Classifications

• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/483—Physical analysis of biological material
  • G01N33/487—Physical analysis of biological material of liquid biological material
  • G01N33/49—Blood
  • G01N33/4925—Blood measuring blood gas content, e.g. O2, CO2, HCO3
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01J—MEASUREMENT OF INTENSITY, VELOCITY, SPECTRAL CONTENT, POLARISATION, PHASE OR PULSE CHARACTERISTICS OF INFRARED, VISIBLE OR ULTRAVIOLET LIGHT; COLORIMETRY; RADIATION PYROMETRY
  • G01J3/00—Spectrometry; Spectrophotometry; Monochromators; Measuring colours
  • G01J3/28—Investigating the spectrum
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
  • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
  • G01N27/28—Electrolytic cell components
  • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
  • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
  • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
  • G01N27/28—Electrolytic cell components
  • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
  • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
  • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
  • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/84—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
  • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
  • G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
  • G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2800/00—Detection or diagnosis of diseases
  • G01N2800/04—Endocrine or metabolic disorders

Definitions

• HHSN268201200360P awarded by the NIH.
• the United States government has certain rights in the disclosure.
• the disclosure relates generally to devices that quantify and identify the presence or absence of ammonia or ammonimum ion in a sample of bodily fluid, water, or other environmental sample. In some embodiments, the disclosure relates to diagnosing a subject with an
• the device is a biosensor only requiring a sample of whole bodily fluid for detection and/or quantification of ammonia or ammonium ion.
• Elevated ammoma levels is a potentially fatal symptom associated with a variety of diseases such as cirrhosis of the liver and urea cycle disorders found in neonatal infants. Left untreated, hyperammonemia can lead to cognitive developmental issues, seizures, other neurological problems, and death.
• the current testing methods include fluorometry and tandem mass spectroscopy performed by central laboratories, which could take multiple days to produce a reliable diagnosis. These methods involve large, cumbersome, and expensive machinery, which prevents testing of ammonia levels at the bedside or home once the disorder has been identified. Therefore, a system for a point of care testing device may be desired, as this may allow administration of treatment to occur more rapidly, in turn improving the neurological development of infants as well as making cirrhosis
• Devices able to test for hyperammonemia may also be modified inexpensively to detect amino acid levels for applications in diagnosing and treating aminoacidopathies and other diseases.
• the present disclosure encompasses the recognition that hyperammonemia can be identified and/or characterized by identifying the levels or quantities of ammonia or ammonium ion in any sample, including a bodily fluid including human and non-human whole blood samples.
• the present disclosure relates to identifying the quantity, presence, or absence of ammonia or ammonium ion in bodily fluids by contacting a bodily fluid to a device disclosed herein.
• the methods disclosed herein do not comprise contacting the bodily fluid with any reagent or external stimuli prior to identifying or quantifying whether or how much one or more ammonia or ammonium ion are present in the bodily fluid.
• a system, method, and apparatus for point of care hyperammonemia sensors may be disclosed.
• the system may utilize a phenol, 2- phenylphenol, ninhydrin, potassium tetraiodomercurate(II), nitroprusside, sodium hydroxide, similar reagents, catalysts, and buffers, or a combination thereof.
• the system may also utilize hyohalite, chloramine T, bleach, or similar chemical. Oftentimes called Berthelot's Reaction or an indophenol reaction, this reaction may determine ammonia levels in various mediums by changing color upon detection ammonia concentration. This may be useful for medical systems, such as in diagnosing hyperammonemia and various aminoacidopathies; for civil engineering systems, such as in determining ammonia levels of wastewater treatment plants; or for home based systems, such as ammonia detection in aquariums or pipes.
• hyperammonemia sensors may be disclosed.
• the apparatus used may have a concavity, a fossa, or any other type of well as desired for the placement of the reagents and sample to be tested.
• Separating the sample and reagents may be a cation exchange membrane filter, such as Nafion or similar perfluorinated ionomers, to allow the passage of ammonia between the two sections of the well.
• Anion exchange membranes may also be used, as well as various polymeric hydrogels such as acrylamide, poly(ethylene glycol) diacrylate, poly(2-hydroxylethyl
• exemplary embodiments may include mechanisms for quantitative analysis of the color change by means of photodiodes and sensors or micro fluidic devices that require smaller amounts of reagent and samples.
• the present disclosure relates to a biosensor capable of measuring the total concentration of ammonia or ammonium ion in a sample with the use of a system comprising reagents for an indophenol or Berthelot reaction, such as hypchlorite, phenylphenol, a basic aqueous solution such as NaOH, and an alkali such as sodium acetate.
• the sensor or system comprises at least a first vessel comprising a basic buffer in aqueous or dried phase.
• a first vessel comprises a gel or hydrogel that comprises at least one or a combination of: an indophenoal reactant or reactants in dried or aqueous phase, a basic buffer in aqueous or dried phase, a alkali solution in aqueos or dried phase, and or an enzyme that oxidizes at least one amino acid substrate.
• the disclosure provides an ammonia or ammonium ion biosensor for measuring the total concentration of ammonia or ammonium ion.
• the detection or quantification of ammonia or ammonium ion is accomplished through colorimetric analysis whereby the reaction products of ammonia or ammonium ion are capable of emitting a wavelength in the visible spectrum of light.
• the system and/or biosensor comprises a diode configured to emit light in at least one vessel and a
• spectrophotometer configured to receive light emitted in a vessel containing indophenol or Berthelot reaction reactant products.
• the system and/or biosensor also detects the absence, presence or quantity of amino acids in solution.
• the system and/or biosensor comprises at least a first electrically conductive surface (for measuring) and at least a second electrically conductive surface (counter electrode), wherein the first electrically conductive surface having one or more indophenol reaction reagents described herein or a combination of any one or more indophenol reaction reagents described herein and any one or combination of constituent factors, mediators, one or a plurality of enzymes, wherein, if the device comprise one or more enzymes, the one or more enzymes selectively utililize one or more amino acids as substrates.
• the one or plurality of enzymes produce reaction products by reacting with the specified amino acids as substrates, wherein the mediators transport electrons between the reaction products and the electrode measures amino acid
• applied voltages at measuring between the first and second electrically conductive surfaces include such an applied voltage that, on a working curve representing the relationship between current value and applied voltage with respect to each of the one or plurality of specified amino acids, the distribution of current value at unchanged applied voltage as to individual amino acids.
• the first and/or second electrodes are positioned in, substantially adjacent to, or adjacent to at least one vessel in which an indophenol reagent decribed herein may react with one or more components of the reagents.
• ammonia of ammonium ion may be the reaction product of one of the enyxmatic reactions in which the indophenol reaction, using a phenol or phenol related campoud, can take place
• an apparatus, device, and/or system for point of care hyperammonemia sensors comprises at least a first vessel, or a concavity, a fossa, or any other type of well as desired for the placement of the reagents and sample to be tested.
• the first vessel may be bifurcated by a membrane disclosed herein or the first vessel may be immediately adjacent to a second vessel in fluid communication with the second vessel via a fluid exchange opening.
• a membrane is positioned at the fluid exchange opening.
• the membrane is capable of transporting ions from the first vessel to the second vessel or vice versa.
• the membrane is a cation exchange membrane filter, such as National® or similar membrane comprising perfluorinated ionomers.
• the membrane allows the passage of ammonia between the two vessels or between the two bifurcated sections of the at least first vessel.
• Anion exchange membranes may also be used, as well as various polymeric hydrogels such as acrylamide, poly(ethylene glycol) diacrylate, poly(2-hydroxylethylmethacrylate), or poly(vinyl alcohol).
• Other exemplary embodiments may include methods and mechnisms for quantitative analysis of ammonia or ammonium ion concentration in a sample by contacting a sample to a vessel comprising at least one indophenol reagent and/or a basic buffer, in either a solid or liquid phase, a section of the vessel exposed to at least a portion of a membrane disclosed herein.
• the method comprises detecting or quantitating the intensity of a color change within at least the first or second vessel before and after addition of a sample to the vessel or vessel.
• the method comprises contacting sample to at least a first vessel, a section or portion exposed or covered by at least one membrane disclosed herein, such first vessel also optionally comprising at least one indophenol reagent disclosed herein and/or a basic buffer, either in solid or liquid phase.
• the buffer may be an alkali solution such as sodium acetate or calcium acetate.
• the disclosure relates to a method of contacting a sample to the device, biosensor or system disclosed herein comprising at least a first and second vessel, said method comprises contacting or exposing the sample to the basic buffer in the at least first vessel, allowing ammonia from the sample to transfer to the second vessel comprising the indophenol reagents disclosed herein.
• the disclosure relates to a method of contacting a sample to the device, biosensor or system disclosed herein comprising at least a first and second vessel, said method comprises contacting or exposing the sample to the alkali solution in the at least first vessel, allowing ammonia from the sample to transfer to the second vessel comprising the indophenol reagents disclosed herein, the second vessel comprising one or a plurality of indophenol reactants, which after coming incontact with the ammonia produce a indephonel or indophenol related compound,
• the contents of the second vessel are exposed to light measue aborbance of light by indphenol compound or indophenol related compound at specific visible wavelengths of light, the absorbance is indicative of or proportionate to a quantity of ammonia or ammonium ion in the sample and whose absorbance is dectected by an individual performing the test or by a device that measures wavelengths which is incorprated in the device, biosensor, or system disclosed herein.
• the method comprises comparing the absorbance of the color or wavelength to a standard which indicates the degree or severity of a hpeyammonemia. In some embodiments, the method comprises contacting a sample to a device, biosensor, or system disclosed comprising a diode, phtodiode, and/or spectrophotometer or other device capable of measuring the aborbance of wavelength by the indophenol or indophenol related compounds produced as a product of an indophenol reaction within the device and exposed to a light.
• the deivce, biosensor, and/or system comprise a microfluidic circuit that comprises at least one conduit configured to receive the sample from a point external to the device, biosensor, and/or system, such microfluidic circuit comprises a conduit or seris of conduits in fluid communication with at least the first and/or second vessel and the one or combination of: a spectrophotometer, diode, or other device capable of measuring the absorbance of specific wavelengths by the indophenol or indophenol related compound upon its exposure to light.
• a spectrophotometer, diode, or other device capable of measuring the absorbance of specific wavelengths by the indophenol or indophenol related compound upon its exposure to light.
• the discosure relates to contacting or exposing a sample with an alkali buffer and/or a membrane disclosed herein within a vessel attached to an electrode able to measure the electron flow produced by indophenol or an indophenol related compound or redox transformation of the metabolite being analyzed.
• concentration of ammonia and or ammonium ion and/or metabolite in blood correlates with the electron flow or current measurments on the circuit that comprise the at least one electrically conductive surfaces.
• the disclosure relates to the reduction to practice of this concept, showing how to select the metabolite, how to choose an immobilized enzyme, how to do the immobilization (what polymer, what additives, etc), how to attach the components to the electrode, how to make a measurement and how do develop a prototype.
• This disclosure is used to measure ammonia or ammoniu ion and/or metabolites in blood of patients in real time. Aside from the sensor disclosed herein, there are no known sensors able to measure the proposed metabolites in real time.
• the disclosure also relates to a device or system comprising at least one electrically conductive surface (such as an electrode) operably connected to a diode, a spectrophotometer, voltmeter and/or amperometer, the electrode comprises components that, when combined and in the presence of an ammonia, cause a indophenol reaction.
• the indophenol reaction product comprises a molecule that emits a visible or known wavelength after exposure to light.
• the device and system disclosed herein comprise a diode, such as a photodiode, which emits light into the vessel comprising the indophenol reaction product thereby exciting the reaction product and causing the reaction product to emit a visible or known wavelength.
• the device and system disclosed herein comprise a spectrophotometer that detects and/or quantitates the intensity of the visible or known wavelength of light emitted by the indophenol reaction product.
• the disclosure also relates to a device and/or system that detects and quantifies amino acids.
• the device and/or systems comprise a vessel or well that comprises a metabolic enzyme disclosed herein or a functional fragment thereof.
• the enzymae or fragment thereof is immobilized to the vessel into which sample is initially place in the device, biosensor, system, test strip, or catridge. After contact with a sample, the enzyme or functional fragment thereof releases at least one or a series of electrons and ammonia, such that ammonia is free in solution and capable of moving between a first vessel to a second vessel through a membrane disclosed herein.
• the device comprises at least a first and second electrically conductive surface, wherein the first electrically conductive surface comprises a hydrogel comprising an ezyme disclosed herein and the second electrically conductive surface does not comprise a hydrogel or an enzyme; wherein a voltmeter and/or amperometer are configured in a circuit such that the voltmeter can detect a voltage differential between the first and second electrodes in the presence of an amino acid and/or wherein the amperometer can detect an increased current in the first electrode as compared to the second electrode in the presence of an amino acid.
• the at least one or a series of electrons are released after one or more enzymes within the hydrogel catalyzes the oxidation of the amino acid in a bodily sample in the presence of the one or more amino acids.
• Hydrogel formulations are used to entrap one or more enzymes (that utilizes the
• the coated electrode is contained within a electrochemical detection device capable of converting redox equivalents generated by the enzyme reaction into electron flow which in turn is measured as a current or voltage differential.
• Analyte concentration is derived using a calibration curve that correlates amperage or voltage differential to concentration of amino acid in the sample of bodily fluid.
• a small volume of whole blood is applied to or ammonia from the ahole blood diffuses to a vessel exposed to the electrode and the result is reported within minutes of the application or contact to the electrode.
• specific enzyme(s) and cofactor(s) are incorporated into the electrode in order to achieve analyte-specific reaction and response.
• the enzyme phenylalanine dehydrogenase is immobilized to the at least one electrically conductive surface optionally contained within a hydrogel.
• the disclosure provides a method of sorting a mixture of samples of bodily fluid comprising: contacting a plurality of bodily fluid samples to a device or system disclosed herein.
• the method of sorting or cataloguing a mixture of samples of bodily fluid further comprises the step of determining one or more concentrations of ammonia, ammonium ion, and/or amino acid in the bodily fluid sample, if in respect to the ammonia or ammonium ion concentration, based upon the presence or quantity of indophenol reaction products in one or more vessels or a current value or voltage differential value measured by the device; and, if in respect to determining one or more concentrations of amino acid in solution, based upon a current value or voltage differential value measured by the device.
• the method further comprises the step of comparing the one or more concentration of ammonia, ammonium ion, and/or amino acid in a sample of bodily fluid with one or more concentrations of ammonia, ammonium ion, and/or amino acid in sample of bodily fluid obtained from subject who does not have or is not suspected of having one or more aminoacidopathies or hyperammonemia, and cataloging, compiling, or identifying whether a sample of bodily fluid from a subject has an aminoacidopathy and/or hyperammonemia based upon their similarities or differences in concentration value to a sample of bodily fluid from a subject without an aminoacidopathy and/or hyperammonemia.
• the disclosure provides a method of diagnosing a subject with an hyperammonemia comprising:
• the method of diagnosing further comprises the step of determining one or more concentrations of ammonia and/or ammonium ion in a bodily fluid sample based upon a current value, voltage differential value, or a presence or absence of a wavelength of light emitted by an indophenol reaction product, indophenol or an indophenol related compound.
• the device and or system disclosed herein detects and/or measures scuh values.
• the method further comprises the step of comparing the one or more concentration of ammonia, ammonium ion, and/or amino acid in the one or more samples from the subject with one or more concentrations of amino acids in sample of bodily fluid obtained from subject who does not have or is not suspected of having one or more aminoacidopathies and/or hyperammonemia, identifying whether a sample of bodily fluid from a subject has an aminoacidopathy and or hyperammonemia based upon their similarities or differences in concentration value to the sample of bodily fluid from a subject without an aminoacidopathy and/or hyperammonemia.
• the disclosure also provides a method of monitoring the concentrations of ammonia or ammonium ion in subject over time in a sample of bodily fluid from a subject diagnosed or suspected as having hyperammonemia, the method comprising: contacting one or more samples of bodily fluid from a subject to a device or system disclosed herein and measuring the concentration of ammonia or ammonium ion of bodily fluid from the subject at one time point and performing a repeating of the measurement at least once at a different time point.
• the method of monitoring the concentrations of ammonia or ammonium ion in subject over time in a sample of bodily fluid from a subject diagnosed or suspected as having hyperammonemia further comprises the step of cataloguing the concentration values of the ammonia or ammonium ion over time.
• the method further comprises the step of comparing the one or more concentration of amino acids from the plurality of samples of bodily fluid from the subject over time and, optionally notifying a subject if the concentration of one or more ammonia or ammonium ion reaches or exceeds or drops below a threshold value that requires medical treatment or modification of diet.
• samples of bodily fluid are isolated from a subject having been diagnosed with or suspected as having hyperammonemia.
• a sample of bodily fluid such as a urine sample or a blood sample is isolated from the subject.
• the sample of bodily fluid is contacted to at least one electrode comprising at least one enzyme disclosed herein and the amino acid concentration in the sample of bodily fluid is measured based upon the magnitude of the voltage differential or current detected by the device comprising the at least one electrode.
• method of the present disclosure comprises contacting a sample of bodily fluid to at least one electrode comprising an immobilized enzyme disclosed herein, measuring the current or voltage difference between the at least one electrode and an electrically conductive surface that does not comprise an immobilized enzyme disclosed herein, determining the concentration of one or more amino acids in the sample of bodily fluid, and optionally, providing a readout of one or more concentration values to a subject from which the sample of bodily fluid was obtained.
• method of detecting ammonia or ammonium ion comprises contacting a sample of bodily fluid to at least one vessel comprising an hyohalite, an aqueous basic solution, and at least one compound comprising a phenyl group disclosed herein, measuring the current or voltage difference between the at least one electrode and an electrically conductive surface that does not comprise an immobilized enzyme disclosed herein, determining the concentration of ammonia or ammonium ion in the sample of bodily fluid, and optionally, providing a readout of one or more concentration values to a subject from which the sample of bodily fluid was obtained.
• the present disclosure provides methods comprising contacting a sample of bodily fluid from a subject to an aqueous basic solution or a basic buffer in a dried or powdered phase, exposing the sample to hyohalite and at least one compound comprising a phenyl group in the presence (or absence— to establish a control value) of a membrane comprising an ionomer, and optionally contacting a gel.
• the gel is a hydrogel comprising alginate.
• the present disclosure provides methods comprising detecting presence or level ammonia or ammonium ion in a sample of bodily fluid between cells in the sample.
• provided methods comprise determining that a particular set of detected interactions defines an threshold value (or control value) that is characteristic of an increased severity of hyperammonemia in that it distinguishes them from elevated or non-elevated amino acid levels in another sample of bodily fluid from the subject or from a sample of bodily fluid that is a reference or control sample such that, if the threshold value is reached, the device or system disclosed herein provides the subject with a signal or notification that treatment or diet modification should be sought.
• the step of detecting comprises detecting presence or level of ammonia or ammonium ion concentrations in a sample of bodily fluid that is characteristic of particular severity of disease in the sample in that it distinguishes them from a sample of bodily fluid that is a reference or control sample.
• the step of detecting comprises detecting presence or level of ammonia or ammonium ion concentrations in a sample of bodily fluid that is characteristic of particular severity of disease in the sample in that it distinguishes them from a sample of bodily fluid that is a reference or control sample.
• any of the methods disclosed herein do not comprise pre- treating the sample of bodily fluid prior to contacting the sample with the test strip, conduit, biosensor, and/or at least one electrically conductive surface. In some embodiments, any of the methods disclosed herein do not comprise using at step of treating the sample with liquid chromatography, gas chromatography, and/or electrophoresis before, simultaneously with or after contacting the sample to the test strip, conduit, biosensor, and/or at least one electrically conductive surface. In some embodiments, any of the methods disclosed herein comprise contacting the sample to at least one electrode that does not comprise an enzyme obtained from an organism other than a bacteria or a plant.
• the disclosure relates to methods of detecting the levels of ammonia or ammonium ion in whole blood by exposing a whole blood sample to one of the biosensors, systems, or devices disclosed herein.
• the disclosure also relates to manufacturing a biosensor disclosed herein by treating the membrane with one, two, three or more washes of an acidic solution prior to placement of the membrane at a fluid exchange opening or at a vessel.
• the disclosure relates to manufacturing a biosensor disclosed herein by treating the membrane with one, two, three or more washes of an acidic solution from about 0.1 M to about 1 M H 2 SO 4 prior to placement of the membrane at a fluid exchange opening or at a vessel.
• the disclosure also relates to manufacturing a biosensor disclosed herein by treating the membrane with one, two, three or more washes of an hydrogen peroxide solution from about 0.1 M to about 1 M H 2 0 2 prior to placement of the membrane at a fluid exchange opening or at a vessel.
• the disclosure relates to manufacturing a biosensor disclosed herein by treating the membrane with one, two, three or more washes of an acid solution and/or a hydrogen proxide solution prior to placement of the membrane at a fluid exchange opening or at a vessel.
• the disclosure also relates to manufacturing a biosensor disclosed herein by treating the membrane with one, two, three or more washes of an acid solution from about 0.1 M to about 1 M H 2 0 2 prior to placement of the membrane at a fluid exchange opening or at a vessel.
• the disclosure also relates to manufacturing a biosensor disclosed herein by treating the membrane with one, two, three or more of an acid solution comprising from about 0.1 M to about 1 M H 2 S0 4 and with one, two, three or more washes of an hydrogen peroxide solution comprising from about 0.1 M to about 1 M H 2 0 2 prior to placement of the membrane at a fluid exchange opening or at a vessel.
• the present disclosure provides a system comprising one or more devices disclosed herein optionally in operable connection to a electronic storage medium that compiles ammonia or ammonium ion and/or amino acid concentration values of a subject.
• the electronic storage medium comprises compiled amino acid concentration values of a subject over time.
• the system comprises at least one electrically conductive surface that comprises an enzyme disclosed herein, a mediator, and optionally a gel or hydrogel.
• the system comprises an electronic circuit that is in operable connection to the at least one electrodes and a diode, spectrophotometer, voltmeter and/or amperometer.
• the diode or spectrophotometer detect and wavelength of light emitted from the at least one vessel.
• the voltmeter and/or amperometer measures the respective voltage and/or amperage of the circuit across the at least one electrode when the at least one electrode is in the presence of one or more amino acids and/or ammonia concentrations.
• system comprising one or more devices disclosed herein optionally in operable connection to a electronic storage medium that compiles amino acid concentration values of a subject determines one or a plurality of concentration values of ammonia concentration values and/or amino acids in a sample of bodily fluid when the sample of bodily fluid is in contact with the at least one electrode and under conditions and for a time sufficient for for the indophenol reaction to take place or the one or more enzymes disclosed herein to oxidize its amino acid substrate, create a voltage differential or current change in the circuit and the device to display the concentration value on one or more displays.
• the device, system, and/or biosensor do not comprises one or more electrodes.
• the disclosure provides for a method comprising steps of: contacting a sample comprising cells with an electrode.
• the disclosure further provides for a method comprising steps of: contacting a sample under conditions and for a time sufficient for a set of interactions to occur between ammonia in a sample and the membrane described herein.
• the disclosure further provides for a method comprising steps of: contacting a whole blood sample under conditions and for a time sufficient for a set of interactions to occur between ammonia in a sample and the membrane described herein.
• the disclosure further provides for a method comprising steps of: contacting a sample comprising bodily fluid under conditions and for a time sufficient for a set of interactions to occur between the ammonia in the sample and the one or plurality of indophenol reaction reagents described herein.
• the disclosure relates to a biosensor comprising: at least one electrically conductive support, the electrically conductive support attached to a hydrogel, the hydrogel comprising at least one electron mediator, at least one reduction agent, and at least one metabolic enzyme or functional fragment thereof, wherein the hydrogel comprises alginate; and an amperometer and/or voltmeter operably connected to the at least one electrically conductive support or surface.
• the biosensor comprises at least three electrically conductive supports.
• the at least one electrically conductive support is a silver and silver chloride wire.
• the at least one electrically conductive support comprises at least one or a combination of metabolic enzymes chosen from: leucine dehydrogenase, tyrosine dehydrogenase, phenylalanine dehydrogenase, leucine oxidoreductase, tyrosine monooxygenase, alanine dehydrogenase, or glutamate dehydrogenase; or functional fragments thereof.
• the biosensor comprises at least a first and a second electrically conductive support, wherein the first electrically conductive support is attached to a hydrogel, the hydrogel comprising at least one electron mediator, at least one reduction agent, and at least one metabolic enzyme or functional fragment thereof, wherein said first and second electrically conductive supports being operably connected to said voltmeter and/or amperometer to apply a voltage therebetween.
• the at least one electrically conductive support comprises an electronegative or anionic chemical component.
• the at least one hydrogel comprises trehalose.
• the biosensor does not comprise one or more of the following: (i) uricase or a functional fragment thereof; (ii) a hydrogel comprising dextran or a derivative thereof; (iii) a bacterial cell; (iv) an electronic dipole configured for electrophoresis; and (v) 3, 4-DHB.
• the biosensor is at least 70% biologically active after about sixteen days in storage at 4 degrees Celsius. In some embodiments, the biosensor is at least 70% biologically active after about thirty days in storage at 4 degrees Celsius.
• the biosensor is at least 80%> biologically active after about thirty days in storage at 4 degrees Celsius In some embodiments, the biosensor is at least 90% biologically active after about thirty days in storage at 4 degrees Celsius In some embodiments, the biosensor is at least 95% biologically active after about thirty days in storage at 4 degrees Celsius. In some embodiments, the biosensor is not functionally dependent upon exposure to UV light or addition of any stimulus external to the biosensor.
• the at least one enzyme or functional fragment thereof is derived from a bacterial species and is immobilized in the hydrogel. In some embodiments, the at least one enzyme or functional fragment thereof is derived from a thermophillic bacterial species and is immobilized in the hydrogel. In some embodiments, the at least one enzyme or functional fragment thereof comprises at least about 70% sequence identity to SEQ ID NO: l or SEQ ID NO:2.
• the disclosure relates to a biosensor, device, or system disclosed herein comprise a circuit comprising at least a first and second electrode in electric communication to at least one or a combination of a diode, photodiode, spectrophotometer, or other device capable of measuring the presence, absence, or intensity of light emitted by an amount of indophenol or indophenol relate compound exposed to light.
• the cioruit comprises a wire.
• the wire comprises silver and silver chloride in operable connection to the voltmeter and/or amperometer.
• the biosensor, device, and/or system disclosed herein comprises a membrane optionally comprsing alginate comprises a block polymer with a formula
• the biosensor the at least one electrically conductive support is not covered by a membrane comprising cellulose or a derivative thereof.
• the at least one electron mediator is selected from: thionine, o-phenylenediamine, methylene blue, and toluidine blue.
• the at least one reduction agent is chosen from: NAD+ or FAD+.
• the disclosure also relates to a biosensor comprising: at least one electrically conductive support, the electrically conductive support attached to at least one hydrogel, the hydrogel comprising at least one electron mediator, at least one reduction agent, and at least one metabolic enzyme or functional fragment thereof; wherein the at least one enzyme or functional fragment thereof is at least 70% homologous to a phenylalanine dehydrogenase from Geobacillus
• thermoglucosidiasus and an amperometer and/or voltmeter operably connected to the at least one electrically conductive support.
• the enzyme or functional fragment thereof is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homologous to SEQ ID NO: l or at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homologous to a functional fragment of SEQ ID NO: 1.
• the enzyme or functional fragment thereof is not derived from a species other than a bacterial cell.
• the enzyme or functional fragment thereof is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homologous to SEQ ID NO:2 or at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homologous to a functional fragment of SEQ ID NO:2.
• the disclosure relates to a system comprising a biosensor comprising at least a first and second vessel; a fluid exchange opening positioned between the at least first and second vessel; at least one conduit in fluid communication with the at least first vessel, the at least one conduit configured to receive a fluid from a point external to the biosensor; and a membrane positioned at the fluid exchange opening; wherein the membrane comprises an ionomer, and wherein the first vessel or the second vessel comprise, individually or in combination: hyohalite, an aqueous basic solution, and at least one compound comprising a phenyl group.
• the disclosure also relates to a system comprising a biosensor disclosed herein optionally comprising an electric circuit comprising any one or combination of: a diode (such as a
• the system further comprises a sample of bodily fluid, such as whole blood.
• the system further comprises a digital display in operable connection to the at least one electrically conductive support (or surface) by an electrical circuit capable of carrying an a electrical signal corresponding to a measurement of current and/or voltage differential from the diode, a spectrophotometer, voltmeter and/or amperometer to the digital display, wherein the digital display is a configured to display one or more concentration values of ammonia or ammonium ion and/or an amino acid in a sample over time when the at least one electrically conductive support (or surface) is in contact with the sample for a time period sufficient for the indophenol reaction to take place.
• the system further comprises a computer processor in operable connection with the at least one computer storage memory.
• the metabolic enzyme is a phenylalanine dehydrogenase immobilized within the hydrogel and wherein the alginate concentration of the hydrogel is from about 1% to about 3% weight to volume of the total volume attached and/or contatcted to the at least one electrically conductive support.
• the disclosure also relates to a kit comprising a biosensor comprising a diode,
• spectrophotometer voltmeter and/or amperometer and a display configured in an electrical circuit such that, upon contact with at least one removable electrically conductive support, the circuit becomes closed such that the diode, spectrophotometer, voltmeter and/or amperometer are in operable communication with at least one electrically conductive support.
• the kit comprises at least one of the following: a plurality of test strips comprising one or a plurality of vessels configured to receive a sample, such as whole blood, wherein the one or plurality of test strips further comprises at least one conduit in fluid
• the kit comprises at least one of the following: a plurality of test strips comprising one or a plurality of vessels configured to receive a sample, such as whole blood, wherein the one or plurality of test strips further comprises at least one conduit in fluid communication with the at least first vessel and, individually or in combination: hyohalite, an aqueous basic solution, and at least one compound comprising a phenyl group.
• the kit comprises at least one of the following: a plurality of test strips comprising one or a plurality of vessels configured to receive a sample, such as whole blood, wherein the one or plurality of test strips further comprises at least one conduit in fluid
• the kit comprises at least one of the following: a plurality of test strips comprising: one or a plurality of vessels configured to receive a sample, such as whole blood, wherein the one or plurality of test strips further comprises at least one conduit in fluid
• the membrane comprises a hydrogel layer.
• the hydrogel layer comprises alginate.
• the a control or reference sample of bodily fluid a set of data comprising threshold values; and a set of instructions, wherein the set of instructions or the set of data optionally accessible remotely through an electronic medium.
• the kit comprises a solid support that comprises at least a first and a second electrode, wherein the first electrode comprises a hydrogel, the hydrogel comprising at least one electron mediator, at least one reduction agent, and at least one metabolic enzyme or functional fragment thereof; and wherein the second electrode is a control or reference electrode.
• the kit comprises a test strip comprising a solid support attached to a first and a second electrode described herein.
• the disclosure also relates to a method of determining or identifying a concentration of an ammonia or ammonium ion in a sample of bodily fluid comprising: (a) contacting a sample of bodily fluid to: (i) a biosensor comprising at least one electrically conductive support, the electrically conductive support attached to a vessel in fluid communication with a membrane disclosed herein and, optionally an amperometer and/or voltmeter operably connected to the at least one electrically conductive support; or (ii) a system comprising a biosensor comprising: at least one electrically conductive support attached to a vessel in fluid communication with a membrane disclosed herein and, optionally an amperometer and/or voltmeter operably connected to the at least one electrically conductive support; or (iii) a test strip disclosed herein; and/or (b) determining a quantity of ammonia or ammonimum ion in the sample.
• the sample of bodily fluid comprises blood or serum from a subject.
• the disclosure also relates to a method of quantifying a concentration of ammonia and/or an amino acid in a sample of bodily fluid comprising: (a) contacting a sample of bodily fluid to: (i) a biosensor comprising at least one electrically conductive support or surface, the electrically conductive support or surface attached to a hydrogel, the hydrogel comprising at least one electron mediator, at least one reduction agent, and at least one metabolic enzyme or functional fragment thereof, wherein the hydrogel comprises alginate; and an amperometer and/or voltmeter operably connected to the at least one electrically conductive support or surface; or (ii) a system comprising a biosensor comprising: at least one electrically conductive support or surface, the electrically conductive support or surface attached to at least one hydrogel, the hydrogel comprising at least one electron mediator, at least one reduction agent, and at least one metabolic enzyme or functional fragment thereof; wherein the at least one enzyme or functional fragment thereof is at least 70% homologous to a phenylalanine dehydrogenas
• the disclosure further relates to a method comprising a step of contacting a biosensor, system, or test strip disclosed herein, wherein the step of contacting a sample of bodily fluid of a subject to any of the disclosed biosensors, systems, or test strips comprises contacting the sample for a sufficient period of time to allow ammonia transport through the membrane and to expose the ammonia from the sample to reagents associated with an indophenol reaction. If amino acids are also being tested by the biosensors, systems, or test strips, such methods comprise contacting a sample for a sufficient period of time to allow oxidation of at least one amino acid in the sample of bodily fluid by the metabolic enzyme or functional fragment therof.
• the method does not comprise exposing the sample of bodily fluid to any external stimuli or reagent prior to contacting the sample to the at least one electrically conductive supports. In some embodiments, the method does not comprise exposing the sample of bodily fluid to iron ions and/or hydrozide ions prior to, simultaneously with, or after exposing the sample to the at least one electrode comprising a hydrogel. In some embodiments, the method does not comprise exposing the sample to a non-porous carrier, such as glass beads, contained within the device, test strip or biosensor. In some embodiments, the sample of bodily fluid contains whole blood or serum from a subject. In some embodiments, the sample of bodily fluid does not contain urine.
• the sample of bodily fluid does not contain bodily fluid other than whole blood or blood serum.
• the disclosure further relates to a method of diagnosing a metabolic disease in a subject comprising: (a) contacting a sample of bodily fluid to one or a combination of: (i) a biosensor comprising at least one electrically conductive support or surface, the electrically conductive support or surface attached to a vessel comprising an amount of indophenol or indophenol related compound; and, optionally an amperometer and/or voltmeter operably connected to the at least one electrically conductive support or surface; or (ii) a system comprising a biosensor comprising: at least one electrically conductive support or surface, the electrically conductive support or surface exposed to th at least first vessel or second vessel comprising the indophenol and/or indophenol related compounds; and an amperometer and/or voltmeter operably connected to the at least one electrically conductive support; or (iii) a test strip disclosed herein; (b) quantify
• hyperammonemia or a metabolic disease related to hyperammonemia if the one or more
• the metabolic disease is a hyperammonemia related disorder.
• the disclosure also relates to a method of determining patient responsiveness to a therapy comprising: (a) contacting a sample of bodily fluid to one or a combination of: (i) a biosensor comprising at least one electrically conductive support or surface, the electrically conductive support or surface attached to a vessel comprising an amount of indophenol or indophenol related compound; and, optionally an amperometer and/or voltmeter operably connected to the at least one electrically conductive support or surface; or (ii) a system comprising a biosensor comprising: at least one electrically conductive support or surface, the electrically conductive support or surface exposed to th at least first vessel or second vessel comprising the indophenol and/or indophenol related compounds; and an amperometer and/or voltmeter operably connected to the at least one electrically conductive support; or (iii) a test strip disclosed herein; (b) quantifying one or more concentration values of ammonia or ammonium ion in the sample; (c)
• test strip comprising a solid support and at least a first and a second electrode attached to the solid support, wherein the first electrode comprises a membrane, the membrane comprising a perfluirnated ionomer.
• the test strip is adapted for a portable device comprising: a diode, spectrophotometer, voltmeter and/or amperometer; and a digital display such that, when the test strip is contacted to the device, the first and second electrodes become operably connected to a closed electrical circuit comprising diode,
• the test strip comprises the at least one or combination of indophenol reagents in solid or liquid phase optionally separated from but in fluid communication with a conduit, volume, or space the at least first vessel.
• the disclosure also relates to a method of manufacturing any of the disclosed biosensors, test strips, systems disclosed herein that comprises at least one electrode, the method comprising: contacting the at least one electrode with a solution comprising at least one vessel, at least one conduit in fluid communication with the at least one vessel, and at least one indophenol reagent; subsequently contacting the at least one electrode with a basic buffer with a Na+, Ca+, C1-, and/or acetate concentration at or below about 1 M.
• FIG. 1 is an exemplary view of a system having the ability to detect ammonia or ammonium ion levels in a given sample applied to a first and second vessel separated by a membrane positioned at an fluid exchange opening.
• FIG. 2 is an exemplary view of a system comprising multiple vessels within which more than one indophenol reaction mat be performed in parallel.
• FIG. 3 shows exemplary reaction otherwise known as Berthelot's Reaction or an indophenol reaction.
• FIG. 4 shows an exemplary embodiment of a microfluidic testing device.
• FIG. 5 shows an exemplary flowchart for a method of quantitative point of care hyperammonemia sensing using embodiments of the disclosure.
• FIG. 6 shows an exemplary embodiment of a blood test strip for use with an electronic testing device.
• FIG. 7 shows an exemplary embodiment of a device comprising an electronic circuit comprising an electrode exposed to a vessel configured for performanceof the indophenol reaction; an analog to digital convertor, a microchip in electronic communication with a display.
• FIG. 8 shows the chemical composition of Nafion.
• FIG. 9 shows experimental data demonstrating how the concentration of sodium salt yields high recovery and transfer of ammonia from a sample.
• FIG. 10 shows experimental data demonstrating the differences in device
• FIG. 11 depicts a photograph of the 3D printed modular pieces snapped together around Nafion to form the bisected well utilized for the sensing experiments
• FIG. 12 depicts an indophenol reaction produces a linear curve with concentrations of ammonium chloride ranging from 0-750 ⁇ M with a COD of 0.9939.
• FIG. 13 depicts reagents for the indophenol reaction were stored at room temperature and used to generate an ammonia standard curve at regular intervals for 100 days. The response to 500 ⁇ ammonia began to degrade at day 75. The reagents of the indophenol reaction are stable at room temperature for up to 50 days before its response to different concentrations of ammonia begins to deteriorate.
• FIG. 14 depicts ImM concentrations of each of the 21 amino were tested using the indophenol reaction.
• the absorbance measured at 635nm for each amino acid after the indophenol reaction was calculated as percentage of the response from indophenol reaction with ImM ammonium chlroide.
• the radar graph displays the percent response as compared to ammonium chloride. The highest response was threonine which produced an absorbance value that was just 7% of ammonia's response.
• FIG. 15 The constructed sensor's response to a range of ammonia concentrations in
• FIG 16 Initial experiments of determining blood ammonia concentration
• FIG 17 Concentrations of 2-1 OX hypochlorite were utilized in the analysis of
• hypochlorite concentration 500mM ammonia in IX PBS and whole sheep's blood.
• concentration of hypochlorite utilized in the indophenol reaction reduced the negative interference small blood molecules had on the indophenol reaction.
• concentrations higher than 3X reaction itself began to degrade.
• a 3- fold increase in hypochlorite concentration was optimal.
• FIG 18 The bisected well sensor was again used to extract ammonia in whole human blood.
• FIG 19 The sensor's response to blood ammonia concentrations ranging from 0-
• FIG. 20 depicts a CAD sketch of the front face of the well plate of an embodiment.
• FIG. 21 depicts a CAD sketch demonstrating the area of the well plate of an embodiment that the adhesive silicone should be attached to (black area) prior to completing the manufacturing of the device.
• FIG. 22 depicts a photograph of the 3D-printed modular left and right sides pieces snapped together around National® to divide the well into two sections.
• FIG. 23 depicts an engineering drawing of 3D printed well.
• FIG. 24 depicts a CAD sketch of the top piece of a disposable catridge, with dimensions in mm. Channels 1 through 5 are labeled.
• FIG. 25 CAD sketch of the bottom piece of the chip with channel 6 labeled.
• FIG. 27 depicts the top half of an embodiment comprising a micro fluidic device used to quantify ammonia levels in whole blood.
• FIG. 28 depicts the bottom half of an embodiment comprising a microfluidic device used to quantify ammonia levels in whole blood.
• FIG. 29 is an exemplary view of a system having the ability to detect ammonia or ammonium ion levels and amino acids in a given sample applied to a first and second vessel separated by a membrane positioned at an fluid exchange opening, wherein the reaction is catalyzed by an enzyme.
• attachment generally refers to immobilizing or fixing, for example, a group, a compound or enzyme, to a surface, such as by physical absorption, chemical bonding, and like processes, or combinations thereof.
• biopsy means a cell sample, collection of cells, or bodily fluid removed from a subject or patient for analysis.
• the biopsy is a bone marrow biopsy, punch biopsy, endoscopic biopsy, needle biopsy, shave biopsy, incisional biopsy, excisional biopsy, or surgical resection.
• the terms "bodily fluid” means any fluid from a isolated from a subject including, but not necessarily limited to, blood sample, serum sample, a whole blood sample, urine sample, mucus sample, saliva sample, and sweat sample.
• the sample may be obtained from a subject by any means such as intravenous puncture, biopsy, swab, capillary draw, lancet, needle aspiration, collection by simple capture of excreted fluid.
• electronic medium mean any physical storage employing electronic technology for access, including a hard disk, ROM, EEPROM, RAM, flash memory, nonvolatile memory, or any substantially and functionally equivalent medium.
• the software storage may be co-located with the processor implementing an embodiment of the disclosure, or at least a portion of the software storage may be remotely located but accessible when needed.
• embodiments of the invention include the discussed feature, advantage or mode of operation.
• those skilled in the art may appreciate the wide variations in sizing scales that may be incorporated into the disclosed or related designs for use with samples many orders of magnitude larger or smaller than those disclosed.
• aminoacidopathy is meant to refer to those diseases and disorders characterized by dysfunction of a metabolic catalysis of amino acids thate results in over production or under production of amino acids in the body of a subject. . Examples of
• aminoaciopathies ar elisted in the definition of a metabolic disease, terms that are used
• sequence identity is determined by using the stand-alone executable BLAST engine program for blasting two sequences (bl2seq), which can be retrieved from the National Center for Biotechnology Information (NCBI) ftp site, using the default parameters (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250; which is incorporated herein by reference in its entirety).
• sequence identity is synonymous with a measured “sequence identity.”
• sequence identity refers to a disclosed nucleic acid sequence or amino acid sequence possessing a homology to a disclosed sequence over its entire length.
• the term "subject” is used throughout the specification to describe an animal from which a sample of bodily fluid is taken.
• the animal is a human.
• the term “patient” may be interchangeably used.
• the term “patient” will refer to human patients suffering from a particular disease or disorder.
• the subject may be a human suspected of having or being identified as at risk to develop an aminoacidopathy.
• the subject may be diagnosed as having at least one aminoacidopathy.
• the subject is suspected of having or has been diagnosed with hyperammonemia.
• the subject may be a human suspected of having or being identified as at risk to develop hyperammonemia.
• the subject may be a mammal which functions as a source of the isolated sample of bodily fluid.
• the subject may be a non-human animal from which a sample of bodily fluid is isolated or provided.
• the term "mammal" encompasses both humans and non-humans and includes but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.
• “conservative” amino acid substitutions may be defined as set out in Tables A, B, or C below.
• Metabolic enzymes include those amino acid sequences wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides disclosed herein. Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties.
• conservative amino acids can be grouped as described in Lehninger,
• polypeptides comprising polypeptide sequences associated with the extracellular matrix described herein are intended to include polypeptides bearing one or more insertions, deletions, or substitutions, or any combination thereof, of amino acid residues as well as modifications other than insertions, deletions, or substitutions of amino acid residues.
• the term "prognosing” means determining the probable course and/or outcome of a disease.
• the term indophenol related compound - a small chemical compound that is a reaction product of an indophenol reaction. In some embodiment, it comprises at least one carbon atom in a 4, 5, 6-membered ring and emits a visible wavelength of light upon excitation of the small chemical compound by light emitted by from light source. In some embodiments, the small chemical compound is a product of the indophenol reaction and emits a wavelength of light visible to the human eye upon excitation of the chemical compound by light emitted from a light source. In some embodiments, the small chemical compound emits a wavelength from about 400 nm to about 600 nm when it is excited by light from a light source. In some embodiments, the biosensor, device, and/or system comprises a light source and at least one diode and/or
• spectrophotometer or other device capable of measuring the light emitted by the indophenol or the indophenol related compound.
• a vessel as used herein is any chamber, indentation, container, receptacle, or space.
• a vessel is a well capable of holding no more than about 1,000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, 40, 30, 20, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 ⁇ of sample, bodily fluid.
• membrane means any monomer or polymer in a solid phase.
• the membrane comprises an ionomer.
• the membrane is incapable of gas chromatography.
• point of care refers to a device, biosensor, system, test strip, or catridge, either individually or configured to function with one or more additional components, capable of analyzing the presence, absence, or quantity of a reaction product, such as ammonia, and/or a sample component, such as an amino acid, within a time period no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 minutes.
• a reaction product such as ammonia
• a sample component such as an amino acid
• the terms refer to a device, biosensor, system, test strip, or catridge, either individually or configured to function with one or more additional components, capable of analyzing the presence, absence, or quantity of ammonia and/or an amino acid within a time period no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 minutes, or capable analyzing the presence, absence, or quantity of ammonia and/or an amino acid at or substantially near the point from which the sample was taken.
• the sample may be taken from a subject suspected of or previously diagnosed with hyperammonemia or a hyperammonemia-related disorder.
• the point of care device or biosensor or system is a point of care device which is capable of detecting the presence, absence, or quantity of ammonia or ammonium ion in a sample.
• fluid exchange opening means any space or void through which a fluid may pass from one vessel to an adjacent vessel or another vessel in fluid commuinication with the one vessel.
• a compound comprising a phenol substituent means any molecule comprising a phenyl group attached to a 4, 5, 6, or more-membered atomic ring comprising at least one carbon atom.
• ionomer refers to any polymer comprising an ion.
• the ionomer is a perflurinated ionomer.
• the ionomer comprises Formula I or a salt thereof.
• CF 2 CF-0-CF2-CF-0-CF2-CF2-CF 2 -S0 2 F
• CF 2 CF-0-CF 2 -CF-0-CF 2 -CF 3 -C0 2
• CF 2 CF-0-CF 2 -CF 2 -CF 2 -C0 2 CH 3 ,
• CF 2 CF-0-CF 2 -CF 2 -S0 2 F
• n and m are any positive integer.
• n and/or m are 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more.
• n and/or m are independently variable and any positive integer from about 1 to about 1000.
• n and/or m are independently variable and any positive integer from about 1 to about 500.
• body fluid means any sample taken from an animal including a human, or non-human animal.
• a functional fragment means any portion of a disclosed polypeptide that is of a sufficient length to retain at least partial biological function that is similar to or substantially similar to the function of the wild-type polypeptide upon which the fragment is based.
• a functional fragment of a polypeptide associated with the function of a metabolic enzyme is a polypeptide that comprises at least 70%, 75%, 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity of any polypeptides disclosed herein and has sufficient length to retain at least partial binding affinity to one or a plurality of substrates that bind to the polypeptide.
• the fragment is a fragment of any polypeptide disclosed herein and has a length of at least about 10, about 20, about 30, about 40, about 50 , about 60, about 70, about 80, about 90, or about 100 contiguous amino acids. In some embodiments, the fragment is a fragment of any polypeptide disclosed herein and has a length of at least about 50 amino acids. In some
• the fragment is a fragment of any polypeptide disclosed herein and has a length of at least about 100 amino acids. In some embodiments, the fragment is a fragment of any polypeptide disclosed herein and has a length of at least about 150 amino acids. In some embodiments, the fragment is a fragment of any polypeptide disclosed herein and has a length of at least about 200 amino acids. In some embodiments, the fragment is a fragment of any polypeptide disclosed herein and has a length of at least about 250 amino acids.
• polypeptide sequence associated with the metabolic enzyme means any polypeptide or fragment thereof, modified or unmodified by any
• polypeptide sequence is synthetic or recombinantly produced in any multicellular or unicellular organism.
• a polypeptide sequence associated with the extracellular matrix is any polypeptide which sequence comprises any of the polypeptides disclosed in Table 2.
• a polypeptide sequence associated with the metabolic enzyme is any polypeptide sequence
• a polypeptide sequence associated with the metabolic enzyme consists of any of the polypeptides disclosed in Table 2 or a sequence that shares 85, 90, 95, 96, 97, 98, or 99% sequence identity with the polypeptides disclosed in Table 2.
• salt refers to acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases. Examples of these acids and bases are well known to those of ordinary skill in the art. Such acid addition salts will normally be pharmaceutically acceptable although salts of non-pharmaceutically acceptable acids may be of utility in the preparation and purification of the compound in question. Salts include those formed from hydrochloric, hydrobromic, sulphuric, phosphoric, citric, tartaric, lactic, pyruvic, acetic, succinic, fumaric, maleic, methanesulphonic and benzenesulphonic acids.
• the device, system, membrane, or vessel may comprise any of the disclosed reagents or formula disclosed herein or any salt.
• Salts may be formed by reacting the free base, or a salt, enantiomer or racemate thereof, with one or more equivalents of the appropriate acid.
• salts of the present invention refer to salts of the disclosed reagents or formula disclosed herein having at least one basic group or at least one basic radical.
• salts of the present invention refer to salts of the disclosed reagents or formula disclosed herein having a free amino group, a free guanidino group, a pyrazinyl radical, or a pyridyl radical that forms acid addition salts.
• salts of the present invention refer to salts of the disclosed reagents or formula disclosed herein that are acid addition salts of the subject compounds with (for example) inorganic acids, such as hydrochloric acid, sulfuric acid or a phosphoric acid, or with suitable organic carboxylic or sulfonic acids, for example aliphatic mono- or di-carboxylic acids, such as trifluoroacetic acid, acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, fumaric acid, hydroxymaleic acid, malic acid, tartaric acid, citric acid or oxalic acid, or amino acids such as arginine or lysine, aromatic carboxylic acids, such as benzoic acid, 2-phenoxy-benzoic acid, 2-acetoxybenzoic acid, salicylic acid, 4-aminosalicylic acid, aromatic-aliphatic carboxylic acids, such as mandelic acid or cinnamic acid, heteroaromatic carboxylic acids,
• salts may be formed.
• the reaction may be carried out in a solvent or medium in which the salt is insoluble or in a solvent in which the salt is soluble, for example, water, dioxane, ethanol, tetrahydrofuran or diethyl ether, or a mixture of solvents, which may be removed in vacuo or by freeze drying.
• the reaction may also be a metathetical process or it may be carried out on an ion exchange resin.
• Salts according to the present invention may be found in their anhydrous form or as in hydrated crystalline form (i.e., complexed or crystallized with one or more molecules of water).
• an antibody refers to any immunoglobulin, whether natural or wholly or partially synthetically produced.
• an antibody is a complex comprised of 4 full-length polypeptide chains, each of which includes a variable region and a constant region, e.g., substantially of the structure of an antibody produced in nature by a B cell.
• an antibody is a single chain.
• an antibody is cameloid.
• an antibody is an antibody fragment.
• an antibody is chimeric.
• an antibody is bi-specific.
• an antibody is multi-specific.
• an antibody is monoclonal.
• an antibody is polyclonal.
• an antibody is conjugated (i.e., antibodies conjugated or fused to other proteins, radiolabels, cytotoxins).
• an antibody is a human antibody.
• an antibody is a mouse antibody.
• an antibody is a rabbit antibody.
• an antibody is a rat antibody.
• an antibody is a donkey antibody.
• the biosensor or system described herein comprises an antibody or plurality of antibodies.
• Characteristic refers to any detectable feature of a sample of bodily fluid that allows it to be distinguished from a comparable sample of bodily fluid.
• a characteristic is an amount or identity of ammonia or ammonium ion in bodily fluid, in an environmental sample, or water sample.
• a characteristic is an amount, sequence of, or modification of a amino acid.
• a characteristic is an amount of a carbohydrate.
• a characteristic is an amount of a small molecule.
• Comparable As is used herein, the term “comparable” is used to refer to two entities that are sufficiently similar to permit comparison, but differing in at least one feature.
• Metabolic Enzyme means an enzyme responsible for catalysis of at least one step in the metabolic pathway of one or more amino acids.
• the metabolic enzyme is phenylalanine dehydrogenase, glutamate dehydrogenase, respective functional fragments or a combination thereof or a fusion protein thereof.
• the terms "metabolic disease” is any one of a group of disorders caused by a defect in an enzymatic step in the metabolic pathway of one or more amino acids or in a protein mediator necessary for transport of certain amino acids into or out of cells.
• the metabolic disease is chosen from: Argininemia (ARG, arginase deficiency) Argininosuccinate acidemia (ASA, argininosuccinase) Citrullinemia type I (CIT-I,
• argininosuccinate synthetase Citrullinemia type II (CIT-II, citrin deficiency) Defects of biopterin cofactor biosynthesis (BIOPT-BS) Defects of biopterin co factor regeneration (BIOPT-RG)
• H-PHE Hyperphenylalaninemia
• Hypermethioninemia (MET) Maple syrup urine disease (MSUD, branched-chain ketoacid dehydrogenase) Phenylketonuria (PKU, phenylalanine hydroxylase) Tyrosinemia type I (TYR-1, fumarylacetoacetate hydrolase), Tyrosinemia type II (TYR-II, tyrosine aminotransferase), and Tyrosinemia type III (TYR-III, hydroxyphenylpyruvate dioxygenase) where the parenthetical phrases after each disease state represent an abbreviation for the disease accompanies by the enzyme that is generally defective in the subject suffering from the disease state.
• Polypeptide generally has its art- recognized meaning of a polymer of at least three amino acids. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having the complete sequence recited herein, but also to encompass polypeptides that represent functional fragments (i.e., fragments retaining at least one activity) of such complete polypeptides. Moreover, those of ordinary skill in the art understand that protein sequences generally tolerate some substitution without destroying or significantly reducing activity.
• threshold value is the concentration of ammonia or ammonium ion or amino acid in a sample of bodily fluid that indicates whether the amount of ammonia or ammonium ion or amino acid in the sample is considered abnormally high or low resulting in a diagnosis or suspected diagnosis of a particular disorder, such as a metabolic disease.
• known threshold values for certain aminoacidopathies are indicated in Table 1 below:
• information about a threshold value or reference sample of bodily fluid is obtained prior to or simultaneously with information about an experimental sample of bodily fluid.
• information about a reference cell or cell type is historical.
• information about a threshold value or reference sample of bodily fluid is stored for example in a computer-readable storage medium.
• comparison of a particular concentration value with a threshold value or reference sample of bodily fluid differentiates the concentration values of ammonia in an experimental sample of bodily fluid with the threshold values thereby allowing a comparison that results in diagnosing a subject with one or more metabolic diseases or a change in severity of one or more metabolic diseases.
• Reference electrode As will be understood from context, a reference electrode or control electrode is an electrically conductive support such as an electrode placed in a circuit with an at least one electrically conductive support comprising hydrogel and/or immobilized enzymes disclosed herein, to permit a relevant comparison of voltage difference between the reference or control electrode and the at least one electrically conductive support comprising hydrogel and/or immobilized enzymes disclosed herein.
• sample refers to a biological sample obtained or derived from a source of interest, as described herein.
• a source of interest comprises an organism, such as an animal or human.
• a biological sample comprises biological tissue or fluid.
• a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs;
• a biological sample is or comprises bodily fluid.
• a sample is a "primary sample" obtained directly from a source of interest by any appropriate means.
• a primary biological sample is obtained by methods selected from the group consisting of biopsy ⁇ e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid ⁇ e.g., blood, lymph, feces etc.), etc.
• sample refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane.
• Such a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc. in some embodiments, the methods disclosed herein do not comprise a processed sample.
• the system, test strip, device, biosensor, and/or catridge comprises a concentration of any one or combination of the reagents disclosed on pages 78-84 of this disclosure.
• YP 00382521 GACTTCGCCATCAACAGCGCCGGCCTGATGAGCGCCGCGCAGAACCTCAG 6.1
• YP_00436810 GCCGCGAAAATGGCCATGGG
• the disclosure relates to an ammonia or ammonium ion biosensor for measuring a total concentration of a ammonia in the blood.
• the ammonia biosensor comprises a measuring electrode which include as components, a mediator and an enzyme, which selectively act on the plurality of specific amino acids each serving as a substrate, and a counter electrode.
• the enzyme has a substrate affinity to each of the plurality of specific amino acids.
• the enzyme is operable to catalyze a reaction in each of the plurality of specific amino acids as a substrate so as to form a reaction product.
• the mediator is operable, during amino-acid
• the amino-acid biosensor is designed to apply a voltage between the measuring electrode and the counter electrode at a measurement point in such a manner that, in an analytical curve representing a relationship between an applied voltage and a current value in a specific concentration for each of the plurality of specific amino acids, the applied voltage is a voltage allowing the variety of the current values for the amino acids in the same concentration and at the same applied voltage.
• the measuring electrode (at least a first electrode) further comprises a a hydrogel that comprises a coenzyme or reduction agent as a component.
• the enzyme consists of a dehydrogenase.
• the reaction product consists of a reduced coenzyme derived by reduction of the coenzyme, and the mediator is operable, during the amino- acid concentration measurement, to carry electrons from the reduced coenzyme to the measuring electrode.
• a biosensor or system disclosed herein is used in conjunction with one or a combination of the following:
• a power source in electrical connection with the electrodes and capable of supplying an electrical potential difference between the electrodes sufficient to cause diffusion limited electro- oxidation of the reduced form of the mediator at the surface of the working electrode;
• At least one meter (such as a spectrophoteomter, voltmeter and/or amperometer) in electrical connection with the electrodes and capable of measuring the diffusion limited current produced by of the reduced form of the mediator with the above-stated electrical potential difference is applied.
• a meter such as a spectrophoteomter, voltmeter and/or amperometer
• the meter will normally be adapted to apply an algorithm to the current measurement, whereby an ammonia or ammonium ion concentration is provided and visually displayed.
• Ammonia or ammonium ion concetrations from a plaurality of samples may be analyzed in parallel.
• human and non-human body fluids such as whole blood, plasma, sera, lymph, bile, urine, semen, cerebrospinal fluid, spinal fluid, lacrimal fluid and stool specimens as well as other biological fluids readily apparent to one skilled in the art may be measured.
• Fluid preparations of tissues from humans and non-human animals can also be assayed, along with foods, water samples, fermentation products and environmental substances, which potentially contain
• human serum is assayed with the disclosed biosensor.
• the biosensor comprises or is configured to assay whole blood.
• a power source e.g., a battery
• a potential difference between electrodes.
• the amount of oxidized form of the mediator at the auxiliary electrode and the potential difference must be sufficient to cause diffusion- limited electro-oxidation of the reduced form of theat least one mediator at the surface of the working electrode.
• the working electrode comprises a hydrogel disclosed herein.
• a current measuring meter measures the diffusion-limited current generated by the oxidation of the reduced form of the mediator at the surface of the working electrode. The measured current may be accurately correlated to the concentration of ammonia or ammonium ion and/or one or more amino acids in sample when the following requirements are satisfied:
• the rate of the indophenol reaction based upon the concentration of indophenol reagents is governed by the rate of diffusion of the ammonia from the sample in a first vessel to the second vessel comrpsing a surface of the working electrode.
• a roll of metallized film is fed through guide rolls into an ablation/washing and drying station.
• a laser system capable of ablating bottom plate element 14 is known to those of ordinary skill in the art. Non-limiting examples of which include excimer lasers, with the pattern of ablation controlled by mirrors, lenses, and masks.
• a non-limiting example of such a system is the LPX-300 or LPX-200 both commercially available from LPKF Laser
• the metallic layer of the metallized film is ablated in a pre-determined pattern, to form a ribbon of isolated electrode sets.
• the metallized film is further ablated, after the isolated electrode sets are formed to create recesses positioned adjacent the electrochemical area.
• the ribbon is then passed through more guide rolls, with a tension loop and through an optional inspection camera. The camera is used for quality control in order to check for defects.
• Reagent is compounded and applied in a liquid form to the center of the electrochemical area at a dispensing and drying station.
• Reagent application techniques are well known to one of ordinary skill in the art as described in U.S. Pat. No. 5,762,770, the disclosure of which is expressly incorporated herein by reference. It is appreciated that reagent may be applied to array in a liquid or other form and dried or semi-dried onto the center of the electrochemical area in accordance with this disclosure.
• a roll or top plate element material is fed into an assembly station along with a roll of spacer material. Liners on either side of the spacer material are removed in that station and the top plate element or surface scaffold is applied to one side of the spacer material to form a top plate element/spacer subassembly.
• the top plate element/spacer subassembly is slit into the appropriate width for a row of biosensors.
• a new release liner is added to the side of the spacer material opposite the cover and the subassembly is wound into a roll.
• the ribbon of the reagent-coated bottom plate element is unwound and fed into a sensor assembly station along with the top plate element/spacer subassembly.
• the liner is removed from the spacer and the subassembly is placed on bottom plate elementto cover reagent.
• the assembled material is cut to form individual biosensors, which are sorted and packed into vials, each closed with a stopper, to give packaged sensor test strips.
• the method of forming recesses in bottom plate element is also not limited.
• the recesses may be formed by etching (e.g., using photoligographic methods) or otherwise removing a portion of the surface of top plate element.
• the nearest electrode edge is approximately about 10 ⁇ to about 500 ⁇ from the recess, or about 100 um to about 400 ⁇ from the recess, or from about 200 ⁇ to about 300 ⁇ from the recess.
• Biosensors that are formed with recesses in accordance with this disclosure yield a reagent profile with generally uniform thickness of chemistry. A generally uniform thickness of chemistry allows for more accurate sample analysis.
• the processes and products described above include a disposable biosensor, especially for use individually as a diagnostic device or in combination with other components such as a pump system or spectrophotometer configured to diagnose hyperammonemia, abnormal function, or abnormally high or low amounts of ammonia in a sample.
• the disclosure relates to contacting a sample with one or a plurality of reagents in independently variable phases of dried, powdered or aqueous phases.
• the reaction has four major components: a compound comprising a phenyl group, a hypohalite, a catalyst and an alkali buffer.
• a compound comprising a phenyl group, a hypohalite, a catalyst and an alkali buffer.
• an indophenol compound is produced that, when exposed to a light source at a particular wavelength, absorbs and/or emits a particular wavenlength of light
• any of the methods disclosed herein make comprise a step of detecting the presence, absence, or quantity of ammonia or ammonium ion by measuring the absorbance of the contents of at least the first vessel or the second vessel.
• any buffer capable of creating an alkali microenvironment for the reaction to take place with ammonia from a sample may be used.
• a vessel comprising an alkali buffer with pH from about 8.5 to about 13 can be used in the biosensor, test strip, or system disclosed herein. Any compound that can create these alkali conditions can be used including sodium and potassium hydroxide, or sodium or potassium acetate.
• the alkali buffer is in a powdered form, lyophilized, or aqueous solution in a vessel located within the biosensor or kit disclosed herein.
• the biosensor, system or test strip disclosed herein comprise one or more electrodes.
• the one or more electrodes transmit current variation generated by the reaction between the indophenol reagents and ammonia or ammonium ion from a sample and/or transmit current variation generated by a battery source to the light source or other equipment necessary to provide a readout of the levels of ammonie in a sample, for instance, in the case of a spectrophotometer to measure absorbance of a reactant vessel in the biosensor.
• the electrodes comprise metal.
• the electrodes comprise a carbon scaffold upon which a metal is deposited.
• the electrodes comprise a carbon scaffold of carbon nanotubes.
• Electrodes or Electrically conductive tracks are created or isolated on first surface. Tracks represent the electrodes of biosensor.
• electrode set is a set of at least two electrodes, for example 2 to 200, or 3 to 20, electrodes. These electrodes may, for example, be a working (or measuring) electrode and an auxiliary electrode.
• tracks cooperate to form an interdigitated electrode array positioned within the periphery of recesses and leads that extend from array and between recesses toward end.
• Tracks are constructed from electrically conductive materials.
• electrically-conductive materials include aluminum, carbon (such as graphite), cobalt, copper, gallium, gold, indium, iridium, iron, lead, magnesium, mercury (as an amalgam), nickel, niobium, osmium, palladium, platinum, rhenium, rhodium, selenium, silicon (such as highly doped polycrystalline silicon), silver, tantalum, tin, titanium, tungsten, uranium, vanadium, zinc, zirconium, mixtures thereof, and alloys, oxides, or metallic compounds of these elements.
• tracks include gold, platinum, palladium, iridium, or alloys of these metals, since such noble metals and their alloys are unreactive in biological systems.
• the track is a working electrode made of silver and/or silver chloride, and track is an auxiliary electrode that is also made of silver and/or silver chloride and is substantially the same size as the working electrode.
• Tracks are isolated from the rest of the electrically conductive surface by laser ablation.
• Techniques for forming electrodes on a surface using laser ablation are known.
• Techniques for forming electrodes on a surface using laser ablation are known. See, for example, U.S. patent application Ser. No. 09/411,940, filed Oct. 4, 1999, and entitled "LASER DEFINED FEATURES FOR PATTERNED LAMINATES AND ELECTRODE", the disclosure of which is expressly incorporated herein by reference.
• Tracks are preferably created by removing the electrically conductive material from an area extending around the electrodes. Therefore, tracks are isolated from the rest of the electrically-conductive material on a surface by a gap having a width of about 5 ⁇ to about 500 ⁇ , preferably the gap has a width of about 100 ⁇ to about 200 ⁇ .
• tracks may be created by laser ablation alone on bottom substrate. Further, tracks may be laminated, screen-printed, or formed by photolithography.
• a biosensor may be formed that includes an additional electrically conductive track.
• the first track is a working electrode
• the second is a counter electrode
• the third electrode is a reference electrode.
• tracks are working electrodes and a third electrode is provided as an auxiliary or reference electrode.
• the number of tracks, as well as the spacing between tracks in array may vary in accordance with this disclosure and that a number of arrays may be formed as will be appreciated by one of skill in the art.
• the electrodes are embedded on or attached to a solid support, such as a test strip comprising a plastic and/or paper material.
• Micro-electrode arrays are structures generally having two electrodes of very small dimensions, typically with each electrode having a common element and electrode elements or micro-electrodes. If "interdigitated" the arrays are arranged in an alternating, finger- like fashion (See, e.g., U.S. Pat. No. 5,670,031). These are a sub-class of micro-electrodes in general. Interdigitated arrays of micro-electrodes, or IDAs, can exhibit desired performance characteristics; for example, due to their small dimensions, IDAs can exhibit excellent signal to noise ratios.
• Interdigitated arrays have been disposed on non- flexible substrates such as silicon or glass substrates, using integrated circuit photolithography methods.
• IDAs have been used on non-flexible substrates because IDAs have been considered to offer superior performance properties when used at very small dimensions, e.g., with feature dimensions in the 1-3 micrometer range. At such small dimensions, the surface structure of a substrate (e.g., the flatness or roughness) becomes significant in the performance of the IDA. Because non-flexible substrates, especially silicon, can be processed to an exceptionally smooth, flat, surface, these have been used with IDAs.
• the at least one electrode is a component of any IDA disclosed herein.
• the membrane positioned at a fluid exchange opening comprises an ionomer.
• the membrane comprises one or a combination of the following polymers:
• the R group is acidic or an electronegative substiuent.
• the variables p, q, r, s, t, u, v, w, x, y, z are independently variable and are 0 or positive integers from about 1 to about 200.
• the variables p, q, r, s, t, u, v, w, x, y, z are independently variable and are 0 or positive integers from about 10 to about 100.
• the variables p, q, r, s, t, u, v, w, x, y, z are independently variable and are 0 or positive integers from about 10 to about 100 across many species within a matrix of material comprising many species of polymer.
• A- represents the anionic or acidic groups that can include sulfonate, carboxylate, or other similar functional group.
• M+ represents the counter ion and may include H+, Li+, Na+, or similar cation.
• Letters (p-z) accompanied by parenthesis or brackets represent repeat units that can range from 0 to any integer value.
• Any polymer containing any combination of Carbon (C), Fluorine (F), Sulfur (S), Oxygen (O), Hydrogen (H), Nitrogen (N), Phosphorous (P), or any similar element, which may be used to create an ionic exchange membrane may also be utilized.
• Ion exchange membranes can be constructed from polymers including perfluorinated ionomers (1&2), polyp hosphazene based ionomers (3), polystyrene based ionomers (4), polystyrene based block-co-polymer ionomers (5), and poly(arlyene ether sulfone) based ionomers (6).
• Total acid content for ionic exchange membranes may range from about 0.57 to about 3.5 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 4.0 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 3.0 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.9 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.8 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.7 meq/g.
• the total acid content for ionic exchange is from about 0.57 to about 2.6 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.5 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.4 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.3 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.2 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.1 meq/g. In some embodiments, the total acid content for ionic exchange is from about 0.57 to about 2.0 meq/g.
• Membranes constructed from these ionomers may range in thickness from about .025 to about .69 mm in thickness. In some embodiments the membrane is from about .001 to about 069 mm in thickness. In some embodiments the membrane is from about .001 to about 068 mm in thickness. In some embodiments the membrane is from about .001 to about 067 mm in thickness.
• the membrane is from about .001 to about 066 mm in thickness. In some embodiments the membrane is from about .001 to about 065 mm in thickness. In some embodiments the membrane is from about .001 to about 064 mm in thickness. In some embodiments the membrane is from about .001 to about 063 mm in thickness. In some embodiments the membrane is from about .001 to about 062 mm in thickness. In some embodiments the membrane is from about .001 to about 061 mm in thickness. In some embodiments the membrane is from about .001 to about 060 mm in thickness. In some embodiments the membrane is from about .001 to about 059 mm in thickness. In some embodiments the membrane is from about .001 to about 058 mm in thickness.
• the membrane is from about .001 to about 050 mm in thickness. In some embodiments the membrane is from about .001 to about 040 mm in thickness. In some embodiments the membrane is from about .001 to about 030 mm in thickness. In some embodiments the membrane is from about .001 to about 020 mm in thickness. In some embodiments the membrane is from about .001 to about 010 mm in thickness. In some embodiments the membrane is from about .025 to about 065 mm in thickness. In some embodiments the membrane is from about .025 to about 064 mm in thickness. In some embodiments the membrane is from about .025 to about 063 mm in thickness.
• the membrane is from about .025 to about 062 mm in thickness. In some embodiments the membrane is from about .025 to about 061 mm in thickness. In some embodiments the membrane is from about .025 to about ; 060 i mm in thickness. In some embodiments the membrane is from about .025 to about 059 mm in thickness. In some embodiments the membrane is from about .025 to about 058 mm in thickness. In some embodiments the membrane is from about .025 to about 050 mm in thickness. In some embodiments the membrane is from about .025 to about 040 mm in thickness. In some embodiments the membrane is from about .025 to about 030 mm in thickness. In some embodiments the membrane is from about .025 to about 020 mm in thickness. In some embodiments the membrane is from about .025 to about 010 mm in thickness.
• Membranes may be formed through extrusion casting, drop casting, hot pressing, or similar method.
• the biosensor, device, system, and or test strip may be or comprise a cartridge.
• the catridge is disposable after one use or can be used more than once per ammonia or ammonium ion detection event.
• the catridge comprises a plurality of microfluidic conduits in fluid communication with a storage portion, a mixing portion and a readout portion of the catridge.
• the storage portion comprises a plurality of compartments that store one or a combination of indophenol reagents either crystalized, dried, lyophilized or in solution.
• the compartments may be partitioned from an adjacent conduit by plastic wall or other inert material.
• the mixing portion of the catridge comprises a trunk-shaped conduit where one or more reagents being stored mix after they are released from the storage portion of the device.
• the reagents may mix with a sample and/or each other at different points in the microfluidic channels adajacent to the storage portion of the device.
• the readout portion of the microfluidic conduits is adjacent to the mixing portion of the device.
• the cartridge comprises only a storage portion and a readout portion, wherein the readout portion comprises a microfluidic conduit configured to align to an instrucment that measures the amount of ammonia or ammonium in a sample but also allows mixing of samples prior to any detection or quantification step takes place through the instrument.
• the catridge does not comprise an instrument for detection of the amount of ammonia or ammonium ion in an sample (spectrophotometer), but is configured to align the readout portion of the catridge to a instrument capable of determining the amount of ammonia or ammonium ion in a sample.
• the catridge comprises an instrument for detection of the amount of ammonia or ammonium ion in an sample, such as a photodiode.
• the catridge comprises readout portion comprising microfluidic conduits for detection or quantification adjacent to the mixing portion of the device.
• the catridge comprises an instrument for detection of the amount of ammonia or ammonium ion in an sample, such as a photodiode, such instrument comprising a light source aligned to or with the readout portion of the device such that light from the light source may penetrate the readout portion and such instrument may detct the presence, absence or absorbance of wavrelength of light in the readout portion.
• an instrument for detection of the amount of ammonia or ammonium ion in an sample such as a photodiode
• such instrument comprising a light source aligned to or with the readout portion of the device such that light from the light source may penetrate the readout portion and such instrument may detct the presence, absence or absorbance of wavrelength of light in the readout portion.
• the catridge comprises a microfluidic circuit comprising a storage portion in fluid communication with a mixing portion which is also in fluid communication with a readout portion. Fluid in such an embodiment is designed to flow from the storage portion to the mixing portion, and from the mixing portion to the readout portion of the catridge.
• the storage portion comprises one compartment for each indophenol reagent.
• the storage portion comprises a first compartment comprising a hypohalite (such as hypochlorite), a second compartment comprising an basic buffer (such as NaOH), and a third compartment comprising at least one indophenol reagent or indophenol related compound (such as 2-phenylphenol).
• the storage portion comprises a fourth compartment comprising a catalyst or coupling reagent (such as Sodium Nitroprusside).
• the storage portion comprises a fifth compartment comprising an alkali buffer (such as sodium acetate or calcium acetate or zinc acetate).
• the catridge comprises a fluid exchange opening between a microfluidic conduit the compartment comprising a an alkali buffer (such as sodium acetate or calcium acetate or zinc acetate).
• a membrane disclosed herein is positioned over at least a portion of the fluid exchange opening such that when a sample comes in contact with the alkali buffer, ammonia can be transported across the membrane into the adjacent microfluidic conduit.
• the storage portion comprises a compartment optionally comprising an electrode.
• the compartment optionally comprising an electrode is adjacent to a compartment comprising the alkali buffer in solid or liquid phase, such compartment having an opening through which a sample may be deposited into the catridge from a point exterior to the cartridge.
• the catridge comprises a sixth compartment comprising an opening and optionally comprising an electrode, such compartment having an opening through which a sample may be deposited into the catridge from a point exterior to the cartridge.
• the catridge comprises a sixth compartment comprising an opening and optionally comprising an electrode, such compartment having an opening through which a sample may be deposited into the catridge from a point exterior to the cartridge; wherein the catridge further comprises a a compartment comprising an alkali buffer that is positioned at or substantially near the compartment comprising the opening, such that, upon inserting a sample into the compartment with an opening, the alkali buffer is transported to the compartmenr comprising the opening and mixes with the sample.
• a compartment has a volume of no more than about 100 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 100 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 90 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 80 microliters of fluid.In some embodiments, one or more compartments in the catridge has a volume of no more than about 70 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 60 microliters of fluid.
• one or more compartments in the catridge has a volume of no more than about 50 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 40 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 30 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 20 microliters of fluid. In some embodiments, one or more compartments in the catridge has a volume of no more than about 10 microliters of fluid.
• FIGs. 24 through 28 depict an embodiment of the invention that is a catridge.
• one half of the ctaridge is depicted in FIG. 24 while the opposite facing half of the cartridge is depicted in FIG> 25.
• the two halves of the catridge may be secured together by one or a plurality of micrscrews, dowels or fastners.
• the two halves of the cartridge may be made out of one or a plurality of inert materials such as a plastic and/or glass.
• the catridge half disclosed in FIG. 24 comprises a first, second, third, fourth and fifth storage compartment.
• FIG. 24 depicts a first, second, third, fourth and fifth compartment (labeled 1, 2, 3, 4, and 5 respectively) that define a volume immediately adjacent to, but partitioned from, a micro fluic conduit on a bottom half of the cartridge.
• the partition is delineated by the small solid dash bisecting the space between the compartment and the micro fluidic conduit (labeled 10, 11, 12, 13, and 14 for each of the compartments 1, 2, 3, 4, and 5 respectively.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Physics & Mathematics (AREA)
• Molecular Biology (AREA)
• Biomedical Technology (AREA)
• Immunology (AREA)
• Hematology (AREA)
• General Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Pathology (AREA)
• Urology & Nephrology (AREA)
• Food Science & Technology (AREA)
• Medicinal Chemistry (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Electrochemistry (AREA)
• Spectroscopy & Molecular Physics (AREA)
• Biotechnology (AREA)
• Cell Biology (AREA)
• Microbiology (AREA)
• Ecology (AREA)
• Biophysics (AREA)
• Inorganic Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Plasma & Fusion (AREA)
• Apparatus Associated With Microorganisms And Enzymes (AREA)
• Investigating Or Analysing Biological Materials (AREA)
• Investigating Or Analysing Materials By Optical Means (AREA)
• Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
• Investigating Or Analyzing Non-Biological Materials By The Use Of Chemical Means (AREA)

Priority Applications (14)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (1)

Family

ID=52587421

Family Applications (1)

Country Status (15)

Cited By (6)

Families Citing this family (16)

Citations (7)

Family Cites Families (25)

• 2014
  • 2014-09-02 EP EP19150428.1A patent/EP3540429B1/en active Active
  • 2014-09-02 MX MX2016002632A patent/MX2016002632A/es active IP Right Grant
  • 2014-09-02 CN CN201480057514.9A patent/CN105940300B/zh active Active
  • 2014-09-02 EP EP14841207.5A patent/EP3039422B1/en active Active
  • 2014-09-02 BR BR112016004320-0A patent/BR112016004320B1/pt active IP Right Grant
  • 2014-09-02 CA CA2922821A patent/CA2922821C/en active Active
  • 2014-09-02 US US14/915,602 patent/US9952199B2/en active Active
  • 2014-09-02 KR KR1020167008373A patent/KR102278346B1/ko active Active
  • 2014-09-02 WO PCT/US2014/053756 patent/WO2015031911A1/en not_active Ceased
  • 2014-09-02 DK DK14841207.5T patent/DK3039422T3/en active
  • 2014-09-02 DK DK19150428.1T patent/DK3540429T3/da active
  • 2014-09-02 TR TR2019/03528T patent/TR201903528T4/tr unknown
  • 2014-09-02 JP JP2016537941A patent/JP6646579B2/ja active Active
  • 2014-09-02 AU AU2014311977A patent/AU2014311977B2/en active Active
• 2016
  • 2016-02-24 IL IL244274A patent/IL244274B/en active IP Right Grant
  • 2016-02-28 SA SA516370640A patent/SA516370640B1/ar unknown
  • 2016-02-29 CL CL2016000467A patent/CL2016000467A1/es unknown
• 2018
  • 2018-03-23 US US15/933,834 patent/US10620187B2/en active Active

Patent Citations (7)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events