WO2010126279A2 - 사이토케라틴１７-특이적인 인간항체 - Google Patents

사이토케라틴１７-특이적인 인간항체 Download PDF

Info

Publication number
WO2010126279A2
WO2010126279A2 PCT/KR2010/002641 KR2010002641W WO2010126279A2 WO 2010126279 A2 WO2010126279 A2 WO 2010126279A2 KR 2010002641 W KR2010002641 W KR 2010002641W WO 2010126279 A2 WO2010126279 A2 WO 2010126279A2
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
cytokeratin
human antibody
group
seq
Prior art date
Application number
PCT/KR2010/002641
Other languages
English (en)
French (fr)
Other versions
WO2010126279A3 (ko
Inventor
박영우
최소영
송은정
조기원
김성섭
장명희
류기혁
김진숙
박소연
이경민
이미혜
Original Assignee
한국생명공학연구원
주식회사 엔지노믹스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원, 주식회사 엔지노믹스 filed Critical 한국생명공학연구원
Publication of WO2010126279A2 publication Critical patent/WO2010126279A2/ko
Publication of WO2010126279A3 publication Critical patent/WO2010126279A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man

Definitions

  • the present invention relates to cytokeratin17-specific human antibodies.
  • Cytokeratin is a cytoskeleletal filament protein, and about 20 subtypes have been reported to be expressed in various forms of human epithelial cells.
  • the CK is in the range of a molecular weight between 40 KDa and 68 KDa and an isoelectric pH between 4.9-7.8 and each of the human CKs is numbered from 1 to 20. It expresses CK related to the degree of maturation or differentiation in various epithelium of the human body.
  • the CK isotype is determined by the localization and cell type of the CK in the cytoplasm. Different CK forms are distributed differently among different types of epithelium throughout the human body depending on their molecular weight as well as whether they are acidic or basic.
  • CK a cytoplasmic molecule
  • HSP70 heat shock protein 70
  • cytokeratin 17 a marker of reserve cells of the uterus, is a valuable marker for diagnosing uterine cervical intraepithelial neoplasia (CIN) along with cytokeratin 8 and their immunostaining Has been associated with increased lesion grade of CIN (Ikeda K et al ., Gynecol Oncol . 108 (3): 598-602, 2008). Cytokeratin17 is also known to cause metaplasia (Martens JE et al ., Anticancer Res . 24: 771-775, 2004) and is expressed in immature metaplastic squamous epithelium (Smedts F et al ., Obstet. Gynecol.
  • cytokeratins which are intermediate filaments found in normal cells, are unknown about the exact origins of overexpression in tumors such as breast cancer, While these tumors are generally associated with high grade, stage and poor prognosis (Gusterson B et al ., Breast Cancer Res 7: 143-148, 2005), these basal phenotypes Contradictory results are still being reported and controversial for independent prognostic significance (Foulkes W et al ., Cancer Res 64: 830-835, 2004). Current cytokeratin antibodies are not only useful tools in cytopathology and flow cytometric assays, but they are also used in several diagnostics of tumors using immunohistochemistry in tissue sections.
  • the present inventors screened seven human antibodies specifically binding to cytokeratin 17, and confirmed that the human antibody has binding ability and specificity to cytokeratin 17 in cancer cell lines expressing cytokeratin 17, The present invention has been completed by suggesting that the human antibody of the present invention can be effectively used for the treatment of cytokeratin17 overexpressing cancer disease.
  • the present invention provides a composition for treating and preventing cancer diseases using a vector capable of mass-producing an antibody specific for cytokeratin 17 having the highest complementarity and a human antibody specific for the cytokeratin 17.
  • the present invention provides human antibodies specific for Cytokeratin17.
  • the present invention also provides an expression vector comprising a polynucleotide encoding the heavy chain or fragment thereof of the human antibody, and a constant region of the polynucleotide and human heavy chain.
  • the present invention also provides an expression vector comprising a polynucleotide encoding the light chain or fragment thereof of the human antibody, and a constant region of the polynucleotide and the human light chain.
  • the present invention also provides a transformant prepared by introducing an expression vector comprising a polynucleotide encoding the heavy chain of the human antibody or an immunologically active fragment thereof into a host cell.
  • the present invention also provides a transformant prepared by introducing an expression vector comprising a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof into a host cell.
  • the present invention is a transformant prepared by introducing an expression vector comprising a polynucleotide encoding a heavy chain or a fragment thereof of the human antibody, and an expression vector comprising a polynucleotide encoding a light chain or a fragment thereof into a host cell at the same time Provide a sieve.
  • the present invention also provides a method for producing a human antibody specific for cytokeratin 17 by culturing the transformant.
  • the present invention also provides a pharmaceutical composition for preventing or treating cancer diseases in which cytokeratin 17 is overexpressed, comprising the human antibody.
  • the present invention also provides a pharmaceutical composition for treating radioimmunity of cancer diseases in which cytokeratin 17 is overexpressed including the human antibody and a therapeutic radioisotope.
  • the present invention also provides a method for preventing or treating cancer diseases in which cytokeratin17 is overexpressed, comprising administering to a subject a pharmaceutically effective amount of the human antibody.
  • the present invention also provides a composition for detecting cancer diseases in which cytokeratin 17 is overexpressed, which comprises a diagnostically effective amount of the human antibody, the light chain or heavy chain of the human antibody, or a fragment thereof.
  • the present invention also provides a method for immunodetection of cancer in which cytokeratin 17 is overexpressed in vitro, comprising contacting the detection composition with cancer cells.
  • the present invention also provides a method for imaging cancer in which cytokeratin17 is overexpressed in vivo, comprising administering a diagnostically effective amount of the composition for detecting cancer to a subject.
  • the present invention also provides a method for the treatment of cancer in which cytokeratin 17 is overexpressed using the composition for detection.
  • the present invention provides a method for prognostic evaluation of cancer treatment in which cytokeratin 17 is overexpressed using the composition for detection.
  • the human antibody specific for the cytokeratin 17 of the present invention can be used for diagnosis of cancer diseases over which the cytokeratin 17 is overexpressed, classification of diseases, imaging, treatment, and prognosis.
  • FIG. 1 is a diagram showing the results of hydrophobic analysis of cytokeratin 17 protein.
  • Figure 2 is a diagram showing the result of comparing the expression level of CK17-D1 according to the expression conditions by SDS-PAGE.
  • FIG. 3 is a diagram showing the results of confirming the purified CK17-D1 by SDS-PAGE.
  • Figure 4 is a diagram showing the result of comparing the expression level of CK17-D3 according to the expression conditions by SDS-PAGE.
  • 5 is a diagram showing the results of confirming the purified CK17-D3 by SDS-PAGE.
  • Figure 6 shows the phage antibody search results for CK17-D1 in the panning step.
  • Figure 8 is a diagram showing the results confirmed by fingerprinting the human CK17 single phage clone antibody diversity (CK17-D1).
  • Figure 9 shows the results confirmed by fingerprinting the human CK17 single phage clone antibody diversity (CK17-D3).
  • FIG. 10 is a diagram showing the results of analyzing a polypeptide in the CDRs of a human CK17 single phage clone antibody against CK17-D1.
  • Fig. 11 shows the results of analyzing a polypeptide in the CDRs of the heavy chain of the human CK17 single phage clone antibody against CK17-D3.
  • Fig. 12 shows the results of analyzing a polypeptide in the CDRs of the light chain of a human CK17 single phage clone antibody against CK17-D3.
  • Figure 13 shows the results of comparing the binding specificities of human CK17 monoclonal antibodies:
  • Figure 16 shows the results of comparing the binding specificities of purified whole IgG:
  • FIG. 17 shows a cleavage map of the pNATAB H vector.
  • the present invention is selected from the group consisting of heavy chain complementarity determining region (hereinafter HCDR) 1, SEQ ID NO: 31 to 37 having any one amino acid sequence selected from the group consisting of SEQ ID NO: 24 to 30 A heavy chain or fragment thereof comprising a heavy chain variable region (V H ) comprising HCDR 2 having any one amino acid sequence and HCDR 3 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 38 to 44; And,
  • a light chain complementarity determining region (hereinafter referred to as LCDR) 1 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 45 to 50, LCDR 2 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 51 to 57, and Human specific for cytokeratin 17 comprising a light chain or fragment thereof comprising a light chain variable region (V L ) comprising LCDR 3 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 58-64 Provide an antibody.
  • the present invention also provides a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof, and an expression vector comprising the polynucleotide.
  • the present invention also provides a polynucleotide encoding a light chain or an immunologically active fragment thereof of the human antibody, and an expression vector comprising the polynucleotide.
  • the present invention also provides a transformant prepared by introducing an expression vector comprising a polynucleotide encoding the heavy chain of the human antibody or an immunologically active fragment thereof into a host cell.
  • the present invention also provides a transformant prepared by introducing an expression vector comprising a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof into a host cell.
  • the present invention is an expression vector comprising a polynucleotide encoding a heavy chain or immunologically active fragments of the human antibody, and an expression comprising a polynucleotide encoding a light chain or fragments immunologically active.
  • a vector is introduced into a host cell at the same time to provide a transformant prepared.
  • the present invention also provides a method for producing a human antibody specific for cytokeratin 17 by culturing the transformant.
  • the present invention also provides a pharmaceutical composition for preventing or treating cancer diseases in which cytokeratin 17 is overexpressed, comprising the human antibody.
  • the present invention also provides a pharmaceutical composition for treating radioimmunity of cancer diseases in which cytokeratin 17 is overexpressed including the human antibody and a therapeutic radioisotope.
  • the present invention also provides a method for treating a cancer disease overexpressing cytokeratin 17, comprising administering a pharmaceutically effective amount of the human antibody to an individual suffering from a cancer disease overexpressing cytokeratin17.
  • the present invention also provides a composition for detecting cancer diseases in which cytokeratin 17 is overexpressed, which comprises a diagnostically effective amount of the human antibody, the light chain or heavy chain of the human antibody, or an immunologically active fragment thereof.
  • the present invention also provides a method for immunodetection of cancer in which cytokeratin 17 is overexpressed in vitro, comprising contacting the detection composition with cancer cells.
  • the present invention comprises the steps of 1) administering a diagnostically effective amount of the composition for detection to a subject; And,
  • step 2 2) identifying tumor cells by detecting the composition of step 1);
  • step 3 A method of in vivo treatment of a cancer in which cytokeratin 17 is overexpressed, the method comprising removing the tumor cells identified in step 2) by surgical resection.
  • step 2 2) identifying tumor cells by detecting the composition of step 1);
  • 3) Provided is a method for evaluating the prognosis of cancer treatment patients overexpressing cytokeratin17, characterized in that if the tumor cells are not detected in step 2), all tumor cells are removed.
  • Variable region refers to a portion of an antibody molecule that exhibits many variations in sequence while performing its function of specifically binding to an antigen, and CDR1, CDR2 and CDR3 are present in the variable region.
  • a framework region (FR) portion exists between the CDRs to support the CDR rings.
  • a “complementarity determining region” is a ring-shaped region that is involved in the recognition of an antigen, and as the sequence of this region changes, the specificity of the antibody to the antigen is determined.
  • “Panning” refers to the surface of a peptide that has a property of binding to a target molecule (antibody, enzyme, cell surface receptor, etc.) from a phage library that displays the peptide on the coat of the phage. The process of selecting only a phage.
  • a target molecule antibody, enzyme, cell surface receptor, etc.
  • the present invention has any one amino acid sequence selected from the group consisting of heavy chain complementarity determining region (hereinafter HCDR) 1, SEQ ID NO: 31 to 37 having any one amino acid sequence selected from the group consisting of SEQ ID NO: 24 to 30 A heavy chain or a fragment thereof comprising a heavy chain variable region (V H ) comprising HCDR 2 and HCDR 3 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 38 to 44; And,
  • a light chain complementarity determining region (hereinafter referred to as LCDR) 1 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 45 to 50, LCDR 2 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 51 to 57, and Provided is a human antibody specific for cytokeratin17 comprising a light chain or a fragment thereof comprising a light chain variable region (V L ) comprising LCDR 3 having any one amino acid sequence selected from the group consisting of SEQ ID NOs: 58-64 do.
  • LCDR light chain complementarity determining region
  • the heavy chain variable region has any one amino acid sequence selected from the group consisting of SEQ ID NOs: 10 to 16 and the light chain variable region comprises any one amino acid sequence selected from the group consisting of SEQ ID NOs: 17 to 23 Have
  • the antibodies are in the form of whole antibodies as well as functional fragments of antibody molecules.
  • the whole antibody is a structure having two full length light chains and two full length heavy chains, and each light chain is linked by a heavy chain and disulfide bond.
  • a functional fragment of an antibody molecule refers to a fragment having an antigen binding function.
  • antibody fragments include (i) the variable region of the light chain (V L ) and the variable region of the heavy chain (V H ) and the constant region of the light chain (C L ) and Fab fragment consisting of the first constant region (C H1 ) of the heavy chain; (ii) a Fd fragment consisting of the V H and C H1 domains; (iii) a Fv fragment consisting of the V L and V H domains of a single antibody; (iv) a dAb fragment consisting of a V H domain (Ward ES et al.
  • a human antibody against cytokeratin 17 was obtained in scFv form using Phage Display Technology, and screened in the form of a single phage clone, which was specific for cytokeratin 17. Monoclonal phage of species was obtained.
  • cytokeratin 17 obtained by recombinant technology was used to prepare monoclonal antibodies.
  • the cytokeratin 17 is reacted and panned with a library phage prepared from a variety of human naive scFv library cells, and then screened for a single clone that binds strongly to the cytokeratin 17 antigen. (See Tables 1 to 3 and FIGS. 6 and 7). After the selected single clones were identified by fingerprinting (see FIGS. 8 and 9), the respective sequences were analyzed to identify CDR regions of V H and V L of the antibody (Table 6 and FIG. 10). , 11).
  • a gene encoding the light and heavy chains of a monoclonal phage is obtained and linked to a vector, respectively, and then the expression vector is simultaneously introduced into a host cell to identify human IgG in the form of expressed IgG.
  • the human antibody was obtained (see FIG. 15) to confirm the avidity (see FIG. 16) and specificity (see Table 9) of CK17 of the total antibody in SKOV3 cell line.
  • the present invention also provides a polynucleotide encoding a heavy chain of the human antibody or an immunologically active fragment thereof, and an expression vector comprising the polynucleotide.
  • the present invention also provides a polynucleotide encoding a light chain or an immunologically active fragment thereof of the human antibody, and an expression vector comprising the polynucleotide.
  • SKOV3 cell line was used for CK17. Adhesion (see FIG. 16) and specificity (see Table 9) were confirmed.
  • Polynucleotides encoding the light and heavy chains or fragments thereof of the human antibodies of the present invention contemplate codons preferred by organisms to express the light and heavy chains or fragments thereof of the human antibody or due to the degeneracy of the codons.
  • codons preferred by organisms to express the light and heavy chains or fragments thereof of the human antibody or due to the degeneracy of the codons.
  • various modifications can be made to the coding region within the range of not changing the amino acid sequence of the light and heavy chains or fragments of the human antibody expressed from the coding region, and do not affect the expression of the gene even in parts other than the coding region.
  • Various modifications or modifications can be made within the scope, and those skilled in the art will understand that such modified genes are also included within the scope of the present invention.
  • nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, which are also included in the scope of the present invention.
  • sequence of such polynucleotides may be single or double chained and may be DNA molecules or RNA (mRNA) molecules.
  • expression control sequences such as promoters, terminators, enhancers, and the like, depending on the type of host cell to produce light and heavy chains or fragments of the human antibody, membranes A sequence for targeting or secretion may be appropriately selected and various combinations may be made depending on the purpose.
  • Expression vectors of the present invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors.
  • Suitable expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals and enhancers and can be prepared in various ways depending on the purpose.
  • the promoter of the expression vector may be constitutive or inducible.
  • the signal sequence includes a PhoA signal sequence and an OmpA signal sequence when the host is Escherichia sp., And an ⁇ -amylase signal sequence and a subtilisin signal when the host is Bacillus sp.
  • the MF ⁇ signal sequence, the SUC2 signal sequence, and the like may be used when the host is a yeast, and the insulin signal sequence, the ⁇ -interferon signal sequence, the antibody molecular signal sequence, or the like may be used when the host is an animal cell.
  • the expression vector may also include a selection marker for selecting a host cell containing the vector, and in the case of a replicable expression vector, includes the origin of replication.
  • the present invention also provides a transformant prepared by introducing an expression vector comprising a polynucleotide encoding the heavy chain of the human antibody or an immunologically active fragment thereof into a host cell.
  • the present invention also provides a transformant prepared by introducing an expression vector comprising a polynucleotide encoding a light chain of the human antibody or an immunologically active fragment thereof into a host cell.
  • the present invention is an expression vector comprising a polynucleotide encoding a heavy chain or immunologically active fragments of the human antibody, and an expression comprising a polynucleotide encoding a light chain or fragments immunologically active.
  • a vector is introduced into a host cell at the same time to provide a transformant prepared.
  • a gene encoding the light and heavy chains of a human-derived monoclonal phage specific to cytokeratin 17 is obtained and linked to a vector, and then the expression vector is simultaneously introduced into a host cell to express the entire IgG.
  • the form of human antibody was identified.
  • the human antibody was obtained to confirm the binding ability (see FIG. 16) and specificity (see Table 9) to cytokeratin 17.
  • the expression vector according to the present invention may be transformed into an appropriate host cell, for example, E. coli or yeast cell, and then cultured in the transformed host cell to mass produce the light and heavy chains or fragments thereof of the human antibody according to the present invention.
  • the host cell may be a prokaryote such as E. coli or Bacillus subtilis . It may also be eukaryotic cells derived from yeast, insect cells, plant cells, animal cells such as Saccharomyces cerevisiae . More preferably, the animal cell may be an autologous or allogeneic animal cell. Transformants prepared by introducing into autologous or allogeneic animal cells may be used in cell therapies for administration to a subject to treat cancer.
  • the expression vector introduction method into the host cell may be any method known to those skilled in the art.
  • the present invention also provides a method for producing a human antibody specific for cytokeratin 17 by culturing the transformant.
  • the culture medium it is preferable to select a medium suitable for the transformant from the culture medium known to those skilled in the art.
  • the antibody purification method may be any purification method known to those skilled in the art.
  • a gene encoding the light and heavy chains of a human-derived monoclonal phage specific to cytokeratin 17 is obtained and linked to a vector, and then the expression vector is simultaneously introduced into a host cell to express the entire IgG.
  • the form of human antibody was identified.
  • the human antibody was obtained to confirm the binding ability (see FIG. 16) and specificity (see Table 9) to cytokeratin 17.
  • the present invention also provides a pharmaceutical composition for preventing or treating cancer diseases in which cytokeratin 17 is overexpressed, comprising the human antibody.
  • the cancer disease in which the cytokeratin 17 is overexpressed is preferably any one selected from the group consisting of colorectal cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer and ovarian cancer, but not limited thereto, and all cancers in which cytokeratin 17 is overexpressed are possible. .
  • the monoclonal antibody showing the binding capacity and specificity for cytokeratin 17 may be usefully used as a composition for preventing or treating cancer diseases in which cytokeratin 17 is overexpressed.
  • the pharmaceutical composition of the present invention may optionally contain a human antibody or the transformant specific for the cytokeratin 17, and may further contain one or more active ingredients exhibiting the same or similar functions in addition to the above components. .
  • it may be prepared by including one or more pharmaceutically acceptable carriers.
  • a pharmaceutically acceptable carrier for example, saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and a mixture of one or more of these components may be used.
  • diluents such as aqueous solutions, suspensions, and emulsions, and antibodies specific for the target cells to act specifically on the target cells.
  • injectable formulations such as aqueous solutions, suspensions, and emulsions, and antibodies specific for the target cells to act specifically on the target cells.
  • ligand may be used in combination with the above carrier.
  • it can be preferably formulated according to each disease or component using an appropriate method in the art or a method published in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.
  • the pharmaceutical composition of the present invention can be administered parenterally, and parenteral administration is by subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection.
  • parenteral administration is by subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection.
  • the pharmaceutical compositions of the present invention are mixed with stabilizers or buffers to prepare solutions or suspensions, which are formulated in unit dosage forms of ampoules or vials.
  • compositions of the present invention can be prepared in various forms depending on the route of administration.
  • the pharmaceutical compositions of the present invention may be prepared in the form of sterile aqueous solutions or dispersions suitable for injectable use, or may be prepared in lyophilized form using freeze-drying techniques. Lyophilized pharmaceutical compositions are typically maintained at about 4 ° C. and may be restored by stabilization solutions, such as saline or / and HEPES, with or without adjuvant.
  • factors affecting the amount of pharmaceutical composition to be administered include, but are not limited to, the mode of administration, frequency of administration, the particular disease being treated, the severity of the disease, the history of the disease, the subject Whether the cooperative therapy is in progress with other therapeutic agents, and the age, height, weight, health, and physical condition of the individual in whom the treatment is in progress.
  • the present invention also provides a pharmaceutical composition for treating radioimmunity of cancer diseases in which cytokeratin 17 is overexpressed including the human antibody and a therapeutic radioisotope.
  • the cancer disease in which the cytokeratin 17 is overexpressed is preferably any one selected from the group consisting of colorectal cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer and ovarian cancer, but not limited thereto, and all cancers in which cytokeratin 17 is overexpressed are possible. .
  • therapeutic radioisotopes examples include 3 H, 11 C, 14 C, 18 F, 64 Cu, 76 Br, 86 Y, 99 m Tc, 111 In, 123 I, 177 Lu and mixtures and combinations thereof.
  • the therapeutic radioisotope is characterized in that it is included in a carrier bound to the human antibody or bound to the human antibody.
  • the present invention also provides a method for treating a cancer disease overexpressing cytokeratin 17, comprising administering a pharmaceutically effective amount of the human antibody to an individual suffering from a cancer disease overexpressing cytokeratin17.
  • the cancer disease in which the cytokeratin 17 is overexpressed is preferably any one selected from the group consisting of colorectal cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer and ovarian cancer, but not limited thereto, and all cancers in which cytokeratin 17 is overexpressed are possible. .
  • monoclonal antibodies showing binding ability and specificity for cytokeratin 17 may be usefully used for the treatment of cancer diseases in which cytokeratin 17 is overexpressed.
  • the subjects to which the present invention is applicable are vertebrates and preferably mammals, more preferably experimental animals such as rats, rabbits, guinea pigs, hamsters, dogs and cats, most preferably apes such as chimpanzees and gorillas. It is an animal.
  • the method for administering the human antibody of the present invention may be parenteral administration (eg, intravenous, subcutaneous, intraperitoneal or topical administration) depending on the purpose of use, and preferably intravenous administration.
  • parenteral administration eg, intravenous, subcutaneous, intraperitoneal or topical administration
  • local administration may be desirable to facilitate and quick access of the antibody.
  • Dosage varies depending on the weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion and severity of the patient.
  • Single doses may be administered in daily or weekly amounts in an amount of about 5 to 500 mg / m 2 . The effective amount can be adjusted at the discretion of the physician treating the patient.
  • Human antibodies of the present invention can be used alone or in combination with surgery, hormone therapy, drug therapy and biological response modifiers for the treatment of cancer patients.
  • the present invention also provides a composition for detecting cancer diseases in which cytokeratin 17 is overexpressed, which comprises a diagnostically effective amount of the human antibody, the light chain or heavy chain of the human antibody, or an immunologically active fragment thereof.
  • the cancer disease in which the cytokeratin 17 is overexpressed is preferably any one selected from the group consisting of colorectal cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer and ovarian cancer, but not limited thereto, and all cancers in which cytokeratin 17 is overexpressed are possible. .
  • the monoclonal antibody showing the binding ability and specificity for cytokeratin 17 may be usefully used as a composition for detecting cancer diseases in which cytokeratin 17 is overexpressed.
  • the human antibody, light chain or heavy chain of the human antibody, or an immunologically active fragment thereof is any one selected from the group consisting of therapeutic radioisotopes, phosphors, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors or ligands. Directly or indirectly bound or linked to the above detectable label.
  • therapeutic radioisotopes include 3 H, 11 C, 14 C, 18 F, 64 Cu, 76 Br, 86 Y, 99 m Tc, 111 In, 123 I, 177 Lu and mixtures and combinations thereof. .
  • the present invention also provides a method for immunodetection of cancer in which cytokeratin 17 is overexpressed in vitro, comprising contacting the detection composition with cancer cells.
  • the cancer in which the cytokeratin 17 is overexpressed is preferably any one selected from the group consisting of colorectal cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer, and ovarian cancer, but is not limited thereto, and all cancers in which cytokeratin 17 is overexpressed are possible.
  • monoclonal antibodies showing binding ability and specificity for cytokeratin 17 may be usefully used for the detection of cancers in which cytokeratin 17 is overexpressed.
  • the detection composition may be bound to a solid substrate to facilitate subsequent steps such as washing or separation of the complex.
  • Solid substrates include synthetic resins, nitrocellulose, glass substrates, metal substrates, glass fibers, microspheres and microbeads.
  • the synthetic resins include polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF and nylon.
  • cancer cells may be diluted to a suitable degree prior to contact with the detection composition.
  • the present invention comprises the steps of 1) administering a diagnostically effective amount of the composition for detection to a subject; And,
  • the cancer in which the cytokeratin 17 is overexpressed is preferably any one selected from the group consisting of colorectal cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer, and ovarian cancer, but is not limited thereto, and all cancers in which cytokeratin 17 is overexpressed are possible.
  • the monoclonal antibody showing binding ability and specificity for cytokeratin 17 may be usefully used for the imaging method of cancer in which cytokeratin 17 is overexpressed.
  • the detection image is characterized in that obtained by near-infrared imaging, PET, MRI or ultrasound imaging.
  • step 2 2) identifying tumor cells by detecting the composition of step 1);
  • step 3 A method of in vivo treatment of a cancer in which cytokeratin 17 is overexpressed, the method comprising removing the tumor cells identified in step 2) by surgical resection.
  • the cancer in which the cytokeratin 17 is overexpressed is preferably any one selected from the group consisting of colorectal cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer, and ovarian cancer, but is not limited thereto, and all cancers in which cytokeratin 17 is overexpressed are possible.
  • monoclonal antibodies showing binding ability and specificity for cytokeratin 17 may be usefully used for the treatment of cancers in which cytokeratin 17 is overexpressed.
  • step 2 2) identifying tumor cells by detecting the composition of step 1);
  • step 2) If the tumor cells are not detected in step 2), it provides a method for evaluating the prognosis of the cancer treatment patient characterized in that it is determined that all the tumor cells have been removed.
  • monoclonal antibodies showing binding ability and specificity for cytokeratin 17 may be usefully used for prognostic evaluation of cancers in which cytokeratin 17 is overexpressed.
  • the protein expressed to delete the domain 1 was named CK17-D1 (SEQ ID NO: 2), and the protein expressed to delete the domains 1 to 3 was named CK17-D3 (SEQ ID NO: 3).
  • a plasmid (hMU000313, Kugi # IRAT-04-C01) containing human cytokeratin17 gene was distributed by KUGI (Korean UniGene Information) of the Korea Research Institute of Bioscience and Biotechnology.
  • KUGI Korean UniGene Information
  • Using the plasmid as the template DNA using a forward primer (SEQ ID NO: 4: 5'-GTCTAGCCATGGAACTGGCTGGAGGTGAG-3 ') and a reverse primer (SEQ ID NO: 5: 5'-GTCTAGAAGCTTGCGGGTGGTCTGGTG-3') to express the CK17-D1
  • the gene was amplified under the following conditions, treated with Nco I and Hind III, and then subcloned into pET28A (69864-3: Novagen, USA).
  • PCR conditions were 50 ⁇ l of the total reaction solution, the template was put to 100 ng, 25 °C, 72 °C 10 minutes reaction at 94 °C 5 minutes, 95 °C 30 seconds, 55 °C 30 seconds, 72 °C 1 minutes 30 seconds To obtain a PCR product.
  • the product was purified using a Bio-Scle Mini profinity IMAC cartridge (cat #: 732-4610) from Bio-Rad's Profinia TM protein Purification System at 1 ml / min as instructed by the manufacturer. Specifically, Ni-NTA (Qiagen 1024473) beads were added to the concentrated solution and bound at 4 ° C. for 2 hours, followed by washing with washing solution (300 mM NaCl, 50 mM sodium phosphage buffer, 20 mM imidazole, pH 8.0). It was. Thereafter, the protein was eluted with an elution solution (300 mM NaCl, 50 mM sodium phosphage buffer, 250 mM imidazole, pH 8.0).
  • an elution solution 300 mM NaCl, 50 mM sodium phosphage buffer, 250 mM imidazole, pH 8.0.
  • the solution was placed in a dialysis membrane network (10K, 132574: SPECTRAPOR, USA) and then dialyzed overnight at 4 ° C. with 4 L of dialysis solution (100 mM tris-HCl pH 8.0, 300 mM NaCl, 1 mM DTT, 10% glycerol). It was.
  • dialysis solution 100 mM tris-HCl pH 8.0, 300 mM NaCl, 1 mM DTT, 10% glycerol.
  • 400 ⁇ g (0.3 mg / ml) of CK17-D1 protein was obtained and confirmed on 10% SDS-PAGE gel to confirm purified CK17-D1 protein of approximately 39 KDa size. (FIG. 3).
  • the expression levels were high and similar at 20 ° C., 28 ° C. and 37 ° C., but the solubility was the highest at 20 ° C., so that overnight induction was performed at 20 ° C. with IPTG concentration of 1 mM to obtain protein.
  • the concentration of the protein was measured by the bradford method, and then 400 ⁇ g (1 mg / mlmM) of CK17-D3 protein was obtained.
  • a size of about 31 KDa was confirmed on a 10% SDS-PAGE gel. Purified CK17-D3 protein was identified. Like CK17-D1, purified CK17-D3 protein was used as an antigen.
  • the protein was purified from the culture solution 500 ml inducing protein expression overnight at 20 ° C. in the same manner as in Example 1-2-1, and as a result, 400 ⁇ g ( 1 mg / ml) of CK17-D3 protein was obtained and confirmed on a 10% SDS-PAGE gel to confirm purified CK17-D3 protein of approximately 31 KDa size (FIG. 5).
  • Example 1 50 ⁇ g of purified CK17-D1 antigen or CK17-D3 obtained in Example 1 was added to an Immunosorb tube (Nunc 470319) in 4 ml of coating buffer [coating buffer; 1.59 g of Na 2 CO 3 (sigma, S7795), 2.93 g of NaHCO 3 (sigma, S8875), NaN 3 (sigma, S2002), 0.2 g] and coated with a rotator at 4 ° C. for about 16 hours. After dissolving in PBS for 2 hours at skim milk [(BD, 232100) -4% in 1XPBS] was blocked in the immunotube (immunotube).
  • coating buffer coating buffer; 1.59 g of Na 2 CO 3 (sigma, S7795), 2.93 g of NaHCO 3 (sigma, S8875), NaN 3 (sigma, S2002), 0.2 g
  • a single phage antibody (# 38) prepared according to the embodiment of the present invention which specifically binds to the WW45 antigen related to the developmental process not related to cytokeratin 17, was used as a control.
  • the culture cells were centrifuged (4500 rpm, 15 min, 4 ° C.) and the supernatant (panned poly scFv-phage) was transferred to a new tube.
  • 100 ng of cytokeratin17 antigen was coated on 96-well immune plate (NUNC 439454) with a coating buffer solution at 4 ° C. for 16 hours, and then each well was prepared using skim milk (4%) dissolved in PBS. Blocked.
  • OPD tablets (Sigmap 8787-TAB) were added with PC buffer [C 6 H 8 O 7 .H 2 O (sigma, C0706) 5.1 g, Na 2 HPO 4 (sigma). , S7907) 7.3 g] was prepared in a substrate solution dissolved in 100 ⁇ l per well and developed for 10 minutes and the absorbance at 490 nm was measured with a Spectrophotometer (Molecular Device, USA).
  • Colonies obtained from the high-binding polyclonal phage antibody group contained 2 ml of YTCM, 2% glucose, and 1 ml of 5 mM MgCl 2 medium.
  • a 96-deep well plate (Bionia 90030), incubated for 16 hours at 37 ° C. Take 100-200 ⁇ l so that the OD 600 value of the cultured cells was 0.1 and 1 ml of 2 ⁇ YTCM, 2% glucose, 5 mM. Diluted in MgCl 2 medium, and then incubated in 96-deep well plate for 2 to 3 hours at 37 ° C.
  • M1 helper phages were infected with a MOI of 1:20, followed by 2 ⁇ .
  • YTCMK, 5 mM MgCl 2 , 1 mM IPTG medium was incubated for 16 hours at 30 ° C.
  • the cultured cells were centrifuged (4500 rpm, 15 minutes, 4 ° C.), and then the supernatant was taken out of 4% PEG 6000 and 3% NaCl.
  • CK17-D1 and CK17-D3 antigens were put into 96-well immune plates and coated at 4 ° C. for 16 hours, and then each well was blocked using skim milk (4%) dissolved in PBS.
  • Each well was washed with 0.2 ml of PBS-tween20 (0.05%), and 100 ⁇ l of monoclonal scFv-phage (each 100 scFv-phage) obtained by the above method was added to each well and reacted at room temperature for 2 hours. .
  • each well was washed four times with 0.2 ml of PBS-tween20 (0.05%), and the second antibody, anti-M13-HRP, was diluted to 1/2000 and reacted at room temperature for 1 hour. After washing with 0.2 ml of PBS-tween 20 (0.05%), color development was measured at 490 nm.
  • the colony PCR product was confirmed on 1% agarose gel (Seakem LE, CAMERES 50004), and 0.2 ⁇ l of Bst NI (Roche11288075001, 10 U / ⁇ l) was added and reacted at 37 ° C. for 2-3 hours.
  • the reaction conditions are shown in Table 5 below.
  • the cleaved product was identified on an 8% DNA polyacrylamide gel.
  • VH3-23 three VH3-53, VH3-72, VH3-7 and VH1-46 each contained one.
  • the light chain two lambda ( ⁇ ) -chains and two kappa ( ⁇ ) -chains were used.
  • the amino acid sequences used in CDR3 of the heavy and light chains of the respective human antibodies were analyzed and confirmed to have different sequences.
  • the ovarian cancer cell line SKOV3 (ATCC HTB-77) overexpressed CK17 in a 100 mm plate was washed twice with PBS and then incubated at 37 ° C. for 10 minutes with the addition of reactive bovine PBS based-dissociation buffer (Gibco). Thereafter, the cells were collected with a scraper, centrifuged at 1300 rpm for 3 minutes, the pellet was washed twice with 2% PBF (1XPBS containing 2% FBS) solution, and then resuspended in 2% PBF solution. Prepared at a concentration of x10 5 cells. 100 ⁇ l of the monoclonal phage antibody of the present invention was concentrated 10 times with PEG and diluted to 1/2 to mix the cells.
  • mice anti-CK17 antibody Anti KRT17; Cat #: MAB1677: Chemicon, USA
  • normal mouse IgG normal mouse IgG was used as a negative control.
  • the supernatant was removed by centrifugation for 3 minutes at 4 °C at 1300 rpm.
  • 100 ⁇ l of anti-g8p antibody (Abcam) diluted 1: 200 was added to the 2% PBF solution, mixed well, and reacted on ice for 30 minutes. After centrifugation at 4 ° C.
  • a monoclonal phage antibody that specifically recognizes and binds to CK17 in CK17 overexpressed ovarian cancer cell line was selected.
  • D1-1B2 for CK17-D1, D3-5C, D3-9D, and D3-12F for CK17-D3 were selected.
  • D1-1F for CK17-D1, D3-6G and D3-12E for CK17-D3, etc. were also selected, but the results are not described separately.
  • the heavy chain was prepared with 1 ⁇ l of monoclonal DNA and 10 pmole / ⁇ l heavy chain forward and heavy chain reverse primers from Table 8, 5 ⁇ l of 10X buffer, 10 mM dNTP mix 1 Colony PCR (iCycler iQ, BIO-RAD) was performed by mixing ⁇ l, 0.5 ⁇ l of pfu DNA polymerase (solvent, 2.5 U / ⁇ l) and distilled water. Also, light chains colony PCR was performed in the same manner using the light chain forward and reverse primers of Table 8.
  • the heavy chain gene obtained from the PCR was purified by DNA-gel extraction kit (Qiagen), and then 1 ⁇ l (10 ng) of pNATAB H vector (Fig. 17), 15 ⁇ l of heavy chain (100-200 ng), 2 ⁇ l of 10 ⁇ Buffer, 1 ⁇ l of Ligase (1 U / ⁇ l) and distilled water were mixed and left at room temperature for 1 to 2 hours to connect with the vector.
  • the vector was allowed to stand on ice with transformed cells (XL1-blue) for 30 minutes, and then transduced with heat shock at 42 ° C. for 90 seconds. After standing again on ice for 5 minutes, 1 ml of LB medium was injected and incubated at 37 ° C. for 1 hour.
  • the light chain was extracted DNA by the same method using the pNATAB L vector (Fig. 18).
  • the four full-form IgGs were purified using a protein A-affinity chromatography column (Pharmacia, GE, USA) (FIG. 15), followed by the method of Example 4-1. Binding to CK17 was confirmed by FACS compared to the commercially purchased anti CK17 antibody (Anti-KRT17) (FIGS. 16A and 16B). At this time, using the purified D1-1B2 antibody Herceptin (Herceptin, Roche, Switzerland) as a control, the results of comparing the quality under reduced and non-reduced conditions by the SDS-PAGE method is shown in Figure 16c.
  • Herceptin Herceptin, Roche, Switzerland
  • each antibody showed specificity for each antigen as expected, and the anti-CK17 antibody bound only to CK17-D1 as compared to CK17-D3, from which the CK17-D2 site was specific. Recognition was limited.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Optics & Photonics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 사이토케라틴17(Cytokeratin17)-특이적인 인간항체에 관한 것으로, 구체적으로 사이토케라틴17에 특이적으로 결합하는 인간으로부터 유도된 상보성 결정 영역(complementarity determining region, CDR)과 프레임 워크 영역(framework region, FR)으로 구성된 인간 항체에 관한 것이다. 본 발명의 사이토케라틴17에 특이적인 인간 항체는 상기 사이토케라틴17이 과발현되는 암질환의 진단, 질환의 분류, 영상화, 치료 및 예후 판정 등에 이용될 수 있다.

Description

사이토케라틴１７-특이적인 인간항체
본 발명은 사이토케라틴17(Cytokeratin17)-특이적인 인간항체에 관한 것이다.
사이토케라틴(Cytokeratin: CK)은 세포골격 필라멘트 단백질(cytoskeleletal filament protein)로, 약 20종의 아형(subtypes)이 다양한 형태의 인간의 상피세포(epithelial cells)에서 발현되는 것으로 현재까지 보고되고 있다. 상기 CK는 40 KDa와 68 KDa사이의 분자량과 4.9-7.8 사이의 등전(isoelectric) pH의 범위에 있고, 인간 CK의 각각은 1부터 20까지 숫자화되어 있다. 인체의 다양한 상피 내에서 성숙(maturation)이나 분화(differentiation)의 정도와 관련된 CK를 발현한다. CK 아이소타입(isotype)은 세포질에서 CK의 위치(localization)와 세포유형(cell type)에 의존하여 결정된다. 서로 다른 CK 형태들은 분자량뿐만 아니라 그들이 산성형(acidic type) 또는 염기형(basic type) 인지에 따라 다양한 CK가 인체를 통틀어 여러 종류의 상피 사이에 다르게 분포되어 있다. CK 아형의 발현 양상은 다른 형태의 상피성 암종(epithelial malignancies)의 특징에서 증가하는 정도로 사용되기도 한다. 또한, 세포질 분자(cytoplasmic molecules)인 CK는 HSP70(heat shock protein 70)과 마찬가지로 여러 가지 암세포의 표면에서 과발현되고 일부는 나쁜 예후과 관련되어 있다는 점에서 현재 주목받고 있다. 사이토케라틴17의 경우, 유방암을 비롯하여 자궁암, 피부암 등과 같은 다양한 암에서의 과발현되고 있어 바이오마커로서의 가능성이 대두하고 있으나 아직 이에 대한 구체적인 증거는 미미하다.
최근의 여러 보고에 따르면, 자궁의 예비 세포(reserve cells)의 마커인 사이토케라틴 17이 사이토케라틴 8과 함께 자궁경부 상피내 종양(uterine cervical intraepithelial neoplasia, CIN) 진단의 가치있는 마커이고, 이들의 면역염색은 CIN의 증가한 병변 등급(increasing lesion grade)과 관련된 것을 보고 하고 있다(Ikeda K et al., Gynecol Oncol.108(3):598-602, 2008). 또한, 사이토케라틴17은 화생(metaplasia)을 일으키고(Martens JE et al., Anticancer Res. 24:771-775, 2004), 미성숙 이형성 편평 상피세포(immature metaplastic squamous epithelium)에서 발현된다고 알려져 있다(Smedts F et al., Obstet. Gynecol. 82:465-474, 1993). 또한, 구강 편평암 세포(oral squamous cancer cells)에서 CK17의 RT-PCR결과 바이오마커로서의 가능성이 대두하고 있으며, 췌담관선암(pancreaticobiliary adenocarcinoma)에서 CK17 고발현이 보고되고 있으나(Sarbia M et al., Am J Clin Pathol. 128(2):255-259, 2007), 이에 대한 연구가 부족하여 자세한 기작이 알려져 있질 않다.
비록 정상적인 세포 내에서 발견되고 있는 중간미세섬유(intermediate filaments)인 사이토케라틴들인 CK-5/6, CK-14와 CK-17등이 유방암과 같은 종양에서 과발현되어 나타나는 정확한 기원에 대해선 알려져 있지 않더라도, 일반적으로 이러한 종양들이 높은 등급(high grade)과 단계(stage) 및 나쁜 예후 등과 관련되어 있으나(Gusterson B et al., Breast Cancer Res 7:143-148, 2005), 이러한 기저형태(basal phenotypes)들의 독립적인 예후판정(prognostic significance)에 대해선 아직도 상반되는 결과들이 보고되어 논란이 되고 있다(Foulkes W et al., Cancer Res 64:830-835, 2004). 현재 사이토케라틴 항체들은 세포병리학(cytopathology)과 유세포분석(flow cytometric assays)에서 유용한 도구로 사용될 뿐만 아니라 조직 절편(tissue sections)에서 면역조직화학분석을 사용한 종양의 여러 진단법에서 보조적으로 사용되기도 한다.
이에, 본 발명자들은 사이토케라틴17에 특이적으로 결합하는 7종의 인간 항체를 선별하고, 상기 인간 항체가 사이토케라틴17이 발현된 암세포주 내 사이토케라틴17에 대한 결합능 및 특이성을 가지는 것을 확인하고, 본 발명의 인간 항체가 사이토케라틴17 과발현 암질환의 치료에 효과적으로 이용될 수 있음을 제시함으로써 본 발명을 완성하였다.
본 발명의 목적은 중쇄와 경쇄의 상보성 결정 영역(CDR) 부분을 변화시켜 사이토케라틴17(Cytokeratin17)에 특이적인 인간 항체를 제공하는 것이다. 또한, 가장 상보성이 높은 사이토케라틴17에 특이적인 항체를 대량 생산할 수 있는 벡터 및 상기 사이토케라틴17에 특이적인 인간항체를 이용하여 암질환 치료 및 예방용 조성물을 제공하는데 있다.
상기 기술적 과제를 해결하기 위하여,
본 발명은 사이토케라틴17(Cytokeratin17)에 특이적인 인간 항체를 제공한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 단편을 암호화하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드 및 인간 중쇄의 불변영역을 포함하는 발현벡터를 제공한다.
또한, 본 발명은 상기 인간 항체의 경쇄 또는 그의 단편을 암호화하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드 및 인간 경쇄의 불변영역을 포함하는 발현벡터를 제공한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 인간 항체의 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터, 및 경쇄 또는 그의 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 동시에 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 형질전환체를 배양하여 사이토케라틴17에 특이적인 인간 항체를 제조하는 방법을 제공한다.
또한, 본 발명은 상기 인간 항체를 포함하는, 사이토케라틴17이 과발현되는 암질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 인간 항체 및 치료용 방사선 동위원소를 포함하는 사이토케라틴17이 과발현되는 암질환의 방사선면역 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 상기 인간 항체를 개체에 투여하는 단계를 포함하는 사이토케라틴17이 과발현되는 암질환을 예방 또는 치료하는 방법을 제공한다.
또한, 본 발명은 상기 인간 항체, 인간 항체의 경쇄 또는 중쇄, 또는 그의 단편의 진단적 유효량을 포함하는 사이토케라틴17이 과발현되는 암질환의 검출용 조성물을 제공한다.
또한, 본 발명은 상기 검출용 조성물을 암세포와 접촉하는 단계를 포함하는 시험관 내 사이토케라틴17이 과발현되는 암의 면역검출 방법을 제공한다.
또한, 본 발명은 상기 암의 검출용 조성물의 진단적 유효량을 개체에 투여하는 단계를 포함하는 생체내 사이토케라틴17이 과발현되는 암의 영상화 방법을 제공한다.
또한, 본 발명은 상기 검출용 조성물을 이용하는 사이토케라틴17이 과발현되는 암의 생체내 치료 방법을 제공한다.
아울러, 본 발명은 상기 검출용 조성물을 이용하는 사이토케라틴17이 과발현되는 암 치료의 예후 평가 방법을 제공한다.
본 발명의 사이토케라틴17에 특이적인 인간 항체는 상기 사이토케라틴17이 과발현되는 암질환의 진단, 질환의 분류, 영상화, 치료 및 예후 판정 등에 이용될 수 있다.
도 1은 사이토케라틴17 단백질의 소수성 분석 결과를 나타낸 도이다.
도 2는 발현 조건에 따른 CK17-D1의 발현량을 SDS-PAGE로 비교한 결과를 나타낸 도이다.
도 3은 정제된 CK17-D1을 SDS-PAGE로 확인한 결과를 나타낸 도이다.
도 4는 발현 조건에 따른 CK17-D3의 발현량을 SDS-PAGE로 비교한 결과를 나타낸 도이다.
도 5는 정제된 CK17-D3를 SDS-PAGE로 확인한 결과를 나타낸 도이다.
도 6은 패닝 단계에서의 CK17-D1에 대한 파아지 항체 탐색 결과를 나타낸 도이다.
도 7은 패닝 단계에서의 CK17-D3에 대한 파아지 항체 탐색 결과를 나타낸 도이다.
도 8은 인간 CK17 단일 파아지 클론 항체 다양성(CK17-D1)을 핑거프린팅을 통해 확인한 결과를 나타낸 도이다.
도 9은 인간 CK17 단일 파아지 클론 항체 다양성(CK17-D3)을 핑거프린팅을 통해 확인한 결과를 나타낸 도이다.
도 10은 CK17-D1에 대한 인간 CK17 단일 파아지 클론 항체의 CDR에서 폴리펩티드를 분석한 결과를 나타낸 도이다.
도 11는 CK17-D3에 대한 인간 CK17 단일 파아지 클론 항체의 중쇄의 CDR에서 폴리펩티드를 분석한 결과를 나타낸 도이다.
도 12는 CK17-D3에 대한 인간 CK17 단일 파아지 클론 항체의 경쇄의 CDR에서 폴리펩티드를 분석한 결과를 나타낸 도이다.
도 13은 인간 CK17 단일클론 항체의 결합 특이성을 비교한 결과를 나타낸 도이다:
a: CK17-D1; 및,
b: CK17-D3.
도 14은 전체 IgG로의 전환을 웨스턴 블랏팅으로 확인한 결과를 나타낸 도이다.
도 15는 정제된 전체 IgG를 SDS-PAGE로 확인한 결과를 나타낸 도이다:
a: D3-5C, D3-9D; 및,
b: D3-12F, D1-1B2.
도 16은 정제된 전체 IgG의 결합 특이성을 비교한 결과를 나타낸 도이다:
a: 항 KRT17;
b: D1-1B2; 및,
c: 품질비교.
도 17은 pNATAB H 벡터의 개열지도를 나타낸 도이다.
도 18은 pNATAB L 벡터의 개열지도를 나타낸 도이다.
상기 목적을 달성하기 위해서, 본 발명은 서열번호 24 내지 30으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 중쇄 상보성 결정영역(이하, HCDR) 1, 서열번호 31 내지 37로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 HCDR 2 및 서열번호 38 내지 44로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 HCDR 3을 포함하는 중쇄 가변영역(VH)을 포함하는 중쇄 또는 그의 단편; 및,
서열번호 45 내지 50으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 경쇄 상보성 결정영역(이하, LCDR) 1, 서열번호 51 내지 57로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 LCDR 2 및 서열번호 58 내지 64로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 LCDR 3을 포함하는 경쇄 가변영역(VL)을 포함하는 경쇄 또는 그의 단편을 포함하는 사이토케라틴17(Cytokeratin17)에 특이적인 인간 항체를 제공한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 발현벡터를 제공한다.
또한, 본 발명은 상기 인간 항체의 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 발현벡터를 제공한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 인간 항체의 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터, 및 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 동시에 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 형질전환체를 배양하여 사이토케라틴17에 특이적인 인간 항체를 제조하는 방법을 제공한다.
또한, 본 발명은 상기 인간 항체를 포함하는, 사이토케라틴17이 과발현되는 암질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 인간 항체 및 치료용 방사선 동위원소를 포함하는 사이토케라틴17이 과발현되는 암질환의 방사선면역 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 상기 인간 항체를 사이토케라틴17이 과발현되는 암질환에 걸린 개체에 투여하는 단계를 포함하는 사이토케라틴17이 과발현되는 암질환을 치료하는 방법을 제공한다.
또한, 본 발명은 상기 인간 항체, 인간 항체의 경쇄 또는 중쇄, 또는 그의 면역학적으로 활성을 가진 단편의 진단적 유효량을 포함하는 사이토케라틴17이 과발현되는 암질환의 검출용 조성물을 제공한다.
또한, 본 발명은 상기 검출용 조성물을 암세포와 접촉하는 단계를 포함하는 시험관 내 사이토케라틴17이 과발현되는 암의 면역검출 방법을 제공한다.
또한, 본 발명은 1) 상기 검출용 조성물의 진단적 유효량을 개체에 투여하는 단계; 및,
2) 상기 개체에 대한 검출영상을 수득하는 단계를 포함하는 생체내 사이토케라틴17이 과발현되는 암의 영상화 방법을 제공한다.
또한, 본 발명은
1) 상기 검출용 조성물을 개체의 정맥내 투여하는 단계;
2) 상기 단계 1)의 조성물을 검출하여 종양 세포를 확인하는 단계;
3) 단계 2)에서 확인된 종양 세포를 수술적 절제에 의해 제거하는 단계를 포함하는 사이토케라틴17이 과발현되는 암의 생체내 치료 방법을 제공한다.
아울러, 본 발명은
1) 상기 검출용 조성물을 종양 세포가 제거된 환자의 정맥내 투여하는 단계;
2) 상기 단계 1)의 조성물을 검출하여 종양 세포를 확인하는 단계;
3) 단계 2)에서 종양 세포가 검출되지 않으면, 종양 세포가 모두 제거된 것으로 판단하는 것을 특징으로 하는 사이토케라틴17이 과발현되는 암 치료 환자의 예후 평가 방법을 제공한다.
이하, 본 발명에서 사용한 용어를 설명한다.
"가변영역"이란 항원과 특이적으로 결합하는 기능을 수행하면서 서열상의 많은 변이를 보이는 항체 분자의 부분을 의미하고, 가변영역에는 CDR1, CDR2 및 CDR3가 존재한다. 상기 CDR 사이에는 프레임 워크 영역(framework region, FR) 부분이 존재하여 CDR 고리를 지지해주는 역할을 한다.
"상보성 결정 영역"은 항원의 인식에 관여하는 고리모양의 부위로서 이 부위의 서열이 변함에 따라 항체의 항원에 대한 특이성이 결정된다.
"패닝(panning)"은 파아지의 외벽(coat)에 펩타이드를 발현(display)하는 파아지 라이브러리로부터, 표적 분자(항체, 효소, 세포표면 리셉터 등)와 결합하는 성질을 지닌 펩타이드를 표면에 발현하고 있는 파아지만을 선택해 내는 과정을 일컫는다.
이하, 본 발명을 상세히 설명한다.
본 발명은 서열번호 24 내지 30으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 중쇄 상보성 결정영역(이하, HCDR) 1, 서열번호 31 내지 37로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 HCDR 2 및 서열번호 38 내지 44로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 HCDR 3을 포함하는 중쇄 가변영역(VH)을 포함하는 중쇄 또는 그의 단편; 및,
서열번호 45 내지 50으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 경쇄 상보성 결정영역(이하, LCDR) 1, 서열번호 51 내지 57로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 LCDR 2 및 서열번호 58 내지 64로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 LCDR 3을 포함하는 경쇄 가변영역(VL)을 포함하는 경쇄 또는 그의 단편을 포함하는 사이토케라틴17에 특이적인 인간 항체를 제공한다.
바람직하게는, 상기 중쇄 가변영역은 서열번호 10 내지 16으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖고, 상기 경쇄 가변영역은 서열번호 17 내지 23으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는다.
상기 항체는 전체(whole) 항체 형태일 뿐 아니라 항체 분자의 기능적인 단편을 포함한다. 전체 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조이며 각각의 경쇄는 중쇄와 다이설파이드 결합으로 연결되어 있다. 항체 분자의 기능적인 단편이란 항원 결합 기능을 보유하고 있는 단편을 뜻하며, 항체 단편의 예는 (i) 경쇄의 가변역역(VL) 및 중쇄의 가변영역(VH)과 경쇄의 불변역역(CL) 및 중쇄의 첫번째 불변 영역(CH1)으로 이루어진 Fab 단편; (ii) VH 및 CH1 도메인으로 이루어진 Fd 단편; (iii) 단일 항체의 VL 및 VH 도메인으로 이루어진 Fv 단편; (iv) VH 도메인으로 이루어진 dAb 단편(Ward ES et al., Nature 341:544-546 (1989)]; (v) 분리된 CDR 영역; (vi) 2개의 연결된 Fab 단편을 포함하는 2가 단편인 F(ab')2 단편; (vii) VH 도메인 및 VL 도메인이 항원 결합 부위를 형성하도록 결합시키는 펩타이드 링커에 의해 결합된 단일쇄 Fv 분자(scFv); (viii) 이특이적인 단일쇄 Fv 이량체(PCT/US92/09965) 및 (ix) 유전자 융합에 의해 제작된 다가 또는 다특이적인 단편인 디아바디(diabody) WO94/13804) 등을 포함한다.
본 발명에서는 사이토케라틴17에 대한 인간 항체를 파지 표출 기술(Phage Display Technology)을 이용하여 scFv 형태로 수득하였으며, 단일 파지 클론(mono phage clone) 형태로 스크리닝(screening)함으로써 사이토케라틴17에 특이적인 7종의 단일 클론 파아지(monoclone phage)를 수득하였다.
본 발명의 구체적인 실시예에서 재조합 기술로 수득한 사이토케라틴17(도 1 내지 도 5 참조)을 단일클론 항체의 제조에 이용하였다. 상기 사이토케라틴17을 다양성을 가진 인간 유래 scFv 라이브러리 세포(human naive scFv library cell)로부터 제조한 라이브러리 파지와 반응하여 패닝(panning)시킨 후, 사이토케라틴17 항원에 강하게 결합하는 단일 클론을 스크리닝(screening)하였다(표 1 내지 3 및 도 6 및 7 참조). 상기 선별된 단일 클론들을 핑거프린팅(fingerprinting)으로 확인한 후(도 8 및 9 참조), 각각의 서열을 분석하여 항체의 VH와 VL의 CDR 부위(region)를 확인하였다(표 6 및 도 10, 11 참조). 상기 항체와 생식 계열(germ line) 항체군의 유사성을 NCBI의 Ig BLAST 프로그램(//www.ncbi.nlm.nih.gov/igblast/)을 이용하여 확인한 결과(표 7 참조), 7종의 사이토케라틴17에 특이적인 파아지 항체를 얻었다. 상기 선별된 단일 클론 항체는 CK17이 과발현된 난소암 세포주에서 CK17을 특이적으로 인식하고 결합할 수 있었다(도 13 참조).
또한, 본 발명의 구체적인 실시예에서는 단일 클론 파아지의 경쇄 및 중쇄를 암호화하는 유전자를 수득하여 각각 벡터에 연결한 후, 상기 발현벡터를 동시에 숙주세포에 도입하여 발현된 전체 IgG 형태의 인간 항체를 확인하였다(도 14 참조). 상기 인간 항체를 수득하여(도 15 참조), SKOV3 세포주에서 상기 전체 항체의 CK17에 대한 결합력(도 16 참조) 및 특이성(표 9 참조)을 확인하였다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 발현벡터를 제공한다.
또한, 본 발명은 상기 인간 항체의 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 발현벡터를 제공한다.
본 발명의 구체적인 실시예에서 재조합 기술로 수득한 사이토케라틴17(도 1 내지 도 5 참조) 및 인간 유래 scFv 라이브러리 세포로부터 제조한 라이브러리 파지를 이용하여, 사이토케라틴17 항원에 강하게 결합하는 단일 클론을 스크리닝하였다(표 1 내지 3 및 도 1 내지 6 참조). 상기 선별된 단일 클론들을 분류한 후, 서열을 분석하여 7종의 사이토케라틴17에 특이적인 파아지 항체를 얻었고(도 8 내지 12 및 표 6 및 7 참조), 상기 선별된 단일 클론 항체는 CK17이 과발현된 난소암 세포주에서 CK17을 특이적으로 인식하고 결합하는 것을 확인하였다(도 13 참조). 이후, 상기 단일 클론 항체의 경쇄 및 중쇄를 발현하기 위한 벡터가 도입된 숙주세포로부터 전체 IgG 형태의 인간 항체를 수득한 후(도 14 및 도 15 참조), SKOV3 세포주에서 상기 전체 항체의 CK17에 대한 결합력(도 16 참조) 및 특이성(표 9 참조)을 확인하였다.
본 발명의 인간 항체의 경쇄 및 중쇄 또는 그의 단편을 암호화하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 인간 항체의 경쇄 및 중쇄 또는 그의 단편을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 인간 항체의 경쇄 및 중쇄 또는 그의 단편의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있고, 코딩영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있으며, 그러한 변형 유전자 역시 본 발명의 범위에 포함됨을 당업자는 잘 이해할 수 있을 것이다. 즉, 본 발명의 폴리뉴클레오티드는 이와 동등한 활성을 갖는 단백질을 코딩하는 한, 하나 이상의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함된다. 이러한 폴리뉴클레오티드의 서열은 단쇄 또는 이중쇄일 수 있으며, DNA 분자 또는 RNA(mRNA)분자일 수 있다.
상기 발현벡터의 제작 시에는, 상기 인간 항체의 경쇄 및 중쇄 또는 그의 단편을 생산하고자 하는 숙주세포의 종류에 따라 프로모터(promoter), 종결자(terminator), 인핸서(inhancer) 등과 같은 발현조절 서열, 막 표적화 또는 분비를 위한 서열 등을 적절히 선택하고 목적에 따라 다양하게 조합할 수 있다.
본 발명의 발현벡터는 플라스미드 벡터, 코즈미드 벡터, 박테리오 파아지 벡터 및 바이러스 벡터 등을 포함하나 이에 제한되지 않는다. 적합한 발현벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널 및 인핸서 같은 발현 조절 엘리먼트 외에도 막 표적화 또는 분비를 위한 시그널 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다. 발현벡터의 프로모터는 구성적 또는 유도성일 수 있다. 상기 시그널 서열에는 숙주가 에쉐리키아속(Escherichia sp.)균인 경우에는 PhoA 시그널 서열, OmpA 시그널 서열 등이, 숙주가 바실러스속(Bacillus sp.)균인 경우에는 α-아밀라아제 시그널 서열, 서브틸리신 시그널 서열 등이, 숙주가 효모(yeast)인 경우에는 MFα 시그널 서열, SUC2 시그널 서열 등이, 숙주가 동물세포인 경우에는 인슐린 시그널 서열, α-인터페론 시그널 서열, 항체 분자 시그널 서열 등을 이용할 수 있으나, 이에 제한되지 않는다. 또한 발현벡터는 벡터를 함유하는 숙주 세포를 선택하기 위한 선택 마커를 포함할 수 있고, 복제 가능한 발현벡터인 경우 복제 기원을 포함한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 인간 항체의 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
또한, 본 발명은 상기 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터, 및 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 암호화하는 폴리뉴클레오티드를 포함하는 발현벡터를 동시에 숙주세포에 도입하여 제조된 형질전환체를 제공한다.
본 발명의 구체적인 실시예에서는 사이토케라틴17에 특이적인 인간 유래 단일 클론 파아지의 경쇄 및 중쇄를 암호화하는 유전자를 수득하여 각각 벡터에 연결한 후, 상기 발현벡터를 동시에 숙주세포에 도입하여 발현된 전체 IgG 형태의 인간 항체를 확인하였다. 상기 인간 항체를 수득하여, 사이토케라틴17에 대한 결합능(도 16 참조) 및 특이성(표 9 참조)을 확인하였다.
본 발명에 따른 상기 발현벡터를 적절한 숙주 세포, 예를 들어, 대장균 또는 효모 세포 등에 형질전환시킨 후, 형질전환된 숙주세포를 배양함으로써 본 발명에 따른 인간 항체의 경쇄 및 중쇄 또는 그의 단편을 대량 생산할 수 있다. 숙주세포의 종류에 따른 적절한 배양 방법 및 배지 조건 등은 당해 분야의 통상의 기술자에게 알려진 공지 기술로부터 당업자가 용이하게 선택할 수 있다. 상기 숙주세포는 대장균(E. coli) 또는 바실러스 서브틸러스(Bacillus subtilis)와 같은 원핵 생물일 수 있다. 또한, 사카로마이세스 세르비시아(Saccharomyces cerevisiae)와 같은 효모, 곤충 세포, 식물 세포, 동물 세포로부터 유래한 진핵 세포일 수 있다. 더욱 바람직하게는, 상기 동물 세포는 자가 또는 동종 이계 동물 세포일 수 있다. 자가 또는 동종 이계 동물 세포에 도입하여 제조된 형질전환체는 개체에 투여되어 암을 치료하는 세포치료 등에 이용될 수도 있다. 상기 숙주세포로의 발현벡터 도입방법은 당업자에게 공지된 어느 방법을 사용해도 무방하다.
또한, 본 발명은 상기 형질전환체를 배양하여 사이토케라틴17에 특이적인 인간 항체를 제조하는 방법을 제공한다.
구체적으로,
1) 상기 형질전환체를 배양하는 단계; 및
2) 상기 배양액으로부터 상기 인간 항체를 정제하는 단계를 포함하는 사이토케라틴17 에 특이적인 인간 항체의 제조방법을 제공한다.
상기 배양 배지로는 당업자에게 공지된 배양 배지 중 형질전환체에 적합한 배지를 선택하여 이용하는 것이 바람직하다. 상기 항체 정제 방법은 당업자에게 공지된 어떠한 정제 방법도 사용 가능하다.
본 발명의 구체적인 실시예에서는 사이토케라틴17에 특이적인 인간 유래 단일 클론 파아지의 경쇄 및 중쇄를 암호화하는 유전자를 수득하여 각각 벡터에 연결한 후, 상기 발현벡터를 동시에 숙주세포에 도입하여 발현된 전체 IgG 형태의 인간 항체를 확인하였다. 상기 인간 항체를 수득하여, 사이토케라틴17에 대한 결합능(도 16 참조) 및 특이성(표 9 참조)을 확인하였다.
또한, 본 발명은 상기 인간 항체를 포함하는, 사이토케라틴17이 과발현되는 암질환의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 사이토케라틴17이 과발현되는 암질환은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않고 사이토케라틴17이 과발현되는 암은 모두 가능하다.
본 발명의 구체적인 실시예에서, 사이토케라틴17에 대한 결합능 및 특이성을 나타낸 단일클론 항체는 사이토케라틴17가 과발현된 암질환의 예방 또는 치료용 조성물로 유용하게 이용될 수 있다.
본 발명의 약학적 조성물은 상기 사이토케라틴17에 특이적인 인간 항체 또는 상기 형질전환체를 선택적으로 함유할 수 있으며, 상기 성분에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 또한, 본 발명의 약학적 조성물의 투여를 위해서 상기에 기재된 유효성분 이외에 추가로 약제학적 허용 가능한 담체를 1종 이상 포함하여 제조할 수 있다. 예를 들면, 약제학적으로 허용 가능한 담체로는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올, 리포좀 및 이들 성분 중 하나 이상의 성분을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액 및 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액 및 유탁액 등과 같은 주사용 제형으로 제제화할 수 있으며, 표적 세포에 특이적으로 작용할 수 있도록 표적 세포에 특이적인 항체 또는 기타 리간드를 상기의 담체와 함께 결합시켜 사용할 수 있다. 아울러, 당해 기술분야의 적정한 방법 또는 레밍턴의 문헌(Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA)에 게재되어 있는 방법 등을 이용하여 각 질환 또는 성분에 따라 바람직하게 제제화할 수 있다.
본 발명의 약학적 조성물은 비경구로 투여할 수 있으며, 비경구 투여는 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내 주사 주입방식에 의한다. 비경구 투여용 제형으로 제제화하기 위해서는 본 발명의 약학적 조성물은 안정제 또는 완충제와 함께 혼합하여 용액 또는 현탁액으로 제조하고 이를 앰플 또는 바이알의 단위 투여형으로 제제화한다.
본 발명의 약학적 조성물은 투여 경로에 따라 다양한 형태로 제조할 수 있다. 예를 들면, 본 발명의 약학적 조성물은 주사용도에 적합한 멸균 수용액 또는 분산액의 형태로 제조될 수 있거나, 또는 동결-건조 기술을 이용하여 냉동건조된 형태로 제조될 수 있다. 냉동건조된 약학적 조성물은 전형적으로 약 4℃에서 유지되며, 보조제를 함유하거나 함유하지 않은 안정화 용액, 예를 들면, 식염수 또는/및 HEPES에 의해 복원될 수 있다.
본 발명의 방법을 실시하는데 있어서, 투여될 약학적 조성물의 양에 영향을 미치는 인자들로는, 이에 한정되는 것은 아니지만 투여 방식, 투여 빈도, 치료가 진행 중인 특정 질병, 질병의 심각성, 질병의 병력, 개체가 다른 치료제와 함께 협력 치료법이 진행중인 지의 여부, 및 치료가 진행중인 개체의 연령, 키, 체중, 건강, 및 신체 조건을 포함한다. 일반적으로 치료가 진행중인 환자의 체중이 증가할 수록 본 발명의 약학적 조성물을 더 많은 양으로 투약하는 것이 바람직하다.
또한, 본 발명은 상기 인간 항체 및 치료용 방사선 동위원소를 포함하는 사이토케라틴17이 과발현되는 암질환의 방사선면역 치료용 약학적 조성물을 제공한다.
상기 사이토케라틴17이 과발현되는 암질환은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않고 사이토케라틴17이 과발현되는 암은 모두 가능하다.
바람직한 치료용 방사선 동위원소의 예로는 3H, 11C, 14C, 18F, 64Cu, 76Br, 86Y, 99mTc, 111In, 123I, 177Lu 및 이들의 혼합물 및 조합을 포함한다. 상기 치료용 방사선 동위원소는 인간 항체와 결합되거나 인간 항체가 결합된 운반체에 포함되는 것을 특징으로 한다.
또한, 본 발명은 약학적으로 유효한 양의 상기 인간 항체를 사이토케라틴17이 과발현되는 암질환에 걸린 개체에 투여하는 단계를 포함하는 사이토케라틴17이 과발현되는 암질환을 치료하는 방법을 제공한다.
상기 사이토케라틴17이 과발현되는 암질환은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않고 사이토케라틴17이 과발현되는 암은 모두 가능하다.
본 발명의 구체적인 실시예에서, 사이토케라틴17에 대한 결합능 및 특이성을 나타낸 단일클론 항체는 사이토케라틴17가 과발현된 암질환의 치료에 유용하게 이용될 수 있다.
본 발명이 적용가능한 개체는 척추동물이고 바람직하게는 포유동물이며, 그보다 바람직하게는 쥐, 토끼, 기니아피그, 햄스터, 개, 고양이와 같은 실험동물이고, 가장 바람직하게는 침팬지, 고릴라와 같은 유인원류 동물이다.
본 발명의 인간 항체의 투여방법은 사용목적에 따라 비경구 투여(예를 들면, 정맥 내, 피하, 복강 내 또는 국소 등에 투여하는 방법)로 할 수 있으며, 바람직하게는 정맥 투여가 바람직하다. 경우에 따라 고형암에 대한 투여에서는 항체의 접근을 빠르고 용이하게 하기 위하여 국부적인 투여가 바람직할 수도 있다. 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다. 1회 투여량은 약 5 내지 500 ㎎/m2의 양으로 일 단위 또는 주 단위로 투여될 수 있다. 상기 유효량은 상기 환자를 치료하는 의사의 재량에 따라 조절될 수 있다.
본 발명의 인간 항체는 암환자의 치료를 위하여 단독 또는 수술, 호르몬 치료, 약물 치료 및 생물학적 반응 조절제와 병행하여 사용될 수 있다.
또한, 본 발명은 상기 인간 항체, 인간 항체의 경쇄 또는 중쇄, 또는 그의 면역학적으로 활성을 가진 단편의 진단적 유효량을 포함하는 사이토케라틴17이 과발현되는 암질환의 검출용 조성물을 제공한다.
상기 사이토케라틴17이 과발현되는 암질환은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않고 사이토케라틴17이 과발현되는 암은 모두 가능하다.
본 발명의 구체적인 실시예에서, 사이토케라틴17에 대한 결합능 및 특이성을 나타낸 단일클론 항체는 사이토케라틴17가 과발현된 암질환의 검출용 조성물로 유용하게 이용될 수 있다.
상기 인간 항체, 인간 항체의 경쇄 또는 중쇄, 또는 그의 면역학적으로 활성을 가진 단편은 치료용 방사선 동위원소, 형광체, 효소, 효소 기질, 효소 보조인자, 효소 억제제 또는 리간드로 이루어진 군으로부터 선택되는 어느 하나 이상의 검출가능한 표지에 직접적으로 또는 간접적으로 결합되거나 연결된다. 바람직한 치료용 방사선 동위원소의 예로는 3H, 11C, 14C, 18F, 64Cu, 76Br, 86Y, 99mTc, 111In, 123I, 177Lu 및 이들의 혼합물 및 조합을 포함한다.
또한, 본 발명은 상기 검출용 조성물을 암세포와 접촉하는 단계를 포함하는 시험관 내 사이토케라틴17이 과발현되는 암의 면역검출 방법을 제공한다.
상기 사이토케라틴17이 과발현되는 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않고 사이토케라틴17이 과발현되는 암은 모두 가능하다.
본 발명의 구체적인 실시예에서, 사이토케라틴17에 대한 결합능 및 특이성을 나타낸 단일클론 항체는 사이토케라틴17가 과발현된 암의 검출에 유용하게 이용될 수 있다.
상기 검출용 조성물은 세척이나 복합체의 분리 등 그 이후의 단계를 용이하게 하기 위해 고형 기질(solid substrate)에 결합될 수 있다. 고형 기질은 예를 들어 합성수지, 니트로셀룰로오스, 유리기판, 금속기판, 유리섬유, 미세구체 및 미세비드 등이 있다. 또한, 상기 합성수지에는 폴리에스터, 폴리염화비닐, 폴리스티렌, 폴리프로필렌, PVDF 및 나일론 등이 있다.
또한, 암세포는 상기 검출용 조성물과 접촉 전에 알맞은 정도로 희석될 수 있다.
또한, 본 발명은 1) 상기 검출용 조성물의 진단적 유효량을 개체에 투여하는 단계; 및,
2) 상기 개체에 대한 검출영상을 수득하는 단계를 포함하는 생체내 사이토케라틴17이 과발현되는 암의 영상화 방법을 제공한다.
상기 사이토케라틴17이 과발현되는 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않고 사이토케라틴17이 과발현되는 암은 모두 가능하다.
본 발명의 구체적인 실시예에서, 사이토케라틴17에 대한 결합능 및 특이성을 나타낸 단일클론 항체는 사이토케라틴17가 과발현된 암의 영상화 방법에 유용하게 이용될 수 있다.
상기 검출영상은 근적외광 이미징, PET, MRI 또는 초음파 이미징에 의해 수득되는 것을 특징으로 한다.
또한, 본 발명은
1) 상기 검출용 조성물을 개체의 정맥내 투여하는 단계;
2) 상기 단계 1)의 조성물을 검출하여 종양 세포를 확인하는 단계;
3) 단계 2)에서 확인된 종양 세포를 수술적 절제에 의해 제거하는 단계를 포함하는 사이토케라틴17이 과발현되는 암의 생체내 치료 방법을 제공한다.
상기 사이토케라틴17이 과발현되는 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것이 바람직하나 이에 한정되지 않고 사이토케라틴17이 과발현되는 암은 모두 가능하다.
본 발명의 구체적인 실시예에서, 사이토케라틴17에 대한 결합능 및 특이성을 나타낸 단일클론 항체는 사이토케라틴17가 과발현된 암의 치료에 유용하게 이용될 수 있다.
아울러, 본 발명은
1) 상기 검출용 조성물을 종양 세포가 제거된 환자의 정맥내 투여하는 단계;
2) 상기 단계 1)의 조성물을 검출하여 종양 세포를 확인하는 단계;
3) 단계 2)에서 종양 세포가 검출되지 않으면, 종양 세포가 모두 제거된 것으로 판단하는 것을 특징으로 하는 암 치료 환자의 예후 평가 방법을 제공한다.
본 발명의 구체적인 실시예에서, 사이토케라틴17에 대한 결합능 및 특이성을 나타낸 단일클론 항체는 사이토케라틴17가 과발현된 암의 예후 평가에 유용하게 이용될 수 있다.
이하, 본 발명을 실시예에 의해 더욱 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
<실시예 1> 사이토케라틴17(CK17) 항원단백질 제조
<1-1> CK17 유전자 클로닝
<1-1-1> 소수성 영역 분석
CK17 단백질의 소수성(hydrophobicity) 영역을 확인하기 위해, 서열번호 1로 기재되는 아미노산 서열을 기반으로 플롯 프로그램(plot program; //www.vivo.colostate.edu/molkit/hydropathy)을 이용하여 Kyte-Doolittle에 의해 처음 제안된 친수도 도표(hydropathy plot)를 작성하였고, 이를 도 1에 나타내었다. 이때, 세포표면으로의 발현에 크게 영향을 주지 않는 아미노 말단 부분을 임의로 도메인 1 내지 3으로 나누어서 화살표로 표시하였다.
상기 도메인 1을 결실하도록 발현된 단백질을 CK17-D1(서열번호 2)으로, 상기 도메인 1 내지 3을 결실하도록 발현된 단백질을 CK17-D3(서열번호 3)으로 명명하였다.
<1-1-2> CK17-D1(80a.a.~432a.a.)의 클로닝
한국생명공학연구원 인간유전체기능연구사업단의 KUGI(Korean UniGene Information)에서 인간 사이토케라틴17 유전자를 함유하고 있는 플라스미드(hMU000313, Kugi # IRAT-04-C01)를 분양받았다. 상기 플라스미드를 주형 DNA로 하고, 상기 CK17-D1을 발현시키기 위한 정방향 프라이머(서열번호 4: 5'-GTCTAGCCATGGAACTGGCTGGAGGTGAG-3') 및 역방향 프라이머(서열번호 5: 5'-GTCTAGAAGCTTGCGGGTGGTCTGGTG-3')를 사용하여 유전자를 하기 조건으로 증폭한 후, NcoI과 HindⅢ으로 처리한 후, pET28A(69864-3: Novagen, USA)에 서브클로닝하였다. PCR 조건은 전체 반응액이 50 ㎕일 때, 주형은 100 ng이 되도록 넣어 주었고, 94℃ 5 분, 95℃ 30 초, 55℃ 30 초, 72℃ 1분 30초로 25 사이클, 72℃ 10분간 반응시켜 PCR 산물을 얻었다.
<1-1-3> CK17-D3(157a.a~432a.a)의 클로닝
hMU000313을 주형으로 하여 상기 CK17-D3을 발현시키기 위한 정방향 프라이머(서열번호 6: 5'-GTCTAGCCATGGAACTACAGATTGACAATGCC-3') 및 역방향 프라이머(서열번호 5)를 사용하여 실시예 1-1-2와 동일한 방법으로 PCR 증폭(단, 어닐링 온도는 58℃)한 후, NcoI과 HindⅢ으로 처리한 후, pET28A에 서브클로닝하였다.
아울러, 상기 서브클로닝된 CK17-D1과 CK17-D3 벡터의 염기서열을 확인하였다.
<1-2> CK17-D1 및 CK17-D3 단백질 발현 및 정제
<1-2-1> CK17-D1 발현 및 정제
CK17-D1을 발현하는 벡터로 형질전환한 BL21(DE3)의 배양액에 1 mM IPTG를 첨가한 후, 37℃에서 4 시간; 28℃에서 6시간; 28℃에서 밤새도록 또는 20℃에서 밤새도록 배양하였다. 최종 O.D값이 동일하도록 보정한 후, 전체 세포 추출물을 수득하여 10% SDS-PAGE 젤에서 전기영동한 후, 쿠마시 블루법으로 단백질의 발현양상을 확인하였다.
그 결과, 도 2에서 나타난 바와 같이 20℃에서 밤새도록 단백질 발현을 유도한 경우에서, 수용성 단백질의 발현량이 많은 것을 확인하였다.
이에, 최종적으로 배양액에 1 mM IPTG를 첨가한 후, 20℃에서 밤새도록 단백질 발현을 유도한 배양액 500 ㎖을 원심분리하였다. 상등액을 0.22 ㎛의 Top-filter(Millipore, Cat#: SCGP T05 RE, USA)를 사용하여 필터한 후, LabScale TFF System(Millipore, Cat#: XX42LSS11)의 pellicon XL membrane(Millipore, 8K, cat #: PXB0 08A 50)을 이용하여 1/10 부피로 농축한 다음, 농축된 10배 부피의 IMAC 완충용액(300 mM KCl, 50 mM KH2PO4, 5 mM imidazole, pH8.0)을 넣어 농축하면서 IMAC 완충용액으로 교환한 다음, Bio-Rad의 ProfiniaTM protein Purification System의 Bio-Scle Mini profinity IMAC 카트리지(cat#:732-4610)를 사용하여 1 ㎖/분 속도로 제조사의 지시대로 정제하였다. 구체적으로, 농축된 용액에 Ni-NTA(Qiagen 1024473) 비드를 첨가하여 4℃에서 2시간 동안 결합시킨 후, 세척액(300 mM NaCl, 50 mM sodium phosphage buffer, 20 mM imidazole, pH 8.0)으로 차례 세척하였다. 이후, 용리용액(300 mM NaCl, 50 mM sodium phosphage buffer, 250 mM imidazole, pH 8.0)으로 단백질을 용리 하였다. 상기 용액을 투석 멤브레인망(10K, 132574: SPECTRAPOR, USA)에 넣은 후, 4℃에서 4L의 투석용액(100 mM tris-HCl pH 8.0, 300 mM NaCl, 1 mM DTT, 10% glycerol)으로 밤새 투석하였다. Bradford 방법으로 단백질 농도를 측정한 결과, 400 ㎍의(0.3 ㎎/㎖)의 CK17-D1 단백질을 얻었고, 10% SDS-PAGE 젤에서 확인하여 대략 39 KDa 크기의 정제된 CK17-D1 단백질을 확인하였다(도 3).
<1-2-2> CK17-D3 발현 및 정제
CK17-D3을 발현하는 벡터로 형질전환한 BL21(DE3)의 배양액에 1 mM IPTG를 첨가한 후, 37℃에서 4 시간; 28℃에서 4시간; 28℃에서 밤새도록; 20℃에서 4시간; 또는 20℃에서 밤새도록 배양하였다. 최종 O.D값이 동일하도록 보정한 후, 전체 세포 추출물을 수득하여 10% SDS-PAGE 젤에서 전기영동한 후, 쿠마시 블루법으로 단백질의 발현양상을 확인하였다.
도 5에서 보는 바와 같이,20℃,28℃과 37℃에서 발현양이 높고 비슷하였으나 solubility는 20℃에서 가장 높아, 단백질을 얻기 위하여 20℃에서 IPTG 1 mM 농도로 overnight induction 시키고 상기와 같은 방법으로 정제하여 bradford 방법으로 단백질 농도를 농도를 측정한 후, 400 ㎍의(1mg/mlmM)의 CK17-D3 단백질을 얻었고, 10% SDS-PAGE 젤에서 확인하여 도6에서 보는 바와 같이, 약 31 KDa 크기의 정제된 CK17-D3 단백질을 확인하였다. CK17-D1과 마찬가지로 정제된 CK17-D3단백질도 항원으로 사용하였다.
그 결과, 도 4에서 나타난 바와 같이 20℃에서 밤새도록 단백질 발현을 유도한 경우에서, 수용성 단백질의 발현량이 많은 것을 확인하였다.
이에, 최종적으로 배양액에 1 mM IPTG를 첨가한 후, 20℃에서 밤새도록 단백질 발현을 유도한 배양액 500 ㎖으로부터 실시예 1-2-1과 동일한 방법으로 단백질을 정제하였고, 그 결과 400 ㎍의(1 ㎎/㎖)의 CK17-D3 단백질을 얻었고, 10% SDS-PAGE 젤에서 확인하여 대략 31 KDa 크기의 정제된 CK17-D3 단백질을 확인하였다(도 5).
<실시예 2> 라이브러리 파아지의 제조
다양성을 가진 인간 유래 scFv 라이브러리 세포 2.7 × 1010를 2×YT CM[Tryptone(CONDA, 1612.00) 17 g, Yeast extract(CONDA, 1702.00) 10 g, NaCl(sigma, S7653-5 ㎏) 5 g, chloramphenicol(sigma, C0857) 34 ㎍/㎖)], 2% glucose(sigma, G5400) 및 5 mM MgCl2(sigma, M2393)을 포함하는 배지(3 L)에서 37℃에서 2~3시간 동안 배양한 후(OD600=0.5~0.7), 헬퍼 파아지(helper phage)를 감염시켜 2×YTCMK[2×YT CM, Kanamycin(sigma, K1876) 70 ㎍/㎖, 1 mM IPTG(ELPISBIO, IPTG025)] 배지에 30℃에서 16시간 동안 배양하였다. 배양한 세포를 원심분리(4500 rpm, 15분, 4℃)한 후, 상등액에 4% PEG(Fluka, 81253) 6000과 3% NaCl(sigma, S7653)을 첨가하여 잘 녹인 후 얼음에서 1시간 동안 반응하였다. 다시 원심분리(8000 rpm, 20분, 4℃)한 후, 펠렛에 PBS를 첨가하여 녹인 다음 원심분리(12000 rpm, 10 분, 4℃)하여 라이브러리 파아지를 포함하는 상등액을 새 튜브에 넣어 4℃에서 보관하였다.
<실시예 3> 단일 클론 항체의 제조
<3-1> 패닝(Panning) 과정
실시예 1에서 수득한 정제된 CK17-D1 항원 또는 CK17-D3 50 ㎍을 Immunosorb 튜브(Nunc 470319)에 4 ㎖의 코팅 완충용액[coating buffer; Na2CO3(sigma, S7795) 1.59 g, NaHCO3(sigma, S8875) 2.93 g, NaN3(sigma, S2002), 0.2 g]으로 4℃에서 16시간 정도 회전기(rotator)로 코팅한 후, 실온에서 2시간 동안 PBS에 녹여 skim milk[(BD,232100)-4% in 1XPBS]를 사용하여 면역튜브(immunotube)에서 차단하였다. 면역튜브에 실시예 2에서 제조한 라이브러리 파아지 2 ㎖을 첨가하여 실온에서 2시간 동안 반응시켰고 PBST(0.05%)로 5회, PBS로 2회 세척하였다. 세척 후 특이적으로 결합한 scFv-파아지들만 100 mM TEA(Sigma T-0886)로 용리하여, 용출된 파아지들을 대장균(XL1-Blue, stratagene, 200249)에 감염시켜 증폭했다. 첫 번째 패닝에서 증폭된 파아지를 PBST 세척 횟수만 늘려서(2차: 13번, 3차: 23번, 4차: 25) 동일한 방법으로 2차, 3차 및 4차 패닝을 수행하였다. CK17-D3의 경우, 3차 패닝까지만 수행하였다.
그 결과, CK17-D1의 경우, 표 1에서 나타난 바와 같이 1차에 비해 4차 항원에 대한 파아지의 콜로니 역가가 30배 이상 증폭됨을 확인하였고, CK17-D3의 경우, CK17-D3 항원에 대한 결합능이 2차 다클론 scFv-파아지 풀(pools)부터 증강하기 시작하여 3차에 결합능이 포화상태에 이른 것을 확인하였다. 또한, CK17-D3 항원에 대한 파아지의 콜로니 역가가 2차에 비해 약 500배 이상 증폭되었다.
표 1
표적 항원 패닝 횟수 초기 파아지수 결합한 파아지수
CK17-D1 1st 1.1 x 1013 1.4 x 106
2nd 4 x 1013 1.1 x 107
3rd 6 x 1012 1.0 x 107
4th 4 x 1013 3.3 x 108
CK17-D3 1st 1.1 x 1013 1.38 x 108
2nd 1.2 x 1013 4.0 x 104
3rd 8 x 1012 2.0 x 107
<3-2> 파아지 ELISA에 의한 파아지 항체 탐색
<3-2-1> 패닝 결과 확인
1차부터 4차까지(CK17-D3의 경우, 3차까지) 패닝하여 얼려두었던 세포 저장물(stock)을 5 ㎖의 2×YTCM, 2% Glucose, 5 mM MgCl2 배지에 OD600=0.1이 되게 넣어준 다음, 37℃에서 2~3시간(OD600=0.5~0.7) 배양하였다. 이후 M1 헬퍼 파아지를 감염시키고 2×YTCMK, 5 mM MgCl2, 1 mM IPTG 배지에 30℃에서 16시간 동안 배양하였다. 이때, 사이토케라틴17과 상관없는 발생과정에 관련 있는 WW45항원에 특이적으로 결합하는, 본 발명의 실시예대로 제조된 단일 파아지항체(#38)를 대조군으로 이용하였다. 배양 세포를 원심분리한 후(4500 rpm, 15 분, 4℃) 상등액(패닝된 poly scFv-파아지)을 새 튜브로 옮겼다. 96웰 면역 플레이트(NUNC 439454)에 사이토케라틴17 항원을 웰 당 100 ng 씩 4℃에서 16시간 정도 코팅 완충용액으로 처리하여 코팅한 후, PBS에 녹인 skim milk(4 %)를 사용하여 각 웰을 차단하였다. 각 웰 마다 PBS-tween20(0.05%) 0.2 ㎖으로 씻어준 다음 패닝된 poly scFV-파아지를 각 웰에 100 ㎕씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 PBS-tween20(0.05%) 0.2 ㎖을 사용하여 4번 세척한 후 이차 항체인 항-M13-HRP(Amersham 27-9421-01)를 1:2000으로 희석하여 실온에서 1시간 동안 반응하였다. PBS-tween20(0.05%) 0.2 ㎖으로 세척한 후에 OPD 정제(Sigmap 8787-TAB)를 PC 완충용액[C6H8O7·H2O(sigma, C0706) 5.1 g, Na2HPO4(sigma, S7907) 7.3 g]에 녹인 기질 용액을 만들어 웰당 100 ㎕씩 넣어 10분 동안 발색시킨 다음 490 ㎚에서 흡광도를 Spectrophotometer(MolecularDevice, 미국)로 측정하였다.
그 결과, 도 6 및 7에서 나타난 바와 같이 CK17-D1과 CK17-D3 항원에 대한 결합능이 각각 2차 다클론 scFv-파아지 풀(pools)부터 증강하기 시작하여 4차와 3차에 결합능이 포화상태에 이르렀음을 확인할 수 있었다.
<3-2-2> 단일 클론 항체 선별
상기 결합능이 큰 다클론 파아지 항체군((CK17-D1과 CK17-D3의 각각 4차와 3차 패닝군)에서 얻은 콜로니를 2×YTCM, 2% glucose, 5 mM MgCl2 배지 1 ㎖이 포함된 96-deep 웰 플레이트(바이오니아 90030)에서, 37℃에서 16시간 동안 배양하였다. 배양한 세포의 OD600 값이 0.1이 되도록 100~200 ㎕를 취해 1 ㎖의 2×YTCM, 2% glucose, 5 mM MgCl2 배지에 희석한 다음, 96-deep 웰 플레이트에서 37℃에서 OD600 값이 0.5~0.7 되도록 2~3시간 배양하였다. M1 헬퍼 파아지를 MOI값이 1:20이 되도록 감염시킨 후, 2×YTCMK, 5 mM MgCl2, 1 mM IPTG 배지에 30℃에서 16시간 배양하였다. 배양한 세포를 원심분리(4500 rpm, 15 분, 4℃)한 후, 상등액을 취해 4% PEG 6000과 3% NaCl을 첨가하여 잘 녹인 후 얼음에서 1시간 동안 반응시켰다. 다시 원심분리(8000 rpm, 20분, 4℃)한 후 펠렛에 PBS를 첨가하여 녹인 다음 원심분리(12000 rpm, 10분, 4℃)하여 상등액을 취해 새 튜브에 옮겨 3차 또는 4차 패닝하여 얻은 단일 클론 scFv-phage를 4℃에서 보관하였다.
이후, 96웰 면역 플레이트에 CK17-D1과 CK17-D3 항원을 웰당 100 ng씩을 넣어 4℃에서 16시간 동안 코팅한 후 PBS에 녹인 skim milk(4%)를 사용하여 각 웰을 차단하였다. 각 웰마다 PBS-tween20(0.05%) 0.2 ㎖을 사용하여 세척한 다음 상기 방법으로 수득한 단일클론 scFv-파아지(each 100 scFv-phage)를 각 웰에 100 ㎕씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 PBS-tween20(0.05%) 0.2 ㎖을 사용하여 4번 씻어준 후 2차 항체인 anti-M13-HRP를 1/2000로 희석하여 실온에서 1시간 동안 반응하였다. PBS-tween20(0.05%) 0.2 ㎖로 세척한 후에 발색하여 흡광도 490 ㎚에서 측정하였다.
그 결과, 표 2에 나타난 바와 같이 CK17-D1 항원에 대한 결합능이 1.6 이상인 34개의 단일 파아지 클론들(표 2에서 음영으로 표시한 것)을 선별하였고, 표 3에 나타난 바와 같이 CK17-D3 항원에 대한 결합능이 2 이상인 60개의 단일 파아지 클론들(표 3에서 음영으로 표시한 것)을 선별하였다.
표 2
Figure PCTKR2010002641-appb-T000001
표 3
Figure PCTKR2010002641-appb-T000002
<3-3> 단일 클론 파아지 분류 및 검사
<3-3-1> 핑거 프린팅에 의한 검증
1차 선별된 CK17-D1에 대한 34개 단일 클론과 CK17-D3에 대한 60개의 단일클론 세포 1 ㎕와 Taq.DNA polymerase(젠닥스 5U/㎕) 0.2 ㎕, 50 p/㎕의 정방향 프라이머(pelB5, 서열번호 7:5'-CTAGATAACGAGGGCAAATCATG-3') 및 역방향 프라이머(cla3, 서열번호 8:5'-CGTCACCAATGAAACCATC-3') 0.2 ㎕, 10X 완충용액 3 ㎕, 10 mM dNTP mix 0.6 ㎕, 증류수 24.8 ㎕를 혼합하여 콜로니 PCR(iCycler iQ, BIO-RAD)을 수행하였다. PCR 프로그램의 조건은 하기 표 4와 같다.
표 4
온도 시간 사이클(cycle)
95℃ 5 min
95℃ 30 sec 30 사이클
56℃ 30 sec
72℃ 1 min
72℃ 10 min
4℃
상기 콜로니 PCR 산물은 1% 아가로스 겔(Seakem LE, CAMERES 50004)에서 확인하였고, BstNI(Roche11288075001, 10 U/㎕) 0.2 ㎕를 가하여 37℃에서 2~3시간 반응하였다. 반응 조건은 하기 표 5와 같다. 상기 절단된 산물을 8% DNA 폴리아크릴 아마이드 겔에서 확인하였다.
표 5
10X Buffer 3 ㎕
콜로니 PCR 산물 10 ㎕
BstNI(10U/㎕) 0.2 ㎕
증류수 16.8 ㎕
그 결과, 도 8와 도 9에서 나타난 바와 같이 BstNI에 의해 잘려진 단일 클론 파아지 항체들의 단편들에 대해 다양성이 확인되었고, CK17-D1에 대해 2종류 및 CK17D3에 대해 5종류의 서로 다른 항체가 선별된 것을 유추하였다.
<3-3-2> 염기서열 분석에 의한 검증
상기 CK17-D1에 대해 2종류 및 CK17D3에 대해 5종류의 단일 파아지 클론을 2×YTCM, 2% glucose, 5 mM MgCl2 배지(5 ㎖)에 37℃에서 16시간 동안 배양하였다. 배양한 단일 클론으로부터 DNA 정제 키트(Nuclogen 5112)를 이용하여 DNA를 수득한 후, 서열번호 125의 pelB5 프라이머를 이용한 서열 분석을 의뢰하였다(솔젠트, 한국).
그 결과, 표 6 및 도 10, 도 11 및 도 12에서 나타난 바와 같이 선별된 항체의 VH와 VL의 CDR 영역을 확인하였다.
이들 항체와 생식세포 계열(germ line) 항체군의 유사성을 NCBI의 Ig BLAST 프로그램(//www.ncbi.nlm.nih.gov/igblast/)을 이용하여 조사한 결과 2종의 CK17-D1에 특이적인 파아지 항체와 5종의 CK17-D3에 특이적인 파아지 항체를 얻었고 이는 하기 표 7에서 정리하여 제시하였다. 특히, 중쇄의 경우 인간 생식세포 계열서열과 82.1%에서 대략 95%까지의 상동성을 보여주었으며, 경쇄의 경우 89.5%에서 약 98.9%의 상동성을 보여주었다. 또한, 각각의 인간항체의 중쇄 및 경쇄의 CDR3에서 사용되고 있는 폴리펩티드를 분석하였으며, 서로 서열이 다른 것을 확인하였다. 이때, 중쇄의 경우 VH3-23이 3종, VH3-53, VH3-72, VH3-7 및 VH1-46이 각각 1종씩 포함되었다. 경쇄의 경우 람다(λ)-사슬이 2종 및 카파(κ)-사슬이 2종이었다. 각각의 인간항체의 중쇄 및 경쇄의 CDR3에서 사용되고 있는 아미노산 서열을 분석하였으며, 서로 다른 서열을 갖는 것을 확인하였다.
표 6
　 　 중쇄 경쇄
그룹 클론명 CDR1 CDR2 CDR3 CDR1 CDR2 CDR3
1 D1-1B2 LSTYAMN: 서열번호 24 LISGSGGTTYYADSVKG: 서열번호 31 GRASFDL: 서열번호 38 RASQSISR: 서열번호 45 KASYLRT: 서열번호 51 QQYNTFPLT: 서열번호 58
2 D1-1F FSDYAMT: 서열번호 25 ATSASGGSTHYADSVRG: 서열번호 32 GLVLDY: 서열번호 39 SGTSDDIGRYN: 서열번호 46 DVTRRSS: 서열번호 52 SSFTNNRTVV: 서열번호 59
3 D3-12E FSSYAMT: 서열번호 26 SISHSGRVTYYGDSVKG: 서열번호 33 ELTPSYGFDT: 서열번호 40 TGTSSDVGGYNYVS: 서열번호 47 DVSKRPS: 서열번호 53 SSYTSSSTVV: 서열번호 60
4 D3-12F FHNYAMS: 서열번호 27 VIYSTGGTYYADSVKG: 서열번호 34 GSYAGYIRD: 서열번호 41 TGTSSDVGGHDHVS: 서열번호 48 DVSERPS: 서열번호 54 TSYTTTNSYV: 서열번호 61
5 D3-6G FSSYWMH: 서열번호 28 EINPGNGHTNYNEKFKS: 서열번호 35 DLGRYAHFYMAD: 서열번호 42 TGTSSDVGGYNYVS: 서열번호 47 DVTKRPS: 서열번호 55 ASYAGSSYV: 서열번호 62
6 D3-5C FSDYYMD: 서열번호 29 RSRNKANSHTTEYAASVKG: 서열번호 36 DPWGGFYGMDV: 서열번호 43 RASQGISSWLA: 서열번호 49 AASTLHS: 서열번호 56 QQANSFPYT: 서열번호 63
7 D3-9D FTRYWMQ: 서열번호 30 GIKNDGNRTMYADSVKG: 서열번호 37 EIGGAFDI: 서열번호 44 TGTSSDVAAYNFVS: 서열번호 50 NIRTRPS: 서열번호 57 TSYAGRNTYV: 서열번호 64
표 7
Group Clone Name VH Identities VH (CDR3- a.a seq) VL Identities Vk (CDR3-a.a seq)
1 D1-1B2 VH3-23 274/294 (93.20%) GRASFDL L12a 262/280 (93.57%) QQYNTFPLT
2** D1-1F VH3-23 275/294 (93.54%) GLVLDY V1-4 263/294 (89.46%) SSFTNNRTVV
3 D3-12F VH3-53 262/291 (90.03%) RGSYAGYIRD V1-4 280/294 (95.24%) TSYTTTNSYV
4 D3-12E VH3-23 275/295 (93.22%) ELTPSYGFDT V1-4 290/294 (98.64%) SSYTSSSTVV
5 D3-5C VH3-72 287/301 (95.35%) DPWGGFYGMDV L5 281/284 (98.94%) QQANSFPYT
6 D3-9D VH3-7 251/295 (85.08%) EIGGAFDI V1-3 281/295 (95.25%) TSYAGRNTYV
7 D3-6G VH1-46 243/296 (82.09%) KDLGRYAHFYMAD V1-3 274/287 (95.47%) ASYAGSSYV
<실시예 4> CK17에 대한 인간항체의 특성 분석
<4-1> 파아지 FACS 분석
100 ㎜ 플레이트에서 CK17이 과발현된 난소암 세포주 SKOV3(ATCC HTB-77)를 PBS로 2번 세척한 후, 무효소 PBS 기반-해리 완충용액(Gibco)을 첨가해서 37℃에서 10분 동안 배양하였다. 이후, 세포를 스크래퍼로 모은 후, 1300 rpm에서 3분 동안 원심분리해서 펠렛을 2% PBF(2% FBS가 든 1XPBS)용액으로 두 번 세척한 후, 2% PBF 용액을 넣어 재현탁하여 ≥5×105 세포의 농도로 준비하였다. 본 발명의 단일 클론 파아지 항체 100 ㎕를 PEG로 10배 농축한 다음 1/2로 희석하여 상기 세포에 섞어주었다. 이때, 상업적으로 구매한 마우스 항 CK17 항체(Anti KRT17; Cat#:MAB1677: Chemicon, USA)를 양성대조군으로 사용하였고, 정상 마우스 IgG를 음성대조군으로 사용하였다. 얼음에서 1시간 동안 반응한 후, 1300 rpm으로 4℃에서 3분 동안 원심분리하여 상등액을 제거하였다. 200 ㎕의 2% PBF 용액으로 3번 세척한 후, 2% PBF 용액에 1:200으로 희석시킨 항-g8p 항체(Abcam) 100 ㎕를 넣어 잘 섞어주고, 얼음에서 30분 동안 반응시켰다. 1300 rpm으로 4℃에서 3분 동안 원심분리한 후, 상등액을 제거하고 200 ㎕의 2% PBF 용액으로 3번 세척하였다. 2% PBF 용액에 1:1000으로 희석시킨 FITC-연결된 항-마우스 IgG 100 ㎕를 각각의 시료에 섞어준 후, 얼음에서 30분 동안 반응시켰다. 추가로 세척한 다음, 500 ㎕의 2% PBF 용액을 첨가하여 FACS 용 튜브(Falcon)에 시료를 옮겨서 볼텍싱 한 후, 염색된 세포들을 유세포분석기(Beckman Coulter)로 분석하였다. 매번 실험시 다른 항원에 특이하게 결합하는 단일 파아지항체 #38을 동일한 조건으로 시료에 처리하여 내부 대조군(internal control)으로 사용하였다. 데이터는 WINMDI2.9 software(//facs.scripps.edu/software.html, The Scripps Research Institute)를 사용하여 분석하였다.
그 결과, 도 13에서 나타난 바와 같이 CK17이 과발현된 난소암 세포주에서 CK17을 특이적으로 인식하고 결합하는 단일클론 파아지 항체를 선별하였다. 구체적으로, CK17-D1에 대해 D1-1B2, CK17-D3에 대해 D3-5C, D3-9D 및 D3-12F 등을 선별하였다. 이외에도, CK17-D1에 대해 D1-1F, CK17-D3에 대해 D3-6G 및 D3-12E 등도 선별하였으나, 결과는 본 명세서에 따로 기재하지 않았을 뿐이다.
<4-2> 전체 IgG 변환 분석
CK17에 대한 단일 클론 파아지 항체들을 파아지에서 IgG 전체 벡터로 전환하기 위해 중쇄는 단일 클론 DNA 1 ㎕와 10 pmole/㎕ 표 8의 중쇄 정방향 프라이머와 중쇄 역방향 프라이머, 10X buffer 5 ㎕, 10 mM dNTP mix 1 ㎕, pfu DNA 중합효소(솔젠트, 2.5 U/㎕) 0.5 ㎕,증류수를 혼합하여 콜로니 PCR(iCycler iQ, BIO-RAD)을 수행하였다. 또한, 경쇄도 표 8의 경쇄 정방향 및 역방향 프라이머를 사용하여 동일한 방법으로 콜로니 PCR을 수행하였다.
표 8
클론명 중쇄 경쇄
정방향 프라이머 역방향 프라이머 정방향 프라이머 역방향 프라이머
(Sfi I) (NheI) (Sfi I) (Bgl II)
D1-1B2 NATVH3-2: 서열번호 65 TTGGTGGCCACAGCGGCCGATGTCCACTCGCAGGTGCAGCTGGTGGAGTC NATJH-ALL: 서열번호 67 GAGGAGGCTAGCTGAGGAGACGGTGA NATVK1-1: 서열번호 68 TTGGTGGCCACAGCGGCCGATGTCCACTCGGACATCCAGATGACCCAGTC NATJK-R4: 서열번호 70 GAGGAGAGATCTTTTGATTTCCACCTTGGT
D3-9D NATVL4: 서열번호 69 TTGGTGGCCACAGCGGCCGATGTCCACTCGCAGTCTGCCCTGACTCAGCC NATJL1-R: 서열번호 71 GAGGAGAGATCTTAGGACGGTGACCTTGGTCCC
D3-5C NATVH1-1: 서열번호 66 TTGGTGGCCACAGCGGCCGATGTCCACTCGCAGGTGCAGCTGGTGCAGTC NATVK1-1: 서열번호 68 TTGGTGGCCACAGCGGCCGATGTCCACTCGGACATCCAGATGACCCAGTC NATJK-R7: 서열번호 72 GAGGAGAGATCTTTTGATTTCCAGCTTGGT
D3-12F NATVL4: 서열번호 69 TTGGTGGCCACAGCGGCCGATGTCCACTCGCAGTCTGCCCTGACTCAGCC NATJL1-R: 서열번호 71 GAGGAGAGATCTTAGGACGGTGACCTTGGTCCC
PCR 결과 수득한 중쇄 유전자를 DNA-겔 추출 키트(Qiagen)로 정제한 후, pNATAB H 벡터(도 17) 1 ㎕(10 ng), 중쇄(100~200 ng) 15 ㎕, 10 X Buffer 2 ㎕, Ligase (1 U/㎕) 1 ㎕, 증류수를 혼합하여 실온에서 1~2시간 방치하여 상기 벡터와 연결하였다. 상기 벡터를 형질전환용 세포(XL1-blue)와 함께 얼음에 30분간 방치한 후, 42℃에서 90초간 열충격을 주어 형질도입하였다. 다시 얼음에 5분간 방치한 후, LB 배지 1 ㎖을 주입하고 1시간 동안 37℃에서 배양하였다. LB Amp 고체배지에 도말한 후, 37℃에서 16시간 동안 배양하였다. 단일 콜로니를 LB Amp 액체배지 5 ㎖에 접종하여 37℃에서 16시간 동안 배양하였다. 상기 배양액으로부터 DNA-prep. 키트(Nuclogen)를 이용하여 DNA를 추출하였다.
또한, 경쇄는 pNATAB L 벡터(도 18)를 사용하여 상기와 같은 방법으로 DNA를 추출하였다.
상기 수득한 DNA의 CMV-proF 프라이머(서열번호 9: AAA TGG GCG GTA GGC GTG)를 이용한 염기서열 분석을 의뢰하였다(솔젠트).
그 결과, 전체 IgG로 전환한 CK17에 대한 4개의 클론 파아지의 중쇄와 경쇄의 서열이 파아지 항체의 서열과 일치됨을 확인하였다.
<4-3> 전체 IgG의 검증
293E 세포에 PEI 40 ㎍과 실시예 4-2에서 수득한 전체 형태(Whole form) 항체 중쇄 DNA 10 ㎍, 경쇄 DNA 10 ㎍을 넣어 공동-형질감염체를 수득하였다. 이를 배양하여 얻은 상등액을 전기영동한 후, 웨스턴 블랏으로 확인하였다. 대조군으로는 정상 인간 IgG(Jackson Lab)을 이용하였다.
그 결과, 도 14에서 나타난 바와 같이 대조군과 비교하여 성공적으로 전체 IgG 형태로 전환되었음을 확인하였다.
또한, 상기 4개의 전체 형태 IgG 를 단백질 A-친화도 크로마토그래피 컬럼(Pharmacia, GE, USA)을 이용하여 정제한 후(도 15), 실시예 4-1의 방법으로 SKOV3 세포주에서 상기 전체 항체의 CK17에 대한 결합력을 상업적으로 구매한 항 CK17 항체(Anti-KRT17)와 비교하여 FACS로 확인하였다(도 16a 및 16b). 이때, 사용한 정제된 D1-1B2 항체를 허셉틴(Herceptin, Roche, 스위스)을 대조군으로 사용하여, SDS-PAGE 방법으로 환원 및 비환원 조건에서 품질을 비교한 결과를 도 16c에서 나타내었다.
아울러, 농도별 항원 CK17-D1과 CK17-D3에 대한 본 발명의 항체들, 인간 IgG, 항 CK17 항체 및 정상 마우스 IgG의 결합 특이성을 실시예 3-2-2와 동일한 방법으로 확인하였다.
그 결과, 표 9에서 나타난 바와 같이 예상대로 각 항체들이 각각의 항원에 대해 특이성을 보였고, 항 CK17 항체의 경우 CK17-D3와 비교하여 CK17-D1에만 결합하였고, 이로부터 CK17-D2 부위를 특이적으로 인식하는 것을 제한하였다.
표 9
Figure PCTKR2010002641-appb-T000003

Claims (31)

  1. 서열번호 24 내지 30으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 중쇄 상보성 결정영역(이하, HCDR) 1, 서열번호 31 내지 37로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 HCDR 2 및 서열번호 38 내지 44로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 HCDR 3을 포함하는 중쇄 가변영역(VH)을 포함하는 중쇄 또는 그의 단편; 및,
    서열번호 45 내지 50으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 경쇄 상보성 결정영역(이하, LCDR) 1, 서열번호 51 내지 57로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 LCDR 2 및 서열번호 58 내지 64로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 LCDR 3을 포함하는 경쇄 가변영역(VL)을 포함하는 경쇄 또는 그의 단편을 포함하는 사이토케라틴17(Cytokeratin17)에 특이적인 인간 항체.
  2. 제 1항에 있어서, 상기 중쇄 가변영역은 서열번호 10 내지 16으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 것을 특징으로 하는 인간 항체.
  3. 제 1항에 있어서, 상기 경쇄 가변영역은 서열번호 17 내지 23으로 이루어진 군으로부터 선택되는 어느 하나의 아미노산 서열을 갖는 것을 특징으로 하는 인간 항체.
  4. 제 1항의 인간 항체의 중쇄 또는 그의 면역학적으로 활성을 가진 단편을 코딩하는 폴리뉴클레오티드.
  5. 제 1항의 인간 항체의 경쇄 또는 그의 면역학적으로 활성을 가진 단편을 코딩하는 폴리뉴클레오티드.
  6. 제 4항의 폴리뉴클레오티드를 포함하는 발현벡터.
  7. 제 5항의 폴리뉴클레오티드를 포함하는 발현벡터.
  8. 제 6항의 발현벡터를 숙주세포에 도입하여 제조된 형질전환체.
  9. 제 7항의 발현벡터를 숙주세포에 도입하여 제조된 형질전환체.
  10. 제 6항 및 제 7항의 발현벡터를 동시에 숙주세포에 도입하여 제조된 형질전환체.
  11. 1) 제 10항의 형질전환체를 배양하는 단계; 및
    2) 상기 배양액으로부터 제 1항의 인간 항체를 정제하는 단계를 포함하는 사이토케라틴17에 특이적인 인간 항체의 제조방법.
  12. 제 1항의 인간 항체를 포함하는, 사이토케라틴17이 과발현되는 암질환의 예방 또는 치료용 약학적 조성물.
  13. 제 12항에 있어서, 화학적 요법과 병행하여 투여하는 것을 특징으로 하는 약학적 조성물.
  14. 제 1항의 인간 항체 및 치료용 방사선 동위원소를 포함하는 사이토케라틴17이 과발현되는 암질환의 방사선면역 치료용 약학적 조성물.
  15. 제 14항에 있어서, 상기 치료용 방사선 동위원소는 3H, 11C, 14C, 18F, 64Cu, 76Br, 86Y, 99mTc, 111In, 123I, 177Lu 및 이들의 혼합물 및 조합으로 이루어진 군으로부터 선택되는 특징으로 하는 약학적 조성물.
  16. 제 14항 또는 제 15항에 있어서, 상기 치료용 방사선 동위원소는 인간 항체와 결합되거나 인간 항체가 결합된 운반체에 포함되는 것을 특징으로 하는 약학적 조성물.
  17. 제 16항에 있어서, 상기 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 하는 약학적 조성물.
  18. 약학적으로 유효한 양의 제 1항의 인간 항체를 사이토케라틴17이 과발현되는 암질환에 걸린 개체에 투여하는 단계를 포함하는 사이토케라틴17이 과발현되는 암질환의 치료방법.
  19. 제 18항에 있어서, 상기 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 하는 치료방법.
  20. 제 1항의 인간 항체, 상기 인간 항체의 경쇄 또는 중쇄, 또는 그의 면역학적으로 활성을 가진 단편의 진단적 유효량을 포함하는 사이토케라틴17이 과발현되는 암질환의 검출용 조성물.
  21. 제 20항에 있어서, 상기 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택된 어느 하나인 것을 특징으로 하는 검출용 조성물.
  22. 제 20항에 있어서, 상기 인간 항체, 인간 항체의 경쇄 또는 중쇄, 또는 그의 단편은 치료용 방사선 동위원소, 형광체, 효소, 효소 기질, 효소 보조인자, 효소 억제제 또는 리간드로 이루어진 군으로부터 선택되는 어느 하나 이상의 검출가능한 표지에 직접적으로 또는 간접적으로 결합되거나 연결된 것을 특징으로 하는 검출용 조성물.
  23. 제 22항에 있어서, 상기 치료용 방사선 동위원소는 3H, 11C, 14C, 18F, 64Cu, 76Br, 86Y, 99mTc, 111In, 123I, 177Lu 및 이들의 혼합물 및 조합으로 이루어진 군으로부터 선택되는 특징으로 하는 검출용 조성물.
  24. 제 20항의 검출용 조성물을 암세포와 접촉하는 단계를 포함하는 시험관 내 사이토케라틴17이 과발현되는 암의 면역검출 방법.
  25. 제 24항에 있어서, 사이토케라틴17이 과발현되는 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 면역검출 방법.
  26. 1) 제 20항의 검출용 조성물의 진단적 유효량을 개체에 투여하는 단계; 및,
    2) 상기 개체에 대한 검출영상을 수득하는 단계를 포함하는 생체내 사이토케라틴17이 과발현되는 암의 영상화 방법.
  27. 제 26항에 있어서, 사이토케라틴17이 과발현되는 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 영상화 방법.
  28. 제 26항에 있어서, 상기 검출영상은 근적외광 이미징, PET, MRI 또는 초음파 이미징에 의해 수득되는 것을 특징으로 하는 영상화 방법.
  29. 1) 제 20항의 검출용 조성물을 개체의 정맥내 투여하는 단계;
    2) 상기 단계 1)의 조성물을 검출하여 종양 세포를 확인하는 단계;
    3) 상기 단계 2)에서 확인된 종양 세포를 수술적 절제에 의해 제거하는 단계를 포함하는 사이토케라틴17이 과발현되는 암의 생체내 치료 방법.
  30. 제 26항에 있어서, 사이토케라틴17이 과발현되는 암은 대장암, 췌장암, 신장암, 폐암, 유방암 및 난소암으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 암의 생체내 치료 방법.
  31. 1) 제 20항의 검출용 조성물을 종양 세포가 제거된 환자의 정맥내 투여하는 단계;
    2) 상기 단계 1)의 조성물을 검출하여 종양 세포를 확인하는 단계;
    3) 단계 2)에서 종양세포가 검출되지 않으면, 종양 세포가 모두 제거된 것으로 판단하는 것을 특징으로 하는 암 치료 환자의 예후 평가 방법.
PCT/KR2010/002641 2009-04-29 2010-04-27 사이토케라틴１７-특이적인 인간항체 WO2010126279A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020090037838A KR101473328B1 (ko) 2009-04-29 2009-04-29 사이토케라틴１７―특이적인 인간항체
KR10-2009-0037838 2009-04-29

Publications (2)

Publication Number Publication Date
WO2010126279A2 true WO2010126279A2 (ko) 2010-11-04
WO2010126279A3 WO2010126279A3 (ko) 2011-03-10

Family

ID=43032678

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/002641 WO2010126279A2 (ko) 2009-04-29 2010-04-27 사이토케라틴１７-특이적인 인간항체

Country Status (2)

Country Link
KR (1) KR101473328B1 (ko)
WO (1) WO2010126279A2 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9234893B2 (en) 2011-02-18 2016-01-12 Korea Research Institute Of Bioscience And Biotechnology Marker comprising anti-CK8/18 complex autoantibody and its use for diagnosing cancer
WO2016141269A1 (en) * 2015-03-05 2016-09-09 The Research Foundation For The State University Of New York Keratin 17 as a diagnostic and therapeutic target for cancer
CN113278070A (zh) * 2021-04-25 2021-08-20 福州迈新生物技术开发有限公司 抗ck17蛋白单克隆抗体及其细胞株、制备方法和应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012112013A2 (en) * 2011-02-18 2012-08-23 Korea Research Institute Of Bioscience And Biotechnology A marker comprising anti-ck8/18 complex autoantibody and its use for diagnosing cancer

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
FAN, J. ET AL.: 'Secretory expression of human ScFv against keratin in Pichia pastoris and its effects on cultured keratinocytes' ARCH. DERMATOL. RES. vol. 301, 21 October 2008, pages 367 - 372 *
PROBY, C. M. ET AL.: 'Keratin 17 expression as a marker for epithelial transformation in viral warts' AM. J. PATHOL. vol. 143, no. 6, December 2003, pages 1667 - 1678 *
REGAUER, S. ET AL.: 'CK17 and p16 expression patterns ditinguish (atypical) immature squamous metaplasia from high-grade cervical intraepithelial neoplasia (CIN III)' HISTOPATHOLOGY vol. 50, April 2009, pages 629 - 635 *
VAN DE RUIN, M. ET AL.: 'Expression of cytokeratins 17 and 5 identifies a group of breast carcinomas with poor clinical outcome' AM. J. PATHOL. vol. 161, no. 6, December 2003, pages 1991 - 1996. *
WNAG, D. ET AL.: 'Cloning and characterization of antikeratin human antibodies using a semisynthtic phage antibody library' ARCH. DERMATOL. RES. vol. 296, 31 August 2004, pages 270 - 277 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9234893B2 (en) 2011-02-18 2016-01-12 Korea Research Institute Of Bioscience And Biotechnology Marker comprising anti-CK8/18 complex autoantibody and its use for diagnosing cancer
WO2016141269A1 (en) * 2015-03-05 2016-09-09 The Research Foundation For The State University Of New York Keratin 17 as a diagnostic and therapeutic target for cancer
CN113278070A (zh) * 2021-04-25 2021-08-20 福州迈新生物技术开发有限公司 抗ck17蛋白单克隆抗体及其细胞株、制备方法和应用

Also Published As

Publication number Publication date
WO2010126279A3 (ko) 2011-03-10
KR101473328B1 (ko) 2014-12-16
KR20100118900A (ko) 2010-11-08

Similar Documents

Publication Publication Date Title
WO2015005632A1 (ko) Dll4와 vegf에 특이적으로 결합하는 신규 이중표적 단백질 및 이의 용도
WO2020111913A1 (en) Anti-4-1bb antibody and use thereof
WO2016153276A1 (ko) 뉴로필린1 특이적 결합 펩타이드 및 이 펩타이드가 융합된 융합 단백질, 및 이의 용도
WO2019098682A1 (ko) 항-her2 항체 또는 그의 항원 결합 단편, 및 이를 포함하는 키메라 항원 수용체
WO2012128580A1 (en) Water-soluble polypeptides comprised of repeat modules, method for preparing the same and method for a target-specific polypeptide and analysis of biological activity thereof
WO2014189303A1 (ko) 뉴로필린에 특이적인 종양 침투성 펩타이드 및 이 펩타이드가 융합된 융합 단백질
WO2012165925A2 (ko) Hgf 활성을 가지는 c-met에 대한 인간항체 및 이의 용도
WO2016013870A1 (ko) 완전한 이뮤노글로불린 형태의 항체를 세포막을 투과하여 세포질에 위치시키는 방법 및 그의 이용
WO2014025199A2 (ko) 스테필로코칼 엔테로톡신 유래의 초항원 변이체 및 이에 표적 특이적 폴리펩타이드가 연결된 융합단백질 및 그 용도
WO2015133882A1 (ko) ScFv 항체 라이브러리, 이의 제조방법 및 이를 이용한 ScFv 항체 스크리닝 방법
WO2014077648A1 (ko) 인간 및 마우스 ｌ１ｃａｍ 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2014025198A2 (ko) Lfa3 변이체 및 상기 변이체 또는 lfa3 cd2 결합영역과 이에 표적 특이적 폴리펩타이드가 연결된 융합단백질 및 그 용도
WO2022039490A1 (en) Anti-b7-h4/anti-4-1bb bispecific antibodies and use thereof
WO2010126279A2 (ko) 사이토케라틴１７-특이적인 인간항체
WO2017010744A1 (ko) 엑소좀 단백질 ｅｉｆ3ａ 특이반응 오토항체검출용 항원 조성물 및 이를 이용한 간암진단법
WO2013103248A1 (ko) Ｄｌｋ１ 세포 외 수용성 도메인을 유효성분으로 포함하는 미오스타틴 저해제
WO2012138102A2 (ko) Ｄｌｋ１ 특이적 인간 항체 및 이를 포함하는 약학적 조성물
WO2017074013A1 (ko) 인간 및 마우스 sema3a에 교차결합하는 항체 및 그의 용도
WO2022216014A1 (ko) 항-cntn4 항체 및 그의 용도
WO2022177392A1 (ko) Cd47에 대한 단일 도메인 항체 및 이의 용도
WO2019078591A1 (ko) 세포막 유동성을 이용한 다중체 단백질 디스플레이 시스템
WO2020117019A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2020117017A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2020159229A1 (ko) Ccsp-2에 특이적으로 결합하는 단일클론항체 및 이의 용도
WO2019093807A2 (ko) Il-17a 에 특이적으로 결합하는 항체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10769924

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10769924

Country of ref document: EP

Kind code of ref document: A2