines and corresponding media were used: African green monkey kidney Vero cell line (ATCC) and human fibrosarcoma (HT1080, ATCC), Eagle's minimal essential medium (EMEM, Hyclone) with 10% fetal bovine serum (FBS); Vero clone 51D11 line (Medlmmune), serum free media (SFMMegaVir, Hyclone) with 1 % glutamine; normal human skin fibroblast cells (CCD 1122Sk, ATCC), ATCC formulated Iscove's Modified
  • NDV Newcastle disease virus
  • NDV sequences (GenBank) were aligned to obtain consensus sequences to design DNA oligonucleotides for RT-PCR of the viral RNA.
  • Six subgenomic cDNA overlapping fragments spanning the entire NDV genome were generated by high- fidelity RT-PCR ( Figure 1).
  • the pUC19 vector was modified to include an 88 nt oligonucleotide linker containing restriction sites introduced between the EcoRl and Hindlll sites for sequential assembly of full-length antigenomic cDNA of the NDV 73T strain.
  • the 73T strain cDNA plasmid contains a 27 nucleotide (nt) T7 RNA polymerase promoter at the 5 'end and a 189 nt containing HDV antigenome ribozyme sequence and a T7 RNA polymerase transcription-termination signal at the 3' end.
  • nt 27 nucleotide
  • gB glycoprotein B
  • NP, P and L expression plasmids For construction of NP, P and L expression plasmids, the protein open reading frames (ORF) were amplified by RT-PCR and cloned into plasmid pCITE2a under the control of the T7 RNA polymerase.
  • ORF protein open reading frames
  • an Afel restriction site was introduced at nt 3148 in the subclone plasmid containing SacII-Pmll fragment (Fig 2A).
  • the cDNA encoding human or mouse granulocyte-macrophage colony- stimulating factor (GM- CSF) or interleukin 2 (IL-2) was codon optimized and synthesized by DNA 2.0.
  • a gene cassette contains the gene end (GE) of N, the gene start (GS) of P and the open reading frame (ORF) of the transgene, which was inserted into the Afel site.
  • the SacII-Pmll fragment from the resulting plasmid was shuffled into plasmid r73T and named as p73T-Pl.
  • an Afel restriction site was introduced at nt 8231 in the plasmid containing the Agel-Xbal fragment ( Figure 2A).
  • the gene cassette was generated by PCR using a pair of phosphate sense and antisense primers (Table 3) and inserted into Afel site.
  • the gene end (GE) and gene start (GS) sequences are underlined. Kozak sequence is shown in lower case. The sequences correspond to 5' or 3' sequences of the transgene are shown in italics. Except for the EGFP (H-N), all other primer pairs can be used for inserting the transgene between G- M or HN-L.
  • hGM-CSF human granulocyte-macrophage colony-stimulating factor
  • mGM-CSF mouse GM-CSF
  • hlL-2 and mlL-2 correspond to human and mouse interleukin 2 (IL-2), respectively.
  • the Agl-Xbal fragment from the resulting plasmid was shuffled into plasmid p73T, yielding p73T-HNl.
  • Another strategy to insert sequence at the HN-L junction was to insert a transgene cassette or sequences from other paramyxoviruses between the gene end signal (GE) of the HN and the gene start signal (GS) of the L ( Figure 4) at Afel site that was introduced at nt 8359.
  • the FL cDNA plasmid was designated p73T-R116i. Since the NDV genome length has to be in a multiple of 6 nucleotides (rule of 6), the antigenomic cDNA of various constructs were made to follow the rule of 6.
  • an Afel site was introduced at the end of the ORF of GM-CSF (nt 3619) ( Figure 2B).
  • the IL-2 ORF was amplified using a pair of phosphate sense and antisense primers containing the GE and GS sequences and inserted at the Afel site.
  • the SacII-Pmll fragment from the resulting plasmid including GM-CSF and IL-2 transcriptional cassettes was swapped back into plasmid r73T, yielding p73T-P2.
  • the chimeric NDV genomic DNA was produced by replacing the F and HN of NDV with those of pigeon paramyxovirus 1 (PPMV-1).
  • PPMV-1 pigeon paramyxovirus 1
  • the C-terminal coding sequence for the cytoplasmic tail and transmembrane portion of NDV 73T F was joined with the ectodomain F protein coding sequence of PPMV-1 (residues 1 to 502)
  • the N-terminal coding sequences of the NDV HN was fused with the HN (residues 46 to 577) by overlapping PCR reactions using GeneArt kit (Invitrogen).
  • the amplified fragment was digested and cloned into Pmll-Agel digested NDV cDNA.
  • the parainfluenza virus 5 (PIV-5) F or HN were introduced into the NDV 73T antigenomic cDNA by a similar cloning strategy.
  • the PIV5 F (residues 1 to 486) ectodomain was fused with the transmembrane and the cytoplasmic tail of NDV 73T F (residues 503 to 553).
  • the NDV HN (residues 1 to 45) was joined with the PIV5 HN ectodomain (residues 36 to 565).
  • the cDNA fragment was cloned into Pmll-Agel digested NDV antigenomic cDNA.
  • the mammalian cell line expressing the T7 RNA polymerase such as the BHK-T7 cells were transfected with the three plasmids expressing the NDV NP, P, and L proteins (0.4 ⁇ g, 0.4 ⁇ g, and 0.2 ⁇ g per well of a 6-well dish, respectively) and a plasmid encoding the NDV antigenomic cDNA (1.6 ⁇ g) using Lipofectamine 2000. Three days after transfection, the cell culture supernatant was injected into the allantoic cavities of 10 to 11 -day-old SPF embryonated chicken eggs or passaged in Vero cells to amplify the rescued virus.
  • r73T-Sl 16 were serially passaged for 10 times in Vero and human fibrosarcoma HT1080 cells at MOI of 0.01. After every 2-3 passages, viral RNA was isolated from the culture media, cDNA was amplified by RT-PCR and the F and/or HN genes were sequenced.
  • Virus plaque morphology in Vero cells and titer quantitation by plaque assay Virus plaque morphology in Vero cells and titer quantitation by plaque assay.
  • Vero cells on a 6-well plate were infected with serial diluted virus and incubated under 1 % methylcellulose overlay at 37° C for 3 days or 6 days for plaque morphology in the presence of trypsin (TrpyLETM, Invitrogen) for viral titer quantitation.
  • the cell monolayers were fixed with methanol and stained with chicken anti-NDV polyclonal antibody against whole inactivated NDV virus followed by exposure to horseradish peroxidase (HRP)- conjugated anti-chicken antibody (Dako).
  • HRP horseradish peroxidase
  • Virus chicken pathogenicity test by egg mean death time (MDT) and intracerebral pathogenicity index (ICPI) assays were tested for egg mean death time (MDT) and intracerebral pathogenicity index (ICPI) assays.
  • the pathogenicity of the r73T viruses was determined by the mean death time (MDT) test in 10-day-old SPF embryonated chicken eggs.
  • the ICPI test in 1 -day-old SPF chicks was conducted at the USDA's National Veterinary Service Laboratory (NVSL, Ames, Iowa).
  • NVSL National Veterinary Service Laboratory
  • 0.1 ml of a series of 10-fold dilution between 10 "6 and 10 "9 was inoculated into the allantoic cavities of 8-10 of 9-10-day-old eggs per dilution and incubated at 37°C.
  • the eggs were examined twice a day for 7 days to record the time of embryo death.
  • the MDT was calculated as the mean time (hr) for the minimum lethal dose of virus to kill all the inoculated embryos.
  • the MDT assay provides a reasonable prediction of virus pathogenicity.
  • 0.05 ml of a 1 : 10 dilution of fresh infective allantoic fluid for each virus was inoculated into group of 10 1 -day-old SPF chicks via the intracerebral route.
  • the birds were observed for clinical symptoms and mortality once every 8 hr for a period of 8 days. At each observation, the birds were scored as follows: 0 if normal, 1 if sick, and 2 if dead.
  • the ICPI is the mean of the score per bird per observation over the 8-day period.
  • the ICPI values ranges from 0.0 to 2.0.
  • the cells were plated in 96-well plates at 5 xlO 3 cells/well overnight infected with r73T at various MOI. Cell viability was determined by CellTiter Glo kit (Promega) per manufacture's manual. The relative percent of surviving cells is determined by comparing the ATP level of each testing sample to the untreated sample control of 100% viable. The data presented in the table is relative percent of the killed cells.
  • Athymic NCR homogenous nude mice (Taconic) were implanted subcutaneously (s.c.) with 5 x 10 6 HT1080 cells (in 100 PBS) into one flank. Viral treatment started when tumors reached a volume of 65-300 mm 3 . Recombinant 73T in 100 ⁇ was administered at different dose levels either locally by intratumor (i.t) injection or systemically by intratumor (i.t) injection into the tail vein, respectively. The control animals were injected with 100 ⁇ L ⁇ PBS only. Tumor growth was measured using a digital caliper, and tumor volume was calculated as 0.5 x (height) x width x length (mm 3 ). Mice were sacrificed when the body weight dropped by 20% of the original body weight or the tumor volume exceeded
  • mice bearing HT1080 human fibrosarcoma xenograft subcutaneous tumors were i.v injected with 10 8 pfu of r73T- Rl 16i-hGM-CSF. Three mice were terminated at 1, 4, and 8 day(s) post- injection. One mouse injected with PBS was terminated on day 8. The tumors, lungs, spleen, ovaries and serum samples were collected. The infectious virus titer in the tissue homogenates was quantified by plaque assay. Quantitation of the GM-CSF protein level by ELISA.
  • Tumors from NDV infected and PBS injected mice were homogenized in PBS using gentle MACS Dissociator (Miltenyi Biotec) per manufacturer's instruction. The supernatant from homogenized tissues or serum collected from mice were tested for the level of GM-CSF by a Duoset ELISA kit (R&D).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pulmonology (AREA)
  • Hematology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/EP2014/068619 2013-09-03 2014-09-02 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia Ceased WO2015032755A1 (en)

Priority Applications (26)

Application Number Priority Date Filing Date Title
RS20190176A RS58332B1 (sr) 2013-09-03 2014-09-02 Sastavi koji sadrže oslabljeni virus njukastl bolesti i postupci upotrebe za tretiranje neoplazije
CA2922071A CA2922071C (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
PL14761317T PL3041490T3 (pl) 2013-09-03 2014-09-02 Kompozycje zawierające atenuowany wirus choroby Newcastle i sposoby ich stosowania w leczeniu neoplazji
HRP20190250TT HRP20190250T1 (hr) 2013-09-03 2014-09-02 Pripravci koji sadrže ublaženi virus newcastleske bolesti i postupci uporabe za liječenje neoplazije
EP14761317.8A EP3041490B1 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
SI201431082T SI3041490T1 (sl) 2013-09-03 2014-09-02 Sestavki z oslabljenim virusom bolezni Newcastle in postopki uporabe za zdravljenje neoplazije
CN201480048630.4A CN106163532B (zh) 2013-09-03 2014-09-02 以减毒的新城疫病毒为特征的组合物和用于治疗瘤形成的使用方法
HK17105137.4A HK1231393A1 (zh) 2013-09-03 2014-09-02 以减毒的新城疫病毒为特徵的组合物和用於治疗瘤形成的使用方法
US14/916,102 US10519426B2 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated Newcastle disease virus and methods of use for treating neoplasia
DK14761317.8T DK3041490T3 (en) 2013-09-03 2014-09-02 COMPOSITIONS CONTAINING AN INCREASED NEWCASTLE DISEASE VIRUS AND PROCEDURES FOR USING NEOPLASY TREATMENT
SM20190094T SMT201900094T1 (it) 2013-09-03 2014-09-02 Composizioni con un virus attenuato della malattia di newcastle e metodi di utilizzo per trattare una neoplasia
MEP-2019-40A ME03345B (me) 2013-09-03 2014-09-02 SASTAVI KOJI SADRŽE OSLABLJjENI VIRUS NJUKASTL BOLESTI I POSTUPCI UPOTREBE ZA TRETIRANJE NEOPLAZIJE
KR1020217012332A KR102310692B1 (ko) 2013-09-03 2014-09-02 약독화된 뉴캐슬병 바이러스를 특징으로 하는 조성물 및 신생물을 치료하기 위한 사용 방법
ES14761317T ES2708755T3 (es) 2013-09-03 2014-09-02 Composiciones que presentan un virus de la enfermedad de Newcastle atenuado y métodos de uso para el tratamiento de la neoplasia
EP22160157.8A EP4101457A1 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
EP18188565.8A EP3508209B1 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
AU2014317215A AU2014317215C1 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated Newcastle disease virus and methods of use for treating neoplasia
EA201690425A EA039404B1 (ru) 2013-09-03 2014-09-02 Аттенуированный вирус ньюкаслской болезни (ndv) штамма 73т для лечения неоплазии, способ селективного цитолиза опухолевых клеток и способ индуцирования регресса опухоли с его использованием
JP2016537333A JP6557234B2 (ja) 2013-09-03 2014-09-02 弱毒化ニューカッスル病ウイルスを特徴とする組成物並びに新生物を治療するための使用方法
MX2016002771A MX367768B (es) 2013-09-03 2014-09-02 Composiciones que representan un virus de la enfermedad de newcastle atenuado y métodos de uso en el tratamiento de neoplasias.
LTEP14761317.8T LT3041490T (lt) 2013-09-03 2014-09-02 Kompozicijos, pasižyminčios susilpnintu niukaslio ligos virusu, ir jų panaudojimo būdai neoplazijų gydymui
KR1020167008307A KR102285894B1 (ko) 2013-09-03 2014-09-02 약독화된 뉴캐슬병 바이러스를 특징으로 하는 조성물 및 신생물을 치료하기 위한 사용 방법
PL18188565T PL3508209T3 (pl) 2013-09-03 2014-09-02 Kompozycje zawierające atenuowany wirus choroby Newcastle i sposoby ich stosowania w leczeniu neoplazji
CY20191100170T CY1121993T1 (el) 2013-09-03 2019-02-08 Συνθεσεις που χαρακτηριζονται απο εναν εξασθενημενο ιο ψευδοπανωλης και μεθοδοι χρησης για την αντιμετωπιση της νέοπλασιας
AU2019204419A AU2019204419B2 (en) 2013-09-03 2019-06-24 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
US16/684,241 US11471499B2 (en) 2013-09-03 2019-11-14 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361873039P 2013-09-03 2013-09-03
US61/873,039 2013-09-03

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US14/916,102 A-371-Of-International US10519426B2 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated Newcastle disease virus and methods of use for treating neoplasia
EP18188565.8A Previously-Filed-Application EP3508209B1 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
US16/684,241 Continuation US11471499B2 (en) 2013-09-03 2019-11-14 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia

Publications (1)

Publication Number Publication Date
WO2015032755A1 true WO2015032755A1 (en) 2015-03-12

Family

ID=51492938

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/068619 Ceased WO2015032755A1 (en) 2013-09-03 2014-09-02 Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia

Country Status (25)

Country Link
US (2) US10519426B2 (https=)
EP (3) EP3041490B1 (https=)
JP (2) JP6557234B2 (https=)
KR (2) KR102285894B1 (https=)
CN (2) CN111944767A (https=)
AU (2) AU2014317215C1 (https=)
CA (1) CA2922071C (https=)
CY (2) CY1121993T1 (https=)
DK (2) DK3041490T3 (https=)
EA (2) EA202191926A3 (https=)
ES (2) ES2914577T3 (https=)
HK (1) HK1231393A1 (https=)
HR (2) HRP20220653T1 (https=)
HU (1) HUE042382T2 (https=)
LT (2) LT3508209T (https=)
ME (1) ME03345B (https=)
MX (2) MX367768B (https=)
PL (2) PL3508209T3 (https=)
PT (2) PT3508209T (https=)
RS (2) RS63291B1 (https=)
SI (2) SI3041490T1 (https=)
SM (2) SMT201900094T1 (https=)
TR (1) TR201902073T4 (https=)
TW (1) TWI653334B (https=)
WO (1) WO2015032755A1 (https=)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3246410A1 (en) 2016-05-19 2017-11-22 Klinikum rechts der Isar der Technischen Universität München Vsv/ndv hybrid viruses for oncolytic therapy of cancer
US10035984B2 (en) 2009-02-05 2018-07-31 Icahn School Of Medicine At Mount Sinai Chimeric newcastle disease viruses and uses thereof
KR20180104483A (ko) * 2017-03-13 2018-09-21 대한민국(농림축산식품부 농림축산검역본부장) 신규한 종양용해성 바이러스 및 이의 용도
WO2018209194A2 (en) 2017-05-12 2018-11-15 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
US10251922B2 (en) 2013-03-14 2019-04-09 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
US10308913B2 (en) 2005-12-02 2019-06-04 Icahn School Of Medicine At Mount Sinai Chimeric viruses presenting non-native surface proteins and uses thereof
EP3552608A1 (en) * 2018-04-09 2019-10-16 Rapo Yerape B.H. Ltd Increased activity of oncoloytic newcastle disease virus
US11389495B2 (en) 2014-02-27 2022-07-19 Merck Sharp & Dohme Llc Combination method for treatment of cancer
US12024724B2 (en) 2016-01-08 2024-07-02 Replimune Limited Oncolytic virus strain
US12059444B2 (en) 2017-01-09 2024-08-13 Replimune Limited Altered virus
US12391957B2 (en) 2018-08-17 2025-08-19 Icahn School Of Medicine At Mount Sinai Recombinant Newcastle disease viruses and uses thereof for the prevention of RSV disease or human metapneumovirus disease
US12611454B2 (en) 2020-05-13 2026-04-28 Laboratorio Avi-Mex, S.A. De C.V. Recombinant vaccine against COVID-19 based on a paramyxovirus viral vector

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HUE042382T2 (hu) * 2013-09-03 2019-06-28 Medimmune Ltd Legyengített Newcastle betegség vírust tartalmazó készítmények és azok alkalmazása neoplázia kezelési eljárásában történõ alkalmazásra
CN107847610B (zh) * 2015-04-28 2022-02-01 塞维卡有限责任公司 基于piv5的扩增病毒样颗粒
CN107254450A (zh) * 2017-07-20 2017-10-17 扬州大学 克服鸡新城疫母源抗体影响的嵌合新城疫病毒疫苗载体候选株及构建方法
CN108486279A (zh) * 2017-09-21 2018-09-04 山东省农业科学院家禽研究所 一种基于荧光定量pcr技术检测鸽新城疫病毒的方法
CN112739359A (zh) * 2018-07-13 2021-04-30 西奈山伊坎医学院 Apmv及其用于治疗癌症的用途
CN110859968A (zh) * 2019-11-21 2020-03-06 四川安可康生物医药有限公司 激活对肿瘤的系统免疫反应的基因生物药物
JP7851254B2 (ja) * 2020-03-20 2026-04-24 オルナ セラピューティクス インコーポレイテッド 環状rna組成物及び方法
CN115197949A (zh) * 2021-04-13 2022-10-18 江苏康缘瑞翱生物医药科技有限公司 一种重组新城疫病毒rNDV-OX40L、其基因组、制备方法及其用途
US20220396809A1 (en) * 2021-06-03 2022-12-15 University Of Guelph Engineered newcastle disease virus vector and uses thereof
CN121263205A (zh) * 2023-02-06 2026-01-02 塞维卡有限责任公司 修饰的piv5疫苗载体:制造方法和用途
WO2025116613A1 (ko) * 2023-11-29 2025-06-05 주식회사 카브 재조합 뉴캣슬병 바이러스 벡터를 포함하는 암 치료용 약제학적 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001020989A1 (en) * 1999-09-22 2001-03-29 Mayo Foundation For Medical Education And Research Therapeutic methods and compositions using viruses of the recombinant paramyxoviridae family
WO2009095167A1 (en) * 2008-01-29 2009-08-06 Bayer Schering Pharma Aktiengesellschaft Attenuated oncolytic paramyxoviruses encoding avian cytokines
WO2009101149A2 (en) * 2008-02-14 2009-08-20 Bayer Schering Pharma Aktiengesellschaft Anti-tumour effective paramyxovirus
WO2010091262A1 (en) * 2009-02-05 2010-08-12 Mount Sinai School Of Medicine Of New York University Chimeric newcastle disease viruses and uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7724558B1 (en) * 1999-03-19 2010-05-25 Nec Corporation Magnetic signal transmission line
KR100801180B1 (ko) * 2006-09-26 2008-02-05 주식회사 고려비엔피 약독화된 재조합 뉴캐슬병 바이러스 및 이를 함유하는뉴캐슬병 백신
EP2968525A4 (en) * 2013-03-14 2016-10-26 Icahn School Med Mount Sinai MORBUS NEWCASTLE VIRUSES AND USES THEREOF
HUE042382T2 (hu) * 2013-09-03 2019-06-28 Medimmune Ltd Legyengített Newcastle betegség vírust tartalmazó készítmények és azok alkalmazása neoplázia kezelési eljárásában történõ alkalmazásra
CN109099045A (zh) * 2018-10-30 2018-12-28 浙江斯泰新材料科技股份有限公司 防松锁固型螺钉

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001020989A1 (en) * 1999-09-22 2001-03-29 Mayo Foundation For Medical Education And Research Therapeutic methods and compositions using viruses of the recombinant paramyxoviridae family
WO2009095167A1 (en) * 2008-01-29 2009-08-06 Bayer Schering Pharma Aktiengesellschaft Attenuated oncolytic paramyxoviruses encoding avian cytokines
WO2009101149A2 (en) * 2008-02-14 2009-08-20 Bayer Schering Pharma Aktiengesellschaft Anti-tumour effective paramyxovirus
WO2010091262A1 (en) * 2009-02-05 2010-08-12 Mount Sinai School Of Medicine Of New York University Chimeric newcastle disease viruses and uses thereof

Non-Patent Citations (49)

* Cited by examiner, † Cited by third party
Title
"Encyclopedia of Pharmaceutical Technology", 1988, MARCEL DEKKER
"Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT WILLIAMS & WILKINS
"Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOURT WILLIAMS & WILKINS
"The Cambridge Dictionary of Science and Technology", 1988
"The Glossary of Genetics", 1991, SPRINGER VERLAG
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 2001, WILEY INTERSCIENCE
AUSUBEL, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 1987
BARLTROP: "Bioorg. & Med. Chem. Lett.l", 1991, pages: 611
BENTON; DAVIS, SCIENCE, vol. 196, 1977, pages 180
BERGER; KIMMEL: "Guide to Molecular Cloning Techniques", 1987, ACADEMIC PRESS
CASSEL ET AL., CANCER, vol. 18, July 1965 (1965-07-01), pages 863 - 8
CASSEL ET AL., CANCER., vol. 52, 1983, pages 856 - 860
COLIGAN, CURRENT PROTOCOLS IN IMMUNOLOGY, 1991
CORY ET AL., CANCER COMM., vol. 3, 1991, pages 207 - 12
CREE ET AL., ANTICANCER DRUGS, vol. 6, 1995, pages 398 - 404
CROUCH ET AL., J. IMMUNOL. METH., vol. 160, pages 81 - 8
DATTA ET AL., IN VIVO, vol. 16, 2002, pages 451 - 7
DORTMANS ET AL., VETERINARY MICROBIOLOGY, vol. 143, 2010, pages 139 - 144
FRESHNEY, ANIMAL CELL CULTURE, 1987
GAIT, OLIGONUCLEOTIDE SYNTHESIS, 1984
GRUNSTEIN; HOGNESS, PROC. NATL. ACAD. SCI., USA, vol. 72, 1975, pages 3961
HAGEMANN ET AL., CARCINOGENESIS, vol. 25, 2004, pages 1543 - 1549
HALE; MARHAM: "The Harper Collins Dictionary of Biology", 1991
J. C. F. M. DORTMANS ET AL: "Passaging of a Newcastle disease virus pigeon variant in chickens results in selection of viruses with mutations in the polymerase complex enhancing virus replication and virulence", JOURNAL OF GENERAL VIROLOGY, vol. 92, no. 2, 21 October 2010 (2010-10-21), pages 336 - 345, XP055155911, ISSN: 0022-1317, DOI: 10.1099/vir.0.026344-0 *
JANKE M ET AL: "Recombinant Newcastle disease virus (NDV) with inserted gene coding for GM-CSF as a new vector for cancer immunogene therapy", GENE THERAPY, NATURE PUBLISHING GROUP, GB, vol. 14, no. 23, December 2007 (2007-12-01), pages 1639 - 1649, XP002606261, ISSN: 0969-7128, [retrieved on 20071004], DOI: 10.1038/SJ.GT.3303026 *
JOS CFM DORTMANS ET AL: "Virulence of newcastle disease virus: what is known so far?", VETERINARY RESEARCH, BIOMED CENTRAL LTD, LONDON, UK, vol. 42, no. 1, 23 December 2011 (2011-12-23), pages 122, XP021130364, ISSN: 1297-9716, DOI: 10.1186/1297-9716-42-122 *
KANGAS ET AL., MED. BIOL., vol. 62, 1984, pages 338 - 43
KAUR ET AL.: "Optimization of plasmid-only rescue of highly attenuated and temperature-sensitive respiratory syncytial virus (RSV) vaccine candidates for human trials", J. VIROL. METHODS, vol. 153, 2008, pages 196 - 202
KIM ET AL., PROC NATL ACAD SCI U S A., vol. 101, 2004, pages 16251 - 6
KIMMEL, A. R, METHODS ENZYMOL., vol. 152, 1987, pages 507
LORENCE, R. M.; REICHARD, K. W.; CASCINO, C. J. ET AL., PROC. AM. ASSOC. CANCER RES., vol. 33, 1992, pages 398
LUNDIN ET AL., METH. ENZYMOL., vol. 133, 1986, pages 27 - 42
MILLER; CALOS, GENE TRANSFER VECTORS FOR MAMMALIAN CELLS, 1987
MULLIS, PCR: THE POLYMERASE CHAIN REACTION, 1994
MURRAY ET AL., CANCER, vol. 40, 1977, pages 680 - 686
PAULL J., HETEROCYCLIC CHEM., vol. 25, 1988, pages 911
PETTY ET AL., COMPARISON OF J. BIOLUM. CHEMILUM, vol. 10, 1995, pages 29 - 34
PHILIPPE FOURNIER ET AL: "Oncolytic Newcastle Disease Virus as Cutting Edge between Tumor and Host", BIOLOGY, vol. 2, no. 3, 2 July 2013 (2013-07-02), pages 936 - 975, XP055155919, DOI: 10.3390/biology2030936 *
REICHARD, K. W.; LORENCE, R. M.; CASCINO, C. J. ET AL., SURG. FORUM, vol. 43, 1992, pages 603 - 606
REICHARD, K. W.; LORENCE, R. M.; KATUBIG, B. B. ET AL., J. PEDIATR. SURG., vol. 28, 1993, pages 1221
S. SAMAL ET AL: "A single amino acid change, Q114R, in the cleavage-site sequence of Newcastle disease virus fusion protein attenuates viral replication and pathogenicity", JOURNAL OF GENERAL VIROLOGY, vol. 92, no. 10, 15 June 2011 (2011-06-15), pages 2333 - 2338, XP055156082, ISSN: 0022-1317, DOI: 10.1099/vir.0.033399-0 *
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", COLD SPRING HARBOR LABORATORY PRESS
SAMBROOK: "Molecular Cloning: A Laboratory Manual", 1989
SINGLETON ET AL.: "Dictionary of Microbiology and Molecular Biology", 1994
VETERINARY MICROBIOLOGY, vol. 143, 2010, pages 139 - 144
WAHL, G. M.; S. L. BERGER, METHODS ENZYMOL., vol. 152, 1987, pages 399
WEIR: "Handbook of Experimental Immunology", 1996, article "Methods in Enzymology"
WEISS, S. R.; BRATT, M. A., J. VIROL, vol. 13, 1974, pages 1220 - 1230
ZHONG ET AL., INT J ONCOL., vol. 24, no. 6, 2004, pages 1573 - 9

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10308913B2 (en) 2005-12-02 2019-06-04 Icahn School Of Medicine At Mount Sinai Chimeric viruses presenting non-native surface proteins and uses thereof
US10035984B2 (en) 2009-02-05 2018-07-31 Icahn School Of Medicine At Mount Sinai Chimeric newcastle disease viruses and uses thereof
US10251922B2 (en) 2013-03-14 2019-04-09 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
US11389495B2 (en) 2014-02-27 2022-07-19 Merck Sharp & Dohme Llc Combination method for treatment of cancer
US12397053B2 (en) 2016-01-08 2025-08-26 Replimune Limited Engineered virus
US12458696B2 (en) 2016-01-08 2025-11-04 Replimune Limited Modified oncolytic virus
US12465639B2 (en) 2016-01-08 2025-11-11 Replimune Limited GB Modified oncolytic virus
US12564633B2 (en) 2016-01-08 2026-03-03 Replimune Limited Oncolytic virus strain
US12024724B2 (en) 2016-01-08 2024-07-02 Replimune Limited Oncolytic virus strain
US12049647B2 (en) 2016-01-08 2024-07-30 Replimune Limited Engineered virus
EP3246410A1 (en) 2016-05-19 2017-11-22 Klinikum rechts der Isar der Technischen Universität München Vsv/ndv hybrid viruses for oncolytic therapy of cancer
US10906942B2 (en) 2016-05-19 2021-02-02 Klinikum Rechts Der Isar Der Technischen Universität München VSV/NDV hybrid viruses for oncolytic therapy of cancer
WO2017198779A1 (en) * 2016-05-19 2017-11-23 Klinikum Rechts Der Isar Der Technischen Universität München Vsv/ndv hybrid viruses for oncolytic therapy of cancer
US12059444B2 (en) 2017-01-09 2024-08-13 Replimune Limited Altered virus
KR101964610B1 (ko) 2017-03-13 2019-04-03 대한민국 신규한 종양용해성 바이러스 및 이의 용도
KR20180104483A (ko) * 2017-03-13 2018-09-21 대한민국(농림축산식품부 농림축산검역본부장) 신규한 종양용해성 바이러스 및 이의 용도
US12042534B2 (en) 2017-05-12 2024-07-23 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
CN111246877A (zh) * 2017-05-12 2020-06-05 西奈山伊坎医学院 新城疫病毒及其用途
WO2018209194A3 (en) * 2017-05-12 2018-12-20 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
WO2018209194A2 (en) 2017-05-12 2018-11-15 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
WO2019197275A1 (en) * 2018-04-09 2019-10-17 Rapo Yerapeh B.H. Ltd Increased activity of oncolytic newcastle disease virus
EP3552608A1 (en) * 2018-04-09 2019-10-16 Rapo Yerape B.H. Ltd Increased activity of oncoloytic newcastle disease virus
US12391957B2 (en) 2018-08-17 2025-08-19 Icahn School Of Medicine At Mount Sinai Recombinant Newcastle disease viruses and uses thereof for the prevention of RSV disease or human metapneumovirus disease
US12611454B2 (en) 2020-05-13 2026-04-28 Laboratorio Avi-Mex, S.A. De C.V. Recombinant vaccine against COVID-19 based on a paramyxovirus viral vector

Also Published As

Publication number Publication date
AU2019204419A1 (en) 2019-07-11
EA202191926A2 (ru) 2021-10-29
PT3041490T (pt) 2019-02-06
SI3041490T1 (sl) 2019-03-29
DK3041490T3 (en) 2019-03-04
ES2708755T3 (es) 2019-04-11
EP3508209A1 (en) 2019-07-10
CY1126790T1 (el) 2024-12-13
EP3041490A1 (en) 2016-07-13
JP6557234B2 (ja) 2019-08-07
HK1225643B (en) 2017-09-15
TW201606079A (zh) 2016-02-16
KR20210048605A (ko) 2021-05-03
TWI653334B (zh) 2019-03-11
AU2019204419B2 (en) 2021-09-02
EP4101457A1 (en) 2022-12-14
HRP20220653T1 (hr) 2022-06-24
KR20160047570A (ko) 2016-05-02
CN106163532A (zh) 2016-11-23
CY1121993T1 (el) 2020-10-14
KR102285894B1 (ko) 2021-08-04
HRP20190250T1 (hr) 2019-05-31
EA202191926A3 (ru) 2022-01-31
EA039404B1 (ru) 2022-01-24
MX2016002771A (es) 2016-09-06
KR102310692B1 (ko) 2021-10-12
AU2014317215B2 (en) 2019-03-28
RS58332B1 (sr) 2019-03-29
US20200181581A1 (en) 2020-06-11
PL3041490T3 (pl) 2019-05-31
CA2922071A1 (en) 2015-03-12
MX2019010364A (es) 2019-10-07
PT3508209T (pt) 2022-05-27
JP2016533749A (ja) 2016-11-04
PL3508209T3 (pl) 2022-06-13
US10519426B2 (en) 2019-12-31
ES2914577T3 (es) 2022-06-14
AU2014317215A1 (en) 2016-04-14
JP6862500B2 (ja) 2021-04-21
CN106163532B (zh) 2019-12-31
EP3041490B1 (en) 2018-11-14
JP2019193662A (ja) 2019-11-07
US11471499B2 (en) 2022-10-18
US20160208222A1 (en) 2016-07-21
EP3508209B1 (en) 2022-03-09
HK1231393A1 (zh) 2017-12-22
SMT202200214T1 (it) 2022-07-21
AU2014317215A8 (en) 2016-04-21
CA2922071C (en) 2022-05-03
SI3508209T1 (sl) 2023-01-31
ME03345B (me) 2019-10-20
CN111944767A (zh) 2020-11-17
LT3041490T (lt) 2019-02-25
SMT201900094T1 (it) 2019-02-28
DK3508209T3 (da) 2022-05-30
AU2014317215C1 (en) 2019-09-12
HUE042382T2 (hu) 2019-06-28
EA201690425A1 (ru) 2016-08-31
LT3508209T (lt) 2022-06-10
TR201902073T4 (tr) 2019-03-21
RS63291B1 (sr) 2022-06-30
MX367768B (es) 2019-09-05

Similar Documents

Publication Publication Date Title
US11471499B2 (en) Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
CN102099045A (zh) 编码禽类细胞因子的减毒溶瘤性副粘病毒
CA3097306A1 (en) Coxsackie virus b for treating tumors
CN102559612B (zh) 表达尼帕脑炎病毒G蛋白的重组新城疫病毒LaSota疫苗株
HK40011356A (en) Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
HK40011356B (en) Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
HK40042398A (en) Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
HK1225643A1 (en) Compositions featuring an attenuated newcastle disease virus and methods of use for treating neoplasia
AU2020351014A1 (en) New oncolytic Newcastle Disease Viruses and recombinant NDV strains
CN113348244A (zh) Vsv嵌合载体
EP3868876A1 (en) New oncolytic newcastle disease viruses and recombinant ndv strains
EA052391B1 (ru) Улучшенные системы опосредованной клетками онколитической вирусной терапии

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14761317

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2922071

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016537333

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14916102

Country of ref document: US

Ref document number: MX/A/2016/002771

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 201690425

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 20167008307

Country of ref document: KR

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2014761317

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014761317

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2014317215

Country of ref document: AU

Date of ref document: 20140902

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016004698

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112016004698

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160302