WO2015005632A1 - Dll4와 vegf에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도 - Google Patents

Dll4와 vegf에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도 Download PDF

Info

Publication number
WO2015005632A1
WO2015005632A1 PCT/KR2014/006090 KR2014006090W WO2015005632A1 WO 2015005632 A1 WO2015005632 A1 WO 2015005632A1 KR 2014006090 W KR2014006090 W KR 2014006090W WO 2015005632 A1 WO2015005632 A1 WO 2015005632A1
Authority
WO
WIPO (PCT)
Prior art keywords
dll4
cancer
protein
seq
vegf
Prior art date
Application number
PCT/KR2014/006090
Other languages
English (en)
French (fr)
Inventor
이동헌
문경덕
최유빈
강경재
김동인
안진형
유원규
정진원
Original Assignee
한화케미칼 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한화케미칼 주식회사 filed Critical 한화케미칼 주식회사
Priority to AU2014287984A priority Critical patent/AU2014287984B2/en
Priority to CN201480049434.9A priority patent/CN105518028B/zh
Priority to RU2016104057A priority patent/RU2648154C2/ru
Priority to US14/903,077 priority patent/US10184010B2/en
Priority to ES14823338T priority patent/ES2742855T3/es
Priority to PL14823338T priority patent/PL3020731T3/pl
Priority to JP2016525275A priority patent/JP6283411B2/ja
Priority to EP14823338.0A priority patent/EP3020731B1/en
Priority to CA2917402A priority patent/CA2917402C/en
Publication of WO2015005632A1 publication Critical patent/WO2015005632A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • C07K16/468—Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/08—Drugs for disorders of the urinary system of the prostate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/10—Drugs for disorders of the urinary system of the bladder
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/286—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against neuromediator receptors, e.g. serotonin receptor, dopamine receptor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/64—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475—Assays involving growth factors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants

Definitions

  • the present invention provides a double protein comprising a protein that specifically binds to a novel delta-like ligand 4 (DLL4) and an antibody that specifically binds to Vascular endothelial cell growth factor (VEGF). It relates to a target protein.
  • DLL4 novel delta-like ligand 4
  • VEGF Vascular endothelial cell growth factor
  • Notch signaling has been reported to be evolutionarily well preserved, from vertebrates to invertebrates, and plays an important role in determining cell fate early in development. Notch signaling is known to be a major factor that regulates the differentiation process of nerves, eyes, lymph, muscle, blood cells, etc. It is also involved in the development of blood vessels.
  • Notch 1, 2, 3 and 4 there are four Notch receptors (Notch 1, 2, 3 and 4), each Notch receptor is synthesized as a 300-350 kDa protein, and in the Golgi apparatus, S1 by furin-like convertase. The site is cut to form a heterodimer on the cell surface.
  • five notch ligands Jagged-1 / 2 and Delta-like ligand (DLL) 1/3/4) were identified in mammals.
  • Activated Notch signaling is known to cause tumorigenesis in several cancer models.
  • the expression of NICD, an active notch, in rat hematopoietic cells causes T-cell leukemia / lymphomas and about 50% of activated Notch 1 was found in T-ALL acute lymphoblastic leukemia (T-ALL).
  • T-ALL T-ALL acute lymphoblastic leukemia
  • overexpression of activated Notch 4 receptor was found in mice in which MMTV (mouse mammary tumor virus) was inserted (Czech II) and mammary tumors were reported in these mice.
  • Notch receptors, ligands and targets of Notch signaling are activated in various cancers such as cervical cancer, lung cancer, pancreatic cancer, ovarian cancer, breast cancer and prostate cancer.
  • Notch 1 receptor expression is associated with poor prognosis in breast cancer patients and is known to be associated with cancer metastasis in prostate cancer.
  • DLL4 Delta Like Ligand 4
  • DLL4 is one of the delta classes of ligands that accept Notch protein overexpressed in vascular endothelial cells and is known as a key factor in regulating angiogenesis. have. DLL4 specifically binds Notch 1 or Notch 4 receptors that are overexpressed in the vascular endothelium. DLL4 is also expressed in normal blood vessels, but is known to be overexpressed in cancer blood vessels. Angiogenesis refers to the mechanism by which new blood vessels are formed from existing blood vessels. In particular, neovascularization in tumors requires VEGF (Vascular endothelial growth factor) to receive oxygen and nutrients in the hypoxia region of cancer tissues.
  • VEGF Vascular endothelial growth factor
  • Angiogenesis is caused by angiogenic factors such as). Angiogenesis in tumors is known to play an important role in metastasis as well as tumor growth. Blocking Notch signaling by DLL4 in tumors can inhibit cancer growth because of poor regulation of angiogenesis. In addition, when inhibiting Notch signaling by DLL4, autoimmune diseases can be treated by increasing the number of regulatory T cells (Treg) (US Patent Publication No. 2011-0189200). For this reason, DLL4 has become a new target in the treatment of cancer and autoimmune diseases.
  • Treg regulatory T cells
  • Avastin (Avastin ® , Genentech / Roche) targeting VEGF is an anti-cancer drug that inhibits neovascularization.
  • VEGF inhibitors transform cancer cells into more aggressive and metastatic cancer cells.
  • DLL4 / Notch signaling pathway One of the new anticancer targets is the DLL4 / Notch signaling pathway.
  • VEGF / VGEFR and DLL4 / Notch signaling pathways affect neovascularization due to different mechanisms of action, and thus, stronger anticancer synergies can be expected when both signaling pathways are simultaneously suppressed. It is expected to be.
  • the present inventors have made intensive efforts to develop dual target proteins that specifically bind to human DLL4 and VEGF to effectively inhibit DLL4 / Notch and VEGF / VEGFR signaling pathways and minimize the risk of immunogenicity.
  • the C-terminal region of the Avastin analog which is an IgG basic form, is linked to a novel ScFv (single-chain variable fragment) form that specifically binds human DLL4.
  • the target protein was newly prepared, and this double-target protein effectively blocks the interaction between VEGF and the VEGF receptor protein, as well as the interaction between DLL4 and Notch protein, thus completing the present invention by showing an excellent anticancer effect. It was.
  • One object of the present invention is a conformational epitope of DLL4 comprising amino acid sequence 58 to 65 and amino acid sequence 110 to 115 in the amino acid sequence of the DLL4 (Delta-like ligand 4) protein represented by SEQ ID NO: 21 It is to provide a dual target protein comprising a protein that specifically binds to DLL4, which recognizes a conformational epitope, and an antibody that specifically binds to Vascular endotelial growth factor (VEGF).
  • VEGF Vascular endotelial growth factor
  • Another object of the present invention is to provide a polynucleotide encoding the dual target protein, an expression vector comprising the polynucleotide, and a transformant comprising the expression vector.
  • Another object of the present invention is to provide a composition comprising the dual target protein.
  • Still another object of the present invention is to provide a pharmaceutical composition for treating cancer comprising the dual target protein.
  • Still another object of the present invention is to provide a cancer diagnostic composition comprising the dual target protein.
  • Another object of the present invention is the conformation of DLL4, comprising amino acid sequence 58 to 65 and amino acid sequence 110 to 115 in the amino acid sequence of the DLL4 (Delta-like ligand 4) protein represented by SEQ ID NO: 21 To provide an epitope.
  • Another object of the present invention is to provide a monoclonal antibody that specifically binds to DLL4, which recognizes the conformational epitope.
  • Still another object of the present invention is to provide a polynucleotide encoding the monoclonal antibody, an expression vector comprising the polynucleotide, and a transformant comprising the expression vector.
  • the dual target protein of the present invention can treat cancer by simultaneously binding to VEGF and DLL4, and by using a novel protein that specifically binds to DLL4, it has excellent binding and anticancer effects, and thus can be widely used in cancer treatment and diagnostic fields.
  • VEGF and DLL4 vascular endothelial growth factor receptor 4
  • a novel protein that specifically binds to DLL4 it has excellent binding and anticancer effects, and thus can be widely used in cancer treatment and diagnostic fields.
  • 1A and 1B show the structure of a dual target protein capable of simultaneously binding DLL4 and VEGF.
  • Figure 2a shows the results confirmed by SDS-PAGE after purification by expressing a dual target protein capable of binding DLL4 and VEGF in CHO cells.
  • FIG. 2b shows the result of SEC-HPLC chromatography analysis after purification by expressing a dual target protein capable of simultaneously binding DLL4 and VEGF in CHO cells.
  • Figure 3 shows the results of analyzing the binding assay for the DLL4 and VEGF of the dual target protein for DLL4 and VEGF (enzyme-linked immunosorbent assay) (ELISA).
  • FIG 4a shows the measurement results of the equilibrium dissociation constant (KD) value for DLL4, the antigen of the dual target protein through the Biacore analysis method.
  • Figure 4b shows the measurement results of the equilibrium dissociation constant (KD) value for the VEGF antigen of the dual target protein via the Biacore analysis method.
  • Figure 5 shows the results of the neutralization assay (Neutralizing assay) for the dual target protein DLL4 and VEGF by ELISA.
  • Figure 6 shows the results of complex formation of human DLL4 and MLCK2 antibody with or without crosslinker.
  • FIG. 7 shows a model in which fragments consisting of amino acid residues 58-65 [FRVCLKHF] and SEQ ID NO: 22 of DLL4 represented by SEQ ID NO: 21 on the surface of a human DLL4 C2 domain (27-174) constitute a continuous molecular surface will be.
  • Figure 8 shows the results confirmed by Western blotting the binding capacity of the mutant protein encoding the deletion fragments of the wild type and the extracellular domain of DLL4.
  • Figure 9a shows the result of confirming that when treated with Avastin, an antibody targeting VEGF, proliferation of vascular endothelial cells is inhibited in a concentration-dependent manner regardless of the presence or absence of DLL4.
  • Figure 9b shows the results confirming that the proliferation of vascular endothelial cells depending on the DLL4 antibody treatment concentration only in the experimental group with DLL4 when the antibody to DLL4 alone.
  • Figure 9c shows that when treated with a double-target protein, the experimental group without the DLL4 showed a proliferative inhibitory effect similar to the Avastin antibody treatment (black bar), the experimental group with the DLL4 present showed a result of reduced vascular growth inhibitory effect compared to the Avastin (White bar).
  • FIG. 10 is a Western blot analysis showing that the dual target protein that binds DLL4 and VEGF shows activity of inhibiting DLL4 / Notch signaling pathway and VEGF / VEGFR signaling pathway of vascular endothelial cells (HUVEC). It is shown.
  • Figure 11 shows that the dual target protein that binds DLL4 and VEGF has a strong anticancer effect in comparison with Avastin in the Avastin-resistant human SCH gastric cancer xenograft model constructed in nude mice. Will be confirmed.
  • Figure 12 shows that the dual target protein binding to DLL4 and VEGF has a strong anticancer efficacy in comparison with Avastin in the Avastin-resistant human A549 lung cancer xenograft model constructed in nude mice. Will be confirmed.
  • the present invention comprises amino acids sequence 58 to 65 and amino acid sequence 110 to 115 in the amino acid sequence of the DLL4 (Delta-like ligand 4) protein represented by SEQ ID NO: 21
  • DLL4 Delta-like ligand 4
  • SEQ ID NO: 21 To provide a dual-target protein comprising a protein that specifically binds to DLL4, which recognizes the conformal epitope of DLL4, and an antibody that specifically binds to Vascular endotelial growth factor (VEGF).
  • VEGF Vascular endotelial growth factor
  • double-target protein refers to a protein capable of binding two different kinds of antigens (target proteins). Specifically, it does not exist naturally, and is preferably in a form prepared by genetic engineering or any method.
  • the dual target protein may bind to VEGF overexpressed in cancer cells and DLL4 expressed in endothelial cells.
  • the dual target protein may be in the form of an antibody.
  • the "dual target protein" of the present invention may be mixed with "dual target antibody", “dual antibody” or “dual antibody protein”.
  • the dual target protein of the present invention may have VEGF and DLL4 as antigens.
  • the form of the double-target protein of the present invention is not particularly limited thereto, and includes a form of a double-target protein in which an antibody specifically binding to VEGF in IgG form and a protein specifically binding to DLL4 are linked by a linker. The structure is as shown schematically in FIG. 1A.
  • the dual target protein of the present invention may specifically include a heavy chain amino acid sequence represented by SEQ ID NO: 1 and a light chain amino acid sequence represented by SEQ ID NO: 20, but is not limited thereto.
  • antibody refers to a protein molecule that acts as a receptor that specifically recognizes an antigen, including an immunoglobulin molecule that is immunologically reactive with a specific antigen, including polyclonal antibodies, monoclonal antibodies, It includes both full antibodies and antibody fragments.
  • the term also includes forms produced by genetic engineering such as chimeric antibodies (eg, humanized murine antibodies) and heterologous antibodies (eg, bispecific antibodies).
  • the full length antibody is a structure having two full length light chains and two full length heavy chains, each of which is linked by a heavy chain and a disulfide bond.
  • the full length antibody includes IgA, IgD, IgE, IgM and IgG, and IgG is a subtype and may include IgG1, IgG2, IgG3 and IgG4.
  • the antibodies may include bivalent, diabodies, triabodies, and tetrabodies.
  • the antibody specifically binding to VEGF of the present invention may be in the form of IgG.
  • the dual target protein is an antibody that specifically binds to Vascular endothelial growth factor (VEGF) in the form of immunoglobulin (Immunoglobulin G, IgG), and a full-length antibody that specifically binds to DLL4 (Delta-like ligand 4), Fab Proteins in the form of ', F (ab') 2 , Fab, Fv, rIgG or scFv may be in linker form.
  • VEGF Vascular endothelial growth factor
  • IgG immunoglobulin G
  • DLL4 Delta-like ligand 4
  • Fab Proteins in the form of ', F (ab') 2 , Fab, Fv, rIgG or scFv may be in linker form.
  • immunoglobulins and scFvs have heavy and light chains, each heavy and light chain comprising a constant region and a variable region (the region is also known as the domain).
  • the variable regions of the light and heavy chains comprise three multivariable regions and four framework regions called complementarity-determining regions (hereinafter referred to as "CDRs").
  • the CDRs mainly serve to bind epitopes of antigens.
  • the CDRs of each chain are typically called CDR1, CDR2, CDR3, starting sequentially from the N-terminus, and can also be identified by the chain where the particular CDR is located.
  • the dual target protein comprising a protein specifically binding to DLL4 and an antibody specifically binding to VEGF shows a strong affinity for human-derived DLL4 and VEGF, and cells expressing DLL4 (eg, cancer cells). Or vascular endothelial cells) effectively inhibits the binding of Notch 1 or Notch 4 receptors, as well as inhibiting neovascularization by vascular endothelial cells expressing VEGF receptors by VEGF overexpressing cancer cells. In the treatment of diseases such as can be expected a stronger therapeutic effect.
  • the antibody specifically binding to VEGF and the protein specifically binding to DLL4 maintain their specific binding, and in particular, because they can simultaneously inhibit two targets (antigens), It may be more effective than inhibiting in combination with the target and may simultaneously inhibit two signals.
  • antibody fragment includes antigen-binding forms of an antibody, including fragments having antigen-binding ability, such as Fab ', F (ab') 2 , Fab, Fv, rIgG and scFv. .
  • the term encompasses single-chain variavle fragments (scFv) and includes bivalent or diabodies, triabodies and tetrabodies.
  • single-chain variavle fragment refers to a minimum antibody fragment having a complete antigen-recognition and antigen-binding site, comprising the VH and VL domains of an antibody, wherein the domains are single polypeptides. May be present in the chain.
  • DLL4 formational epitope of DLL4 comprising amino acids 58-65 and amino acids 110-115 in the amino acid sequence of the DLL4 (Delta-like ligand 4) protein represented by SEQ ID NO: 21
  • Dual-target proteins including proteins that bind specifically to DLL4, which recognizes conformational epitopes, and antibodies that specifically bind to Vascular Endotelial Growth Factor (VEGF) are two signaling pathways by DLL4 and VEGF. Any dual target protein capable of simultaneously inhibiting may be included without limitation.
  • Antibodies that specifically bind to VEGF constituting the dual target protein and antibodies that specifically bind to DLL4 may include both the full-length antibodies and antibody fragments described above.
  • the term “conformational epitope of DLL4 comprising amino acids 58 to 65 and amino acids 110 to 115 in the amino acid sequence of the DLL4 (Delta-like ligand 4) protein represented by SEQ ID NO: 21 protein that specifically binds to DLL4, which recognizes a conformational epitope "is a conformation of DLL4 comprising amino acid sequences 58 to 65 and amino acid sequences 110 to 115 in the amino acid sequence in DLL4 represented by SEQ ID NO: 21 It means a protein that specifically binds to the enemy epitope.
  • Such a protein means a protein capable of inhibiting the growth of cancer and exhibiting a cancer therapeutic effect, and may bind to the epitope with high affinity and neutralize DLL4 activity.
  • the protein may block DLL4 binding to Notch receptors and may inhibit signaling by DLL4.
  • the protein that specifically binds to a conformational epitope comprising SEQ ID NO: 21 and SEQ ID NO: 22 of the DLL4 is specifically a full length antibody, Fab ', F (ab') 2 , Fab, Fv, rIgG or It may be in the form of a single-chain variable fragment (scFv).
  • the protein specifically binding to the DLL4 is a heavy chain CDR1 represented by SEQ ID NO: 2; A heavy chain CDR2 represented by SEQ ID NO: 3; And a heavy chain variable region comprising a heavy chain CDR3 represented by SEQ ID NO: 4 and a light chain CDR1 represented by SEQ ID NO: 5; Light chain CDR2 represented by SEQ ID NO: 6; And a light chain variable region comprising the light chain CDR3 represented by SEQ ID NO: 7.
  • the heavy chain may include a heavy chain amino acid sequence represented by SEQ ID NO: 8
  • the light chain may include a light chain amino acid sequence represented by SEQ ID NO: 9, but includes the CDR sequences described above, If the protein is specifically bound to exhibit a cancer therapeutic effect, the sequence may be different.
  • the heavy and light chains may be linked via a linker.
  • a protein that specifically binds to DLL4 which is a component of the dual target protein of the present invention, may specifically inhibit the interaction between DLL4 and Notch protein while specifically binding to mouse DLL4 as well as human DLL4.
  • the epitope of the antibody specifically binding to DLL4 of the dual target protein of the present invention excellent in the biological inhibitory activity of DLL4 and VEGF.
  • amino acid sequence 58-65 (SEQ ID NO: 22) and / or amino acid sequence 110-115 (SEQ ID NO: 23) of DLL4 may be an epitope of an antibody that specifically binds to DLL4 according to the present invention
  • the molecular surface portion formed by the SEQ ID NOs: 22 and 23 of the DLL4 may be a conformational epitope.
  • delta-like ligand 4 refers to a protein that binds to Notch 1 or Notch 4 receptors, as one of the delta classes of ligands using Notch protein as a receptor. However, it is not limited thereto.
  • the DLL4 may be included without limitation as long as it is a mammalian DLL4. Specifically, the DLL4 may mean a DLL4 of a human or a mouse. DLL4 is overexpressed in various cancer cells, including tumor vasculature, and is known to promote cancer growth by increasing abnormal vascular numbers in several xenograft models.
  • DLL4 (Delta-like ligand 4) protein represented by SEQ ID NO: 21 of the present invention specific for the conformational epitope of DLL4 comprising the amino acid sequence of 58 to 65 and amino acid sequence of 110 to 115 Dual-target proteins, including proteins that bind to can be effectively used in cancer therapy by inhibiting the function of DLL4.
  • the information on the DLL4 may be obtained from a known database such as GenBank of the National Institutes of Health.
  • the accession number may be information of DLL4 having Gene ID: 54567 and NCBI Reference Sequence: NM_019074.3, and the DLL4 may be a sequence number. May comprise the amino acid sequence of 21.
  • notch receptor refers to a protein that mediates Notch signal transduction and may be used in combination with Notch.
  • the notch receptor may be included as long as it is a protein that mediates Notch signal transduction, and specifically, may be Notch 1 or Notch 4 receptor, but is not limited thereto.
  • the term "inhibit the interaction between human delta-like ligand 4 (DLL4) and Notch receptors” means that a dual-target protein that specifically binds to DLL4 of the present invention binds DLL4 between DLL4 and Notch receptors.
  • the dual target protein specific for the conformational epitope of may bind to DLL4 and inhibit the interaction of DLL4 with Notch 1 or Notch 4 receptor, but is not limited thereto.
  • DLL4 (Delta-like ligand 4) protein represented by SEQ ID NO: 21 of the present invention
  • a duplex specific to the conformational epitope of DLL4 comprising amino acids 58 to 65 and amino acids 110 to 115 Interaction between DLL4 and Notch receptors is inhibited by the binding of the target protein, and the structural change of Notch protein due to Notch receptor binding of DLL4 is not brought about so that it cannot be hydrolyzed and thus notch signaling.
  • DLL4 and Notch receptors The binding of DLL4 and Notch receptors in cancer is known to increase blood vessel size, activate signaling between gonocyte endothelial cells or notch signaling between cancer cells and vascular endothelial cells, thereby inhibiting cancer proliferation and metastasis.
  • blocking Notch signaling by DLL4 in cancer is particularly difficult to control angiogenesis, which can inhibit cancer growth.
  • blocking DLL4 results in the deletion of lateral inhibition in the cells at the end of the angiogenesis site, resulting in excessive germination, resulting in an angiogenic reaction that results in excessively high but poor productivity.
  • hypoxia can be induced around the cancer, resulting in anti-cancer effects, especially in cancers that are resistant to anti-VEGF treatment.
  • dual target proteins comprising proteins that specifically bind to DLL4 of the present invention that effectively inhibit the interaction between DLL4 and Notch can be effectively used in the treatment of cancer.
  • antibody that specifically binds VEGF includes any antibody that specifically binds to VEGF as an antigen in cancer cells.
  • Specific examples may include, but are not limited to, Bevacizumab (trade name Avastin ® ), a therapeutic antibody targeting VEGF.
  • Antibodies that specifically bind to such VEGF include all the forms of the full-length antibodies or antibody fragments described above, and may be in the form of IgG antibodies, but are not limited thereto.
  • VEGF is a ligand that plays an important role in angiogenesis. When it is suppressed, angiogenesis is not achieved and cancer can be treated.
  • Bevacizumab is a therapeutic antibody that can be stably used as approved by the US FDA as Avastin of Genentech.
  • the heavy chain variable region is a heavy chain CDR1 represented by SEQ ID NO: 10; A heavy chain CDR2 represented by SEQ ID NO: 11; And a heavy chain CDR3 represented by SEQ ID NO: 12 and the light chain variable region comprises a light chain CDR1 represented by SEQ ID NO: 13; Light chain CDR2 represented by SEQ ID NO: 14; And light chain CDR3 represented by SEQ ID NO: 15, and more specifically, may include a heavy chain amino acid sequence represented by SEQ ID NO: 16 and a light chain amino acid sequence represented by SEQ ID NO: 17, but specifically binds to VEGF.
  • the sequence of the protein that can exhibit a cancer therapeutic effect can be included without limitation.
  • Antibodies that specifically bind to VEGF which is a component of the dual target protein of the present invention, specifically bind to VEGF overexpressed in cancer cells, so that the dual target protein of the present invention can be concentrated on cancer cells expressing VEGF. In combination with VEGF, it may have anticancer activity by itself.
  • vascular endothelial growth factor is a growth factor that enhances the growth activity of vascular endothelial cells, secreted by various cells such as dashed cells, smooth muscle cells, tumor cells, and the like. . Not only plays an important role in the generation of angiogenesis, but also to induce angiogenesis (angiogenesis) for the supply of oxygen in the tumor tissue that is fast growth and metabolism.
  • angiogenesis angiogenesis
  • the pathway by the VEGF protein and its receptor has been studied in adult as a target signaling pathway of anticancer drugs.
  • the VEGF binding site of the double-target protein means inhibiting the interaction between human VEGF and the VEGF receptor, specifically, the VEGF-specific double-target protein binds to VEGF and interacts with the VEGF and VEGFR-2 receptors. It may mean to inhibit the action, but is not limited thereto.
  • the VEGF receptor may be included as long as it is a protein that binds to VEGF in mammals, but may specifically mean a protein that binds to human VEGF.
  • VEGF / VEGF receptor signaling by VEGF receptor binding of VEGF through inhibition of the interaction between VEGF and the VEGF receptor by the dual target protein specific for VEGF of the present invention.
  • VEGF / VEGF receptor signaling is activated in stromal / endothelial cells of cancer tissues, which is different from the mechanism of action of DLL4 / Notch signaling pathways. It strongly inhibits the number of blood vessels, and is known to inhibit the growth and metastasis of cancer by weakening the vascular function (tumor function) in the tumor.
  • the dual target protein specific for DLL4 and VEGF of the present invention can be used as a therapeutic agent having a superior anticancer ability by showing the ability to inhibit neovascularization of cancer tissues of different mechanisms.
  • the dual target protein may be in a form in which a protein specifically binding to DLL4 and an antibody specifically binding to VEGF in IgG (Immuniglobulin G) form are linked by a linker.
  • IgG immunoglobulin G
  • linker basically refers to two different fusion partners (e.g., biological polymers, etc.) that are hydrogen bonds, electrostatic interactions, van der Waals forces, disulfide bonds, salt bridges, It refers to a linker that can be linked using hydrophobic interactions, covalent bonds, and the like, specifically, at least one disulfide bond under physiological conditions or other standard peptide conditions (eg, peptide purification conditions, peptide storage conditions).
  • a hinge that can have at least one cysteine that can participate and, in addition to simply connecting each fusion partner, serves to provide a certain amount of spacing between the fusion partners or to provide flexibility or rigidity to the fusion. Can play the role of).
  • the linker may be a non-peptide linker or a peptide linker, and may include all directly linked by peptide bonds, disulfide bonds, and the like.
  • the linker is not particularly limited thereto, but may be a polypeptide capable of linking a protein specifically binding to DLL4 and an antibody specifically binding to VEGF, and more specifically, to the DLL4. It may be a peptide linker capable of linking the C-terminus of the Fc region of the antibody that specifically binds to VEGF and the protein that binds specifically, and more specifically, the GGGGS motif is an amino acid sequence of three repeats. It may be a constructed peptide linker. The GGGGS motif may be repeated 1 to 10 times, and most specifically, may be composed of an amino acid sequence encoded by the following amino acid sequence of SEQ ID NO: 18 or polynucleotide sequence of SEQ ID NO: 19.
  • Linker Peptide (SEQ ID NO: 18): GGGGSGGGGSGGGGS
  • non-peptide linker refers to a biocompatible linker having two or more repeating units linked thereto, and the repeating units may be linked to each other through any covalent bonds other than peptide bonds.
  • Non-peptide linkers of the present invention are polyethylene glycol (PEG) homopolymers, polypropylene glycol homopolymers, ethylene glycol-propylene glycol copolymers, polyoxy ethylenated polyols, polyvinyl alcohols, polysaccharides, dextran, poly Biodegradable polymers such as vinyl ethyl ether, lipid polymers, chitin, hyaluronic acid or combinations thereof.
  • PEG polyethylene glycol
  • polypropylene glycol homopolymers ethylene glycol-propylene glycol copolymers
  • polyoxy ethylenated polyols polyvinyl alcohols
  • polysaccharides polysaccharides
  • dextran polysaccharides
  • poly Biodegradable polymers such as vinyl ethyl ether, lipid polymers, chitin, hyaluronic acid or combinations thereof.
  • it may be a polyethylene glycol homopolymer,
  • it may be a polyethylene glycol homopolymer having a molecular weight of 1 to 5 kDa, and most specifically, a protein and VEGF that specifically bind to DLL4 in the form of bifunctional aldehyde at both ends of about 3.4 kDa. It may be a linker capable of linking an antibody that specifically binds. In particular, having a reactor of reactive aldehyde groups at both ends is effective for minimizing nonspecific reactions.
  • Sites directly or indirectly linked through the linker are not particularly limited thereto, and may be Fc moieties, Fab ′, F (ab ′) 2 , Fab, Fv, and the like.
  • the dual target protein is not particularly limited thereto, but all or a portion of a protein specifically binding to DLL4 and a form in which all or a portion of an antibody specifically binding to VEGF is linked; Alternatively, all or a portion of a protein that specifically binds to DLL4 and all or a portion of an antibody specifically binding to VEGF may be linked by a peptide linker.
  • all or a portion of the protein that specifically binds to DLL4 and all or a portion of the heavy chain of the antibody that specifically binds to VEGF is linked by a peptide linker; All or a portion of a protein that specifically binds to DLL4 and a form in which all or a portion of the light chain of the antibody specifically binds to VEGF is linked with a peptide linker; Or a combination thereof.
  • the inventors insert a polynucleotide encoding a double target protein in which a heavy chain region C-terminus of Avastin in IgG form and a DLL4 binding protein in scFv form by linker are linked to a vector, and the animal cell
  • the Avastin-DLL4 binding double target protein was isolated to introduce a double target protein Avastin-DLL4 BsAb that specifically binds DLL4 and VEGF.
  • the dual target protein molecule has a structure in which an Avastin IgG antibody molecule and a DLL4 binding scFv are linked by a linker (FIG. 1).
  • Avastin-DLL4 binding dual target protein introduced and expressed in the animal cells was isolated and confirmed for expression and purity (FIGS. 2A and 2B).
  • the Avastin-DLL4 binding dual target protein specifically binds the target VEGF and DLL4 (FIG. 3).
  • the double-target protein showed similar binding activity to the control antibody for each antigen, showing a KD value of 30 nM for human DLL4 and a KD value of 0.126 nM for human VEGF (Tables 2-3). It was confirmed that each signal transduction pathway by the binding of endothelial cells to DLL4 and human Notch 1 receptors and the binding of VEGF and VEGF receptors was effectively inhibited by dual target protein treatment (FIG.
  • the present invention provides a polynucleotide encoding the dual target protein, an expression vector comprising the polynucleotide, and a transformant into which the expression vector is introduced.
  • Expression vectors comprising the polynucleotide encoding the dual target protein provided in the present invention is not particularly limited, mammalian cells (eg, human, monkey, rabbit, rat, hamster, mouse cells, etc.), plant cells May be a vector capable of replicating and / or expressing the polynucleotide in eukaryotic or prokaryotic cells, including yeast cells, insect cells or bacterial cells (eg, Escherichia coli, etc.), specifically in the host cell It may be a vector operably linked to an appropriate promoter for expression of the polynucleotide, and may comprise a vector comprising at least one selection marker, more specifically phage, plasmid, cosmid, mini-chromosome, virus, retroviral vector It may be a form in which the polynucleotide is introduced.
  • mammalian cells eg, human, monkey, rabbit, rat, hamster, mouse cells, etc.
  • plant cells May be a vector capable of replicating
  • the expression vector comprising the polynucleotide encoding the double target protein is an expression vector comprising both a polynucleotide encoding the heavy or light chain of the double target protein or an expression vector including all of the polynucleotides encoding a heavy or light chain. Can be.
  • the transformant introduced with the expression vector provided by the present invention is not particularly limited thereto, but the bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium transformed by introducing the expression vector; Yeast cells; Fungal cells such as Pchia pastoris; Insect cells such as Drozophila and Spodoptera Sf9 cells; Chinese hamster ovary cells (CHO), SP2 / 0 (mouse myeloma), human lymphoblastoid, COS, NSO (mouse myeloma), 293T, Bow melanoma cells, HT-1080, BHK ( Animal cells such as baby hamster kidney cells, baby hamster kidney cells, HEK (human embryonic kidney cells), and PERC.6 (human retinal cells); Or plant cells.
  • CHO-S cells were used as host cells.
  • introduction refers to a method of delivering a vector comprising a polynucleotide encoding a dual target protein to a host cell.
  • introductions include calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroshock, microinjection, liposome fusion, lipofectamine and protoplast fusion. It can be carried out by various methods known in the art.
  • transduction refers to the delivery of a target product into cells using viral particles by means of infection.
  • the vector can be introduced into the host cell by gene bombardment or the like. Introduction in the present invention can be used interchangeably with transformation.
  • the present invention provides a method for preparing the dual target protein.
  • step (a) culturing the transformant to produce a dual target protein; And (b) recovering the dual target protein produced in step (a), which comprises a protein that specifically binds to DLL4 and an antibody that specifically binds to Vascular Endotelial Growth Factor (VEGF). It may be a method for producing a target protein.
  • VEGF Vascular Endotelial Growth Factor
  • the polynucleotide and heavy chain variable region encoding an antibody that specifically binds VEGF include heavy chain CDR1 represented by SEQ ID NO: 2; A heavy chain CDR2 represented by SEQ ID NO: 3; And a heavy chain CDR3 represented by SEQ ID NO: 4 and the light chain variable region comprises a light chain CDR1 represented by SEQ ID NO: 5; Light chain CDR2 represented by SEQ ID NO: 6; And obtaining a polynucleotide encoding a protein that specifically binds to DLL4, including the light chain CDR3 represented by SEQ ID NO: 7; (b) a poly encoding the protein specifically binding to the 3'-terminus of the polynucleotide encoding the Fc region and the DLL4 of the polynucleotide encoding the antibody specifically binding to the VEGF obtained in step (a) Linking the 5'-terminus of a nucleotide with a linker to obtain a polynucle
  • the preparation method (a) the polynucleotide encoding the antibody specifically binding to VEGF and the heavy chain variable region is a heavy chain CDR1 represented by SEQ ID NO: 2; A heavy chain CDR2 represented by SEQ ID NO: 3; And a heavy chain CDR3 represented by SEQ ID NO: 4 and the light chain variable region comprises a light chain CDR1 represented by SEQ ID NO: 5; Light chain CDR2 represented by SEQ ID NO: 6; And obtaining a polynucleotide encoding a protein that specifically binds to DLL4, including the light chain CDR3 represented by SEQ ID NO: 7; (b) cloning the polynucleotide of step (a) to prepare an expression vector; (c) culturing the transformant by introducing the expression vector of step (b) into a host cell; And (d) obtaining an antibody and a protein binding to DLL4 specifically binding to VEGF from the transformant of step (c), to the C-terminus and D
  • the dual target protein of the present invention can be prepared by any of the above known recombinant means or biochemical methods, and the antibody can be introduced into an appropriate host cell and recovered from the culture of the transformant.
  • dual-target proteins can be separated by known separation methods, such as conventional immunoglobulin purification procedures such as protein A-sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis or affinity chromatography. It can be properly separated from the culture medium by, but is not limited thereto.
  • the present invention provides a composition comprising the dual target protein.
  • the present invention provides a composition for treating cancer comprising the dual target protein.
  • the dual target protein may be involved in inhibiting cancer growth by simultaneously binding DLL4 and VEGF to inhibit Notch and binding to VEGF receptors.
  • the DLL4 / Notch receptor and the VEGF / VEGF receptor are as described above.
  • the composition of the present invention can be administered in vivo a composition comprising a dual target protein that specifically binds DLL4 and VEGF, to inhibit the development, proliferation or metastasis of the cancer or to prevent the cancer to be treated.
  • cancer in the present invention includes, without limitation, the type of cancer, for example esophageal cancer, stomach cancer, colon cancer, rectal cancer, oral cancer, pharyngeal cancer, laryngeal cancer, lung cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, ovary Cancer, prostate cancer, testicular cancer, bladder cancer, kidney cancer, liver cancer, pancreatic cancer, bone cancer, connective tissue cancer, skin cancer, brain cancer, thyroid cancer, leukemia, Hodgkin's disease, lymphoma or multiple myeloma hematologic cancer.
  • treatment may mean any action that improves or advantageously changes the symptoms of cancer by administration of the composition.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier.
  • the term "pharmaceutically acceptable carrier” refers to a carrier or diluent that does not irritate an organism and does not inhibit the biological activity and properties of the administered compound.
  • Acceptable pharmaceutical carriers in compositions formulated as liquid solutions are sterile and physiologically compatible, including saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary.
  • diluents may be additionally added to formulate injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
  • the pharmaceutical composition may be in various oral or parenteral formulations.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
  • Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, which form at least one excipient such as starch, calcium carbonate, sucrose or lactose (at least one compound). lactose) and gelatin.
  • lubricants such as magnesium stearate, talc and the like are also used.
  • Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, and syrups, and various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the pharmaceutical composition is any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquid solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories. It can have one formulation.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • the term “pharmaceutically effective amount” means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level is determined by the type and severity, age, sex, disease of the individual. It may be determined according to the type, activity of the drug, sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field.
  • the compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.
  • the dual target protein of the present invention binds to both VEGF and DLL4 (FIGS. 3, 4A and 4B), can neutralize DLL4 (FIG. 5), and human gastric cancer with Avastin resistance.
  • SCH human gastric cancer with Avastin resistance
  • lung cancer A549) cell line xenograft model confirmed the anti-cancer efficacy of the dual target protein (Figs. 11 and 12), it was confirmed that it can be used as an active ingredient for cancer treatment compositions.
  • the present invention provides a method for treating cancer using a pharmaceutical composition comprising the dual target protein.
  • the method may be achieved by administering the pharmaceutical composition in a pharmaceutically effective amount.
  • the dual target protein and the pharmaceutically effective amount are as described above.
  • the dual target protein may be a method for treating cancer, comprising administering a pharmaceutical composition further comprising a pharmaceutically acceptable carrier to an individual with or suspected of having cancer, and which may be used as a carrier and
  • the cancer is the same as described above.
  • the subject may include a mammal, a bird, etc., including a cow, a pig, a sheep, a chicken, a dog, a human, and the like, and the subject to which the cancer is treated by administration of the composition of the present invention may be included without limitation.
  • the composition may be administered in the form of a liquid, powder, aerosol, capsule, enteric skin tablets or capsules or suppositories.
  • Routes of administration include, but are not limited to, intraperitoneal, intravenous, intramuscular, subcutaneous, endothelial, oral, topical, nasal, pulmonary, rectal, and the like.
  • the oral composition needs to be formulated to coat the active agent or protect it from degradation in the stomach.
  • the pharmaceutical composition may be administered by any device in which the active agent may migrate to the target cell.
  • the present invention provides a cancer diagnostic composition comprising the dual target protein.
  • the dual target protein and cancer are as described above.
  • diagnosis means identifying the presence or characteristic of a pathological condition. For the purposes of the present invention, the diagnosis is to determine whether the cancer has developed.
  • the cancer diagnostic composition of the present invention measures the level of VEGF or DLL4 protein in an isolated sample of a subject suspected of cancer by using the dual target protein of the present invention, and thus the level of the measured VEGF or DLL4 protein is higher than that of a normal control sample. Can be used to determine cancer.
  • Methods for measuring protein levels include Western blot, Enzyme Linked Immunosorbent Assay (ELISA), badioimmunoassay (otA: badioimmunoassay), radioioimmunodiffusion, and Ouchterlony immunity. Diffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS and protein chip, but are not limited thereto. Through such analytical methods, VEGF or DLL4 protein levels can be compared between a normal control group and a suspected cancer patient, thereby enabling diagnosis of cancer in a suspected cancer patient.
  • composition for diagnosing cancer of the present invention may further include, without limitation, what is known in the art as required to perform a method for measuring the level of the protein in addition to the dual target protein of the present invention.
  • the present invention provides a method for treating cancer, comprising: (a) measuring the level of VEGF or DLL4 protein in an isolated sample of an individual suspected of cancer using the dual target protein; And (b) provides a method for diagnosing cancer, comprising the step of judging cancer when the level of VEGF or DLL4 protein measured in step (a) is higher than the normal control.
  • the steps (method) of measuring the dual target protein, cancer, subject, diagnosis and protein are as described above.
  • sample includes samples, such as whole blood, serum, blood, plasma, saliva, urine, sputum, lymph, cerebrospinal fluid, and intercellular fluid, which differ in expression levels of VEGF or DLL4 in cancer patients. It is not limited.
  • the present invention provides a three-dimensional structure of DLL4, comprising amino acid sequence 58 to 65 and amino acid sequence 110 to 115 in the amino acid sequence of the DLL4 protein (Delta-like ligand 4) represented by SEQ ID NO: 21 Provide morphological epitopes.
  • the crosslinking reaction and mass spectrometry have identified the amino acid residues in which the crosslinking reaction occurs in DLL4 of SEQ ID NO: 21, amino acid sequence 58 to 65 containing the residues [FRVCLKHF] and 110 Two fragments of amino acid sequence from SEQ ID NO: 115 (SEQ ID NO: 23) were confirmed to form epitopes of DLL4 by constructing a continuous molecular surface, as shown in FIG.
  • the present invention provides a monoclonal antibody that specifically binds to DLL4, which recognizes the conformational epitope.
  • the monoclonal antibody is a heavy chain CDR1 represented by SEQ ID NO: 2; A heavy chain CDR2 represented by SEQ ID NO: 3; And a heavy chain variable region comprising a heavy chain CDR3 represented by SEQ ID NO: 4 and a light chain CDR1 represented by SEQ ID NO: 5; Light chain CDR2 represented by SEQ ID NO: 6; And a light chain variable region comprising the light chain CDR3 represented by SEQ ID NO: 7. More specifically, the heavy chain may be composed of the amino acid sequence of SEQ ID NO: 8, the light chain may be composed of the amino acid sequence of SEQ ID NO: 9.
  • the present invention provides a polynucleotide encoding the monoclonal antibody, an expression vector comprising the polynucleotide and a transformant into which the expression vector is introduced.
  • DLL4 monoclonal antibody, vector, transformant and the like of the present invention are the same as described above.
  • the present invention provides a method for treating cancer, comprising administering the dual target protein to a subject suspected of having cancer.
  • the subject may be a subject in need of preventing or treating cancer, and may be a mammal such as a cow, a horse, a sheep, a pig, a goat, a camel, a antelope, a dog, a cat, etc., in need of treatment of cancer and similar symptoms. However, it is not limited thereto.
  • the term "administration" refers to introducing the pharmaceutical composition of the present invention to a patient in any suitable manner, the route of administration of the composition of the present invention being oral or parenteral as long as it can reach the target tissue. Administration can be via a variety of routes.
  • the method of treating cancer of the present invention comprises administering a dual target protein or a pharmaceutical composition comprising the same in a therapeutically effective amount. It will be apparent to those skilled in the art that a suitable total daily usage may be determined by the practitioner within the scope of good medical judgment. It may also be administered once or in divided doses.
  • a specific therapeutically effective amount for a particular patient is determined by the specific composition, including the type and severity of the reactions to be achieved, whether or not the other agent is used in some cases, the age, weight, general state of health of the patient, It can be applied differently depending on various factors and similar factors well known in the medical field, including sex and diet, time of administration, route of administration and rate of composition, duration of treatment, drugs used with or concurrent with the specific composition.
  • Example 1 Preparation of anti DLL4 / VEGF dual target protein
  • the extracellular domain antigen of human DLL4 was a human DLL4 protein (Cat: 1506-D4 / CF) provided by R & D Systems. This DLL4 antigen protein was identified as Accession No. Amino acids 27-524 of the DLL4 amino acid sequence of Q9NR61. The histidine-tag (10-His tag) is ligated at the protein C-terminus.
  • Antigens against specific regions of another DLL4 extracellular domain were prepared. This particular region comprises amino acids 27 to 251. This region contains a motif called the "DSL (Delta / Serrate / lag-2)" domain that is known to bind the Notch1 receptor.
  • DLL Delta / Serrate / lag-2
  • Mammalian expression plasmid vectors containing a CMV promoter upstream of a polynucleotide encoding a deletion fragment (amino acids 27-251) of the extracellular domain of DLL4 fused to an Fc protein were prepared using standard recombinant DNA techniques. Additional constructs encoding deletion fragments of the chimeric DLL4 of human DLL4 fused to the Fc protein were prepared using conventional recombinant DNA techniques.
  • the constructed construct was transiently transfected into HEK 293E cells to express recombinant fusion proteins comprising human DLL4 amino acids 27 to 251 fused to Fc protein.
  • Conditioning medium was collected every 72 hours to obtain the protein and this was repeated four times. Purification from this conditioning medium was carried out using Protein A affinity chromatography.
  • helper phage was infected to infect 2X YT CMK (2X YT CM, kanamycin (sigma, K1876) 70 ⁇ g / ml, 1 mM IPTG (ELPISBIO, IPTG025)).
  • the medium was incubated at 30 ° C. for 16 hours.
  • the cultured cells were centrifuged (4500 rpm, 15 minutes, 4 ° C), and then dissolved in the supernatant by adding 4% PEG (Fluka, 81253) 6000 and 3% NaCl (sigma, S7653) to ice for 1 hour. Reacted.
  • Nonspecifically bound phages were washed five times with PBS-T (Phosphate buffered saline-0.05% Tween 20) solution, and the remaining antigen-specific phage antibodies were recovered using 100 mM triethylamine solution.
  • PBS-T Phosphate buffered saline-0.05% Tween 20
  • the recovered phages were neutralized with 1M Tris buffer (pH 7.4) and then infected with ER2537 Escherichia coli for 1 hour at 37 ° C., and infected E. coli were plated in LB (Luria-Bertani) agar medium containing carbenicillin overnight at 37 ° Incubated. The next day, E. coli cultured was suspended in 4 mL of SB (superbroth) -carbenicillin medium, 15% glycerol was added, and some were stored at -80 ° C. % Glucose solution (glucose) was added and incubated at 37 °C.
  • the culture medium When the absorbance of the culture medium reached 0.6 at 600 nm (OD 600 ), the culture medium was removed by centrifugation, suspended again in 20 mL of SB-carbenicillin culture medium, and then stirred in a 10 12 PFU VCSM13 helper phage and slowly stirred at 37 ° C. Incubated. The next day, the culture medium was centrifuged, and only the culture medium was taken out, 4% polyethylene glycol 8000 (PEG8000) and 3% sodium chloride (NaCl) were added thereto, precipitated at 4 ° C. for 30 minutes, and then centrifuged. The supernatant was removed and the precipitated phage was suspended in 1 mL of PBS and used as a library to amplify / concentrate the antigen specific clones by repeating the panning process above.
  • PEG8000 polyethylene glycol 8000
  • NaCl sodium chloride
  • coli was suspended in TES solution (Tris, EDTA, sucrose), left at 4 ° C for 1 hour and centrifuged to extract periplasm, which was then used to confirm the binding of recombinant human DLL4 antigen to scFv using ELISA. Used.
  • TES solution Tris, EDTA, sucrose
  • Bound scFv was detected using HRP (Horseradish peroxidase) -anti-HA antibody and tetramethylbenzidine (TMB) substrate.
  • HRP Haseradish peroxidase
  • TMB tetramethylbenzidine
  • Antigen-specific antibody clones identified therefrom were analyzed by sequencing. The results of analyzing the sequence of the selected scFv are shown in Table 1 below.
  • the anti-DLL4 antibody having this sequence was named "MLCK-2”.
  • the scFv type antibody that binds to human DLL4 prepared in Examples 1-3 was linked to Avastin IgG form using a linker to prepare a dual target protein expression vector capable of binding to human VEGF (FIG. 1B).
  • the prepared double target protein has a heavy chain amino acid sequence of SEQ ID NO: 1 (VEGF-DLL4 BsAb heavy chain) and a light chain amino acid sequence of SEQ ID NO: 20.
  • the heavy chain is a heavy chain CDR1 represented by SEQ ID NO: 2; A heavy chain CDR2 represented by SEQ ID NO: 3; And a heavy chain variable region comprising a heavy chain CDR3 represented by SEQ ID NO: 4, wherein the light chain comprises a light chain CDR1 represented by SEQ ID NO: 5; Light chain CDR2 represented by SEQ ID NO: 6; And a light chain variable region comprising the light chain CDR3 set forth in SEQ ID NO: 7.
  • a dual-target protein expression vector in CHO cells 200 cells per bottle in a 500 ml culture Erlenmeyer flask (Corning Costa) was used for the production of suspended cell cells transfected with the gene using a polymer that enhances the efficiency of intracellular gene transfer. A total of 1 L was incubated with mL. 1 L of a mixture of RPMI medium (Invitrogen Corporation) and CHO cell medium containing ultra low IgG Fetal Bovine Serum (Invitrogen Corporation) is added to the cell culture medium (Sanyo) for 4 days. Cultured at to produce recombinant protein. Cell cultures were obtained and centrifuged to separate supernatants containing suspended cells and secreted recombinant protein and filtered once with a 0.22 ⁇ m vacuum filter device (Millipore).
  • Avastin-DLL4 BsAb dual target antibody was purified from the culture primarily using recombinant Protein-A Sepharose column (Hitrap MabSelect Sure, 5 mL, GE healthcare). Specifically, the filtered culture medium was loaded onto a recombinant protein-A Sepharose column. The column was washed with 20 mM column volume with 50 mM Tris-Cl (pH 7.5), 100 mM NaCl, and impurities were washed with 10 mM column volume of 50 mM Na-citrate buffer solution (pH 5.0). The antibody was eluted with 5 mM Na-citrate 10 mM NaCl buffer solution (pH 3.4) and neutralized with 1M Tris-HCl buffer solution (pH 8.0).
  • Fractions separated and purified using the column were analyzed by SDS-PAGE (FIG. 2), and the positive fractions were collected and concentrated in a centrifugal concentrator (Amicon Ultra, Amicon Ultra, 30,000 MWCO, Millipore). Buffer exchange and concentration were performed with phosphorylated formulation buffer solution using the same centrifugal concentrator. Finally, the antibody was sterile filtered with a syringe filter of 0.22 ⁇ m pore diameter, and the absorbance (A 280 ) was measured to determine antibody concentration.
  • the binding capacity of the dual target protein was assessed using an ELISA based solution color development test for the anti DLL4, anti VEGF dual target protein.
  • 96-well plates (Nunc-Immuno Plates, NUNC, Rochester, NY) were prepared at 50 ng / ml for HVEGF (R & D systems, cat: 293-VE) at 50 ng overnight and at 200 ng / ml for rhDLL4 (R & D systems, cat: 1506-D4 / CF) was coated with 100 ⁇ l per well, and the nonspecific binding site was blocked with BSA for 2 hours.
  • Antibodies were diluted 1/5 at 128 nM and 64 nM on 96-well microtiter plates and inoculated with 100 ⁇ l of hDLL4 and hVEGF protein-coated plates, followed by 2 hours of incubation and 0.05% tween 20 Washed 5 times with PBS containing 20). To detect the antibody bound to the plate, HRP conjugated anti Fab antibody (Pierce, cat: 31414) was diluted 1: 40000, treated in a washed 96-well plate, and then reacted at 37 ° C. for 1 hour.
  • Color development was carried out using a colorimetric substrate (3,3 ', 5,5'-Tetramethylbenzidine; Sigma-Aldrich) and the enzyme reaction was stopped with 0.5 mol / l sulfuric acid. Absorbance was measured at a wavelength of 450 nm using a SpectraMax 190 (molecular Devices) instrument.
  • Example 1 the separated and purified dual target protein (double antibody) was named Avastin-DLL4 BsAb, and the affinity for the antigen of the isolated and purified antibody was analyzed as follows. A BIACORE assay was performed to determine the difference in binding capacity of Avastin-DLL4 BsAb dual target antibody to DLL4 and VEGF.
  • the first and third flow paths were blank, the second flow path was fixed as hVEGF, and the fourth flow path was designated as hDLL4.
  • the first and third flow passages are reference values showing nonspecific binding and buffer changes.
  • the experimental results used Fc2-Fc1 and Fc4-Fc3.
  • the Avastin-DLL4 BsAb double target antibody was converted to molar concentration, diluted to 100 nM with running buffer, and then diluted 1/2 consecutively at 5 concentration intervals.
  • the analytical sample was prepared in high purity / concentration so as to have a minimum dilution multiple of 100 or more to minimize the buffer effect. All analyzes were performed in multiples of one sample using the Wizard program, with a regeneration step between all assays to ensure that the baseline of the experiment was constant.
  • the results were analyzed by Biaevaluation software 4.0 version.
  • the baseline was set to 0, the buffer injection (analyte 0 nM) was subtracted from the entire sensorgram, and the results were analyzed using the binding affinity model using the Bivalent binding model.
  • the analysis items are K a (M ⁇ 1 s ⁇ 1 ), Kd (s ⁇ 1 ), and KD (M).
  • K a is an association constant indicating affinity
  • K d is a dissociation constant indicating stability.
  • Table 2 shows the results of the binding capacity analysis for hVEGF of the dual target protein
  • Table 3 shows the results of the binding capacity for hDLL4 of the dual target protein.
  • the neutralizing effect of the Avastin-DLL4 BsAb dual target antibody was assessed through ELISA-based solution competition experiments.
  • 500 ⁇ l / mL of hNotch-1-hFc protein (R & D systems) diluted in PBS was added 100 ⁇ l per well and then overnight at 4 ° C. After coating, the cells were treated with BSA for 2 hours to block nonspecific binding sites.
  • antigenic protein human DLL4-His, 600 ng / mL
  • the plate was then incubated for 2 hours and washed 5 times with PBS containing 0.05% tween 20, and the DLL4 antigen bound to the plate was HRP-conjugated His anti-mouse IgG polyclonal antibody reagent ( The HRP-conjugated His anti-mouse IgG polyclonal antibody was treated in a washed microtiter plate in a ratio of 1: 800 for detection by Roche applied science, and then reacted at 37 ° C. for 1 hour. Then, color development was carried out using a colorimetric substrate (3,3 ', 5,5'-Tetramethylbenzidine; Sigma-Aldrich co.) And the enzyme reaction was stopped with 0.5 mol / l sulfuric acid.
  • a colorimetric substrate (3,3 ', 5,5'-Tetramethylbenzidine; Sigma-Aldrich co.
  • the double-target protein of the present invention has a low IC 50 value of 1.12nM for DLL4, it was confirmed to have a DLL4 inhibitory activity as well as the anti-DLL4 antibody alone.
  • the antigen protein human delta-like ligand 4 (human DLL4, hDLL4, R & D Systems) and the MLCK2 antibodies of Examples 1-3 were mixed in a molar ratio of 2: 1, followed by a K200 crosslinker (CovalX AG.) With a final concentration of 0.2 mg / ml. I put it to be. The mixture was reacted for 3 hours at room temperature to form an antigen-antibody complex, followed by analyzing the molecular weight of the reaction product using Ultraflex II MALDI ToF (Bruker Daltonics) equipment. As shown in FIG.
  • the undeuterium-labeled deuccinimidyl suberate (d0-DSS) and the 12 deuterium-labeled d12-DSS were mixed 1: 1 and dissolved in DMF to prepare a 2 mg / ml solution.
  • Reactants were denatured by reduction and alkylation using dithiothreitol (DTT) and iodoacetamide (DTT) for effective degradation reactions, and fragmented using proteolytic enzymes such as trypsin, alpha-chymotrypsin, and ASP-N protease, respectively.
  • DTT dithiothreitol
  • DTT iodoacetamide
  • proteolytic enzymes such as trypsin, alpha-chymotrypsin, and ASP-N protease, respectively.
  • the resulting fragmentation reactants were subjected to mass spectrometry using the Ultimate 3000 nano-liquid chromatography system (Dionex) and the LTQ Orbitrap XL mass spectrometer (Thermo).
  • the resulting mass spectrometry data were analyzed using Xquest (version 2.0) software, Stavrox (version 2.1) software.
  • Crosslinked peptide pairs were fractionated. As a result,
  • the crosslinking reactions on human DLL4 occurred at amino acids residues 59, 63, 64, and 110 and included [58-65, FRVCLKHF] (SEQ ID NO: 22) and [110-115, TWPGTF] (SEQ ID NO: 23).
  • the two fragments constitute a contiguous molecular surface as shown in FIG. 7 on the human DLL4 C2 domain (27-174) model, and these two sequences could be estimated as epitopes of human DLL4 against MLCK2 antibodies.
  • a panel of alanine substitution mutants of human DLL4 was prepared as follows, in which the amino acids 64 (Histidine, histidine), 65 (phenylalanine, phenylalanine) and 69 (Valine, valine) of the human DLL4 extracellular protein region were prepared, respectively.
  • the amino acid of was substituted with alanine (Alanine).
  • a vector used for preparing an antigen for a specific region of the DLL4 extracellular domain was used as shown in Example 1-1.
  • the vector is a vector comprising genes of amino acids 27 to 251 of the human DLL4 specific region, which region is known as "DSL (delta / serrate / lag-2)" domain that binds to the Notch1 receptor. It contains a motif called.
  • a mammalian expression plasmid vector comprising a CMV promoter upstream of a polynucleotide encoding a deletion fragment (amino acids 27-251) of the extracellular domain of DLL4 fused to an Fc protein.
  • Recombinant DNA technology QuikChange Site-Directed Mutagenesis, Agilent
  • Transfection was performed using (Invitrogen, Invitrogen) and cultured for 4 days to obtain an expression medium.
  • a protein encoding a deletion fragment (amino acids 27 to 251) of the extracellular domain of wild type DLL4 was used.
  • the mutant expression medium incubated for 4 days was centrifuged at 1000 rpm for 10 minutes at room temperature to remove suspended solids, followed by 0.45 ⁇ m syringe filtration.
  • Western block was quantified using the Octet ® system (ForteBio) the expression level of the mutant expression medium for ratting experiments, so as to produce a constant amount of protein during SDS-Gel Loading use them. Thereafter, 20 ⁇ l of mutant expression medium was loaded onto two gels in the same manner as Novex 4-12% Bis / Tris gel, and gel electrophoresis was performed at 140V for 50 minutes using MOPS buffer.
  • a protein encoding a deletion fragment (amino acids 27 to 251) of the extracellular domain of wild-type DLL4 was used. After electrophoresis, protein bands were transferred to polyvinylidene difluoride membrane. There are two methods in total, one of which is HRP-conjugated anti-human to confirm that the SDS-Gel loading of deletion fragments (amino acids 27-251) of the extracellular domain of DLL4 was loaded with a certain amount of mutant and wild-type proteins.
  • the Fc antibody (1: 10000) (Pierce Cat: 31413) was used to bind to the transferred membrane, and then washed three times with PBS-T. The other was to determine the binding capacity of the MLCK2 antibody to the mutant.
  • Example 7 Analysis of the effect of DLL4 / VEGF double antibody on vascular endothelial cell (HUVEC) proliferation
  • vascular endothelial cell (HUVEC) proliferation of the double antibody binding to DLL4 and VEGF
  • human umbilical vein endothelial cells (HUVEC) were purchased from Lonza and used in the experiment.
  • the culture of HUVEC was coated with T-flask (Nunc) at room temperature for 4-6 hours with PBS buffer solution (Gibco) in which 1% gelatin (Sigma) was dissolved and washed with PBS.
  • the medium used was EBM-2 (Lonza) containing EGM-2 Single Quot (Lonza), and the culture of cells was subcultured in a 37 ° C., 5% CO 2 incubator at a density not exceeding 80%. Experiments were performed using cells within passage 6.
  • the vascular endothelial cell proliferation assay was performed as follows. To prepare hDLL4 coated plates, rhDLL4 (R & D systems) was diluted to 1 mg / mL using Carbonate buffer solution in 96-well plates (BD) the day before the experiment, and then inoculated at 100 mL / well to stand overnight at 4 ° C. I made it. In addition, HUVEC was to be left in EBM-2 medium with 0.1% FBS for 24 hours to minimize the effect of serum.
  • hVEGF 50 ng / mL
  • antibody Avastin: 20 mg / mL
  • DLL4 alone antibody 20 mg / mL
  • Avastin for each experimental group -DLL4 BsAb dual antibody: 26 mg / mL
  • HUVECs starved for 24 hours from the day before were single-celled, diluted to 4 x 10 3 cells / well using EBM-2 minimal medium and inoculated into wells treated with antibodies in a 37 ° C., 5% CO 2 incubator.
  • cell counting kit-8 (CCK-8, Dojino) was treated with 10 mL in each well and allowed to stand for 5 hours in a 37 °C, 5% CO 2 incubator. Absorbance was measured at a wavelength of 450 nm using a SpectraMax 190 (molecular Devices) device to compare the proliferation of cells in each group (FIG. 9).
  • the effect of inhibiting the proliferation of the VEGF-only antibody treatment can be interpreted as the experimental result that the double antibody of the present invention effectively inhibits both the VEGF and DLL4 signal transduction system.
  • Example 8 Analysis of DLL4 / Notch and VEGF / VEGFR Signaling Pathway Inhibitory Activity of DLL4 / VEGF Double Antibody
  • HUVEC was used in the same manner as used in Example 4 to determine the DLL4 / Notch and VEGF / VEGFR signal transduction inhibitory activity of the double antibody that binds DLL4 and VEGF.
  • the recombinant human DLL4 (rhDLL4, recombinant human DLL4, R & D systems) was diluted with 1 mg / mL of Carbonate buffer solution on 6-well plate (BD), and then added at 1 mL / well, and left overnight at 4 ° C.
  • the control group not treated with rhDLL4 was treated with 1 mL / well of Carbonate buffer solution alone, and left standing at 4 ° C. overnight.
  • HUVECs cultured in 75T plates of passages # 2 to # 5 were taken out during the antibody treatment time, and the cells were removed and cultured as single cells. Wash the cells by centrifugation and resuspend using fresh EGM-2 medium, count the cells and dilute to 5x 10 5 cells / mL, inoculate 1 mL into each well and incubate at 37 ° C, 5%. Incubation was overnight in a CO 2 incubator. EBM-2 minimal medium containing 0.2% FBS was prepared, medium was removed from each well of HUVEC incubated for one day, and once washed with PBS, 2 mL of EBM-2 medium containing 0.2% FBS was treated. .
  • cytolysis buffer solution 1% NP-40, 20mM Tris, 137mM NaCl, 10% Glycerol, 2mM EDTA, 1mM Sodium orthovanabate, 1x Protease & phosphatase inhibitor coctail
  • a cytolysis buffer solution 1% NP-40, 20mM Tris, 137mM NaCl, 10% Glycerol, 2mM EDTA, 1mM Sodium orthovanabate, 1x Protease & phosphatase inhibitor coctail
  • the plate was placed on ice and scraped off the HUVECs of each well with a scraper, collected in a 1.5 mL tube and left on ice. Remove 1.5 mL tubes from the ice every 5 minutes, vortex three times, and then immerse on ice again to proceed with cell lysis, centrifuge (4 ° C, 14000 rpm, 10 minutes) and transfer the supernatant to a new tube. After quantification, the mixture was mixed with 5x SDS sample buffer and boiled at 100 ° C. for 10 minutes, followed by SDS-PAGE analysis.
  • the dual target protein of the present invention can inhibit DLL4 / Notch and VEGF / VEGFR signal transduction pathways as much as the respective antibodies alone.
  • Example 9 Analysis of dual antibody anticancer activity in Avastin-resistant human SCH gastric cancer xenograft model
  • the double-target protein of the present invention significantly increased the anticancer effect against gastric cancer cell lines resistant to Avastin.
  • Avastin (2.5 mg / kg / week) was treated for 3 months to obtain A549 cancer cells resistant to administration of Avastin in which the tumor did not decrease after Avastin treatment. After removing the tumor, Avastin-resistant A549 cells were subjected to Ex-vivo culture and used for the efficacy analysis of the dual target antibody.
  • Avastin resistant A549 lung cancer cell line was inoculated into female nude mice, when the tumor size reached an average of 200 mm 3, each antibody was administered twice a week to in vivo anticancer activity of the dual target antibody. It was confirmed (FIG. 9).
  • In vivo testing using Avastin resistant A549 cells was also performed by administering Avastin-mouse DLL4 surrogate, a double antibody that binds to mouse DLL4 at the same site as human DLL4 epitope, instead of Avastin-DLL4 double antibody targeting human DLL4. Efficacy verification was demonstrated.
  • the double-target protein of the present invention significantly increased the anticancer effect against lung cancer cell lines resistant to Avastin.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Neurology (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pulmonology (AREA)

Abstract

본 발명은 신규한 델타 유사 리간드 4(Delta like ligand 4, DLL4)에 특이적으로 결합하는 단백질 및 혈관 내피 세포 성장 인자(Vascular endothelial cell growth factor, VEGF)에 특이적으로 결합하는 항체를 포함하는 이중표적 단백질에 관한 것이다.

Description

DLL4와 VEGF에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도
본 발명은 신규한 델타 유사 리간드 4(Delta like ligand 4, DLL4)에 특이적으로 결합하는 단백질 및 혈관 내피 세포 성장 인자(Vascular endothelial cell growth factor, VEGF)에 특이적으로 결합하는 항체를 포함하는 이중표적 단백질에 관한 것이다.
노치(Notch) 신호전달은 척추 동물에서 무척추 동물에 이르기까지 진화론적으로 잘 보존되어 있으며 발생 초기에 세포의 운명을 결정짓는데 매우 중요한 역할을 수행하는 것으로 보고되었다. 노치 신호전달은 신경, 안구, 림프, 근육, 혈구 등의 분화과정을 조절하는 주요 인자로 알려져 있으며, 또한 혈관 발생에도 관여하고 있다. 포유류에서는 4개의 노치 수용체를 가지고 있으며(Notch 1, 2, 3 및 4), 각각의 노치 수용체는 300-350kDa 크기의 단백질로 합성되며 골지체에서 퓨린-유사 전환효소(furin-like convertase)에 의해 S1 자리가 잘리면서 세포 표면에서 이형이합체(heterodimer)를 형성한다. 또한, 포유류에는 5개의 노치 리간드(Jagged-1/2 및 Delta-유사 리간드 (DLL) 1/3/4)가 확인되었다.
활성화된 노치 신호전달은 여러 암 모델에서 종양형성을 유발하는 것으로 알려져 있다. 활성 노치인 NICD를 쥐의 조혈세포에 발현시키는 경우 T-cell leukemia/lymphomas를 일으키고, T-ALL(T-cell acute lymphoblastic leukemia)에선 활성화된 노치 1이 50% 정도 발견되었다. 또한, 유방암의 경우에도 MMTV(mouse mammary tumor virus)가 삽입된 쥐(Czech II)에서 활성화된 노치 4 수용체가 과발현된 것이 발견되었고 이들 쥐에서 유선종양이 발생한 것이 보고되었다. 자궁경부암, 폐암, 췌장암, 난소암, 유방암, 전립선암과 같은 다양한 암에서 노치 수용체와 리간드 그리고 노치 신호 전달의 타겟이 활성화되어 있는 것이 보고되었다. 노치 1 수용체 발현과 유방암 환자의 좋지 않은 예후가 관련이 있고, 전립선 암에서는 암 전이와 관련되어 있는 것으로 알려져 있다.
델타 유사 리간드 4(Delta Like Ligand 4, DLL4)(이하에서는 "DLL4")는 혈관 내피 세포에서 과발현되어 있는 노치 단백질을 수용체로 하는 리간드의 델타 부류의 하나로서, 혈관 신생을 조절하는 주요 요소로 알려져 있다. DLL4는 특히, 혈관 내피에 과발현되는 노치 1 또는 노치 4 수용체에 결합을 한다. DLL4는 정상적인 혈관에서도 발현되나, 암 혈관에서는 매우 과발현되어 있는 것으로 알려져 있다. 신생 혈관 형성 과정(angiogenesis)은 기존 혈관으로부터 새로운 혈관이 생성되는 기작을 의미하며, 특히 종양에 있어서 혈관신생은 암 조직의 저산소 (hypoxia) 지역에서 산소와 영양분을 공급받기 위하여 VEGF(Vascular endothelial growth factor)와 같은 혈관 신생 인자에 의해 혈관신생이 일어난다. 종양에 있어서 혈관 신생은 종양의 성장뿐만 아니라 전이(metastasis)에 있어서도 중요하게 작용하는 것으로 알려져 있다. 종양에서 DLL4에 의한 노치 신호전달을 차단하게 되면 혈관 신생(angiogenesis)의 조절이 잘 이루어지지 않게 되므로 암의 성장을 억제할 수 있다. 또한, DLL4에 의한 노치 신호전달을 억제시키는 경우, 조절 T 세포(regulatory T cell, Treg)의 수를 증가시켜 자가면역질환(autoimmune diseases)을 치료할 수 있다(미국공개특허 제2011-0189200호). 이러한 이유로 DLL4는 암 및 자가면역질환의 치료에 있어서 새로운 표적이 되고 있다.
한편, 신생 혈관 형성을 억제하는 항암 항체 의약품으로는 VEGF를 타겟으로 하는 아바스틴(Avastin®, Genentech/Roche)이 지난 2004년 FDA의 승인을 거쳐 항암 치료제로 대성공을 거두고 있다. 그러나, 최근의 일부 임상 모델과 전임상 동물 모델 연구에서 모든 고형암(Solid tumor)이 VEGF 억제제에 반응하는 것은 아니며, 또한 초기에 VEGF 억제제로 치료가 진행되던 일부 종양이 일정 시간 경과 후 저항성을 띄는 경우가 다수 보고되고 있을뿐더러, VEGF 억제제 투여로 인해 암세포가 보다 공격적이고 전이가 잘 일어나는 암세포로 형질이 변환된다는 연구 결과들이 발표되고 있다. 이와 같은 연구 보고들은 아바스틴 내성을 이겨내거나 아바스틴의 약효를 뛰어넘는 신규 항암 타겟에 대한 연구 개발을 활발하게 추진하도록 만들었는데 이러한 새로운 항암 타겟으로 각광을 받고 있는 것들 중 하나가 DLL4/Notch 신호 전달 경로에 관여하는 단백질들이다. 현재까지 밝혀진 연구 결과에 따르면 VEGF/VGEFR 신호 경로와 DLL4/Notch 신호 경로가 서로 다른 작용 기전으로 신생 혈관 형성에 영향을 미치기 때문에 두 가지 신호 경로를 동시에 억제하였을 경우, 보다 강한 항암 시너지 효과를 기대할 수 있을 것으로 예상된다.
본 발명자들은 인간 DLL4와 VEGF에 특이적으로 결합하여 DLL4/Notch 및 VEGF/VEGFR 신호 전달 경로를 효과적으로 저해하고 면역원성의 위험성을 최소화할 수 있는 이중표적 단백질을 개발하기 위해 예의 노력한 결과, 인간 VEGF에 특이적으로 결합하는 인간 단일클론항체로서, IgG 기본형태인 아바스틴 유사체(Avastin similar)의 C-말단 부위에 인간 DLL4에 특이적으로 결합하는 신규한 ScFv(Single-chain variable fragment) 형태를 연결한 이중표적 단백질을 새로이 제작하였고, 이러한 이중표적 단백질이 VEGF와 VEGF 수용체 단백질의 상호작용은 물론, DLL4와 노치 단백질 사이의 상호작용 역시 효과적으로 차단하고, 이에 따라 우수한 항암 효과를 나타냄을 확인하여 본 발명을 완성하였다.
본 발명의 하나의 목적은 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프(conformational epitope)를 인지하는, DLL4에 특이적으로 결합하는 단백질, 및 VEGF(Vascular endotelial growth factor)에 특이적으로 결합하는 항체를 포함하는, 이중표적 단백질을 제공하는 것이다.
본 발명의 다른 목적은 상기 이중표적 단백질을 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 발현 벡터 및 상기 발현 벡터를 포함하는 형질전환체를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이중표적 단백질을 제조하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이중표적 단백질을 포함하는 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이중표적 단백질을 포함하는 암 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이중표적 단백질을 포함하는 암 진단용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이중표적 단백질을 이용하는 암의 진단방법을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는, DLL4의 입체형태적 에피토프를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 입체형태적 에피토프를 인지하는, DLL4에 특이적으로 결합하는 단일클론항체를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 단일클론항체를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 발현 벡터 및 상기 발현 벡터를 포함하는 형질전환체를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 이중표적 단백질을 암이 의심되는 개체에 투여하는 단계를 포함하는, 암의 치료방법을 제공하는 것이다.
본 발명의 이중표적 단백질은 VEGF와 DLL4에 동시에 결합하여 암을 치료할 수 있으며, DLL4에 특이적으로 결합하는 신규한 단백질을 이용함으로써, 결합력 및 항암효과가 뛰어나, 암 치료 및 진단 분야에 널리 활용될 수 있을 것이다.
도 1a 및 도 1b는 DLL4와 VEGF를 동시에 결합할 수 있는 이중표적 단백질의 구조를 나타낸 것이다.
도 2a는 DLL4 와 VEGF 를 동시에 결합할 수 있는 이중표적 단백질을 CHO 세포에서 발현하여 정제한 후, SDS-PAGE로 확인한 결과를 나타낸 것이다.
도 2b는 DLL4 와 VEGF 를 동시에 결합할 수 있는 이중표적 단백질을 CHO 세포에서 발현하여 정제한 후, SEC-HPLC 크로마토그래피 분석 결과를 나타낸 것이다.
도 3은 DLL4와 VEGF에 대한 이중표적 단백질의 DLL4와 VEGF에 대한 결합능 어세이(Binding assay)를 ELISA(enzyme-linked immunosorbent assay)를 통하여 분석한 결과를 나타낸 것이다.
도 4a는 이중표적 단백질의 항원인 DLL4에 대한 평형해리상수(equilibrium dissociation constant, KD) 값을 비아코어(Biacore) 분석 방법을 통해 측정결과를 나타낸 것이다.
도 4b는 이중표적 단백질의 항원인 VEGF에 대한 평형해리상수(equilibrium dissociation constant, KD) 값을 비아코어(Biacore) 분석 방법을 통해 측정결과를 나타낸 것이다.
도 5는 이중표적 단백질의 DLL4 및 VEGF에 대한 중화효과(Neutralizing assay)를 ELISA를 통하여 분석한 결과를 나타낸 것이다.
도 6은 크로스링커 유무에 따른 인간 DLL4 및 MLCK2 항체의 복합체 형성 결과를 나타낸 것이다.
도 7은 인간 DLL4 C2 도메인(27-174) 표면 상에서 서열번호 21로 표시되는 DLL4의 58-65번 아미노산 잔기[FRVCLKHF] 및 서열번호 22로 이루어진 단편이 연속된 분자표면을 구성하고 있는 모델을 나타낸 것이다.
도 8은 야생형 및 DLL4의 세포외 도메인의 결실단편을 코딩하는 돌연변이 단백질의 결합력을 웨스턴블랏팅을 통해 확인한 결과를 나타낸 것이다.
도 9a는 VEGF를 타겟으로 하는 항체인 아바스틴을 처리하였을 때, DLL4 의 존재 유무에 관계 없이 농도 의존적으로 혈관 내피 세포의 증식이 억제되는 것을 확인한 결과를 나타낸 것이다.
도 9b는 DLL4 단독에 대한 항체를 처리하였을 때, DLL4가 있는 실험군에서만 DLL4 항체 처리 농도에 의존적으로 혈관 내피 세포의 증식이 나타나는 것을 확인한 결과를 나타낸 것이다.
도 9c는 이중표적 단백질을 처리하였을 때, DLL4가 존재하지 않는 실험군에서는 아바스틴 항체 처리와 유사한 증식 억제 효능을 나타내고(흑색 막대), DLL4가 존재하는 실험군에서는 아바스틴 대비 혈관 증식 억제 효능이 줄어든 결과를 나타낸 것이다(백색 막대).
도 10은, DLL4와 VEGF에 결합하는 이중표적 단백질이 혈관내피세포(HUVEC)의 DLL4/Notch 신호 전달 경로와 VEGF/VEGFR 신호 전달 경로를 억제하는 활성을 나타냄을 웨스턴블롯(Western blot) 분석을 통해 나타낸 것이다.
도 11은, DLL4와 VEGF에 결합하는 이중표적 단백질이 누드 마우스에 구축한 아바스틴 저항성을 가지는 인간 위암 세포주 이종이식 모델(Avastin-resistant human SCH gastric cancer xenograft model)에서 아바스틴에 비해 강한 항암 효능을 가지고 있음을 확인한 것이다.
도 12는, DLL4와 VEGF에 결합하는 이중표적 단백질이 누드 마우스에 구축한 아바스틴 저항성을 가지는 인간 폐암 세포주 이종이식 모델(Avastin-resistant human A549 lung cancer xenograft model)에서 아바스틴에 비해 강한 항암 효능을 가지고 있음을 확인한 것이다.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프(conformational epitope)를 인지하는, DLL4에 특이적으로 결합하는 단백질, 및 VEGF(Vascular endotelial growth factor)에 특이적으로 결합하는 항체를 포함하는, 이중표적 단백질을 제공한다.
본 발명에서 용어, "이중표적 단백질"이란 서로 다른 두 종류의 항원 (표적 단백질)에 결합할 수 있는 단백질을 의미한다. 구체적으로는 자연적으로는 존재하지 않으며, 유전공학 또는 임의의 방법에 의해 제조된 형태임이 바람직하다.
본 발명의 목적상 상기 이중표적 단백질은 암세포에서 과발현되는 VEGF 및 내피세포에서 발현되는 DLL4과 결합할 수 있다. 또한, 상기 이중표적 단백질은 항체의 형태일 수 있다. 본 발명의 "이중표적 단백질"은 "이중표적 항체", "이중 항체" 또는 "이중 항체 단백질"과 혼용될 수 있다. 바람직하게 본 발명의 이중표적 단백질은 VEGF 및 DLL4를 항원으로 할 수 있다. 본 발명의 상기 이중표적 단백질의 형태는 특별히 이에 제한되지 않으나, IgG 형태의 VEGF에 특이적으로 결합하는 항체 및 DLL4에 특이적으로 결합하는 단백질이 링커로 연결된 이중표적 단백질의 형태를 포함하며, 그 구조는 도 1a에 간략히 모식도로 나타낸 바와 같다.
본 발명의 이중표적 단백질은 구체적으로 서열번호 1로 표시되는 중쇄 아미노산 서열 및 서열번호 20으로 표시되는 경쇄 아미노산 서열을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 용어, "항체"는 면역학적으로 특정 항원과 반응성을 갖는 면역글로불린 분자를 포함하는, 항원을 특이적으로 인식하는 수용체 역할을 하는 단백질 분자를 의미하며, 다클론항체, 단일클론항체, 전장(whole) 항체 및 항체 단편을 모두 포함한다. 또한, 상기 용어는 키메라성 항체(예를 들면, 인간화 뮤린 항체) 및 이종결합항체(예를 들면, 양특이성 항체)와 같은 유전공학에 의해 생산된 형태를 포함한다. 전장 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조이며, 각각의 경쇄는 중쇄와 다이설파이드 결합으로 연결되어 있다. 상기 전장 항체는 IgA, IgD, IgE, IgM 및 IgG를 포함하며, IgG는 아형(subtype)으로, IgG1, IgG2, IgG3 및 IgG4를 포함할 수 있다. 또한, 상기 항체는 이가(bivalent), 디아바디, 트리아바디 및 테트라바디를 포함할 수 있다. 구체적으로는 본 발명의 VEGF에 특이적으로 결합하는 항체는 IgG 형태일 수 있다.
본 발명에서 이중표적 단백질은 면역글로불린(Immunoglobulin G, IgG) 형태의 VEGF(Vascular endothelial growth factor)에 특이적으로 결합하는 항체 및 DLL4(Delta-like ligand 4)에 특이적으로 결합하는 전장 항체, Fab', F(ab')2, Fab, Fv, rIgG 또는 scFv 형태의 단백질이 링커로 연결된 형태일 수 있다.
전형적으로, 면역글로불린 및 scFv는 중쇄 및 경쇄를 가지며 각각의 중쇄 및 경쇄는 불변 영역 및 가변 영역(상기 부위는 도메인으로 또한 알려져 있음)을 포함한다. 경쇄 및 중쇄의 가변 영역은, 상보성 결정 영역(complementarity-determining region, 이하 "CDR"이라 함)이라 불리우는 3개의 다변가능한 영역 및 4개의 구조 영역(framework region)을 포함한다. 상기 CDR은 주로 항원의 에피토프(epitope)에 결합하는 역할을 한다. 각각의 사슬의 CDR은 전형적으로 N-말단으로부터 시작하여 순차적으로 CDR1, CDR2, CDR3로 불리우고, 또한 특정 CDR이 위치하고 있는 사슬에 의해서 식별될 수 있다.
본 발명에 따른 DLL4에 특이적으로 결합하는 단백질 및 VEGF에 특이적으로결합하는 항체를 포함하는 이중표적 단백질은 인간 유래 DLL4와 VEGF에 대해서 강한 친화력을 나타내며, DLL4를 발현하고 있는 세포(예-암세포나 혈관 내피 세포)가 노치 1 또는 노치 4 수용체에 결합하는 것을 효과적으로 저해할 뿐 아니라, 암세포에서 과발현하는 VEGF에 의해 VEGF 수용체를 발현하고 있는 혈관 내피 세포가 활성화되는 신생 혈관 형성 작용을 억제하여, 암과 같은 질병의 치료에 있어 보다 강한 치료 효과를 기대할 수 있다.
본 발명의 이중표적 단백질에서 VEGF에 특이적으로 결합하는 항체 및 DLL4에 특이적으로 결합하는 단백질은 각각의 특이적인 결합을 유지하며, 특히 두 개의 표적(항원)을 동시에 억제시킬 수 있기 때문에 하나의 표적과 결합하여 억제하는 것보다 더욱 효과적일 수 있고, 동시에 두 개의 신호를 억제시킬 수 있다.
본 발명에서 용어, "항체 단편"은 항원결합능력을 가지는 단편, 예를 들면, Fab', F(ab')2, Fab, Fv, rIgG 및 scFv를 포함하는, 항체의 항원 결합 형태를 포함한다. 특히, 상기 용어는 scFv(single-chain variavle fragment)를 포함하고, 이가(bivalent) 또는 디아바디(Diabody), 트리아바디(Triabody) 및 테트라바디 (Tetrabody)를 포함한다.
본 발명에서 용어, "scFv(single-chain variavle fragment)"는 완전한 항원-인식 및 항원-결합 부위를 갖는 최소 항체 단편을 의미하며, 항체의 VH 및 VL 도메인을 포함하고, 여기서 상기 도메인들은 단일 폴리펩티드 사슬에 존재할 수 있다.
본 발명에서 용어, " 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프(conformational epitope)를 인지하는, DLL4에 특이적으로 결합하는 단백질, 및 VEGF(Vascular endotelial growth factor)에 특이적으로 결합하는 항체를 포함하는, 이중표적 단백질"은 DLL4 및 VEGF에 의한 두 가지 신호 전달 경로를 동시에 억제할 수 있는 이중표적 단백질이라면 제한없이 포함할 수 있다. 상기 이중표적 단백질을 구성하는 VEGF에 특이적으로 결합하는 항체 및 DLL4에 특이적으로 결합하는 항체는 상기에서 설명한 전장 항체 및 항체 단편의 형태를 모두 포함할 수 있다.
본 발명에서 용어, "서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프(conformational epitope)를 인지하는, DLL4에 특이적으로 결합하는 단백질"은 서열번호 21로 표시되는 DLL4 내의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프에 특이적으로 결합하는 단백질을 의미한다. 이러한 단백질은 암의 성장을 억제하여 암 치료 효과를 나타낼 수 있는 단백질을 의미하며, 높은 친화도로 상기 에피토프에 결합하고 DLL4 활성을 중화시키는 역할을 할 수 있다. 상기 단백질은 노치 수용체에 대한 DLL4 결합을 차단할 수 있으며, DLL4에 의한 신호전달을 억제할 수 있다. 상기 DLL4의 서열번호 21 및 서열번호 22를 포함하는 입체형태적 에피토프(epitope)에 특이적으로 결합하는 단백질은 구체적으로는 전장 항체, Fab', F(ab')2, Fab, Fv, rIgG 또는 scFv(Single-chain variable fragment) 형태일 수 있다.
상기 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 입체형태적 에피토프에 특이적으로 결합하는 단백질은 구체적으로는, 상기 DLL4에 특이적으로 결합하는 단백질은 서열번호 2로 표시되는 중쇄 CDR1; 서열번호 3으로 표시되는 중쇄 CDR2; 및 서열번호 4로 표시되는 중쇄 CDR3를 포함하는 중쇄 가변 영역 및 서열번호 5로 표시되는 경쇄 CDR1; 서열번호 6으로 표시되는 경쇄 CDR2; 및 서열번호 7로 표시되는 경쇄 CDR3를 포함하는 경쇄 가변 영역을 포함하는 형태일 수 있다.
보다 구체적으로는 상기 중쇄는 서열번호 8로 표시되는 중쇄 아미노산 서열을 포함할 수 있고, 경쇄는 서열번호 9로 표시되는 경쇄 아미노산 서열을 포함할 수 있으나, 상기 기술한 CDR 서열을 포함하며, DLL4에 특이적으로 결합하여 암 치료 효과를 나타낼 수 있는 단백질이라면 그 서열은 달라질 수 있다. 상기 중쇄 및 경쇄는 링커를 통해 연결될 수 있다.
또한, 본 발명의 이중표적 단백질의 구성요소인 DLL4에 특이적으로 결합하는 단백질은 인간 DLL4뿐만 아니라 마우스 DLL4에 특이적으로 결합하면서 DLL4와 노치 단백질 간의 상호작용을 저해시킬 수 있다.
본 발명의 일 실시예에서는 DLL4 및 VEGF의 생물학적 저해 활성이 우수한 본 발명의 이중표적 단백질의 DLL4에 특이적으로 결합하는 항체의 에피토프를 규명하였다. 구체적으로, 본 발명에서는 DLL4의 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열이 형성하는 DLL4의 연속된 분자표면에 결합함을 규명하였다. 따라서, DLL4의 58번 내지 65번 아미노산 서열(서열번호 22) 및/또는 110번 내지 115번 아미노산 서열(서열번호 23)이 본 발명에 따른 DLL4에 특이적으로 결합하는 항체의 에피토프가 될 수 있으며, 보다 구체적으로 상기 DLL4의 서열번호 22 및 23번 부위가 형성하는 분자표면 부위가 입체형태적 에피토프가 될 수 있다.
본 발명에서 용어, "델타 유사 리간드 4(delta-like ligand 4, DLL4)"는 노치 단백질을 수용체로 하는 리간드의 델타 부류의 하나로서, 구체적으로는 노치 1 또는 노치 4 수용체에 결합하는 단백질을 의미하나, 이에 제한되지 않는다. 상기 DLL4는 포유류의 DLL4라면 제한없이 포함될 수 있으나, 구체적으로는 인간 또는 마우스의 DLL4를 의미할 수 있다. DLL4는 암의 혈관(tumor vasculature)을 비롯한 다양한 암 세포에서 과발현되어 있으며, 여러 이종이식(xenograft) 모델에서 비정상적혈관수를 증가시켜 암의 성장을 촉진시키는 것으로 알려져 있다.
이에 본 발명의 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프에 특이적으로 결합하는 단백질을 포함하는 이중표적 단백질은 DLL4의 기능을 억제하여 암치료에 효과적으로 이용될 수 있다. 상기 DLL4에 대한 정보는 미국국립보건원의 GenBank 등 공지의 데이터베이스로부터 얻을 수 있으며, 그 예로 Accession Number가 Gene ID:54567, NCBI Reference Sequence: NM_019074.3인 DLL4의 정보일 수 있으며, 상기 DLL4는 서열번호 21의 아미노산 서열을 포함할 수 있다.
본 발명에서 용어, "노치(Notch) 수용체"는 노치 신호 전달을 매개하는 단백질을 의미하며, 노치와 혼용하여 사용될 수 있다. 상기 노치 수용체는 노치 신호 전달을 매개하는 단백질이라면 제한없이 포함될 수 있으며, 구체적으로는 노치 1 또는 노치 4 수용체일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "인간 델타 유사 리간드 4(DLL4)와 노치(Notch) 수용체 간의 상호작용을 저해"는 본 발명의 DLL4에 특이적으로 결합하는 이중표적 단백질이 DLL4에 결합하여 DLL4와 노치 수용체 간의 상호작용을 저해시키는 것을 의미하며, 구체적으로는 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프에 특이적인 이중표적 단백질이 DLL4에 결합하여 DLL4와 노치 1 또는 노치 4 수용체와의 상호작용을 저해시키는 것을 의미할 수 있으나, 이에 제한되지 않는다. 본 발명의 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프에 특이적인 이중표적 단백질의 결합에 의해 DLL4와 노치 수용체 간의 상호작용이 저해되며, DLL4의 노치 수용체 결합에 의한 노치 단백질의 구조적 변화를 가져오지 못하여 가수분해될 수 없어 노치 신호전달을 가져올 수 없게 한다. 암에서 DLL4와 노치 수용체가 결합하게 되면, 혈관 크기를 증대시키고, 혈곤 내피 세포 간의 신호전달 또는 암 세포와 혈관 내피 세포 간의 노치 신호전달을 활성화시켜, 암의 증식과 전이를 억제하는 것으로 알려져 있다.
따라서, 암에서 DLL4에 의한 노치 신호전달을 차단하게 되면 특히 혈관 신생 조절이 잘 이루어지지 않게 되어 암의 성장을 억제할 수 있게 된다. 또한, DLL4를 차단하게 되면 혈관신생 부위 말단의 세포에서 외측 억제(lateral inhibition)의 결실이 나타나서 과도한 발아가 이루어지게 되고 그 결과로 지나치게 많으면서도 생산성은 떨어지는 혈관신생 반응이 높아지게 되며, 산소를 공급하는 관류가 나빠져서 암 주변에 저산소 상태가 유도될 수 있어 항암 효과를 가져올 수 있으며, 특히 항 VEGF 치료에서도 저항성을 보이는 암에서도 항암 효과를 나타낼 수 있다.
따라서, DLL4와 노치 간의 상호작용을 효과적으로 억제하는 본 발명의 DLL4에 특이적으로 결합하는 단백질을 포함하는 이중표적 단백질을 암의 치료에 있어 효과적으로 사용할 수 있다.
본 발명의 용어 "VEGF에 특이적으로 결합하는 항체"는 암세포에서 광범위하게 VEGF를 항원으로 하여 이에 특이적으로 결합하는 항체이면 모두 포함한다. 구체적인 예로는 VEGF를 표적으로 하는 치료용 항체인 베바시주맙(Bevacizumab, 상품명 아바스틴®), 일 수 있으나 이에 제한되지는 않는다. 이와 같은 VEGF에 특이적으로 결합하는 항체는 상기 기술한 전장 항체 또는 항체 단편의 형태를 모두 포함하며, IgG 항체 형태일 수 있으나, 이에 제한되지 않는다. VEGF는 신생혈관생성에서 중요한 역할을 하는 리간드로 이를 억제하면 신생혈관생성이 이루어지지 않아서 암을 치료할 수 있다. 상기 베바시주맙은 제넨텍사의 아바스틴(Avastin)으로 미국 FDA에 승인을 받은 것으로 안정적으로 사용할 수 있는 치료용 항체이다.
상기 VEGF에 특이적으로 결합하는 항체는 구체적으로, 중쇄 가변 영역은 서열번호 10으로 표시되는 중쇄 CDR1; 서열번호 11로 표시되는 중쇄 CDR2; 및 서열번호 12로 표시되는 중쇄 CDR3를 포함하고 경쇄 가변 영역은 서열번호 13으로 표시되는 경쇄 CDR1; 서열번호 14로 표시되는 경쇄 CDR2; 및 서열번호 15로 표시되는 경쇄 CDR3를 포함할 수 있으며, 더욱 구체적으로는 서열번호 16으로 표시되는 중쇄 아미노산 서열 및 서열번호 17로 표시되는 경쇄 아미노산 서열을 포함할 수 있으나, VEGF에 특이적으로 결합하여 암 치료 효과를 나타낼 수 있는 단백질의 서열은 제한 없이 포함될 수 있다.
본 발명의 이중표적 단백질의 구성요소인 VEGF에 특이적으로 결합하는 항체는 암세포에서 과발현되는 VEGF에 특이적으로 결합하여, 본 발명의 이중표적 단백질을 VEGF를 발현하는 암세포로 집중시킬 수 있을 뿐만 아니라, VEGF와 결합하여 그 자체로도 항암활성을 가질 수 있다.
본 발명에서 용어, "혈관 내피 성장인자(vascular endothelial growth factor, VEGF)"는 혈관내피세포의 생장활성을 증진시키는 성장인자의 일종으로, 대시식세포, 평활근세포, 종양세포 등 여러 세포에 의하여 분비된다. 태생기 혈관 생성에 중요한 역할을 할 뿐 아니라 빠른 생장과 대사가 이루어지는 종양 조직에서 산소의 공급을 위하여, 혈관신생(angiogenesis)를 유도하는 역할을 한다. 해당 VEGF 단백질과 이의 수용체에 의한 pathway는 성체에서 특히 항암제의 타겟 신호전달 경로로 연구되고 있다.
아울러, 상기 이중표적 단백질의 VEGF 결합부위는 인간 VEGF 와 VEGF 수용체 간의 상호작용을 저해시키는 것을 의미하며, 구체적으로는 VEGF에 특이적인 이중표적 단백질이 VEGF에 결합하여 VEGF와 VEGFR-2 수용체와의 상호작용을 저해시키는 것을 의미할 수 있으나, 이에 제한되지 않는다.
본 발명의 목적상 상기 VEGF 수용체는 포유류의 VEGF에 결합하는 단백질이라면 제한없이 포함될 수 있으나, 구체적으로는 인간 VEGF에 결합하는 단백질을 의미할 수 있다.
본 발명의 VEGF에 특이적인 이중표적 단백질에 의한 VEGF와 VEGF 수용체 간의 상호작용 저해를 통하여 VEGF의 VEGF 수용체 결합에 의한 VEGF/VEGF 수용체 신호전달을 억제하게 된다. 암에서 VEGF와 VEGF 수용체가 결합하게 되면, 암조직의 혈관 내피 세포(stromal/endothelial cell)에서 VEGF/VEGF 수용체 신호전달이 활성화되고, 이는 DLL4/Notch 신호 전달 경로의 작용 기전과 달리 신생 혈관 형성 과정을 강하게 억제하여 혈관의 수를 감소시키며, 종양 내의 맥관 기능(vascular function)을 약화시켜 암의 증식과 전이를 억제하는 것으로 알려져 있다.
따라서, 본 발명의 상기 DLL4와 VEGF에 특이적인 이중표적 단백질은 서로 다른 기전의 암조직 신생 혈관 형성 억제능을 보여주어 보다 뛰어난 항암 능력을 가진 치료제로서 사용될 수 있다.
구체적으로, 상기 이중표적 단백질은 DLL4에 특이적으로 결합하는 단백질 및 IgG(Immuniglobulin G) 형태의 VEGF에 특이적으로 결합하는 항체가 링커로 연결된 형태일 수 있다.
본 발명의 용어, "링커(linker)"란 기본적으로는 두개의 서로 다른 융합 파트너(예를 들어, 생물학적 고분자 등)를 수소 결합, 정전기적 상호작용, 반데르 바알스력, 이황화 결합, 염 브릿지, 소수성 상호작용, 공유결합 등을 이용하여 연결할 수 있는 연결체를 의미하는데, 구체적으로는 생리학적 조건 또는 다른 표준 펩타이드 조건(예를 들면, 펩타이드 정제 조건, 펩타이드 저장 조건)하에서 적어도 하나의 이황화 결합에 참여할 수 있는 적어도 하나의 시스테인을 가질 수 있으며, 단순히 각각의 융합 파트너를 연결하는 역할 이외에도, 융합파트너 사이에 일정한 크기의 간격을 부여하는 역할을 수행하거나 또는 융합체에 유연성 또는 강직성을 제공하는 힌지(hinge)의 역할을 수행할 수 있다. 상기 링커는 비펩타이드 링커 또는 펩타이드 링커일 수 있으며, 펩티드 결합, 이황화 결합 등에 의해서 직접 연결되는 것도 모두 포함될 수 있다.
본 발명에서 상기 링커는 특별히 이에 제한되지는 않으나, 구체적으로는 DLL4에 특이적으로 결합하는 단백질 및 VEGF에 특이적으로 결합하는 항체를 연결할 수 있는 폴리펩티드가 될 수 있고, 더욱 구체적으로는 상기 DLL4에 특이적으로 결합하는 단백질과 VEGF에 특이적으로 결합하는 항체의 Fc 영역의 C-말단을 연결할 수 있는 펩타이드 링커가 될 수 있으며, 더욱 더 구체적으로는 GGGGS 모티프가 3번 반복된 형태의 아미노산 서열로 구성된 펩타이드 링커가 될 수 있다. 상기 GGGGS 모티프는 1~10번 반복될 수 있으며, 가장 구체적으로는 하기의 서열번호 18의 아미노산 서열 또는 서열번호 19의 폴리뉴클레오티드 서열에 의하여 코딩된 아미노산 서열로 구성될 수 있다.
링커 펩타이드(서열번호 18): GGGGSGGGGSGGGGS
링커 폴리뉴클레오티드(서열번호 19): GGTGGAGGTGGCAGCGGTGGTGGCGGCAGTC CCGGTGGCGGCTCC
본 발명에서 용어, "비펩타이드 링커"는 반복 단위가 2개 이상 결합된 생체 적합성 링커를 의미하며, 상기 반복 단위들은 펩타이드 결합이 아닌 임의의 공유 결합을 통해 서로 연결될 수 있다.
본 발명의 비펩타이드 링커는 폴리에틸렌 글리콜(polyethylene glycol; PEG) 단독 중합체, 폴리프로필렌 글리콜 단독 중합체, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시 에틸화 폴리올, 폴리비닐 알콜, 폴리사카라이드, 덱스트란, 폴리비닐 에틸 에테르과 같은 생분해성 고분자, 지질 중합체, 키틴류, 히아루론산 또는 이들의 조합일 수 있다. 구체적으로는 폴리에틸렌 글리콜 단독 중합체일 수 있으며, 당해 분야에 이미 알려진 이들의 유도체 및 당해 분야의 기술 수준에서 용이하게 제조할 수 있는 유도체들도 본 발명의 범위에 포함될 수 있다. 더욱 구체적으로는 분자량 1 내지 5kDa의 분자량인 폴리에틸렌 글리콜 단독 중합체일 수 있으며, 가장 구체적으로는 3.4kDa 정도의 양 말단에 양기능성 알데히드(bifunctional aldehyde) 형태로 DLL4에 특이적으로 결합하는 단백질 및 VEGF에 특이적으로 결합하는 항체를 연결시킬 수 있는 링커일 수 있다. 특히, 양 말단에 반응 알데히드 그룹의 반응기를 갖는 경우, 비특이적 반응을 최소화하는 데 효과적이다.
상기 링커를 통하여 직접 또는 간접적으로 연결되는 부위는 특별히 이에 제한되지 않으나, Fc 부분, Fab', F(ab')2, Fab, Fv 등이 될 수 있다. 상기 이중표적 단백질은 특별히 이에 제한되지 않으나, 상기 DLL4에 특이적으로 결합하는 단백질 전체 또는 일부 및 VEGF에 특이적으로 결합하는 항체 전체 또는 일부가 연결된 형태; 또는 DLL4에 특이적으로 결합하는 단백질 전체 또는 일부 및 VEGF에 특이적으로 결합하는 항체 전체 또는 일부가 펩타이드 링커로 연결된 형태가 될 수 있다.
또한, DLL4에 특이적으로 결합하는 단백질 전체 또는 일부 및 VEGF에 특이적으로 결합하는 항체의 중쇄 전체 또는 일부가 펩타이드 링커로 연결된 형태; DLL4에 특이적으로 결합하는 단백질 전체 또는 일부 및 VEGF에 특이적으로 결합하는 항체의 경쇄 전체 또는 일부가 펩타이드 링커로 연결된 형태; 또는 이들의 조합이 될 수 있다.
본 발명의 실시예에 따르면, 본 발명자들은 IgG 형태의 아바스틴의 중쇄 영역 C-말단과 scFv 형태의 DLL4 결합 단백질을 링커로 연결한 이중표적 단백질을 코딩하는 폴리뉴클레오티드를 벡터에 삽입하고, 이를 동물세포에 도입하여 아바스틴-DLL4 결합 이중표적 단백질을 분리하여, DLL4와 VEGF에 특이적으로 결합하는 이중표적 단백질 아바스틴-DLL4 BsAb를 제작하였다. 상기 이중표적 단백질 분자는 아바스틴 IgG 항체 분자와 DLL4 결합 scFv 를 링커로 연결한 구조를 가지고 있다(도 1). 상기 동물세포에 도입·발현한 아바스틴-DLL4 결합 이중표적 단백질을 분리하여 발현 및 순도를 확인하였다(도 2a 및 도 2b). 또한, 아바스틴-DLL4 결합 이중표적 단백질이 표적인 VEGF 및 DLL4에 특이적으로 결합하는 것을 확인하였다(도 3). 또한, 상기 이중표적 단백질은 각 항원에 대한 대조 항체와 유사한 결합 활성을 보여주어 인간 DLL4에 대해서는 30 nM의 KD값을 인간 VEGF에 대해서는 0.126 nM의 KD값을 나타내었으며(표 2 내지 3), 혈관 내피 세포의 DLL4와 인간 노치 1 수용체와의 결합 및 VEGF와 VEGF 수용체와의 결합에 의한 각각의 신호 전달 경로가 이중표적 단백질 처리에 의해 효과적으로 억제됨을 확인하였다(도 10). 이러한 결과는 본 발명의 DLL4와 VEGF에 특이적인 이중표적 단백질이 각각의 수용체인 노치 및 VEGF 수용체와의 결합을 효율적으로 차단하여 항암 효과를 가져올 수 있음을 시사하는 것으로 아바스틴 내성을 가진 인간 위암(SCH) 및 폐암(A549) 세포주 이종이식 모델(xenograft model)에서 이중 항체의 항암 효능을 확인하였다(도 11 및 도 12).
또 하나의 양태로서, 본 발명은 상기 이중표적 단백질을 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 발현 벡터 및 상기 발현 벡터가 도입된 형질전환체를 제공한다.
본 발명에서 제공하는 상기 이중표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터는 특별히 이에 제한되지 않으나, 포유류 세포(예를 들어, 사람, 원숭이, 토끼, 래트, 햄스터, 마우스 세포 등), 식물 세포, 효모 세포, 곤충 세포 또는 박테리아 세포(예를 들어, 대장균 등)를 포함하는 진핵 또는 원핵세포에서 상기 폴리뉴클레오티드를 복제 및/또는 발현할 수 있는 벡터가 될 수 있고, 구체적으로는 숙주세포에서 상기 폴리뉴클레오티드가 발현될 수 있도록 적절한 프로모터에 작동가능하도록 연결되며, 적어도 하나의 선별마커를 포함하는 벡터가 될 수 있으며, 더욱 구체적으로는 파아지, 플라스미드, 코스미드, 미니-염색체, 바이러스, 레트로바이러스 벡터 등에 상기 폴리뉴클레오티드가 도입된 형태가 될 수 있다.
상기 이중표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터는 상기 이중표적 단백질의 중쇄 또는 경쇄를 코딩하는 폴리뉴클레오티드를 각각 포함하는 발현벡터 또는 중쇄 또는 경쇄를 코딩하는 폴리뉴클레오티드를 모두 포함하는 발현벡터일 수 있다.
본 발명에서 제공하는 상기 발현 벡터가 도입된 형질전환체는 특별히 이에 제한되지 않으나, 상기 발현벡터가 도입되어 형질전환된 대장균, 스트렙토미세스, 살모넬라 티피뮤리움 등의 박테리아 세포; 효모 세포; 피치아 파스토리스 등의 균류세포; 드로조필라, 스포도프테라 Sf9 세포 등의 곤충 세포; CHO(중국 햄스터 난소 세포, chinese hamster ovary cells), SP2/0(마우스 골수종), 인간 림프아구(human lymphoblastoid), COS, NSO(마우스 골수종), 293T, 보우 멜라노마 세포, HT-1080, BHK(베이비 햄스터 신장세포, baby hamster kidney cells), HEK(인간 배아신장 세포, human embryonic kidney cells), PERC.6(인간망막세포) 등의 동물 세포; 또는 식물 세포가 될 수 있다. 본 발명의 일 실시예에 따르면 CHO-S 세포를 숙주세포로 이용하였다.
본 발명에서 용어, "도입"은 이중표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포에 전달하는 방법을 의미한다. 이와 같은 도입은 칼슘 포스페이트-DNA 공침전법, DEAE-덱스트란-매개 트랜스펙션법, 폴리브렌-매개 형질감염법, 전기충격법, 미세주사법, 리포좀 융합법, 리포펙타민 및 원형질체 융합법 등의 당 분야에 공지된 여러 방법에 의해 수행될 수 있다. 또한, 형질도입은 감염(infection)을 수단으로 하여 바이러스 입자를 사용하여 목적물을 세포 내로 전달시키는 것을 의미한다. 아울러, 유전자 밤바드먼트 등에 의해 벡터를 숙주세포 내로 도입할 수 있다. 본 발명에서 도입은 형질전환과 혼용되어 사용될 수 있다.
또 하나의 양태로서, 본 발명은 상기 이중표적 단백질을 제조하는 방법을 제공한다.
구체적으로는 (a) 상기 형질전환체를 배양하여 이중표적 단백질을 생산하는 단계; 및 (b) 상기 (a) 단계에서 생산된 이중표적 단백질을 회수하는 단계를 포함하는, DLL4에 특이적으로 결합하는 단백질 및 VEGF(Vascular endotelial growth factor)에 특이적으로 결합하는 항체를 포함하는 이중표적 단백질의 제조방법일 수 있다.
더욱 구체적으로는 (a) VEGF에 특이적으로 결합하는 항체를 코딩하는 폴리뉴클레오티드 및 중쇄 가변 영역은 서열번호 2로 표시되는 중쇄 CDR1; 서열번호 3으로 표시되는 중쇄 CDR2; 및 서열번호 4로 표시되는 중쇄 CDR3를 포함하고 경쇄가변영역은 서열번호 5로 표시되는 경쇄 CDR1; 서열번호 6으로 표시되는 경쇄 CDR2; 및 서열번호 7로 표시되는 경쇄 CDR3를 포함하는, DLL4에 특이적으로 결합하는 단백질을 코딩하는 폴리뉴클레오티드를 수득하는 단계; (b) 상기 (a) 단계에서 수득한 VEGF에 특이적으로 결합하는 항체를 코딩하는 폴리뉴클레오티드 중 Fc 영역을 코딩하는 폴리뉴클레오티드의 3'-말단 및 DLL4에 특이적으로 결합하는 단백질을 코딩하는 폴리뉴클레오티드의 5'-말단을 링커로 연결하여 이중표적 단백질을 코딩하는 폴리뉴클레오티드를 수득하는 단계; (c) 상기 (b) 단계의 이중표적 단백질을 코딩하는 폴리뉴클레오티드를 클로닝하여 발현 벡터를 제조하는 단계; (d) 상기 (c) 단계의 발현 벡터를 숙주 세포에 도입하여 형질전환체를 배양하는 단계; 및 (e) 상기 (d) 단계의 형질전환체로부터 이중표적 단백질을 회수하는 단계를 포함하는 방법일 수 있다.
또한, 상기 제조방법은 (a) VEGF에 특이적으로 결합하는 항체를 코딩하는 폴리뉴클레오티드 및 중쇄 가변 영역은 서열번호 2로 표시되는 중쇄 CDR1; 서열번호 3으로 표시되는 중쇄 CDR2; 및 서열번호 4로 표시되는 중쇄 CDR3를 포함하고 경쇄가변영역은 서열번호 5로 표시되는 경쇄 CDR1; 서열번호 6으로 표시되는 경쇄 CDR2; 및 서열번호 7로 표시되는 경쇄 CDR3를 포함하는, DLL4에 특이적으로 결합하는 단백질을 코딩하는 폴리뉴클레오티드를 수득하는 단계; (b) 상기 (a) 단계의 폴리뉴클레오티드를 클로닝하여 발현 벡터를 제조하는 단계; (c) 상기 (b) 단계의 발현 벡터를 숙주 세포에 도입하여 형질전환체를 배양하는 단계; 및 (d) 상기 (c) 단계의 형질전환체로부터 VEGF에 특이적으로 결합하는 항체 및 DLL4에 결합하는 단백질을 수득하여, VEGF에 특이적으로 결합하는 항체의 Fc 영역의 C-말단 및 DLL4에 결합하는 단백질의 N-말단을 링커로 연결하는 단계를 포함하는 방법일 수 있다.
본 발명의 이중표적 단백질은 상기의 공지의 재조합 수단 또는 생화학적 방법에 의해 제조될 수 있으며, 항체는 적절한 숙주세포에 도입되고, 형질전환체의 배양액으로부터 회수할 수 있다.
구체적으로는 이중표적 단백질은 공지의 분리방법에 의해 분리할 수 있으며, 그 예로 단백질 A-세파로오스, 히드록시아파타이트 크로마토그래피, 겔 전기영동, 투석 또는 친화성크로마토그래피와 같은 통상적 면역글로불린 정제 절차에 의해 배양 배지로부터 적절히 분리될 수 있으며, 이에 제한되지는 않는다.
또 다른 양태로서, 본 발명은 상기 이중표적 단백질을 포함하는 조성물을 제공한다.
또 다른 양태로서, 본 발명은 상기 이중표적 단백질을 포함하는 암 치료용 조성물을 제공한다.
상기 이중표적 단백질은 DLL4와 VEGF에 동시에 결합하여 노치 및 VEGF 수용체와의 결합을 저해함으로써 암의 성장 억제에 관여할 수 있다. 상기 DLL4/노치 수용체와 VEGF/VEGF 수용체에 대해서는 상기에서 설명한 바와 같다. 본 발명의 조성물은 DLL4와 VEGF에 특이적으로 결합하는 이중표적 단백질을 포함하는 조성물을 생체 내에 투여하여, 암의 발생, 증식 또는 전이를 억제시키거나 진행을 막아 암을 치료할 수 있다.
본 발명에서 용어, "암"은 암의 종류에 제한없이 포함되나, 그 예로 식도암, 위암, 대장암, 직장암, 구강암, 인두암, 후두암, 폐암, 결장암, 유방암, 자궁경부암, 자궁내막암, 난소암, 전립선암, 고환암, 방광암, 신장암, 간암, 췌장암, 골암, 결합 조직암, 피부암, 뇌암, 갑상선암, 백혈병, 호지킨(Hodgkin) 질환, 림프종 또는 다발성 골수종 혈액암일 수 있다. 본 발명에서 용어, "치료"란 조성물의 투여에 의해 암의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미할 수 있다.
또한, 상기 약학적 조성물은 약학적으로 허용가능한 담체를 더욱 포함할 수 있다.
본 발명에서 용어, "약학적으로 허용가능한 담체"란 생물체를 자극하지 않고 투여 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 말한다. 액상 용액으로 제제화되는 조성물에 있어서 허용되는 약학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.
상기 약학적 조성물은 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용된다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테로 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
상기 약학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제으로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다.
상기 본 발명의 조성물은 약학적으로 유효한 양으로 투여한다.
본 발명에서 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 질병의 종류, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 일 실시예에 따르면 본 발명의 이중표적 단백질이 VEGF 및 DLL4에 모두 결합하며(도 3, 도 4a 및 도 4b), DLL4를 중화시킬 수 있고(도 5), 아바스틴 내성을 가진 인간 위암(SCH) 및 폐암(A549) 세포주 이종이식 모델에서 이중표적 단백질의 항암 효능을 확인하여(도 11 및 도 12), 암 치료용 조성물의 유효성분으로 사용할 수 있음을 확인하였다.
또 하나의 양태로서, 본 발명은 상기 이중표적 단백질을 포함하는 약학적 조성물을 이용하여 암을 치료하는 방법을 제공한다. 상기 방법은 약학적 조성물을 약학적으로 유효한 양으로 투여하는 것을 통하여 이루어지는 것일 수 있다.
상기 이중표적 단백질 및 약학적으로 유효한 양에 대해서는 상기에서 설명한 바와 같다.
상기 이중표적 단백질은 약학적으로 허용 가능한 담체를 추가로 포함하는 약학적 조성물을 암이 발병되거나 발병 의심이 있는 개체에 투여하는 단계를 포함하는 암을 치료하는 방법일 수 있으며, 사용될 수 있는 담체 및 암은 상기에서 설명한 바와 동일하다. 상기 개체는 소, 돼지, 양, 닭, 개, 인간 등을 포함하는 포유 동물, 조류 등을 포함할 수 있으며, 본 발명의 상기 조성물의 투여에 의해 암이 치료되는 개체는 제한없이 포함될 수 있다.
이때, 조성물은 액제, 산제, 에어로졸, 캡슐제, 장용피 정제 또는 캡슐제 또는 좌제의 형태로 투여할 수 있다. 투여 경로는 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 내 투여, 내피 투여, 경구 투여, 국소 투여, 비 내 투여, 폐 내 투여, 직장 내 투여 등을 포함하지만, 이에 제한되지는 않는다. 그러나 경구 투여시, 펩타이드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화될 필요가 있다. 또한, 제약 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
또 하나의 양태로서, 본 발명은 상기 이중표적 단백질을 포함하는, 암 진단용 조성물을 제공한다.
상기 이중표적 단백질 및 암에 대해서는 상기에서 설명한 바와 같다.
본 발명에서 용어, "진단"은 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 발명의 목적상, 진단은 암의 발병 여부를 확인하는 것이다.
본 발명의 암 진단용 조성물은 본 발명의 이중표적 단백질을 이용하여 암이 의심되는 개체의 분리된 시료의 VEGF 또는 DLL4 단백질의 수준을 측정하여, 측정된 VEGF 또는 DLL4 단백질의 수준이 정상 대조군 시료보다 높은 경우 암으로 판단하는데 사용될 수 있다.
이를 위한 단백질의 수준을 측정하는 방법으로는 웨스턴 블럿(Western blot), ELISA(Enzyme Linked Immunosorbent Assay), 방사선면역분석(otA: badioimmunoassay), 방사 면역 확산법(badioimmunodiffusion), 오우크테로니(Ouchterlony)면역 확산법, 로케트(rocket)면역전기영동, 조직면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), FACS 및 단백질 칩(protein Chip) 등이 있으나, 이로 제한되는 것은 아니다. 상기와 같은 분석 방법들을 통하여 정상 대조군과 암 의심 개체에서의 VEGF 또는 DLL4 단백질 수준을 비교할 수 있으며, 이를 통해 실제 암 의심 환자에서의 암 발병 여부에 대해 진단할 수 있게 된다.
본 발명의 암 진단용 조성물은 본 발명의 이중표적 단백질 외에 상기 단백질의 수준을 측정하는 방법을 수행하기 위해 필요한 것으로 당업계에 알려진 것을 제한없이 추가로 포함할 수 있다.
또 하나의 양태로서, 본 발명은 (a) 상기 이중표적 단백질을 이용하여 암이 의심되는 개체의 분리된 시료의 VEGF 또는 DLL4 단백질의 수준을 측정하는 단계; 및 (b) 상기 (a) 단계에서 측정된 VEGF 또는 DLL4 단백질의 수준이 정상 대조군보다 높은 경우 암으로 판단하는 단계를 포함하는, 암의 진단방법을 제공한다.
상기 이중표적 단백질, 암, 개체, 진단 및 단백질의 수준을 측정하는 단계(방법)에 대해서는 상기에서 설명한 바와 같다.
본 발명에서 용어, “시료”란 암 환자에서 VEGF 또는 DLL4의 발현 수준이 차이나는 전혈, 혈청, 혈액, 혈장, 타액, 뇨, 객담, 림프액, 뇌척수액 및 세포간액과 같은 시료 등을 포함하나, 이에 제한되지 않는다.
또 하나의 양태로서, 본 발명은 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는, DLL4의 입체형태적 에피토프를 제공한다.
본 발명의 일 실시예에서는 가교화 반응 및 질량분석을 통해 서열번호 21의 DLL4에서 가교화 반응이 일어나는 아미노산 잔기를 규명하였으며, 상기 잔기를 포함하는 58번 내지 65번 아미노산 서열[FRVCLKHF] 및 110번 내지 115번 아미노산 서열(서열번호 23) 두 단편이 도 7에 나타난 바와 같이, 연속된 분자표면을 구성함으로써 DLL4의 에피토프를 형성함을 확인하였다.
또 하나의 양태로서, 본 발명은 상기 입체형태적 에피토프를 인지하는, DLL4에 특이적으로 결합하는 단일클론항체를 제공한다.
구체적으로, 상기 단일클론항체는 서열번호 2로 표시되는 중쇄 CDR1; 서열번호 3으로 표시되는 중쇄 CDR2; 및 서열번호 4로 표시되는 중쇄 CDR3를 포함하는 중쇄 가변 영역 및 서열번호 5로 표시되는 경쇄 CDR1; 서열번호 6으로 표시되는 경쇄 CDR2; 및 서열번호 7로 표시되는 경쇄 CDR3를 포함하는 경쇄 가변 영역을 포함하는 형태일 수 있다. 더욱 구체적으로, 상기 중쇄는 서열번호 8의 아미노산 서열로 이루어진 것일 수 있으며, 경쇄는 서열번호 9의 아미노산 서열로 이루어진 것일 수 있다.
또 하나의 양태로서, 본 발명은 상기 단일클론항체를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 발현 벡터 및 상기 발현 벡터가 도입된 형질전환체를 제공한다.
본 발명의 DLL4, 단일클론항체, 벡터, 형질전환체 등은 상기 설명한 바와 동일하다.
또 다른 양태로서, 본 발명은 상기 이중표적 단백질을 암이 의심되는 개체에 투여하는 단계를 포함하는, 암의 치료방법을 제공한다.
상기 개체는 암의 예방 또는 치료가 필요한 개체로서, 인간뿐만 아니라 암 및 이와 유사한 증상의 치료를 필요로 하는 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물일 수 있으나, 이에 제한되지는 않는다.
본 발명에서 사용된 용어, "투여"는 어떠한 적절한 방법으로 환자에게 본 발명의 약학적 조성물을 도입하는 것을 의미하며, 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.
본 발명의 암의 치료방법은 이중표적 단백질 또는 이를 포함하는 약학적 조성물을 치료학적으로 유효한 양으로 투여하는 것을 포함한다. 적합한 총 1일 사용량은 올바른 의학적 판단 범위 내에서 처치의에 의해 결정될 수 있다는 것은 당업자에게 자명한 일이다. 또한, 1회 또는 수회로 나누어 투여할 수 있다. 그러나 본 발명의 목적상, 특정 환자에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는 지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용할 수 있다.
이하, 실시예를 통하여 본 발명의 구성 및 효과를 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것일 뿐 본 발명의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1: 항 DLL4/VEGF이중표적 단백질의 제조
실시예 1-1: DLL4 항원의 제조
인간 DLL4의 세포외 도메인 항원은 알앤디 시스템사에서 제공된 인간 DLL4 단백질(Cat: 1506-D4/CF)을 사용하였다. 이 DLL4 항원 단백질은 Accession No. Q9NR61의 DLL4 아미노산 서열의 27번째 내지 524번째 아미노산을 포함한다. 상기 단백질 C-말단에는 히스티딘-태그(10-His tag)이 결찰되어 있다.
또 다른 DLL4 세포외 도메인의 특정 영역에 대한 항원을 제조하였다. 이 특정 영역은 아미노산 27 내지 아미노산 251을 포함한다. 이 영역은 Notch1 수용체와 결합하는 것으로 알려진 "DSL(델타/세레이트(Serrate)/lag-2)" 도메인으로 칭해지는 모티프를 함유한다. Fc 단백질에 융합된 DLL4의 세포외 도메인의 결실단편(아미노산 27 내지 251)을 코딩하는 폴리뉴클레오티드의 상류에 CMV 프로모터를 포함하는 포유류 발현 플라스미드 벡터가 표준 재조합 DNA 기술을 사용하여 제조하였다. Fc 단백질에 융합된 인간 DLL4의 키메라인 DLL4의 결실단편을 코딩하는 추가적인 구축물이 일반적인 재조합 DNA 기술을 사용하여 제조하였다. 상기 제조된 구축물을 HEK 293E 세포에 일시적으로 형질 감염하여, Fc 단백질에 융합된 인간 DLL4 아미노산 27 내지 251을 포함하는 재조합 융합 단백질들을 발현시켰다. 상기 단백질을 수득하기 위해 72시간마다 컨디셔닝 배지를 수집하였고 이를 4번 반복하였다. 이 컨디셔닝 배지로부터 단백질 A 친화성 크로마토그래피를 사용하여 정제하였다.
실시예 1-2: 라이브러리 파아지의 제조
다양성을 가진 인간 유래 scFv(single-chain variable fragment) 라이브러리 세포 2.7 x 1010 개를 2X YT CM[Tryptone(CONDA, 1612.00) 17 g, 이스트 추출물(CONDA, 1702.00) 10 g, NaCl(sigma, S7653-5kg) 5 g, 클로람페니콜(sigma, C0857) 34 ㎍/㎖)], 2% 글루코스(sigma, G5400) 및 5 mM MgCl2(sigma, M2393)를 포함하는 배지(3ℓ)에서 37℃에서 2 내지 3시간 동안 배양한 후(OD600=0.5~0.7), 헬퍼 파아지(helper phage)를 감염시켜 2X YT CMK(2X YT CM, 카나마이신(sigma, K1876) 70 ㎍/㎖, 1 mM IPTG(ELPISBIO, IPTG025)) 배지에 30℃에서 16시간 동안 배양하였다. 배양한 세포를 원심분리(4500 rpm, 15분, 4℃)한 후, 상등액에 4% PEG(Fluka, 81253) 6000과 3% NaCl(sigma, S7653)을 첨가하여 잘 녹인 후 얼음에서 1시간 동안 반응시켰다. 다시 원심분리(8000rpm, 20분, 4℃)한 후, 펠렛에 PBS를 첨가하여 녹인 다음 원심분리(12000rpm, 10분, 4℃)하여 라이브러리 파아지를 포함하는 상등액을 새 튜브에 넣어 4℃에서 보관하였다.
실시예 1-3: 파아지 디스플레이(phage display)를 통한 패닝(panning)
인간 DLL4 결합하는 항 DLL4 항체를 선별하기 위해, 인간 DLL4 항원에 대한 패닝을 3회(round) 진행하였다.
면역시험관(immunotube)에 10㎍/mL 농도의 재조합 인간 DLL4(R&D system 사) 용액을 첨가하여 4℃에서 밤새 시험관 표면에 단백질을 흡착시킨 후 우혈청 알부민 1% 용액을 시험관에 첨가하여 DLL4가 흡착되지 않은 표면을 보호하였다. 시험관을 비운 후 1% 우혈청 알부민용액에 분산된 1012 CFU의 항체파지 라이브러리를 넣어 항원과 결합시켰다. 비특이적으로 결합한 파지를 PBS-T(Phosphate buffered saline - 0.05% Tween 20) 용액으로 5회 씻어낸 후 남아있는 항원 특이적 파지항체를 100 mM 트리에틸아민 용액을 이용하여 회수하였다.
상기 회수된 파지를 1M 트리스 버퍼(pH 7.4)로 중화시킨 후 ER2537 대장균에 37 ℃에서 1시간 감염시키고 감염된 대장균을 카베니실린을 함유하는 LB(Luria-Bertani) 한천 배지에 도말하여 37 ℃에서 밤새 배양하였다. 다음날 배양된 대장균을 4 mL의 SB(superbroth)-카베니실린 배양액에 현탁하고 15% 글리세롤을 첨가하여 일부는 -80℃에 보관하고 나머지 중 50㎕를 20 mL의 SB-카베니실린 배양액에 2% 포도당용액(glucose)를 첨가하여 37 ℃에서 배양하였다.
배양액의 흡광도가 600nm에서(OD600) 0.6이 되면 원심분리하여 배양액을 제거하고, 이를 다시 20mL의 SB-카베니실린 배양액에 현탁한 후 1012 PFU의 VCSM13 헬퍼파지를 넣고 천천히 교반하며 37℃에서 배양하였다. 다음날 배양액을 원심분리한 후 배양액만 취하여 폴리에틸렌글라이콜 8000(PEG8000)을 4%, 염화나트륨(NaCl) 3% 첨가하여 4℃에서 30분간 침전시킨 후 원심분리하였다. 상층액을 제거하고 침전된 파지를 PBS 1mL에 현탁시켜 이를 라이브러리로 사용하여 위의 패닝과정을 반복함으로써 항원특이적 클론을 증폭/농축시켰다.
인간 DLL4 단백질 내 Notch1과 결합하는 부위에 결합하는 항체를 선별하기 위해 패닝시, 인간 DLL4 단백질과 인간 DLL4 특정영역을 지칭하는 결실단편(아미노산 27 내지 251)을 교차하여 패닝을 진행하였고, 3회(round) 진행하였다. 그 후 항체유전자를 포함하는 LB-카베니실린 한천 배지에 도말, 배양하여 단일 콜로니들을 얻고 이를 400㎕ SB-카베니실린 배양액에 접종, 배양한 후 IPTG로 유도하여 scFv형태의 단백질을 대장균의 페리플라즘(periplasm)에서 발현하였다. 대장균을 TES용액(Tris, EDTA, sucrose)에 현탁한 후 4 ℃에서 1시간 방치 후 원심분리하여 페리플라즘을 추출하고, 이를 ELISA 기법을 사용하여 재조합 인간 DLL4 항원과 scFv와의 결합을 확인하는 데 사용하였다.
결합한 scFv는 HRP(Horseradish peroxidase)-항-HA 항체와 테트라메틸벤지딘(TMB) 기질을 이용하여 검출하였다. 이로부터 확인된 항원 특이적 항체 클론은 염기서열 분석법을 통해 분석하였다. 상기 선별된 scFv의 서열을 분석한 결과는 하기 표 1과 같다.
표 1
Figure PCTKR2014006090-appb-T000001
상기 서열을 가지는 항-DLL4 항체를“MLCK-2”로 명명하였다.
실시예 1-4: DLL4와 VEGF를 타겟으로 하는 이중표적 단백질(이중 항체)의 제조
상기 실시예 1-3에서 만들어진 인간 DLL4와 결합하는 scFv 형태의 항체를 링커를 이용하여 아바스틴 IgG 형태와 연결하여 인간 VEGF와도 결합할 수 있는 이중표적 단백질 발현 벡터를 제조하였다(도 1b).
상기 제조된 이중표적 단백질은 서열번호 1의 중쇄 아미노산 서열(VEGF-DLL4 BsAb heavy chain) 및 서열번호 20의 경쇄 아미노산 서열을 가진다. 상기 중쇄는 서열번호 2로 표시한 중쇄 CDR1; 서열번호 3으로 표시한 중쇄 CDR2; 및 서열번호 4로 표시한 중쇄 CDR3를 포함하는 중쇄 가변 영역을 포함하고, 경쇄는 서열번호 5로 표시한 경쇄 CDR1; 서열번호 6으로 표시한 경쇄 CDR2; 및 서열번호 7로 표시한 경쇄 CDR3를 포함하는 경쇄 가변 영역을 포함하였다.
이중표적 단백질 발현 벡터를 CHO 세포에 항체 생산을 위해서, 세포 내 유전자 전달 효율을 높이는 폴리머를 이용하여 해당 유전자를 형질 주입한 부유 동물 세포를 500 ㎖ 배양용 삼각 플라스크(코닝 코스타)에서 병 1개당 200 ㎖로 배양하여 총 1ℓ를 배양하였다. IgG 함량이 매우 낮은(ultra low IgG) 소 태아 혈청(Fetal Bovine Serum, 인비트로젠 코포레이션)을 포함하는 RPMI 배지(인비트로젠 코포레이션)와 CHO 세포 전용 배지의 혼합액 1ℓ를 4일간 세포배양기(산요)에서 배양하여 재조합 단백질을 생산하였다. 세포 배양액을 수득하여 원심분리를 수행하여 부유 세포와 분비된 재조합 단백질을 포함하는 상등액을 분리하고 0.22 ㎛ 진공 필터 장치(Millipore)로 1회 여과하였다.
항체 정제를 위해서, 1차적으로 재조합 프로틴-A 세파로즈 컬럼(Hitrap MabSelect Sure, 5 mL, GE healthcare)을 사용하여, 아바스틴-DLL4 BsAb 이중표적 항체를 배양액으로부터 정제하였다. 구체적으로, 상기 여과된 배양 배지를 재조합 프로틴-A 세파로즈 컬럼에 로딩하였다. 컬럼을 50 mM Tris-Cl(pH7.5), 100 mM NaCl로 20배 컬럼 부피만큼 세척하고, 10배 컬럼 부피의 50 mM Na-citrate 완충 용액(pH5.0)로 불순물을 세척하였다. 5 mM Na-citrate 10 mM NaCl 완충 용액 (pH3.4)로 항체를 용출시켜 1M Tris-HCl완충 용액(pH 8.0)으로 중화시켰다.
2차 정제는 HiLoad TM 26/60 Superdex 200 Prep grade GL(GE healthcare)를 사용하여 아바스틴-DLL4 BsAb 이중표적 항체의 침전물(Aggregation)을 제거하는 정제과정을 수행하였다. 컬럼을 50mM Na-Phosphate 완충 용액(pH6.0), 20mM L-Arg 로 2배 컬럼부피만큼 평형화시킨 뒤 1차 정제 완료된 아바스틴-DLL4 BsAb 이중표적 항체를 흘려 크기에 따른 분리 정제를 수행하였다.
상기 컬럼을 이용하여 분리 정제한 분획물들을 SDS-PAGE로 분석(도 2)하여, 양성 분획물을 모아서 원심분리형 농축기(아미콘 울트라, Amicon Ultra, 30,000 MWCO, Millipore)로 농축시켰다. 동일 원심분리형 농축기를 사용하여 인산화 제형 완충 용액으로 완충제 교환 및 농축을 실시하였다. 마지막으로, 항체를 0.22 ㎛ 공극 직경의 시린지 필터로 멸균 여과하고, 흡광도(A280)를 측정하여 항체 농도를 결정하였다.
실시예 2: ELISA를 통한 이중표적 단백질의 DLL4와 VEGF에 대한 결합력 분석
항 DLL4, 항 VEGF 이중표적 단백질에 대해 ELISA 기반 용액 발색 시험을 사용하여 이중표적 단백질의 결합력를 평가하였다. 96-웰 플레이트(Nunc-Immuno Plates, NUNC, Rochester, NY)를 4℃에서 밤새 50ng/㎖ 농도의 hVEGF(R&D systems, cat: 293-VE) 및 200ng/㎖ 농도의 rhDLL4(R&D systems, cat: 1506-D4/CF)로 웰당 100 ㎕씩 코팅한 후, 비특이적 결합부위를 BSA로 2시간 동안 차단시겼다. 96-웰 미세역가 플레이트 상에서 항체를 128 nM 및 64 nM에서 1/5씩 희석을 진행하여 hDLL4 및 hVEGF 단백질로 코팅된 플레이트에 100 ㎕씩 접종한 다음, 2시간 항온처리하고 0.05% 트윈 20(tween 20)을 포함하는 PBS로 5번 세척하였다. 플레이트에 결합된 항체를 검출하기 위해 HRP가 접합된 항 Fab 항체(Pierce, cat: 31414)를 1: 40000으로 희석하여 세척된 96웰 플레이트에 처리한 다음, 1시간 동안 37 ℃에서 반응시킨 후, 비색용 기질(3,3',5,5'-Tetramethylbenzidine; Sigma-Aldrich)을 사용하여 발색시키고, 효소반응을 0.5mol/ℓ 황산으로 중지시켰다. 흡광도는 SpectraMax 190(molecular Devices)기기를 이용하여 450 nm의 파장에서 측정하였다.
도 3에서 확인할 수 있듯이, 본 발명의 이중표적 단백질이 표적인 VEGF 및 DLL4에 특이적으로 결합하는 것을 확인하였다.
실시예 3: DLL4/VEGF 이중표적 단백질의 DLL4 와 VEGF 에 대한 평형 해리 상수 (KD) 분석 어세이
상기 실시예 1에서 분리 정제된 이중표적 단백질(이중 항체)을 아바스틴-DLL4 BsAb로 명명하고, 분리 정제된 항체의 항원에 대한 친화도를 다음과 같이 분석하였다. 아바스틴-DLL4 BsAb 이중표적 항체의 DLL4와 VEGF 에 대한 결합능 차이를 알아보기 위하여 BIACORE 어세이를 실시하였다.
SPR 분석은 T200을 사용하였고, running buffer는 HBS-EP (10 mM HEPES, pH7.4, 150 mM NaCl, 3 mM EDTA, 0.15% surfactant P20)를 사용하였다. 표면 준비는 wizard program의 surface preparation_target immobilization (condition: 25 ℃, 5 ㎕/min)을 이용하여 리간드인 hVEGF와 hDLL4를 10 mM 소듐아세테이트(sodium acetate) 완충 용액 (pH 4.5) 에 각각 5 ㎍/㎖, 4 ㎍/㎖이 되도록 희석하여 CM5 칩 표면에 각 실험이 목표로 하는 타겟 고정화 레벨만큼 고정시켰다. 고정화는 2개의 유로 (Fc, flow cell)가 하나의 셋트로 진행되며 본 실험에서 첫번째, 세번째 유로는 blank, 두번째 유로는 hVEGF로 고정화하였고 네번째 유로는 hDLL4로 지정하였다. 첫번째, 세번째 유로는 비특이적인 결합 및 버퍼에 의한 변화 수치를 보이는 reference로 실험 결과는 Fc2-Fc1, Fc4-Fc3 의 수치를 사용하였다. hVEGF, hDLL4와 결합하는 물질로 아바스틴-DLL4 BsAb이중표적 항체를 몰농도로 환산하여 running buffer로 100 nM로 희석한 뒤, 1/2 연속 희석하여 5 농도 구간에서 분석하였다. 분석 시료는 최소 희석 배수 100 이상이 되도록 고순도/고농도로 준비하여 완충액 변화에 의한 영향(Buffer effect)을 최소화하였다. 모든 분석은 Wizard 프로그램을 이용하여 한 시료에 대하여 2 배수로 진행되었으며 모든 분석 간에는 재활성화 단계(regeneration step)를 두어 실험의 기준선이 일정하게 유지될 수 있도록 하였다.
결과는 Biaevaluation software 4.0 version으로 분석하였다. Fc2-Fc1, Fc4-Fc3 결과에서 baseline을 0으로 설정 후 완충액 주입(analyte 0 nM) 부분을 전체 sensorgram에서 뺀 후에 결과를 Bivalent binding model을 사용하여 결합친화도 분석을 하였다. 분석 항목은 Ka(M-1s-1), Kd(s-1), KD(M)이다. Ka는 친화도(recognition)를 나타내는 결합 상수(association constant)이고, Kd는 안전성 (stability)을 나타내는 해리 상수(dissociation constant)이다.
하기 표 2에 이중표적 단백질의 hVEGF에 대한 결합능 분석 결과를 나타내었으며, 하기 표 3에 이중표적 단백질의 hDLL4에 대한 결합능 분석 결과를 나타내었다.
표 2
Figure PCTKR2014006090-appb-T000002
표 3
Figure PCTKR2014006090-appb-T000003
상기 표 2 및 표 3에서 확인할 수 있듯이, 평형해리상수인 KD(M)는 kd/ka로 환산하였다. hVEGF에 대한 결합능 분석결과, KD값이 0.126nM 수준으로 아바스틴 IgG의 평형해리상수와 유사한 값을 얻었고(도 4a 및 표 2) hDLL4에 대한 결합능 분석 결과, KD값이 30nM 수준의 값을 얻었다(도 4b 및 표 3). 이는 본 발명의 이중표적 단백질이 각각의 항원에 대한 결합능이 방해받지 않고 높은 수준을 유지한다는 것을 시사한다.
실시예 4: DLL4/VEGF 이중표적 단백질의 중화효과 어세이
상기 아바스틴-DLL4 BsAb이중표적 항체에 대해 ELISA-기반 용액 경쟁실험을 통하여 중화효과를 평가하였다. 96-웰 미세역가 플레이트(Nunc-Immuno Plates, NUNC, Rochester, NY)에 PBS로 희석된 500ng/㎖ 농도의 hNotch-1-hFc 단백질(R&D systems)을 웰당 100㎕씩 첨가한 후 4 ℃에서 밤새 코팅한 다음, BSA로 2시간 동안 처리하여 비특이적 결합부위를 차단시켰다.
96-웰 미세역가 플레이트 상에서 아바스틴-DLL4 BsAb이중표적 항체(정제된 단백질)를 0 nM 내지 140 nM 범위의 농도에서 항체를 항원 단백질(인간 DLL4-His, 600 ng/mL)의 계열 희석액과 예비 혼합시켰다. 상기 항원과 항체를 30분간 항온처리한 후에 유리 항체의 측정을 위해서 상기 혼합 용액을 DLL4 수용체인 hNotch-1-hFc 단백질로 미리 코팅(50 ng/well)된 미세역가 플레이트에 옮겼다. 그 다음, 상기 플레이트를 2시간 항온처리하고 0.05% 트윈 20(tween 20)을 포함하는 PBS로 5번 세척하고, 플레이트에 결합된 DLL4 항원을 HRP-접합된 His 항-마우스 IgG 다클론 항체 시약(Roche applied science)으로 검출하기 위해 1:800 비율로 상기 HRP-접합된 His 항-마우스 IgG 다클론 항체를 세척된 미세역가 플레이트에 처리한 다음, 1시간 동안 37℃에서 반응시켰다. 그 다음, 비색용 기질 (3,3',5,5'-Tetramethylbenzidine; Sigma-Aldrich co.)을 사용하여 발색시키고, 효소반응을 0.5mol/l 황산으로 중지시켰다. 450 nm에서 흡광도를 기록하여 그 결과를 도 5에 나타내었으며, 플레이트-코팅된 hNotch-1-hFc 단백질에 결합된 인간 DLL4-His의 50% 감소를 달성하는데 필요한 항체의 양(IC50)을 하기 표 4에 나타내었다.
표 4
Figure PCTKR2014006090-appb-T000004
상기 표 4과 같이, 본 발명의 이중표적 단백질은 DLL4에 대하여 1.12nM의 낮은 IC50값을 가져, 단독 항-DLL4 항체에 못지 않은 DLL4 저해 활성을 가지는 것을 확인하였다.
실시예 5: 가교화 반응과 질량분석 통한 에피토프 지도 작성
복수의 불연속적인 서열로 구성된, 그러나 입체구조적으로 단일한 분자표면을 형성하는 구조적 에피토프를 규명하기 위하여 가교화 반응과 질량분석을 통한 가교화 반응의 위치 확인하는 기법을 사용하였다.
실시예 5-1: 가교화 복합체의 형성
항원 단백질 인간 델타 유사 리간드 4(human DLL4, hDLL4, R&D Systems) 와 실시예 1-3의 MLCK2 항체를 몰비가 2:1 되도록 혼합한 다음 K200 크로스링커(CovalX AG.)를 최종농도 0.2 mg/ml이 되도록 넣어주었다. 이 혼합물을 실온에서 3시간 동안 반응시켜 항원-항체 복합체를 만든 후 Ultraflex II MALDI ToF(Bruker Daltonics) 장비를 이용하여 반응 생성물의 분자량을 분석하였다. 도 6에 나타난 바와 같이 크로스링커를 사용하지 않은 대조 실험에 비해 크로스링커를 사용한 경우 인간 DLL4와 MLCK2 항체간의 1:1 및 2:1 복합체가 형성되었음을 알 수 있었다. 반면, 인간 DLL4 혹은 MLCK2 항체 단독으로 크로스링커와 반응시켰을 경우에는 어떠한 다량체나 복합체도 검출되지 않았으며, 이로부터 상기 인간 DLL4 및 MLCK2 항체 복합체 형성이 상호 특이적인 반응임을 알 수 있었다.
실시예 5-2: 가수분해효소에 의한 단편의 형성
가교화된 펩타이드 절편을 구분해 내기 위해서 중수소로 표지되어 있지 않은 d0-DSS(disuccinimidyl suberate)와 12개의 중수소로 표지된 d12-DSS를 1:1로 섞고 DMF로 녹여 2 mg/ml 용액을 만들었다. 이 용액을 인간 DLL4: MLCK2 = 2:1 혼합용액에 최종농도 0.2 mg/ml이 되게 넣고 상온에서 3시간 동안 가교화 반응을 시켰다. 반응물은 효과적인 분해반응을 위해 DTT(dithiothreitol)와 요오드아세트아미드(iodoacetamide)를 이용하여 환원 및 알킬화를 시켜 변성시켰고 트립신, 알파-카이모트립신, ASP-N 프로테아제 등의 단백질 가수분해 효소를 각각 사용하여 단편화를 시켰다. 생성된 단편화 반응물은 Ultimate 3000 nano-liquid 크로마토그래피 시스템(Dionex) 과 LTQ Orbitrap XL 질량분석기(Thermo)를 통해 질량분석을 하였고 얻어진 질량분석 데이터는 Xquest(버전 2.0) 소프트웨어, Stavrox (버전 2.1) 소프트웨어를 통해 가교화된 펩타이드 쌍을 분별해냈다. 그 결과 표 5에 나타난 바와 같이 hDLL4과 MLCK2 사이의 가교화된 펩타이드 쌍을 검출할 수 있었다.
인간 DLL4상의 가교화 반응이 일어난 지점은 59, 63, 64 및 110 번 아미노산 잔기였으며 이들 잔기를 포함하는 [58-65, FRVCLKHF](서열번호 22) 및 [110-115,TWPGTF](서열번호 23) 두 단편은 인간 DLL4 C2 도메인(27-174) 모델상에서 도 7에서 보이는 바와 같이 연속된 분자표면을 구성하고 있어 이 두 서열을 MLCK2 항체에 대한 인간 DLL4의 에피토프로 추정할 수 있었다.
표 5
Figure PCTKR2014006090-appb-T000005
실시예 6: 웨스턴블랏팅을 통한 에피토프 지도 확인
인간 DLL4의 알라닌 치환 돌연변이체 패널을 다음과 같이 제조하였는데 이러한 패널에서 인간 DLL4 세포외 단백질 영역의 64번(Histidine, 히스티딘), 65번(phenylalanine, 페닐알라닌) 및 69번(Valine, 발린) 아미노산을 각각의 아미노산을 알라닌(Alanine)으로 치환하였다. 알라닌 치환 돌연변이체를 위한 발현 벡터는 상기 실시예 1-1에 나타낸 바와 같이 DLL4 세포외 도메인의 특정 영역에 대한 항원 제조에 사용한 벡터를 이용하였다. 구체적으로 상기 벡터는 인간 DLL4 특정영역의 아미노산 27 내지 아미노산 251의 유전자를 포함하는 벡터이며, 이 영역은 Notch1 수용체와 결합하는 것으로 알려진 "DSL(델타/세레이트(Serrate)/lag-2)" 도메인으로 칭해지는 모티프를 함유한다.
표준 재조합 DNA 기술을 사용하여, Fc 단백질에 융합된 DLL4의 세포외 도메인의 결실단편(아미노산 27 내지 251)을 코딩하는 폴리뉴클레오티드의 상류에 CMV 프로모터를 포함하는 포유류 발현 플라스미드 벡터를 제조하였다. 이 벡터에서 아미노산 64번, 65번 및 69번을 각각 알라닌(Alanine)으로 치환할 수 있도록 재조합 DNA 기술(QuikChange Site-Directed Mutagenesis, Agilent) 을 활용하였으며, 돌연변이체를 HEK293E 동물세포에 리포펙타민 2000(인비트로젠, Invitrogen)을 사용하여 트렌스펙션을 시키고 4 일간 배양한 후 발현배지를 수득하였다. 이때 대조군으로 야생형 (Wild type) DLL4의 세포외 도메인의 결실단편 (아미노산 27 내지 251)을 코딩하는 단백질을 사용하였다.
4 일간 배양한 돌연변이체 발현 배지를 1000 rpm, 상온에서 10분간 원심 분리하여 부유물을 제거한 후 0.45μm 시린지여과(syringe filtration)하였다. 웨스턴 블랏팅 실험을 위해 돌연변이체 발현 배지에서의 발현 정도를 Octet® system(ForteBio)을 사용하여 정량하였고, 이를 이용하여 SDS-Gel 로딩시 일정한 단백질 양이 되도록 하였다. 이후 Novex 4~12% Bis/Tris 젤에 동일하게 돌연변이체 발현 배지 20 μl씩 2개의 젤에 로딩하고 MOPS 완충액을 사용, 140V로 50분간 젤 전기영동을 수행하였다. 이때 대조군으로 야생형의 DLL4의 세포외 도메인의 결실단편(아미노산 27 내지 251)을 코딩하는 단백질을 사용하였다. 전기영동이 끝난 후 폴리비닐리덴디플루오라이드 막으로 단백질 밴드를 트랜스퍼(transfer) 하였다. 총 2개의 방법으로 진행하는데, 하나는 DLL4의 세포외 도메인의 결실단편 (아미노산 27 내지 251)의 SDS-Gel 로딩시 일정한 양의 돌연변이 및 야생형 단백질들을 로딩했는지 확인하기 위하여 HRP-컨쥬게이션 된 항 인간 Fc 항체(1:10000)(Pierce Cat: 31413)를 활용하여 트랜스퍼된 막에 결합을 시킨 후 PBS-T로 3번 세척을 진행하였고, 또 다른 하나는 돌연변이체에 대한 MLCK2 항체의 결합력을 알아보기 위해 MLCK2 항체(1μg/mL)를 트랜스퍼된 막에 결합을 1차 시키고, PBS-T로 3번 세척한 후 다시 HRP-컨쥬게이션 된 항 인간 Fab 항체(1:10000)을 이용하여 2차 결합을 시키고 PBS-T로 3번 세척하였다. 그 후 막에 Amersham ECL 웨스턴블랏팅 검출 시약(GE Healthcare)을 도포하고, ImageQuant LAS 4000(GE Healthcare) 장비를 사용하여 신호를 검출하였다.
도 8에 나타난 바와 같이 웨스턴블랏팅 분석 결과를 토대로 보면, 야생형 및 DLL4의 세포외 도메인의 결실단편(아미노산 27 내지 251)을 코딩하는 돌연변이 단백질들을 일정한 양으로 로딩하였음을 확인하였다. 또한, MLCK2 항체의 돌연변이체에 대한 결합력을 확인하였을 때, 64번 아미노산 돌연변이체의 경우 MLCK2 항체의 결합력이 상실되었으며, 65번 아미노산 돌연변이체도 MLCK2 항체의 결합력이 현저하게 낮아진 것을 알 수 있었다. 또한, 69번 아미노산 돌연변이체의 경우에는 MLCK2항체의 결합력에 영향을 주지 않음을 확인하였다.
실시예 7: DLL4/VEGF 이중 항체의 혈관내피세포(HUVEC) 증식에 대한 영향 분석
DLL4와 VEGF에 결합하는 이중 항체의 혈관내피세포(HUVEC) 증식에 대한 영향을 분석하기 위하여 혈관 내피세포(HUVEC, Human umbilical vein endothelial cell)을 Lonza사에서 구매하여 실험에 사용하였다.
HUVEC의 배양은 1% 젤라틴(Sigma)이 용해된 PBS 완충 용액(Gibco)으로 T-플라스크(Nunc)를 상온에서 4~6 시간 코팅시킨 후 PBS로 세척하여 사용하였다. 사용된 배지는 EGM-2 Single Quot(Lonza)가 포함된 EBM-2(Lonza)로 세포의 배양은 밀집도가 80%가 넘지 않는 한도에서 37 ℃, 5% CO2 인큐베이터에서 계대배양을 진행하였고, 패시지(passage) 6 이내의 세포들을 이용하여 실험하였다.
혈관 내피 세포 증식 어세이(HUVEC proliferation assay)는 다음과 같은 방법으로 진행하였다. hDLL4가 코팅된 플레이트를 준비하기 위하여, 실험 전날 96웰 플레이트(BD)에 rhDLL4(R&D systems)를 1 mg/mL로 Carbonate 완충 용액을 사용하여 희석시킨 후 100 mL/웰로 접종하여 4 ℃에서 밤샘 정치시켜 놓았다. 또한, HUVEC은 0.1% FBS가 첨가된 EBM-2 최소배지에서 24 시간 동안 방치하여 혈청에 의한 효과를 최소화하고자 하였다. 실험당일 rhDLL4가 코팅된 플레이트는 각각의 웰을 PBS로 2회 세척 후, 각각의 실험군 별로 hVEGF(50 ng/mL), 항체(아바스틴: 20 mg/mL, DLL4 단독 항체: 20 mg/mL, 아바스틴-DLL4 BsAb 이중 항체: 26 mg/mL)를 앞서 사용한 EBM-2 최소 배지로 희석하여 처리(triplicate)하고 상온에서 20분간 정치시켰다. 전날부터 24 시간 동안 굶주림된 HUVEC은 단일 세포화시킨 후, EBM-2 최소배지를 사용하여 4 x103 cells/웰이 되도록 희석하여 항체가 처리된 웰에 접종하여 37 ℃, 5% CO2 인큐베이터에서 96시간 동안 정치하였다. 세포증식이 종료되었을 때 cell counting kit-8(CCK-8, Dojino)를 각 웰에 10 mL씩 처리하고 37 ℃, 5% CO2 인큐베이터에서 5시간 동안 정치하였다. SpectraMax 190(molecular Devices)기기를 이용하여 450 nm의 파장에서 흡광도를 측정하여 세포의 증식 정도를 각 군별로 비교하였다(도 9).
도 9의 모든 도면 (PBS 처리군)에서 보여주듯이, DLL4/Notch 신호 전달이 활성화 되면 혈관 내피 세포의 증식이 약 30% 정도 억제가 되며 이는 VEGF 에 의해 혈관 내피 세포 증식이 활성화되는 작용과 반대되는 현상이라 할 수 있다. In vivo 기전 역시, 앞서 설명하였듯이 VEGF 항체는 종양의 혈관 형성이 억제되어 종양 성장과 전이를 막는 반면에 DLL4 항체는 종양의 비정상적 혈관(비활성형 혈관) 생성을 과도하게 유도함으로써 종양의 성장을 억제하는 것으로 밝혀져 있으며 도 9의 결과는 VEGF 와 DLL4 의 서로 다른 신생 혈관 형성 작용 기전을 in vitro 에서 반영하고 있다고 할 수 있다.
도 9a에서 확인할 수 있듯이, 혈관 내피 세포의 증식에 중요한 역할을 하는 VEGF 와 그 수용체, VEGFR의 신호 전달 경로를 VEGF-targeting 항체(아바스틴, Avastin)를 처리할 경우 DLL4 의 존재 유무에 관계 없이 농도 의존적으로 혈관 내피 세포의 증식이 억제되는 것을 확인하였다. 반면, 도 9b 의 경우, DLL4 단독 항체를 처리한 실험 결과로 DLL4 가 존재하지 않는 실험군에서는 항체 처리 농도에 관계없이 혈관 내피 세포의 증식에 별다른 영향을 주지 않았으며, DLL4가 있는 실험군에서는 DLL4 항체 처리 농도에 의존적으로 혈관 내피 세포의 증식이 다시 재개되는 현상을 밝혀내었다. 이중표적 단백질을 처리한 경우는 DLL4가 존재하지 않는 실험군에서는 아바스틴 항체 처리와 유사한 증식 억제 효능을 보여주었으나(도 9c, 흑색 막대), DLL4 가 존재하는 실험군에서는 아바스틴 대비 혈관 증식 억제 효능이 줄어들어 있음을 확인 할 수 있었다 (도 9a, 9c, 백색 막대).
DLL4 처리군에서 VEGF 단독 항체 처리만큼의 증식 억제 효과를 보여주지 않았다는 것은 본 발명의 이중 항체가 VEGF 및 DLL4 의 신호 전달 체계를 모두 효과적으로 억제하고 있다는 실험 결과로 해석할 수 있다.
실시예 8: DLL4/VEGF 이중 항체의 DLL4/Notch 및 VEGF/VEGFR 신호 전달 경로 억제활성 분석
DLL4와 VEGF에 결합하는 이중 항체의 DLL4/Notch 및 VEGF/VEGFR 신호 전달 경로 억제 활성을 알아보기 위하여 실시예 4에 사용된 동일한 방법으로 HUVEC을 이용하였다. 실험 전날 6 웰 플레이트(BD)에 재조합 인간 DLL4(rhDLL4, recombinant human DLL4, R&D systems)를 1 mg/mL로 Carbonate 완충 용액을 사용희석시킨 후 1 mL/웰로 첨가한 다음 4 ℃에서 밤샘 정치시켰다. rhDLL4를 처리하지 않는 대조 실험군에는 Carbonate 완충 용액 단독으로 1 mL/웰로 처리하여 동일하게 4 ℃에서 밤새 정치시켰다. 다음날, 4 ℃ 냉장고에서 DLL4가 코팅된 플레이트를 꺼내어 PBS로 1회 세척한 후, EGM-2 배지를 각 웰에 1 mL씩 처리하고, 각 웰 별로 항체 (아바스틴: 20 mg/mL, DBZ: 0.08mM, DLL4 단독 항체: 20 mg/mL, Oncomed 사 DLL4 단독 항체: 20 mg/mL, 아바스틴-DLL4 BsAb 이중 항체: 26 mg/mL)를 처리하였다. 최종 배양액의 양은 2 mL이므로 항체 처리를 2배로 하여 상온에서 20분간 정치하였다. 항체 처리시간 동안 패시지 #2 내지 #5(passage #2 ~#5)의 75T 플레이트에서 배양된 HUVEC을 꺼내어 배지제거 후 단일세포화 시켰다. 원심분리 과정을 통하여 세포를 세척하고 신선한 EGM-2 배지를 사용하여 재부유시키고, 세포의 개수를 세어 5x 105 cells/mL로 희석한 다음 각각에 웰에 1 mL씩 접종하고 37 ℃, 5% CO2 인큐베이터에서 하룻동안 배양하였다. 0.2% FBS가 포함된 EBM-2 최소배지를 준비하고, 하루동안 배양된 HUVEC의 각 웰에서 배지를 제거하고, PBS 1회 세척 후 0.2% FBS 가 포함된 EBM-2 최소배지를 2 mL 처리하였다. 또한, 각각의 웰에 전날 처리한 동일한 농도의 항체(아바스틴: 20 mg/mL, DBZ: 0.08mM, DLL4 단독 항체: 20 mg/mL, Oncomed 사 DLL4 단독 항체: 20 mg/mL, 아바스틴-DLL4 BsAb 이중 항체: 26 mg/mL)를 처리하고 37 ℃, 5% CO2 인큐베이터에서 하루동안 배양하였다. 항체가 처리된 HUVEC들의 각 웰에 hVEGF(R&D systems)를 100 ng/mL로 처리하고, 37 ℃, 5% CO2 인큐베이터에서 5분간 반응 시킨 다음 플레이트를 꺼내어 재빨리 배지를 버리고, PBS 1회 세척한 후, 세포용해완충 용액 (1% NP-40, 20mM Tris, 137mM NaCl, 10% Glycerol, 2mM EDTA, 1mM Sodium orthovanabate, 1x Protease & phosphatase inhibitor coctail)을 준비하여 각각의 웰에 150 mL를 첨가한 다음 고루 퍼지도록 흔들어 주었다.
이 플레이트를 얼음 위에 얹고 스크립퍼로 각각의 웰의 HUVEC들을 긁어 모은 후 1.5 mL 튜브에 모은 다음, 얼음에 정치시켜 놓았다. 5분 단위로 얼음에서 1.5 mL 튜브를 꺼내어 볼텍싱(Vortexing) 3회 후 다시 얼음에 담궈 놓아 세포용해를 진행한 다음, 이것을 원심분리(4 ℃, 14000rpm, 10분)하고 상등액을 새로운 튜브로 옮긴 후 정량을 진행하고, 5x SDS sample buffer에 섞고 100 ℃에서 10분간 끓인 후 SDS-PAGE 분석을 진행하였다. 준비된 단백질 시료를 4% to 12% bis-TRIS 젤을 통하여 SDS-PAGE를 진행하고 크기별로 분리시킨 후, NICD(Cell signaling), P-ERK(Cell signaling), ERK(Cell signaling), VEGFR2(Cell signaling), P-VEGFR2(Cell signaling), Actin(Santa Cruz) 항체를 이용하여 웨스턴 블랏을 진행하였다(도 10).
도 10과 같이, 본 발명의 이중표적 단백질은 DLL4/Notch 및 VEGF/VEGFR 신호 전달 경로를 각각의 단독 항체만큼이나 억제할 수 있음을 확인하였다.
실시예 9: 아바스틴 저항성을 가지는 인간 위암 세포주 이종이식 모델(Avastin-resistant human SCH gastric cancer xenograft model)에서의 이중 항체 항암 활성 분석
보고된 문헌에 의하면 SCH 인간 위암 세포주(human gastric cancer)는 아바스틴에 대해 내성을 가지고 있는 것으로 개시되어 있어, SCH 세포주를 이용한 누드 마우스 이종이식 모델(nude mouse xenograft model)에서 이중 항체의 항암 효능 시험을 수행하였다.
구체적으로는, 아바스틴 내성 SCH 위암 세포주를 암컷 누드 마우스(female nude mouse)에 접종한 후 종양 크기(tumor size)가 평균 200 mm3에 도달하였을 때 일주일에 1회 각 항체들을 투여하여 본 발명에 따른 이중 타겟 항체의 in vivo 항암 활성을 확인하였다(도 11). 본 누드 마우스 이종이식 모델(Nude mouse xenograft model)의 in vivo 시험에서는 인간 DLL4를 표적하는 아바스틴-DLL4 이중 항체 대신에 인간 DLL4 에피토프(DSL 도메인)와 동일한 마우스 DLL4 에피토프(DSL 도메인)에 결합하는 이중 항체인 아바스틴-마우스 DLL4 surrogate 이중표적 단백질을 투여하여 이중 항체의 우수한 항암 효능 검증을 입증하였다.
도 11과 같이, 아바스틴에 대하여 내성을 가지는 위암 세포주에 대하여, 본 발명의 이중표적 단백질이 항암 효과를 현저히 증가시키는 것을 in vivo 실험으로 확인하였다.
실시예 10: 아바스틴 저항성을 가지는 인간 폐암 세포주 이종이식 모델 (Avastin-resistant human A549 lung cancer xenograft model)에서의 이중 항체 항암 활성 분석
A549 세포주를 누드 마우스에 접종한 후, 아바스틴(2.5 mg/kg/week)을 3개월간 처리하여 아바스틴 처리 후에도 종양의 크기가 줄어들지 않고, 종양이 성장하는 아바스틴 투여에 내성을 지닌 A549 암세포를 확보하였다. 이 종양을 떼어낸 다음 아바스틴 내성 A549 세포를 Ex-vivo 배양을 진행하여 이중 타겟 항체의 효능 분석을 위해 사용하였다.
구체적으로는, 아바스틴 내성 A549 폐암 세포주를 암컷 누드 마우스(female nude mouse)에 접종한 후 종양 크기가 평균 200 mm3에 도달하였을 때 일주일에 2회 각 항체들을 투여하여 이중 타겟 항체의 in vivo 항암 활성을 확인하였다 (도 9). 아바스틴 저항성 A549 세포를 이용한 in vivo 시험에서도 인간 DLL4를 표적하는 아바스틴-DLL4 이중 항체 대신에 인간 DLL4 에피토프와 동일한 부위의 마우스 DLL4에 결합하는 이중 항체인 아바스틴-마우스 DLL4 surrogate 을 투여하여 이중 항체의 우수한 항암 효능 검증을 입증하였다.
도 12와 같이, 아바스틴에 대하여 내성을 가지는 폐암 세포주에 대하여, 본 발명의 이중표적 단백질이 항암 효과를 현저히 증가시키는 것을 in vivo 실험으로 확인하였다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (26)

  1. 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는 DLL4의 입체형태적 에피토프(conformational epitope)를 인지하는, DLL4에 특이적으로 결합하는 단백질 및 VEGF(Vascular endotelial growth factor)에 특이적으로 결합하는 항체를 포함하는, 이중표적 단백질.
  2. 제1항에 있어서, 상기 DLL4에 특이적으로 결합하는 단백질은
    서열번호 2로 표시되는 중쇄 CDR1; 서열번호 3으로 표시되는 중쇄 CDR2; 및 서열번호 4로 표시되는 중쇄 CDR3를 포함하는 중쇄 가변 영역 및
    서열번호 5로 표시되는 경쇄 CDR1; 서열번호 6으로 표시되는 경쇄 CDR2; 및 서열번호 7로 표시되는 경쇄 CDR3를 포함하는 경쇄 가변 영역을 포함하는 것인, 이중표적 단백질.
  3. 제1항에 있어서, 상기 이중표적 단백질은 DLL4에 특이적으로 결합하는 단백질 및 IgG(Immuniglobulin G) 형태의 VEGF에 특이적으로 결합하는 항체가 링커로 연결된 형태인, 이중표적 단백질.
  4. 제3항에 있어서, 상기 링커는 비펩타이드 링커 또는 펩타이드 링커인, 이중표적 단백질.
  5. 제4항에 있어서, 상기 펩타이드 링커는 서열번호 18의 펩타이드인 것인, 이중표적 단백질.
  6. 제1항에 있어서, 상기 DLL4에 특이적으로 결합하는 단백질은 서열번호 8로 표시되는 중쇄 아미노산 서열 및 서열번호 9로 표시되는 경쇄 아미노산 서열을 포함하는 것인, 이중표적 단백질.
  7. 제1항에 있어서, 상기 VEGF에 특이적으로 결합하는 항체는,
    중쇄 가변 영역은 서열번호 10으로 표시되는 중쇄 CDR1; 서열번호 11로 표시되는 중쇄 CDR2; 및 서열번호 12로 표시되는 중쇄 CDR3를 포함하고,
    경쇄 가변 영역은 서열번호 13으로 표시되는 경쇄 CDR1; 서열번호 14로 표시되는 경쇄 CDR2; 및 서열번호 15로 표시되는 경쇄 CDR3를 포함하는 것인, 이중표적 단백질.
  8. 제1항에 있어서, 상기 VEGF에 특이적으로 결합하는 항체는 서열번호 16으로 표시되는 중쇄 아미노산 서열 및 서열번호 17로 표시되는 경쇄 아미노산 서열을 포함하는 것인, 이중표적 단백질.
  9. 제1항에 있어서, 상기 VEGF에 특이적으로 결합하는 항체는 베바시주맙 (Bevacizumab)인 것인, 이중표적 단백질.
  10. 제1항에 있어서, 상기 이중표적 단백질은 서열번호 1로 표시되는 중쇄 아미노산 서열 및 서열번호 20으로 표시되는 경쇄 아미노산 서열을 포함하는 것인, 이중표적 단백질.
  11. 제1항에 있어서, 상기 DLL4에 특이적으로 결합하는 단백질은 전장 항체, Fab', F(ab')2, Fab, Fv, rIgG 또는 scFv(Single-chain variable fragment) 형태인 것인, 이중표적 단백질.
  12. 제1항 내지 제11항 중 어느 한 항의 이중표적 단백질을 코딩하는 폴리뉴클레오티드.
  13. 제12항의 폴리뉴클레오티드를 포함하는 발현 벡터.
  14. 제13항의 벡터가 도입된 형질전환체.
  15. (a) 제14항의 형질전환체를 배양하여 이중표적 단백질을 생산하는 단계; 및
    (b) 상기 (a) 단계에서 생산된 이중표적 단백질을 회수하는 단계를 포함하는, DLL4에 특이적으로 결합하는 단백질 및 VEGF(Vascular endotelial growth factor)에 특이적으로 결합하는 항체를 포함하는 이중표적 단백질의 제조방법.
  16. 제1항 내지 제11항 중 어느 한 항의 이중표적 단백질을 포함하는 조성물.
  17. 제1항 내지 제11항 중 어느 한 항의 이중표적 단백질을 포함하는, 암 치료용 약학적 조성물.
  18. 제17항에 있어서, 상기 암은 식도암, 위암, 대장암, 직장암, 구강암, 인두암, 후두암, 폐암, 결장암, 유방암, 자궁 경부암, 자궁 내막체암, 난소암, 전립선암, 고환암, 방광암, 신장암, 간암, 췌장암, 골암, 결합 조직암, 피부암, 뇌암, 갑상선암, 백혈병, 호지킨(Hodgkin) 질환, 림프종, 및 다발성 골수종혈액암으로 이루어진 군에서 선택된 것인, 조성물.
  19. 제1항 내지 제11항 중 어느 한 항의 이중표적 단백질을 포함하는, 암 진단용 조성물.
  20. (a) 제1항 내지 제11항 중 어느 한 항의 이중표적 단백질을 이용하여 암이 의심되는 개체의 분리된 시료의 VEGF 또는 DLL4 단백질의 수준을 측정하는 단계; 및
    (b) 상기 (a) 단계에서 측정된 VEGF 또는 DLL4 단백질의 수준이 정상 대조군 시료보다 높은 경우 암으로 판단하는 단계를 포함하는, 암의 진단방법.
  21. 서열번호 21로 표시되는 DLL4(Delta-like ligand 4) 단백질의 아미노산 서열에서 58번 내지 65번 아미노산 서열 및 110번 내지 115번 아미노산 서열을 포함하는, DLL4의 입체형태적 에피토프.
  22. 제21항의 입체형태적 에피토프를 인지하는, DLL4에 특이적으로 결합하는 단일클론항체.
  23. 제22항의 단일클론항체를 코딩하는 폴리뉴클레오티드.
  24. 제23항의 폴리뉴클레오티드를 포함하는 발현 벡터.
  25. 제24항의 벡터가 도입된 형질전환체.
  26. 제1항 내지 제11항 중 어느 한 항의 이중표적 단백질을 암이 의심되는 개체에 투여하는 단계를 포함하는, 암의 치료방법.
PCT/KR2014/006090 2013-07-09 2014-07-08 Dll4와 vegf에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도 WO2015005632A1 (ko)

Priority Applications (9)

Application Number Priority Date Filing Date Title
AU2014287984A AU2014287984B2 (en) 2013-07-09 2014-07-08 Novel dual-targeted protein specifically binding to DLL4 and VEGF, and use thereof
CN201480049434.9A CN105518028B (zh) 2013-07-09 2014-07-08 与dll4和vegf特异性结合的新型双靶向蛋白及其用途
RU2016104057A RU2648154C2 (ru) 2013-07-09 2014-07-08 Новые белки, специфично связывающиеся с двумя мишенями -dll4 и vegf-, и их применение
US14/903,077 US10184010B2 (en) 2013-07-09 2014-07-08 Dual-targeting protein binding specifically to DLL4 and VEGF and use thereof
ES14823338T ES2742855T3 (es) 2013-07-09 2014-07-08 Nueva proteína de objetivo doble que se une específicamente a DLL4 y CEGF, y uso de la misma
PL14823338T PL3020731T3 (pl) 2013-07-09 2014-07-08 Nowe podwójnie nakierowane białko specyficznie wiążące się z dll4 i vegf oraz zastosowanie tego białka
JP2016525275A JP6283411B2 (ja) 2013-07-09 2014-07-08 Ｄｌｌ４とｖｅｇｆに特異的に結合する新規二重標的タンパク質とこれの用途
EP14823338.0A EP3020731B1 (en) 2013-07-09 2014-07-08 Novel dual-targeted protein specifically binding to dll4 and vegf, and use thereof
CA2917402A CA2917402C (en) 2013-07-09 2014-07-08 Novel dual-targeting protein binding specifically to dll4 and vegf and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2013-0080523 2013-07-09
KR20130080523 2013-07-09

Publications (1)

Publication Number Publication Date
WO2015005632A1 true WO2015005632A1 (ko) 2015-01-15

Family

ID=52280248

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/006090 WO2015005632A1 (ko) 2013-07-09 2014-07-08 Dll4와 vegf에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도

Country Status (12)

Country Link
US (1) US10184010B2 (ko)
EP (1) EP3020731B1 (ko)
JP (1) JP6283411B2 (ko)
KR (1) KR101673389B1 (ko)
CN (1) CN105518028B (ko)
AU (1) AU2014287984B2 (ko)
CA (1) CA2917402C (ko)
ES (1) ES2742855T3 (ko)
PL (1) PL3020731T3 (ko)
RU (1) RU2648154C2 (ko)
TR (1) TR201910592T4 (ko)
WO (1) WO2015005632A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11339213B2 (en) 2015-09-23 2022-05-24 Mereo Biopharma 5, Inc. Methods and compositions for treatment of cancer

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102091293B1 (ko) 2011-09-23 2020-03-20 온코메드 파마슈티칼스, 인크. Vegf/dll4 결합제 및 그의 용도
US9840553B2 (en) 2014-06-28 2017-12-12 Kodiak Sciences Inc. Dual PDGF/VEGF antagonists
US11566082B2 (en) 2014-11-17 2023-01-31 Cytiva Bioprocess R&D Ab Mutated immunoglobulin-binding polypeptides
IL260323B1 (en) 2015-12-30 2024-09-01 Kodiak Sciences Inc Antibodies and their conjugates
US10730908B2 (en) 2016-05-11 2020-08-04 Ge Healthcare Bioprocess R&D Ab Separation method
US10703774B2 (en) 2016-09-30 2020-07-07 Ge Healthcare Bioprocess R&D Ab Separation method
US10654887B2 (en) 2016-05-11 2020-05-19 Ge Healthcare Bio-Process R&D Ab Separation matrix
EP3455243B1 (en) 2016-05-11 2021-03-24 Cytiva BioProcess R&D AB Separation matrix
JP7106187B2 (ja) 2016-05-11 2022-07-26 サイティバ・バイオプロセス・アールアンドディ・アクチボラグ 分離マトリックスを保存する方法
CN109311948B (zh) 2016-05-11 2022-09-16 思拓凡生物工艺研发有限公司 清洁和/或消毒分离基质的方法
US10889615B2 (en) 2016-05-11 2021-01-12 Cytiva Bioprocess R&D Ab Mutated immunoglobulin-binding polypeptides
AU2018244677B2 (en) * 2017-03-27 2021-03-04 Zymedi Co., Ltd. Antibody binding specifically to N-terminal region of lysyl-tRNA synthetase exposed on cell membrane
US12071476B2 (en) 2018-03-02 2024-08-27 Kodiak Sciences Inc. IL-6 antibodies and fusion constructs and conjugates thereof
CA3119458A1 (en) * 2018-11-15 2020-05-22 Oncomed Pharmaceuticals, Inc. Methods and monitoring of treatment with vegf/dll4 binding agent
CN109666073B (zh) * 2018-12-28 2022-02-01 中国药科大学 一种抗人dll4和抗人vegf双特异性抗体及其制备与应用
US11912784B2 (en) 2019-10-10 2024-02-27 Kodiak Sciences Inc. Methods of treating an eye disorder
AU2020378280A1 (en) 2019-11-07 2022-04-07 Feng Biosciences, Ltd. Classification of tumor microenvironments
KR20220124008A (ko) 2021-03-02 2022-09-13 서상로 자동 연마장치
EP4314348A1 (en) 2021-03-25 2024-02-07 Oncxerna Therapeutics, Inc. Targeted therapies in cancer

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090088936A (ko) * 2006-12-14 2009-08-20 리제너론 파아마슈티컬스, 인크. 사람 델타 유사 리간드 4에 대한 사람 항체
KR20110014607A (ko) * 2008-04-29 2011-02-11 아보트 러보러터리즈 이원 가변 도메인 면역글로불린 및 이의 용도
KR20110055726A (ko) * 2008-10-08 2011-05-25 에프. 호프만-라 로슈 아게 이중특이성 항-ｖｅｇｆ/항-ａｎｇ-2 항체
US20110123532A1 (en) * 2009-04-27 2011-05-26 Oncomed Pharmaceuticals, Inc. Method for Making Heteromultimeric Molecules
US20110189200A1 (en) 2010-01-29 2011-08-04 Regeneron Pharmaceuticals, Inc. Methods of treating autoimmune diseases with dll4 antagonists

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7906116B2 (en) 2005-09-01 2011-03-15 Parkash Gill Methods for using and identifying modulators of Delta-like 4
US9266967B2 (en) * 2007-12-21 2016-02-23 Hoffmann-La Roche, Inc. Bivalent, bispecific antibodies
US8192738B2 (en) * 2008-09-19 2012-06-05 Medimmune, Llc Targeted antibodies directed to DLL4
UY32920A (es) 2009-10-02 2011-04-29 Boehringer Ingelheim Int Moleculas de unión biespecíficas para la terapia anti-angiogénesis
SG191712A1 (en) * 2010-11-02 2013-08-30 Abbvie Inc Dual variable domain immunoglobulins and uses thereof
KR102091293B1 (ko) 2011-09-23 2020-03-20 온코메드 파마슈티칼스, 인크. Vegf/dll4 결합제 및 그의 용도
KR101535341B1 (ko) * 2012-07-02 2015-07-13 한화케미칼 주식회사 Dll4에 특이적으로 결합하는 신규한 단일클론항체 및 이의 용도
BR112015009961B1 (pt) * 2012-11-01 2020-10-20 Abbvie Inc. proteína de ligação capaz de se ligar a dll4 e vegf, bem como composição que a compreende como composição que a compreende

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090088936A (ko) * 2006-12-14 2009-08-20 리제너론 파아마슈티컬스, 인크. 사람 델타 유사 리간드 4에 대한 사람 항체
KR20110014607A (ko) * 2008-04-29 2011-02-11 아보트 러보러터리즈 이원 가변 도메인 면역글로불린 및 이의 용도
KR20110055726A (ko) * 2008-10-08 2011-05-25 에프. 호프만-라 로슈 아게 이중특이성 항-ｖｅｇｆ/항-ａｎｇ-2 항체
US20110123532A1 (en) * 2009-04-27 2011-05-26 Oncomed Pharmaceuticals, Inc. Method for Making Heteromultimeric Molecules
US20110189200A1 (en) 2010-01-29 2011-08-04 Regeneron Pharmaceuticals, Inc. Methods of treating autoimmune diseases with dll4 antagonists

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BOWDEN, E. T. ET AL.: "DLL4-Notch signaling mediates tumor resistance to anti-VEGF therapy in vivo.", CANCER RES., vol. 71, no. 18, 29 July 2011 (2011-07-29), pages 6073 - 6083, XP055221882 *
See also references of EP3020731A4
YAN, M. ET AL.: "Delta-like 4/Notch signaling and its therapeutic implications. Clin.", CANCER RES., vol. 13, no. 24, 15 December 2007 (2007-12-15), pages 7243 - 7246, XP002563705 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11339213B2 (en) 2015-09-23 2022-05-24 Mereo Biopharma 5, Inc. Methods and compositions for treatment of cancer

Also Published As

Publication number Publication date
KR101673389B1 (ko) 2016-11-08
CA2917402A1 (en) 2015-01-15
KR20150007241A (ko) 2015-01-20
RU2016104057A (ru) 2017-08-15
US20160159929A1 (en) 2016-06-09
CN105518028A (zh) 2016-04-20
EP3020731B1 (en) 2019-06-12
ES2742855T3 (es) 2020-02-17
CA2917402C (en) 2019-10-22
EP3020731A4 (en) 2017-02-22
US10184010B2 (en) 2019-01-22
JP2016531097A (ja) 2016-10-06
PL3020731T3 (pl) 2019-11-29
AU2014287984A1 (en) 2016-02-04
JP6283411B2 (ja) 2018-02-21
CN105518028B (zh) 2019-08-13
AU2014287984B2 (en) 2016-09-22
EP3020731A1 (en) 2016-05-18
TR201910592T4 (tr) 2019-08-21
RU2648154C2 (ru) 2018-03-22

Similar Documents

Publication Publication Date Title
WO2015005632A1 (ko) Dll4와 vegf에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도
AU2019386549B2 (en) Anti-4-1BB antibody and use thereof
WO2019098682A1 (ko) 항-her2 항체 또는 그의 항원 결합 단편, 및 이를 포함하는 키메라 항원 수용체
WO2016153276A1 (ko) 뉴로필린1 특이적 결합 펩타이드 및 이 펩타이드가 융합된 융합 단백질, 및 이의 용도
WO2019225787A1 (ko) 항-b7-h3 항체 및 그 용도
WO2014189303A1 (ko) 뉴로필린에 특이적인 종양 침투성 펩타이드 및 이 펩타이드가 융합된 융합 단백질
WO2012165925A2 (ko) Hgf 활성을 가지는 c-met에 대한 인간항체 및 이의 용도
WO2016013870A1 (ko) 완전한 이뮤노글로불린 형태의 항체를 세포막을 투과하여 세포질에 위치시키는 방법 및 그의 이용
WO2020005003A1 (ko) Lag-3에 특이적으로 결합하는 단클론항체 및 이의 용도
WO2019112347A2 (ko) 악성 b 세포를 특이적으로 인지하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이의 용도
WO2022039490A1 (en) Anti-b7-h4/anti-4-1bb bispecific antibodies and use thereof
WO2020251316A1 (ko) α-SYN/IGF1R에 대한 이중 특이 항체 및 그 용도
WO2019132533A1 (ko) 항-pd-l1 항체 및 이의 용도
WO2019078699A2 (ko) 항-vista 항체 및 이의 용도
WO2024049161A1 (ko) 신규한 항-pd-l1 키메릭 항원 수용체 및 이를 발현하는 면역세포
WO2021066612A2 (ko) 종양 표적화 단백질 또는 이의 단편 및 그것에 결합하는 항체 및 이의 용도
WO2014021693A2 (ko) Tm4sf5 단백질에 특이적으로 결합하는 신규한 단일클론항체 및 이의 용도
WO2017171373A2 (ko) Egfr 표적 제제에 대한 저항성을 억제하기 위한 조성물
WO2017074013A1 (ko) 인간 및 마우스 sema3a에 교차결합하는 항체 및 그의 용도
WO2020004934A1 (ko) 항-bcma 항체 및 그 용도
WO2010126279A2 (ko) 사이토케라틴１７-특이적인 인간항체
WO2016084993A1 (ko) 신규 EGFRvIII 항체 및 이를 포함하는 조성물
WO2021029746A2 (ko) 항-tie2 항체 및 이의 용도
WO2020117017A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2020117019A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14823338

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2917402

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2014823338

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016525275

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2014287984

Country of ref document: AU

Date of ref document: 20140708

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2016104057

Country of ref document: RU

Kind code of ref document: A