WO2012096463A2 - 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 조성물 및 이의 용도 - Google Patents

복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 조성물 및 이의 용도 Download PDF

Info

Publication number
WO2012096463A2
WO2012096463A2 PCT/KR2011/010247 KR2011010247W WO2012096463A2 WO 2012096463 A2 WO2012096463 A2 WO 2012096463A2 KR 2011010247 W KR2011010247 W KR 2011010247W WO 2012096463 A2 WO2012096463 A2 WO 2012096463A2
Authority
WO
WIPO (PCT)
Prior art keywords
allergic
cells
dermatitis
extract
skin
Prior art date
Application number
PCT/KR2011/010247
Other languages
English (en)
French (fr)
Other versions
WO2012096463A3 (ko
Inventor
진미림
Original Assignee
대전대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020110003477A external-priority patent/KR101189938B1/ko
Priority claimed from KR1020110003478A external-priority patent/KR101231446B1/ko
Application filed by 대전대학교 산학협력단 filed Critical 대전대학교 산학협력단
Publication of WO2012096463A2 publication Critical patent/WO2012096463A2/ko
Publication of WO2012096463A3 publication Critical patent/WO2012096463A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/23—Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/904—Stemonaceae (Stemona family), e.g. croomia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A61K8/9789—Magnoliopsida [dicotyledons]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A61K8/9794—Liliopsida [monocotyledons]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/005—Preparations for sensitive skin

Definitions

  • the present invention relates to a composition for the prevention and improvement and the use thereof containing a complex herbal extract of Bupyeongcho, casualty and baekryeok as an active ingredient.
  • Epithelial tissue is mainly composed of keratinocytes and contains Langerhans cells, T cells and macrophages (2).
  • Most skin diseases are characterized by an inflammatory response by immune cells and are accompanied by clinical symptoms such as itching, edema, erythema, eczema and scaling.
  • antigen-presenting cells recognize antigens that invade from the outside, chemotactic factors are secreted, eosinophils and mast cells are introduced, and T cells are activated and gathered into damaged tissues.
  • cytokines secreted from activated T cells is known to act as a pathogen of dermatitis (3). They cause itching and increase the influx of inflammatory cells, leading to allergic or non-allergic skin diseases such as psoriasis as well as atopic dermatitis and contact dermatitis (Incorvaria C et al., Allergy and the skin Clin Exp Immunol 153 suppl 1: 27-29 (2008); Anna Paula Galli Snchez, Immunopathogenesis of psoriasis An Bras Dermatol 85 (5): 747-9 (2009); Werfel T, Wittmann M., T cell regulation in allergy, asthma and atopic skin disease Chem Immunol Allergy 94: 101-11 (2008).
  • IL-31 is produced in activated T cells (more expressed in Th2 cells) and belongs to the IL-6 cytokine family.
  • IL-31 receptors consist of the gp-130 receptor (GPL, or IL-31RA) and oncostatin M receptor (OSMR), which are present in epithelial cells and keratinocytes.
  • GPL gp-130 receptor
  • OSMR oncostatin M receptor
  • IL-31 receptors in epithelial cells, keratinocytes, and macrophages isolated from patients with atopic dermatitis is known to increase.
  • transgenic mice that inject IL-31 into the skin of mice or continue to express IL-31 show severe itching and significant influx of eosinophils and mast cells into the skin tissue, which is a major pathological factor for deepening dermatitis.
  • IL-2 secreted from T cells stimulates and activates proliferation of T cells.
  • Bupyeongcho (Spirodela polyrrhiza ) is a perennial herb with Chunnamseong . It is a small grass that floats on the water, and it is also known as Bupyeongcho, which is known as Bupyeongcho. (Joo In-seop et al., Hyangje Brown, Younglimsa, pp.277 ⁇ 278, 1998).
  • Torilis japonica DC refers to the fruit of a year-old herbaceous herbaceous and related plant, which is an annual herb of the apiaceae, distributed in central and northern Korea. Isovaleric esters are known, and the effects of antitrichomonas and similar effects such as sex hormones have been known.
  • Stem japonica MIQ is a perennial herb and is native to China and refers to the roots of the albino and coriander plant. It is known as a component of stemonine, stemonidine, isostmonine, etc. It has been known to have the effect of insecticides, etc. (Information, et al., Herbal Metabolism, Younglimsa, pp.152 ⁇ 154, 1998).
  • the present inventors found that itching and erythema and swelling of skin tissues were significantly reduced and that epidermis and dermis thickness were reduced when oral administration of herbal extract (MJ201) composed of Bupyeongcho, casualty and baekryeok to NC / Nga atopic dermatitis mice. Inhibition of the increase and the influx of eosinophils and mast cells was significantly reduced. Induction of contact dermatitis and oral administration of MJ201 to mice significantly reduced IgE production and decreased IL-31 expression and IL-2 production from isolated CD4 + T cells.
  • herbal extract MJ201
  • IL-31 expression and IL-2 production of EL-4 T cells activated by PMA and ionomycin significantly decreased MJ201, reducing the itch of various skin diseases, skin inflammation, erythema, By suppressing the occurrence of pathological damage such as edema and increased thickness, it can be applied to various skin disease treatments.
  • the present inventors completed the present invention by confirming the suppression of pathological damage such as itching, dermatitis, erythema, and edema thickness of the herbal extract composed of Bupyeongcho, casualty, and baekryeok.
  • the present invention provides a pharmaceutical composition for the prevention and treatment of allergic or non-allergic skin diseases containing a complex herbal extract of herbal extract (MJ201) consisting of Bupyeongcho, casualty and baekryeok as an active ingredient. .
  • a complex herbal extract of herbal extract MJ201
  • Complex herbal extract as defined herein has a dry weight ratio (w / w) of Bupyeongcho, casualty and albino to 1 to 10: 1 to 10: 1, preferably 1 to 5: 1 to 5: 1, more preferably 1 -3: 1-3: 1.
  • an “extract” is one or more selected from the group consisting of water, ethanol, methanol, propanol, butanol, acetone, ethyl acetate, hexane, butylene glycol, propylene glycol, hydrobutylene glycol, hydrous propylene glycol, hydrous glycerin Solvents, preferably water and ethanol, most preferably 60% to 90% ethanol soluble extract.
  • allergic or non-allergic skin diseases include allergic skin diseases including hypersensitivity, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, atopic dermatitis, allergic contact dermatitis, urticaria, insects Allergy, food allergy or drug allergy, preferably allergic rhinitis, asthma, allergic dermatitis, atopic dermatitis, allergic contact dermatitis, urticaria, food allergy or drug allergy, more preferably atopic dermatitis or contact dermatitis It can be mentioned;
  • Non-allergic skin diseases include non-allergic eczema (irritant dermatitis, seborrheic dermatitis, molecular eczema, congestive dermatitis, chronic simple salivary glands, han herpes, senile eczema), primary simple contact dermatitis, psoriasis, psoriasis, etc. Includes irritant dermatitis or sebor
  • the dry weight ratio of Bupyeongcho, casualty and baekryeok drug is 1 ⁇ 10: 1 ⁇ 10: 1 ⁇ 10, preferably 1 ⁇ 5: 1 ⁇ 5: 1 ⁇ 5, more
  • the compound herbal medicines of the present invention have been used for a long time as a herbal medicine and edible, herbal extracts of the present invention extracted from them also have no problems such as toxicity and side effects, and has been proved to be a non-irritant sample in the skin patch test for a long time use We can use in peace in city.
  • the present invention provides a pharmaceutical composition for the prevention and treatment of allergic or non-allergic skin diseases, containing as an active ingredient a complex herbal extract obtained by the above production method.
  • the present invention provides a method for treating allergic or non-allergic skin disease patients, comprising administering a herbal extract (MJ201) consisting of Bupyeongcho, casualty and baekryeeun to allergic or non-allergic skin disease patients to provide.
  • a herbal extract consisting of Bupyeongcho, casualty and baekryeeun to allergic or non-allergic skin disease patients to provide.
  • the present invention provides the use of the herbal extract (MJ201) composed of Bupyeongcho, casualty and baekryeok for the preparation of a medicament for the treatment of allergic or non-allergic skin diseases.
  • MJ201 herbal extract
  • Herbal extract of Bupyeongcho, casualty, baekryeok of the present invention is useful in the treatment and prevention of allergic or non-allergic skin diseases by confirming the suppression of the occurrence of pathological damage, such as reducing itching, skin inflammation, erythema, edema thickness It was confirmed.
  • the present invention provides a health functional food for the prevention and improvement of allergic or non-allergic skin diseases containing the complex herbal extract obtained by the above production method as an active ingredient.
  • the pharmaceutical composition for the prevention and treatment of allergic or non-allergic skin diseases containing the complex herbal extract of the present invention comprises 0.1 to 50% by weight of the complex herbal extract based on the total weight of the composition.
  • composition as described above is not necessarily limited thereto, and may vary according to the condition of the patient and the type and extent of the disease.
  • the pharmaceutical composition containing the complex herbal extract of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.
  • compositions containing the complex herbal extracts according to the present invention may be prepared in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral formulations, external preparations, suppositories, and sterile injectable solutions, respectively. It can be formulated and used in the form.
  • Carriers, excipients and diluents that may be included in the composition containing the extract of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber Alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil have.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
  • Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, which form at least one excipient such as starch, calcium carbonate, sucrose or lactose in the compound. Mixed with gelatin.
  • lubricants such as magnesium stearate and talc are also used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the amount of the complex herbal extract of the present invention may vary depending on the age, sex, and weight of the patient, but may be 0.1 to 100 mg / kg, preferably 1 to 10 mg / kg once or several times daily.
  • the dosage may also be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, age, and the like. Therefore, the above dosage does not limit the scope of the present invention in any aspect.
  • the pharmaceutical composition may be administered to various mammals such as mice, mice, livestock, humans, and the like. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.
  • the present invention provides a dietary supplement for the prevention and improvement of allergic or non-allergic skin diseases, which contains a complex herbal extract of Bupyeongcho, casualty, baekryeokeun as an active ingredient.
  • Foods to which it may be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, tea vitamin complexes, and health functional foods.
  • the extract itself of the present invention has little toxicity and side effects, it is a drug that can be used safely even when taken for a long time for the purpose of prevention.
  • the extract of the present invention may be added to food or beverages for the purpose of preventing and improving allergic or non-allergic skin diseases.
  • the amount of the composite herbal extract in the food or beverage may be added in 0.01 to 15% by weight of the total food weight
  • the health functional beverage composition is added in a ratio of 0.02 to 10g, preferably 0.3 to 1g based on 100ml Can be.
  • the health functional beverage composition of the present invention is not particularly limited to other ingredients except for containing the extract as an essential ingredient in the indicated ratio, and may contain various flavors or natural carbohydrates as additional ingredients, such as ordinary drinks.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents such as, tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • the proportion of said natural carbohydrates is generally about 1-20 g, preferably about 5-12 g per 100 ml of the composition of the present invention.
  • the herbal extract of the present invention may be used in various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors such as flavoring agents, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid And salts thereof, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the extracts of the present invention may contain pulp for the production of natural fruit juices and vegetable drinks. These components can be used independently or in combination. The proportion of such additives is not so critical but is usually selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the extract of the present invention.
  • composition as described above is not necessarily limited thereto, and may vary according to the condition and the degree of progression of the patient.
  • the present invention provides a cosmetic composition for the prevention and improvement of allergic or non-allergic skin diseases containing a complex herbal extract of the herbal extract (MJ201) composed of Bupyeongcho, casualty and baekryeok as an active ingredient.
  • a complex herbal extract of the herbal extract MJ201
  • the cosmetic composition includes a lotion, skin, lotion, nutrition lotion, nutrition cream, massage cream, essence, the formulation of the pack.
  • complex herbal extract of the present invention can be used in a variety of cosmetics and face wash having a whitening effect.
  • Products to which the composition can be added include, for example, cosmetics such as lotion, skin, lotion, nourishing lotion, nourishing cream, massage cream, essence, pack, etc., and cleansing, face wash, soap, treatment, essence, etc. have.
  • Cosmetics of the present invention comprises a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, polymer peptides, polymer polysaccharides, sphingolipids and seaweed extract.
  • the water-soluble vitamins may be any compound that can be incorporated into cosmetics, but preferably vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, vitamin H, and the like.
  • Their salts thiamine hydrochloride, sodium ascorbate salt, etc.
  • derivatives ascorbic acid-2-sodium phosphate salt, ascorbic acid-2-magnesium phosphate salt, etc.
  • the water-soluble vitamins can be obtained by conventional methods such as microbial transformation, purification from microorganism culture, enzyme or chemical synthesis.
  • the oil-soluble vitamin may be any compound that can be incorporated into cosmetics, but preferably vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), and the like. And derivatives thereof (ascorbic palmitate, ascorbic stearate, ascorbic acid dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherolvitamin E, dl-pantothenyl alcohol, D-pantothenyl alcohol, pantotenylethyl Ethers, etc.) are also included in the oil-soluble vitamins used in the present invention. Oil-soluble vitamins can be obtained by conventional methods such as microbial transformation, purification of microorganism culture, enzyme or chemical synthesis.
  • the polymer peptide may be any compound as long as it can be incorporated into cosmetics.
  • collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin, and the like can be given.
  • Polymeric peptides can be purified and obtained by conventional methods such as purification from microbial cultures, enzymatic methods or chemical synthesis methods, or can be purified and used from natural products such as dermis and pig silk such as pigs and cattle.
  • the polymer polysaccharide may be any compound as long as it can be blended into cosmetics.
  • hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or a salt thereof (sodium salt, etc.) may be mentioned.
  • chondroitin sulfate or its salt, etc. can be normally purified from a mammal or fish.
  • the sphingolipid may be any compound as long as it can be blended into cosmetics.
  • ceramide, phytosphingosine, sphingosaccharide lipid, etc. may be mentioned.
  • Sphingo lipids can usually be purified from mammals, fish, shellfish, yeasts or plants by conventional methods or obtained by chemical synthesis.
  • the seaweed extract may be any compound as long as it can be blended into cosmetics.
  • the seaweed extract may include brown algae extract, red algae extract, green algae extract, and the like.
  • calginine, arginic acid, sodium arginate, Potassium arginate and the like are also included in the seaweed extract used in the present invention.
  • Seaweed extract can be obtained by purification from seaweed by conventional methods.
  • Other components that may be added include fats and oils, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, fungicides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, flavorings, Blood circulation accelerators, cooling agents, restriction agents, purified water and the like.
  • Examples of the fat or oil component include ester fats, hydrocarbon fats, silicone fats, fluorine fats, animal fats, and vegetable fats and oils.
  • ester fats and oils As ester fats and oils, glyceryl tri2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl mystinate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, and stearic acid Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl acid isocetyl, isostyl acid isostearyl, isostaryl palmitate, octylate acid octyldodecyl, isostearic acid isetyl, diethyl sebacate, adipine Acid isopropyl, isoalkyl neopentane, tri (capryl, capric acid) glyceryl, tri
  • Hydrocarbon-based fats and oils such as squalene, a liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, a liquid isoparaffin, polybutene, microcrystal wax, and a vaseline, etc. are mentioned as a hydrocarbon-type fats and oils.
  • silicone-based oils and fats examples include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane and methylcetyloxysiloxane copolymer, dimethylsiloxane and methyl steoxysiloxane copolymer and alkyl.
  • Modified silicone oil amino modified silicone oil and the like.
  • Perfluoro polyether etc. are mentioned as fluorine-based fats and oils.
  • Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, soybean oil, soybean oil, corn oil, rapeseed oil, almond oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil. , Cottonseed oil, Palm oil, Cucumber nut oil, Wheat germ oil, Rice germ oil, Shea butter, Walnut colostrum oil, Marker demia nut oil, Meadow home oil, Egg yolk oil, Uji, Horse oil, Mink oil, Orange rape oil, Jojoba oil And animal or plant fats and oils such as candeler wax, carnava wax, liquid lanolin and hardened castor oil.
  • the moisturizing agent examples include a water-soluble low molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer.
  • fat-soluble low molecular humectants examples include cholesterol and cholesterol esters.
  • water-soluble polymer examples include carboxyvinyl polymer, polyasparaginate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water soluble chitin, chitosan, and dextrin. Can be.
  • fat-soluble polymers examples include polyvinylpyrrolidone-eicosene copolymers, polyvinylpyrrolidone-hexadecene copolymers, nitrocellulose, dextrin fatty acid esters, polymer silicones, and the like.
  • emollient examples include long-chain acyl glutamic acid cholesteryl esters, hydroxy stearic acid cholesterol, 12-hydroxystearic acid, stearic acid, rosin acid, lanolin fatty acid cholesteryl esters, and the like.
  • nonionic surfactant nonionic surfactant, anionic surfactant, cationic surfactant, amphoteric surfactant, etc. are mentioned.
  • nonionic surfactant self-emulsifying glycerin monostearate, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbitan fatty acid ester, POE Glycerin Fatty Acid Ester, POE Alkyl Ether, POE Fatty Acid Ester, POE Cured Castor Oil, POE Castor Oil, POE ⁇ POP (Polyoxyethylene Polyoxypropylene) Copolymer, POE / POP Alkyl Ether, Polyether Modified Silicone, Laurin Acid Alkanolamide, alkylamine oxide, hydrogenated soybean phospholipid, etc. are mentioned.
  • Anionic surfactants include fatty acid soaps, alpha-acyl sulfonates, alkyl sulfonates, alkyl allyl sulfonates, alkyl naphthalene sulfonates, alkyl sulfates, POE alkyl ether sulfates, alkylamide sulfates, alkyl phosphates, POE alkylphosphates, and alkylamides.
  • amphoteric surfactants include the carboxybetaine type, the amide betain type, the sulfobetain type, the hydroxysulfobetain type, the amide sulfobetain type, the phosphobetaine type, the aminocarboxylate type, the imidazoline derivative type, and the amideamine type.
  • An amphoteric surfactant etc. are mentioned.
  • Organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium film mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide
  • Inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine and composites thereof; Polyamide, Polyester, Polypropylene, Polystyrene, Polyurethane, Vinyl Resin, Urea Resin, Phenol Resin, Fluoro Resin, Silicon Resin, Acrylic Resin, Melamine Resin, Epoxy Resin, Polycarbonate Resin, Divinylbenzene Styrene Copolymer, Silk Organic pigments such as powder, cellulose, CI pigment yellow, CI pigment orange,
  • Metal soaps such as a calcium stearate; Alkyl phosphate metal salts such as sodium cetylinate, zinc lauryl acid and calcium laurate; Acylamino acid polyvalent metal salts such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc, and N-lauroylglycine calcium; Amide sulfonic acid polyvalent metal salts, such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; N-epsilon-lauroyl-L-lysine, N-epsilon-palmitolyzine, N-alpha-paratoylol nitin, N-alpha-lauroyl arginine, N-alpha-cured fatty acid acyl arginine -Acyl basic amino acid; N-acyl polypeptides, such as N-lauroyl glyc
  • Examples of the ultraviolet absorber include paraaminobenzoic acid, ethyl paraaminobenzoate, amyl paraaminobenzoic acid, octyl paraaminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomentyl salicylic acid and benzyl cinnamic acid.
  • paraaminobenzoic acid ethyl paraaminobenzoate, amyl paraaminobenzoic acid, octyl paraaminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomentyl salicylic acid and benzyl cinnamic acid.
  • fungicides hinokithiol, trichloric acid, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, ginxitlionone, benzalkonium chloride, photosensitive Sodium No. 301, sodium mononitroguicol, undecylenic acid, and the like.
  • antioxidants examples include butylhydroxyanisole, propyl gallic acid, and erythorbic acid.
  • pH adjuster examples include citric acid, sodium citrate, malic acid, sodium malate, fmaric acid, sodium pmarate, succinic acid, sodium succinate, sodium hydroxide, sodium dihydrogen phosphate, and the like.
  • Examples of the alcohol include higher alcohols such as cetyl alcohol.
  • the compounding component which may be added other than this is not limited to this, Moreover, although all the said components can be mix
  • the cosmetic of the present invention may take the form of a solution, an emulsion, a viscous mixture, or the like.
  • Components included in the cosmetic composition of the present invention may include components commonly used in cosmetic compositions in addition to the complex herbal extract as an active ingredient, for example, such as stabilizers, solubilizers, vitamins, pigments and flavorings Phosphorus aids and carriers.
  • the cosmetic composition of the present invention may be prepared in any formulation commonly prepared in the art, and includes, for example, milky lotion, cream, lotion, pack, foundation, lotion, essence, hair cosmetic, and the like.
  • the cosmetic composition of the present invention skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisturizing cream, hand cream, foundation, essence, nutrition essence, Formulations of packs, soaps, cleansing foams, cleansing lotions, cleansing creams, body lotions and body cleansers.
  • the formulation of the present invention is a paste, cream or gel
  • animal carriers vegetable fibers, waxes, paraffins, starches, tracantes, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide, etc.
  • carrier components can be used as carrier components.
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellant such as butane or dimethyl ether.
  • a solvent, solvating or emulsifying agent is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.
  • liquid carrier diluents such as water, ethanol or propylene glycol
  • suspension agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline Cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.
  • the carrier component is aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide.
  • Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
  • Herbal extract of Bupyeongcho, casualty, baekryeok of the present invention is useful in the treatment and prevention of allergic or non-allergic skin diseases by confirming the suppression of the occurrence of pathological damage, such as reducing itching, skin inflammation, erythema, edema thickness
  • a composition can be provided.
  • Ear biopsies were stained (hematoxylin and eosin (H & E) (left panel) and toluidine blue (right panel)) to examine inflammatory and mast cells, and the stained tissue was examined under a light microscope (Nikon, Japan, orignalmagnification, x200).
  • Figure 2 shows the histological results of the embryonic skin in NC / Nga mice, animals were administered saline (Naive) or MJ201 (250 mg / kg / day) for 6 weeks.
  • a back skin biopsy was performed to examine inflammatory and mast cells (hematoxylin and eosin (H & E) (left panel) and toluidine blue (right panel)) and stained tissues under a light microscope (Nikon, Japan, orignalmagnification, x200).
  • H &E-a Naive, b; Control, c; CsA, d; MJ201, Toluidine blue-e; Naive, f; Control, g; CsA, h; MJ201
  • Figure 3 shows the effect on the number of WBC (white blood cells) in the blood of NC / Nga mice.
  • Blood was collected from DNCB-induced NC / Nga mice to measure the number of WBC (white blood cells) in the blood by Hematological parameters Is the result of the analysis,
  • Figure 4 shows the effect on the blood cell count of WBC (white blood cell) in the blood of NC / Nga mice by collecting blood from DNCB-induced NC / Nga mice by WBC Differential Counting (Neutrophills, Monocytes) in WBC with hematological parameters It is the result of analysis expressed in%,
  • FIG. 5 shows the effect on the number of cells in the embryonic skin of NC / Nga mouse. The results of counting microscopically isolated cells after chopping a certain amount of embryonic skin tissue in DNCB-induced NC / Nga mice are shown. ,
  • Figure 6 shows the effect on the number of cells of ALN in NC / Nga mouse in two NCN-induced NC / Nga mice extracted two ALN (auxiliary lymph node) per head, cells were separated and counted cells under a microscope One result,
  • Figure 7 shows the effect on the fluorescence flow of the cells isolated from ALN of NC / Nga mouse in two NCN-induced NC / Nga mice extracted two ALN (auxiliary lymph node) per animal after separating the cells
  • Anti-CD4-FITC and anti-CD8-PE were added to the solution and reacted on ice for 30 minutes, followed by immunofluorescence staining, followed by flow cytometry (FACs) analysis.
  • Figure 8 shows the effect on the fluorescence flow of the cells isolated from ALN of NC / Nga mouse to extract two ALN (auxiliary lymph node) per one in NC / Nga mice induced by DNCB and separated the cells respectively
  • Anti-CD3-PE, anti-CD69-FITC, anti-B220- FITC and anti-CD23-PE were added and reacted on ice for 30 minutes, followed by immunofluorescence staining, and analyzed by flow cytometry (FACs).
  • Figure 9 shows the effect on the fluorescence flow of the cells isolated from ALN of NC / Nga mouse in two NCN-induced NC / Nga mice extracted two ALN (auxiliary lymph node) per one and then separated cells After the anti-CD11b-FITC was added to the reaction in ice for 30 minutes, immunofluorescence staining was performed, followed by flow cytometry (FACs) analysis.
  • FACs flow cytometry
  • Figure 10 shows the effect on the fluorescence flow of the cells isolated from the embryonic skin of NC / Nga mouse finely chopping a certain amount of embryonic skin tissue per one in DNCB-induced NC / Nga mice finely separated cells It was analyzed by flow cytometry (FACs) after immunofluorescence staining by adding anti-CD4-FITC, anti-CD11b-FITC, anti-Gr-1-PE and reacting on ice for 30 minutes.
  • FACs flow cytometry
  • Figure 11 shows the effect on the fluorescence flow of the cells isolated from the embryonic skin of NC / Nga mouse, finely chopping a certain amount of embryonic skin tissue in DNCB-induced NC / Nga mice after separating the cells to each Anti-CCR3-PE was added and reacted on ice for 30 minutes, followed by immunofluorescence staining, followed by flow cytometry (FACs) analysis.
  • FACs flow cytometry
  • Figure 12 shows the effect on the cytokine (IgE) in the serum isolated from the blood of NC / Nga mouse was collected by cardiac puncture method in the state of anesthesia of DNCB-induced NC / Nga mice with ethyl ether The serum was obtained and the IgE concentration was measured using an ELISA kit.
  • IgE cytokine
  • Figure 13 shows the effect on the cytokine (IL) in serum isolated from the blood of NC / Nga mouse was collected by cardiac puncture method under the anesthesia of DNCB-induced NC / Nga mice with ethyl ether Serum obtained and measured the IL-5, 13 concentration using the ELISA kit,
  • Figure 14 shows the effect on the cytokine in the culture medium of splenocytes of NC / Nga mouse, 96-well culture coated with anti-CD3 (1 ⁇ g / ml) antibody after separating the cells by spleen extraction from NC / Nga mice After culturing for 48 hours in a plate, the culture medium was taken, and the results of IL-4 and IFN- ⁇ concentrations were measured using an ELISA kit.
  • FIG. 15 shows the effect of MJ201 on sensory evaluation of NC / Nga mice.
  • the sensory evaluation was performed by clinical visual evaluation method commonly used in atopic dermatitis at 1, 3, and 5 weeks after drug treatment. Silver erythema, pruritus & dry skin, edema and hematoma, erosion, lichenification, etc. Scored as (1), severity (2), severe (3),
  • 16 is a result showing the effect of MJ201 on the scratching behavior in NC / Nga mouse, and the number of scratching occurrences of the scratching behavior was read for 20 minutes (* ⁇ 0.05, ** ⁇ ⁇ 0.01, *** ⁇ ⁇ 0.001);
  • FIG. 18 shows the effect of MJ201 on IL-31 mRNA expression in CD4 + T cells.
  • Animals were treated with DNCB to induce contact dermatitis and treated with saline (Naive) or MJ201 (250 mg / kg / day for 4 consecutive days. day), CD4 + T cells were isolated from the spleen and stimulated with anti-CD3 and anti-CD28 antibodies for 6 hours and IL-31 mRNA levels were characterized by quantitative real-time PCR. Will;
  • FIG. 19 is a diagram showing the effect of MJ201 on IL-2 production in CD4 + T cells, MJ201 (250 mg / kg / day) was orally administered to BALB / c mice for 4 days, animals were sacrificed the next day, CD4 + T cells were isolated and anti-CD3 and anti-CD28 antibodies for 6 hours Stimulated and IL-2 levels in culture supernatants were measured by ELISA;
  • FIG. 20 is a diagram showing the effect of MJ201 on the production of IgE, the serum level of IgE was measured by ELISA, individual bars (mean SEM) of the blood IgE level (mean SEM) (* ⁇ ⁇ 0.05, ** ⁇ ⁇ 0.01, *** ⁇ ⁇ 0.001);
  • FIG. 21 is a diagram showing the effect of MJ201 on IL-31 mRNA expression in activated EL-4 T cells, EL-4 T cells were pretreated with 60 ⁇ g / ml of MJ201 for 1 hour, stimulated with PMA (50 ng / ml) and Inomycin (0.25 ⁇ M) for 6 hours, and quantitative real time PCR of IL-31 mRNA levels Measured by;
  • FIG. 22 is a diagram showing the effect of MJ201 on IL-2 production in activated EL-4 T cells, EL-4 T cells pretreated with 60 ⁇ g / ml MJ201 for 1 hour, PMA (50ng) for 6 hours / Ml) and Inomycin (0.25 ⁇ M) and IL-2 production levels were measured by quantitative real time PCR (* p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001).
  • Erlenmeyer flasks were mixed in three proportions of dry chemicals purchased from herb feeders ( http://www.herbforyou.net , Daejeon, Korea) in equal proportions. 300 g of the drug mixture was extracted with 80% ethanol mixed with 95% ethanol and distilled water at 80:20 for 1 day at room temperature. After extracting the extract obtained by repeated extraction three times in this manner was filtered and concentrated under reduced pressure using a rotary evaporator (Rotary evaporator) and then freeze-dried to obtain 70g of ethanol extract of the crude drug was named MJ201. MJ201 was stored at ⁇ 20 ° C. in powder form.
  • NC / Nga mice (Male, 6 weeks old) and BALB / c mice (Female, 4 weeks old) were purchased from Korea Biolink (Korea), supplied with solid feed (Samyang Feed Co.) and water, and room temperature 22 ⁇ 2 , Humidity 50 ⁇ 70%, Illumination time 12 hours (08:00 ⁇ 20:00), Illumination 150 ⁇ 300Lux was set to the laboratory environment for one week and then used in the experiment.
  • EL-4 T lymphoma cells were purchased from Korea Cell Line Bank (Seuol, Korea), and 10% fetal bovine serum (FBS), penicillin 100U / ml and streptomycin 100 ⁇ g / ml were added to RPMI 1640 at 37 ° C and 5% CO 2. Incubated at.
  • FBS fetal bovine serum
  • penicillin 100U / ml penicillin 100U / ml
  • streptomycin 100 ⁇ g / ml were added to RPMI 1640 at 37 ° C and 5% CO 2. Incubated at.
  • Reagents used in this experiment were MJ201 (herb-for-oil), anti-CD3 / anti-CD28 (BDbiosciences Co., Korea), Phorbol 12-myristate 13-acetate (PMA), Ionomycin, isopropanol, chloroform (Sigma Co., USA) ), Trizol, DEPC water (Invitrogen Co., USA), VarioMACS (Miltenyi Biotec Co., Germany), SYBRPCR Master Mix, TaqManExpression Master Mix (Applied Biosystems Co., USA), Prime Script RT reagent kit (TAKARA Co., JAPAN), Maxime PCR PreMix Kit (iNtRON Biotechnology Co., Korea), IgE ELISA kit for mouse (SAIBAYAGI Co., Itd.JAPAN), RPMI-1640, dulbecco's phosphate buffered saline (D-PBS), fetal bovine serum (FBS ), penicillin and streptomycin were used by
  • the instrument used in this experiment was microplate spectrophotometer (Molecular Devices, USA), CO 2 incubator (Formascientific Co., USA), cleanbench (Visionscientific Co., Korea), autoclave (Sanyo, Japan), micro-pipet (Gilson, France). ), waterbath (VisionscientificCo., Korea), vortexmixer (VisionscientificCo., Korea), real-time PCR (Applied Biosystems Co., USA), centrifuge (Sigma Co., USA), Microscopy (Nikon, JAPAN), etc. were used. .
  • the tip of the ear and the back skin were removed and fixed in 10% paraformaldehyde for 24 hours.
  • the tissue was formatted with paraffin and a block was made to a thickness of 5 ⁇ m.
  • Epidermis, dermis, keratinocytes and neutrophils / eosinophil were stained using hematoxyline and Eosin (H & E) staining, and mast cell infiltration was observed using toluidine blue staining.
  • TNCB was treated on the back of NC / Nga mice to induce dermatitis and administered orally at a dose of 250 mg / kg daily for 6 weeks.
  • part of the ear and back skin were cut and then H & E stained and toluidine stained.
  • H & E staining the epidermis and dermis of the control group were significantly expanded to edema and leukocyte infiltration was also observed (Fig. 1.b and Fig. 2.b).
  • the MJ201-administered group reduced epidermis and dermis thickness and inhibited leukocyte infiltration (FIG. 1 d and FIG. 2 d).
  • WBC leukocytes
  • RESULTS Reduction of activated CD4 +, CD8 + T cells (FIG. 7), CD3 + CD69 +, an early activation marker of T cells, and B220 + CD23, an initial activation marker of B cells (FIG. 8), and CD11b + macrophage cell reduction effects ( As shown in FIG. 9, it is considered that there is a reduction effect of related immune cells.
  • RESULTS The decrease of activated CD4 + T cells, the markers of mature granulocytes, CD11b + Gr-1 + (FIG. 10) and the chemokine receptor CCR3 + (FIG. 11) are thought to be effective in reducing immune cells.
  • DNCB-induced NC / Nga mice were collected by cardiac puncture under anesthesia with ethyl ether, and serum was isolated by centrifugation at 6,500 rpm for 20 minutes.
  • IL-5, 13, and IgE concentration was measured as follows using an ELISA kit.
  • the antibody was diluted in the coating buffer solution and coated on the microwell, and then overnight at 4 ° C. Each well was washed three times with a buffer solution, and then 100 ⁇ l of serum (100-fold dilution) was dispensed. This was allowed to stand at room temperature for 1 hour, washed twice with washing buffer solution, and then treated with 100 ⁇ l of avidin-HRP conjugated antibody, and washed again at room temperature for 1 hour. 100 ⁇ l of TMB substrate was dispensed here, and left standing in the dark for 30 minutes. After treatment with 50 ⁇ l of stop solution, the absorbance was measured at 450 nm of ELISA reader.
  • Spleens were extracted from NC / Nga mice, cells were separated with 100 mesh, centrifuged for 5 minutes (1200 rpm) with DMEM (5% FBS), and then ACK solution (8.3 g NH 4 Cl, 1 g KHCO 3 in 1 L of Demineralized water + 0.1 mM EDTA) was treated for 5 minutes at room temperature to dissociate erythrocytes.
  • the isolated splenocytes (1 ⁇ 10 5 cells / well) were incubated for 48 hours in a 96-well culture plate coated with anti-CD3 (1 ⁇ g / mL) antibody, and then cultured with IL-4, IFN using ELISA kit. - ⁇ was measured.
  • the measuring method is the same as the measuring method of cytokines in serum.
  • Ear skin tissues of NC / Nga mice were removed, 500 ⁇ l of Trizol reagent was added to the tube, and 100 ⁇ l of chloroform was mixed. When the layers were separated by centrifugation, 200 ⁇ l of aqueous phase solution was taken and transferred to a tube. The same amount of isopropanol was added thereto and left at room temperature for 10 minutes, followed by centrifugation. The supernatant was removed, and 1 ml of 75% ethanol was mixed well, followed by centrifugation to completely remove the supernatant, dried until it became clear, and then dissolved in 20 ⁇ 50 ⁇ l of DEPC water according to the amount of RNA.
  • RNA was quantified and adjusted to 200ng / ⁇ l, and cDNA was synthesized according to the manufacturer's instructions using Prime Script TM RT reagent kit. After making cDNA, the cDNA was put into Maxime PCR PreMix Kit, and RT-PCR was performed 25 to 30 times at 94 ° C 30 seconds, 57 ° C 30 seconds, and 72 ° C 30 seconds (see Table 1).
  • mice The back of the BALB / c mice, 4 weeks old, were removed from the bottom of the ear to the top of the tail, and left for 24 hours to heal fine wounds on the skin.
  • the experiment was divided into three groups of five animals, and normal group and control group were treated with physiological saline, and MJ201 (250 mg / kg / day) was administered orally once daily for 4 days.
  • Serum IgE production was measured using the ELISA kit as follows. Antibodies coated with microwells were washed three times with a buffer solution and 50 ⁇ l of serum (10-fold dilution) was dispensed. This was allowed to react at room temperature for 2 hours, washed three times with washing buffer solution, and then treated with 50 ⁇ l of biotin-conjugated antibody at room temperature for 2 hours, and then reacted with 50 ⁇ l of HRP-avidin solution for 1 hour. 50 ⁇ l of TMB substrate (chromogenic substrate) was dispensed thereto, and left in the dark for 20 minutes, and then treated with 50 ⁇ l of stop solution. The reaction solution was measured for absorbance at 450nm ELISA reader.
  • MJ201 Two days after administration of MJ201 for 4 days, BALB / c mice were killed by cervical dislocation and lethal, and spleens were aseptically extracted to grind spleen tissue on nylon sieve (70 uM) in ice-cold RPMI medium to release immune cells. After centrifuging the cell suspension, erythrocytes were hemolyzed by adding RBC lysis buffer to the cell precipitate, followed by washing twice with PBS, and using a medium of RPMI 1640-FBS (RPM-1640 containing 10% FBS). The cell solution was prepared by adjusting 10 7 cells / ml.
  • Biotin-antibody cocktail, anti-biotin microBeads, and MACS buffer were added to the cell solution according to the instructions of the MACS CD4 + T cell kit, and the cells were loaded onto the MACS column to obtain CD4 + T cells. This was adjusted to 2 ⁇ 10 6 cells / and 2ml was dispensed into 6wells, followed by 6 hours incubation at 37 ° C and 5% CO 2 incubator with anti-CD3 / anti-CD28.
  • Splenocyte CD4 + T cells were injected into 6 wells at 2 ⁇ 10 6 cells /, and then stimulated with anti-CD3 / anti-CD28 for 6 hours to obtain cells.
  • CD4 + T cells were isolated from the spleen of mice that caused contact dermatitis, mRNA was obtained, and the expression levels of IL-31 were compared. In the group administered with MJ201, IL-31 mRNA expression was suppressed (FIG. 18).
  • CD4 + T cells were isolated from the spleen of mice that caused contact dermatitis, and supernatants of anti-CD3 and anti-CD28 activated CD4 + T cells were obtained.
  • the control group showed a two-fold increase in the production of IL-2 compared to the normal group, the IL-2 production in the MJ201 administration group showed a similar level as the normal group (see Fig. 19).
  • the concentration of IgE in the control group was 651.79 ⁇ 46.68 ng / ml, which was significantly higher than the normal group (319.47 ⁇ 58.44 ng / ml), and the MJ201 administration group was significantly reduced to 362.76 ⁇ 62.56 ng / ml.
  • MJ201 (60 ⁇ g / ml) was treated with EL-4 T cells activated with PMA and Ionomycin to obtain mRNA, and the expression levels of IL-31 were compared with those treated with PI compared to normal cells treated with PBS only. Expression of IL-31 was significantly increased in the control group, and IL-31 mRNA expression was suppressed in the cells treated with MJ201 (FIG. 21). After supernatant was obtained by treating M-4201 with PMA and Ionomycin-activated EL-4 T cells, IL-2 expression was increased in the control group compared to the normal group. Was significantly reduced than the control (FIG. 22).
  • the above ingredients are mixed and filled in an airtight cloth to prepare a powder.
  • tablets are prepared by tableting according to a conventional method for preparing tablets.
  • the above ingredients are mixed and filled into gelatin capsules to prepare capsules.
  • each component is added to the purified water to dissolve, the lemon flavor is appropriately added, the above components are mixed, the purified water is added, the whole is adjusted to 100 by adding purified water, and then filled into a brown bottle and sterilized. To prepare a liquid solution.
  • Vitamin B6 0.5
  • the formulation of the present invention is exemplified as a cream, massage cream, lotion, skin lotion, essence, packs, cleansing foam formulation, but is not limited to the formulation comprising the cosmetic composition of the present invention.
  • the oil phase and the water phase are each dissolved by heating to 75, and then cooled to room temperature.
  • the oil phase and the water phase are each heated to emulsified at 75 ° C. and then cooled to room temperature.
  • the aqueous phase and the ethanol phase are each prepared and mixed and filtered.
  • the aqueous phase and the ethanol phase are each prepared, mixed and filtered.
  • aqueous and ethanol phases are dispersed, dissolved and mixed, and then cooled to room temperature.
  • aqueous and oil phases are dispersed, dissolved and mixed, and then cooled and cooled to room temperature.
  • IL-31 expression and IL-2 production of EL-4 T cells activated by PMA and ionomycin significantly decreased MJ201, reducing the itch of various skin diseases, skin inflammation, erythema, By suppressing the occurrence of pathological damage such as edema and increased thickness, it can be applied to various skin disease treatments.

Abstract

본 발명은 알러지성 또는 비알러지성 피부 질환의 치료 및 예방에 유용한 혼합생약 추출물을 함유한 조성물을 제공한다.

Description

복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 조성물 및 이의 용도
본 발명은 부평초, 사상자 및 백부근의 복합 생약 추출물을 유효성분으로 함유하는 예방 및 개선용 조성물 및 이의 용도에 관한 것이다.
[문헌 1] Incorvaria C et al., Allergy and the skin Clin Exp Immunol 153 suppl 1:27-29 (2008)
[문헌 2] Anna Paula Galli Snchez, Immunopathogenesis of psoriasis An Bras Dermatol 85(5):747-9 (2009)
[문헌 3] Werfel T, Wittmann M., T cell regulation in allergy, asthma and atopic skin disease Chem Immunol Allergy 94:101-11 (2008)
[문헌 4] Asnis L.A et al., Cutaneous reaction to recombinant cytokine therapy J Am Acad Dermatol 24, 915-926, 1995
[문헌 5] 정보섭 외 1인, 향약 대사전, 영림사, pp.277~278, 1998
[문헌 6] 정보섭 외 1인, 향약 대사전, 영림사, pp.416~418, 1998
[문헌 7] 정보섭 외 1인, 향약 대사전, 영림사, pp.152~154, 1998
외부로부터의 자극과 항원에 대항하기 위하여 피부에는 다양한 면역세포가 존재하며 서로간의 복잡한 네트워크를 형성하며 항상성을 유지한다 (1). 상피조직은 주로 케라티노사이트로 구성되어있고 랑거한스 세포, T 세포와 대식 세포가 존재한다 (2). 대부분의 피부질환은 면역 세포에 의한 염증 반응을 특징으로 하며, 가려움, 부종, 홍반, 습진, 비늘화와 같은 임상 증상을 동반한다. 항원제시세포가 외부로부터 침입한 항원을 인지하면 화학유주인자가 분비되고 호산구와 비만세포가 유입되며, T 세포가 활성화되어 손상 조직으로 모여든다. 활성화된 T 세포로부터 분비되는 특정 사이토카인들이 과 발현되는 것은 피부염의 병리인자로서 작용한다는 것이 알려져 있다 (3). 이들은 가려움을 유발하고 염증세포의 유입을 증가시켜 아토피성 피부염, 접촉성 피부염뿐 만 아니라 건선과 같은 알러지성 혹은 비알러지성 피부 질환을 일으킨다(Incorvaria C et al., Allergy and the skin Clin Exp Immunol 153 suppl 1:27-29 (2008); Anna Paula Galli Snchez, Immunopathogenesis of psoriasis An Bras Dermatol 85(5):747-9 (2009); Werfel T, Wittmann M., T cell regulation in allergy, asthma and atopic skin disease Chem Immunol Allergy 94:101-11 (2008)).
IL-31은 활성화된 T 세포 (Th2 세포에서 더 많이 발현됨)에서 생산되는데 IL-6 사이토카인 가족 (family)에 속한다. IL-31수용체는 gp-130수용체 (GPL, or IL-31RA) 와 oncostatin M receptor (OSMR)로 구성되며, 상피세포와 케라티노사이트에 상시 존재한다. 아토피 피부염 환자의 피부조직에서는 IL-31의 발현이 현저히 증가되어 있으며 IL-4 와 IL-13 같은 Th2 사이토카인 증가를 유도한다고 여겨진다. 이들 Th2 사이토카인은 B 세포에 작용하여 IgE의 생산을 증가 시킬 수 있으며, IgE는 비만세포에 존재하는 수용체에 결합하여 히스타민등의 유리를 매개 함으로서 염증 반응과 가려움증을 일으킨다. 더불어 아토피 피부염 환자의 상피와 케라티노사이트, 환자에서 분리된 대식세포에서 IL-31수용체의 발현이 증가한다고 알려졌다. 또한 IL-31을 생쥐의 피부에 주입하거나 IL-31을 계속 발현하는 transgenic 생쥐는 심한 가려움증을 나타내며 호산구, 비만 세포의 피부 조직으로의 현저한 유입이 관찰되는 바, 피부염을 심화시키는 주요 병리 인자임을 알 수 있다. 한편 T 세포로부터 분비되는 IL-2은 T 세포의 증식을 자극하고 활성화시킨다. IL-2로 치료 받는 암환자의 경우 심한 피부 소양증을 나타내며, 피부 조직의 부종, 홍반, 괴사, 두드러기, 수포등을 형성한다는 것이 알려져 있다 (Asnis L.A et al., Cutaneous reaction to recombinant cytokine therapy J Am Acad Dermatol 24, 915-926, 1995).
부평초(Spirodela polyrrhiza)는 천남성과의 다년생 초본으로서 수면에 뜨는 작은 풀로서 개구리밥에 전초를 부평초라고도 지칭하며, 산화칼륨 및 염화칼륨, 불소 등의 성분이 알려져있고 강심작용, 해혈작용 등에 효과가 있는 것으로 알려진바 있다 (정보섭 외 1인, 향약 대사전, 영림사, pp.277~278, 1998년).
사상자(Torilis japonica DC)는 대한민국 중북부에 분포하는 미나리과의 일년생 초본인 벌사상자 및 동속 근연식물의 과실을 지칭하며, 피넨(l-pinene), 캄펜(l-camphene), 보르네올(borneol), 이소발레릭 에스테르(isovaleric ester)등 의 성분이 알려져 있으며 항트리코모나스 작용, 성호르몬과 같은 유사작용등의 약효가 알려진 바 있다 (정보섭 외 1인, 향약 대사전, 영림사, pp.416~418, 1998년).
백부근(Stemona japonica MIQ)은 다년생 초본으로서 중국 원산지이며 백부 및 동속 근연식물의 괴근을 지칭하며 스테모닌(stemonine), 스테모니딘(stemonidine), 이소스테모닌(isostemonine)등의 성분으로 알려져 있으며 향균 작용, 살충작용등의 효능을 가진 것으로 알려진 바 있다 (정보섭 외 1인, 향약 대사전, 영림사, pp.152~154, 1998년).
본 연구자는 부평초, 사상자, 백부근으로 조성된 생약 추출물 (MJ201)을 NC/Nga 아토피 피부염 생쥐에 경구 투여 하였을 때 가려움증이 현저히 감소하고 피부 조직의 홍반과 부종이 억제 된 것을 확인하였고 epidermis와 dermis의 두께가 증가하는 것을 억제하며 호산구와 비만세포의 유입이 현저히 감소하는 것을 확인하였다. 접촉성 피부염을 유도하며 MJ201을 생쥐에 경구 투여한 결과 IgE 생산이 유의적으로 감소하였으며, 분리된 CD4+ T 세포로부터 IL-31의 발현과 IL-2의 생산이 감소 하는 것을 확인하였다. 또한 PMA와 ionomycin에 의해 활성화된 EL-4 T 세포의 IL-31발현과 IL-2의 생성이 유의적으로 감소하는 것을 확인 한 바, MJ201은 다양한 피부 질환의 가려움증을 감소시키고 피부염증, 홍반, 부종, 두께 증가와 같은 병리적 손상이 발생하는 것을 억제함으로써 다양한 피부 질환 치료제로 응용할 수 있다.
이에 본 발명자는 부평초, 사상자, 백부근으로 조성된 생약 추출물을 가려움증 감소, 피부염증, 홍반, 부종 두께 증가와 같은 병리적 손상의 발생 억제를 확인함으로써 본 발명을 완성하였다.
상기 목적을 달성하기 위하여, 본 발명은 부평초, 사상자 및 백부근으로 구성된 생약 추출물(MJ201)의 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 치료용 약학 조성물을 제공한다.
본원에서 정의되는 복합 생약 추출물은 부평초, 사상자 및 백부근의 건조중량비(w/w)가 1~10:1~10:1, 바람직하게는 1~5:1~5:1, 더 바람직하게는 1~3:1~3:1을 포함함을 특징으로 한다.
본원에서 정의되는 "추출물"은 물, 에탄올, 메탄올, 프로판올, 부탄올, 아세톤, 에틸아세테이트, 헥산, 부틸렌글리콜, 프로필렌글리콜, 함수부틸렌글리콜, 함수프로필렌글리콜, 함수글리세린으로 구성된 그룹으로부터 선택된 하나 이상의 용매, 바람직하게는 물 및 에탄올, 가장 바람직하게는 60% 내지 90% 에탄올 가용 추출물을 포함한다.
본원에서 정의되는 알러지성 또는 비알러지성 피부 질환의 예로는 알러지성 피부질환으로는 과민증, 알러지성 비염, 천식, 알러지성 결막염, 알러지성 피부염, 아토피성 피부염, 알러지성 접촉성 피부염, 두드러기, 곤충 알러지, 식품알러지 또는 약품 알러지, 바람직하게는 알러지성 비염, 천식, 알러지성 피부염, 아토피성 피부염, 알러지성 접촉성 피부염, 두드러기, 식품 알러지 또는 약품 알러지, 보다 바람직하게는 아토피성 피부염 또는 접촉성 피부염을 들 수 있으며; 비알러지성 피부질환으로는 비알러지성 습진 (자극성 피부염, 지루성 피부염, 화폐성 습진, 울체성 피부염, 만성 단순성 태선, 한포진, 노인성 습진), 원발성 단순 접촉성 피부염, 완선, 건선 등, 바람직하게는 자극성 피부염 또는 지루성 피부염을 포함한다.
이하 본 발명을 상세히 설명한다.
예를 들어, 건조상태의 부평초, 사상자 및 백부근 약제를 건조중량비(W/W)가 1~10:1~10:1~10, 바람직하게는 1~5:1~5:1~5, 더 바람직하게는 1~3:1~3:1~3 비율로 혼합하는 제 1단계; 상기 혼합물 중량의 약 1 내지 30배, 바람직하게는 약 1 내지 15배에 달하는 부피의 물, 에탄올, 메탄올, 프로판올, 부탄올, 아세톤, 에틸아세테이트, 헥산, 부틸렌글리콜, 프로필렌글리콜, 함수부틸렌글리콜, 함수프로필렌글리콜, 함수글리세린으로 구성된 그룹으로부터 선택된 하나 이상의 용매, 바람직하게는 물 및 에탄올, 보다 바람직하게는 60-90% 에탄올 혼합용매로, 약 0 내지 100℃, 바람직하게는 20 내지 60℃ 온도에서 약 1 내지 48시간, 바람직하게는 12시간 내지 36시간 동안 추출하는 제 2단계; 제 2단계를 약 1 내지 10회, 바람직하게는 2 내지 7회 반복하는 제 3단계; 이를 여과농축 및 동결 건조시키는 제 4단계를 포함하는 제조방법을 통해 본 발명의 복합 생약 추출물을 수득할 수 있다. 또한, 본 발명의 복합생약들은 오랫동안 생약 및 식용으로 사용되어 오던 약재로서 이들로부터 추출된 본 발명의 복합생약 추출물 역시 독성 및 부작용 등의 문제가 없으며, 피부 첩포 시험에서 무자극 시료임이 입증되었으므로 장기간 사용 시에도 안심하고 사용할 수 있다.
본 발명은 상기의 제조방법으로 얻어진 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 치료용 약학조성물을 제공한다.
또한 본 발명은 부평초, 사상자 및 백부근으로 조성된 생약 추출물(MJ201)을 알러지성 또는 비알러지성 피부 질환 환자에게 투여함을 포함하는, 알러지성 또는 비알러지성 피부 질환 환자를 치료하기 위한 치료방법을 제공한다.
또한 본 발명은 알러지성 또는 비알러지성 피부 질환 치료용 약제를 제조하기 위한 부평초, 사상자 및 백부근으로 조성된 생약 추출물(MJ201)의 용도를 제공한다.
본 발명의 부평초, 사상자, 백부근으로 조성된 생약 추출물은 가려움증 감소, 피부염증, 홍반, 부종 두께 증가와 같은 병리적 손상의 발생 억제를 확인하여 알러지성 또는 비알러지성 피부 질환의 치료 및 예방에 유용함을 확인하였다.
또한, 본 발명은 상기의 제조방법으로 얻어진 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 건강기능식품을 제공한다.
본 발명의 복합 생약 추출물을 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 치료를 위한 약학조성물은, 조성물 총 중량에 대하여 상기 복합 생약 추출물을 0.1 내지 50 중% 포함한다.
그러나 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 질환의 종류 및 진행 정도에 따라 변할 수 있다.
본 발명의 복합생약추출물을 함유하는 약학조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다.
본 발명에 따른 복합생약추출물을 함유하는 약학조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 추출물을 함유하는 조성물에 함유될 수 있는 담체, 부형제 및 희석제로는 락토오즈(lactose), 덱스트로즈, 수크로스(sucrose), 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 복합 생약 추출물의 사용량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으나, 0.1 내지 100mg/kg으로, 바람직하게는 1 내지 10mg/kg을 일일 1회 내지 수회 투여할 수 있다. 또한 그 투여량은 투여경로, 질병의 정도, 성별, 체중, 나이 등에 따라서 증감될 수 있다. 따라서 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
상기 약학조성물은 쥐, 생쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁 내 경막 또는 뇌혈관 내 주사에 의해 투여될 수 있다.
본 발명은 부평초, 사상자, 백부근의 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 건강기능식품을 제공한다. 이를 첨가할 수 있는 식품으로는, 각종 식품류, 분말, 과립, 정제, 캡슐, 시럽제, 음료, 껌, 차 비타민 복합제, 건강기능성 식품류 등이 있다.
본 발명의 상기 추출물 자체는 독성 및 부작용은 거의 없으므로 예방 목적으로 장기간 복용 시에도 안심하고 사용할 수 있는 약제이다.
본 발명의 상기 추출물은 알러지성 또는 비알러지성 피부 질환의 예방 및 개선을 목적으로 식품 또는 음료에 첨가될 수 있다. 이 때, 식품 또는 음료 중의 복합 생약 추출물의 양은 전체 식품 중량의 0.01 내지 15 중량%로 가할 수 있으며, 건강 기능성 음료 조성물은 100㎖를 기준으로 0.02 내지 10g, 바람직하게는 0.3 내지 1g의 비율로 가할 수 있다.
본 발명의 건강 기능성 음료 조성물은 지시된 비율로 필수 성분으로서 상기 추출물을 함유하는 외에는 다른 성분에는 특별한 제한이 없으며, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100㎖당 일반적으로 약 1 내지 20g, 바람직하게는 약 5 내지 12g이다.
상기 외에 본 발명의 복합 생약 추출물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그밖에 본 발명의 추출물들은 천연 과일 쥬스 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하지는 않지만 본 발명의 추출물 100 중량부 당 0 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
그러나 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 진행 정도에 따라 변할 수 있다.
또한, 본 발명은 부평초, 사상자 및 백부근으로 조성된 생약 추출물(MJ201)의 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 화장료 조성물을 제공한다.
또한, 상기 화장료 조성물은 화장수, 스킨, 로션, 영양로션, 영양크림, 마사지 크림, 에센스, 팩의 제형을 포함한다.
또한, 본 발명의 복합생약 추출물은 미백 효과를 갖는 화장품 및 세안제 등에 다양하게 이용될 수 있다.
본 조성물을 첨가할 수 있는 제품으로는, 예를 들어, 화장수, 스킨, 로션, 영양로션, 영양크림, 맛사지크림, 에센스, 팩 등과 같은 화장품류와 클렌징, 세안제, 비누, 트리트먼트, 미용액 등이 있다.
본 발명의 화장료는 수용성 비타민, 유용성 비타민, 고분자 펩티드, 고분자 다당, 스핑고 지질 및 해초 엑기스로 이루어진 군에서 선택된 조성물을 포함한다.
수용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 비타민 B1, 비타민 B2, 비타민 B6, 피리독신, 염산피리독신, 비타민 B12, 판토텐산, 니코틴산, 니코틴산아미드, 엽산, 비타민 C, 비타민 H 등을 들 수 있으며, 그들의 염 (티아민염산염, 아스코르빈산나트륨염 등)이나 유도체 (아스코르빈산-2-인산나트륨염, 아스코르빈산-2-인산마그네슘염 등)도 본 발명에서 사용할 수 있는 수용성 비타민에 포함된다. 수용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 수득할 수 있다.
유용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 비타민 A, 카로틴, 비타민 D2, 비타민 D3, 비타민 E (d1-알파 토코페롤, d-알파 토코페롤, d-알파 토코페롤) 등을 들 수 있으며, 그들의 유도체 (팔미틴산아스코르빈, 스테아르산아스코르빈, 디팔미틴산아스코르빈, 아세트산 dl-알파 토코페롤, 니코틴산 dl-알파 토코페롤비타민 E, dl-판토테닐알코올, D-판토테닐알코올, 판토테닐에틸에테르 등) 등도 본 발명에서 사용되는 유용성 비타민에 포함된다. 유용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소 또는 화학 합성법 등의 통상의 방법에 의해 취득할 수 있다.
고분자 펩티드로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 콜라겐, 가수 분해 콜라겐, 젤라틴, 엘라스틴, 가수 분해 엘라스틴, 케라틴 등을 들 수 있다. 고분자 펩티드는 미생물의 배양액으로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 정제 취득할 수 있으며, 또는 통상 돼지나 소 등의 진피, 누에의 견섬유 등의 천연물로부터 정제하여 사용할 수 있다.
고분자 다당으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 히드록시에틸셀룰로오스, 크산탄검, 히알루론산나트륨, 콘드로이틴 황산 또는 그 염 (나트륨염 등) 등을 들 수 있다. 예를 들어, 콘드로이틴 황산 또는 그 염 등은 통상 포유동물이나 어류로부터 정제하여 사용할 수 있다.
스핑고 지질로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 세라미드, 피토스핑고신, 스핑고당지질 등을 들 수 있다. 스핑고 지질은 통상 포유류, 어류, 패류, 효모 또는 식물 등으로부터 통상의 방법에 의해 정제하거나 화학 합성법에 의해 취득할 수 있다.
해초 엑기스로는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 갈조 엑기스, 홍조 엑기스, 녹조 엑기스 등을 들 수 있으며, 또, 이들의 해초 엑기스로부터 정제된 칼라기난, 아르긴산, 아르긴산나트륨, 아르긴산칼륨 등도 본 발명에서 사용되는 해초 엑기스에 포함된다. 해초 엑기스는 해초로부터 통상의 방법에 의해 정제하여 취득할 수 있다.
본 발명의 화장료에는 상기 필수 성분과 더불어 필요에 따라 통상 화장료에 배합되는 다른 성분을 배합해도 된다.
이외에 첨가해도 되는 배합 성분으로서는 유지 성분, 보습제, 에몰리엔트제, 계면 활성제, 유기 및 무기 안료, 유기 분체, 자외선 흡수제, 방부제, 살균제, 산화 방지제, 식물 추출물, pH 조정제, 알콜, 색소, 향료, 혈행 촉진제, 냉감제, 제한(制汗)제, 정제수 등을 들 수 있다.
유지 성분으로서는 에스테르계 유지, 탄화수소계 유지, 실리콘계 유지, 불소계 유지, 동물 유지, 식물 유지 등을 들 수 있다.
에스테르계 유지로서는 트리2-에틸헥산산글리세릴, 2-에틸헥산산세틸, 미리스틴산이소프로필, 미리스틴산부틸, 팔미틴산이소프로필, 스테아르산에틸, 팔미틴산옥틸, 이소스테아르산이소세틸, 스테아르산부틸, 리놀레산에틸, 리놀레산이소프로필, 올레인산에틸, 미리스틴산이소세틸, 미리스틴산이소스테아릴, 팔미틴산이소스테아릴, 미리스틴산옥틸도데실, 이소스테아르산이소세틸, 세바신산디에틸, 아디핀산디이소프로필, 네오펜탄산이소알킬, 트리(카프릴, 카프린산)글리세릴, 트리2-에틸헥산산트리메틸롤프로판, 트리이소스테아르산트리메틸롤프로판, 테트라2-에틸헥산산펜타엘리슬리톨, 카프릴산세틸, 라우린산데실, 라우린산헥실, 미리스틴산데실, 미리스틴산미리스틸, 미리스틴산세틸, 스테아르산스테아릴, 올레인산데실, 리시노올레인산세틸, 라우린산이소스테아릴, 미리스틴산이소트리데실, 팔미틴산이소세틸, 스테아르산옥틸, 스테아르산이소세틸, 올레인산이소데실, 올레인산옥틸도데실, 리놀레산옥틸도데실, 이소스테아르산이소프로필, 2-에틸헥산산세토스테아릴, 2-에틸헥산산스테아릴, 이소스테아르산헥실, 디옥탄산에틸렌글리콜, 디올레인산에틸렌글리콜, 디카프린산프로필렌글리콜, 디(카프릴,카프린산)프로필렌글리콜, 디카프릴산프로필렌글리콜, 디카프린산네오펜틸글리콜, 디옥탄산네오펜틸글리콜, 트리카프릴산글리세릴, 트리운데실산글리세릴, 트리이소팔미틴산글리세릴, 트리이소스테아르산글리세릴, 네오펜탄산옥틸도데실, 옥탄산이소스테아릴, 이소노난산옥틸, 네오데칸산헥실데실, 네오데칸산옥틸도데실, 이소스테아르산이소세틸, 이소스테아르산이소스테아릴, 이소스테아르산옥틸데실, 폴리글리세린올레인산에스테르, 폴리글리세린이소스테아르산에스테르, 시트르산트리이소세틸, 시트르산트리이소알킬, 시트르산트리이소옥틸, 락트산라우릴, 락트산미리스틸, 락트산세틸, 락트산옥틸데실, 시트르산트리에틸, 시트르산아세틸트리에틸, 시트르산아세틸트리부틸, 시트르산트리옥틸, 말산디이소스테아릴, 히드록시스테아르산 2-에틸헥실, 숙신산디2-에틸헥실, 아디핀산디이소부틸, 세바신산디이소프로필, 세바신산디옥틸, 스테아르산콜레스테릴, 이소스테아르산콜레스테릴, 히드록시스테아르산콜레스테릴, 올레인산콜레스테릴, 올레인산디히드로콜레스테릴, 이소스테아르산피트스테릴, 올레인산피트스테릴, 12-스테알로일히드록시스테아르산이소세틸, 12-스테알로일히드록시스테아르산스테아릴, 12-스테알로일히드록시스테아르산이소스테아릴 등의 에스테르계 등을 들 수 있다.
탄화 수소계 유지로서는 스쿠알렌, 유동 파라핀, 알파-올레핀올리고머, 이소파라핀, 세레신, 파라핀, 유동 이소파라핀, 폴리부덴, 마이크로크리스탈린왁스, 와셀린 등의 탄화 수소계 유지 등을 들 수 있다.
실리콘계 유지로서는 폴리메틸실리콘, 메틸페닐실리콘, 메틸시클로폴리실록산, 옥타메틸폴리실록산, 데카메틸폴리실록산, 도데카메틸시클로실록산, 디메틸실록산·메틸세틸옥시실록산 공중합체, 디메틸실록산·메틸스테알록시실록산 공중합체, 알킬 변성 실리콘유, 아미노 변성 실리콘유 등을 들 수 있다.
불소계 유지로서는 퍼플루오로폴리에테르 등을 들 수 있다.
동물 또는 식물 유지로서는 아보카도유, 아르몬드유, 올리브유, 참깨유, 쌀겨유, 새플라워유, 대두유, 옥수수유, 유채유, 행인(杏仁)유, 팜핵유, 팜유, 피마자유, 해바라기유, 포도종자유, 면실유, 야자유, 쿠쿠이너트유, 소맥배아유, 쌀 배아유, 시아버터, 월견초유, 마커데이미아너트유, 메도홈유, 난황유, 우지(牛脂), 마유, 밍크유, 오렌지라피유, 호호바유, 캔데리러왁스, 카르나바왁스, 액상 라놀린, 경화피마자유 등의 동물 또는 식물 유지를 들 수 있다.
보습제로서는 수용성 저분자 보습제, 지용성 분자 보습제, 수용성 고분자, 지용성 고분자 등을 들 수 있다.
수용성 저분자 보습제로서는 세린, 글루타민, 솔비톨, 만니톨, 피롤리돈-카르복실산나트륨, 글리세린, 프로필렌글리콜, 1,3-부틸렌글리콜, 에틸렌글리콜, 폴리에틸렌글리콜B(중합도 n = 2 이상), 폴리프로필렌글리콜(중합도 n = 2 이상), 폴리글리세린B(중합도 n = 2 이상), 락트산, 락트산염 등을 들 수 있다.
지용성 저분자 보습제로서는 콜레스테롤, 콜레스테롤에스테르 등을 들 수 있다.
수용성 고분자로서는 카르복시비닐폴리머, 폴리아스파라긴산염, 트라가칸트, 크산탄검, 메틸셀룰로오스, 히드록시메틸셀룰로오스, 히드록시에틸셀룰로오스, 히드록시프로필셀룰로오스, 카르복시메틸셀룰로오스, 수용성 키틴, 키토산, 덱스트린 등을 들 수 있다.
지용성 고분자로서는 폴리비닐피롤리돈·에이코센 공중합체, 폴리비닐피롤리돈·헥사데센 공중합체, 니트로셀룰로오스, 덱스트린지방산에스테르, 고분자 실리콘 등을 들 수 있다.
에몰리엔트제로서는 장쇄아실글루타민산콜레스테릴에스테르, 히드록시스테아르산콜레스테릴, 12-히드록시스테아르산, 스테아르산, 로진산, 라놀린지방산콜레스테릴에스테르 등을 들 수 있다.
계면 활성제로서는 비이온성 계면 활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제 등을 들 수 있다.
비이온성 계면 활성제로서는 자기 유화형 모노스테아르산글리세린, 프로필렌글리콜지방산에스테르, 글리세린지방산에스테르, 폴리글리세린지방산에스테르, 솔비탄지방산에스테르, POE (폴리옥시에틸렌)솔비탄지방산에스테르, POE 솔비트지방산에스테르, POE 글리세린지방산에스테르, POE 알킬에테르, POE 지방산에스테르, POE 경화피마자유, POE 피마자유, POE·POP (폴리옥시에틸렌·폴리옥시프로필렌) 공중합체, POE·POP 알킬에테르, 폴리에테르변성실리콘, 라우린산알카놀아미드, 알킬아민옥시드, 수소첨가대두인지질 등을 들 수 있다.
음이온성 계면 활성제로서는 지방산비누, 알파-아실술폰산염, 알킬술폰산염, 알킬알릴술폰산염, 알킬나프탈렌술폰산염, 알킬황산염, POE 알킬에테르황산염, 알킬아미드황산염, 알킬인산염, POE 알킬인삼염, 알킬아미드인산염, 알킬로일알킬타우린염, N-아실아미노산염, POE 알킬에테르카르복실산염, 알킬술포숙신산염, 알킬술포아세트산나트륨, 아실화 가수분해 콜라겐펩티드염, 퍼플루오로알킬인산에스테르 등을 들 수 있다.
양이온성 계면 활성제로서는 염화알킬트리메틸암모늄, 염화스테아릴트리메틸암모늄, 브롬화스테아릴트리메틸암모늄, 염화세토스테아릴트리메틸암모늄, 염화디스테아릴디메틸암모늄, 염화스테아릴디메틸벤질암모늄, 브롬화베헤닐트리메틸암모늄, 염화벤잘코늄, 스테아르산디에틸아미노에틸아미드, 스테아르산디메틸아미노프로필아미드, 라놀린 유도체 제 4급 암모늄염 등을 들 수 있다.
양성 계면 활성제로서는 카르복시베타인형, 아미드베타인형, 술포베타인형, 히드록시술포베타인형, 아미드술포베타인형, 포스포베타인형, 아미노카르복실산염형, 이미다졸린 유도체형, 아미드아민형 등의 양성 계면 활성제 등을 들 수 있다.
유기 및 무기 안료로서는 규산, 무수규산, 규산마그네슘, 탤크, 세리사이트, 마이카, 카올린, 벵갈라, 클레이, 벤토나이트, 티탄피막운모, 옥시염화비스무트, 산화지르코늄, 산화마그네슘, 산화아연, 산화티탄, 산화알루미늄, 황산칼슘, 황산바륨, 황산마그네슘, 탄산칼슘, 탄산마그네슘, 산화철, 군청, 산화크롬, 수산화크롬, 칼라민 및 이들의 복합체등의 무기 안료 ; 폴리아미드, 폴리에스테르, 폴리프로필렌, 폴리스티렌, 폴리우레탄, 비닐수지, 요소수지, 페놀수지, 불소수지, 규소수지, 아크릴수지, 멜라민수지, 에폭시수지, 폴리카보네이트수지, 디비닐벤젠스티렌 공중합체, 실크파우더, 셀룰로오스, CI 피그먼트옐로우, CI 피그먼트오렌지 등의 유기 안료 및 이들의 무기 안료와 유기 안료의 복합 안료 등을 들 수 있다.
유기 분체로서는 스테아르산칼슘 등의 금속비누 ; 세틸린산아연나트륨, 라우릴린산아연, 라우릴린산칼슘 등의 알킬인산금속염 ; N-라우로일-베타-알라닌칼슘, N-라우로일-베타-알라닌아연, N-라우로일글리신칼슘 등의 아실아미노산 다가금속염 ; N-라우로일-타우린칼슘, N-팔미토일-타우린칼슘 등의 아미드술폰산 다가금속염 ; N-엡실론-라우로일-L-리진, N-엡실론-팔미토일리진, N-알파-파리토일올니틴, N-알파-라우로일아르기닌, N-알파-경화우지지방산아실아르기닌 등의 N-아실염기성아미노산 ; N-라우로일글리실글리신 등의 N-아실폴리펩티드 ; 알파-아미노카프릴산, 알파-아미노라우린산 등의 알파-아미노지방산 ; 폴리에틸렌, 폴리프로필렌, 나일론, 폴리메틸메타크릴레이트, 폴리스티렌, 디비닐벤젠·스티렌 공중합체, 사불화에틸렌 등을 들 수 있다.
자외선 흡수제로서는 파라아미노벤조산, 파라아미노벤조산에틸, 파라아미노벤조산아밀, 파라아미노벤조산옥틸, 살리실산에틸렌글리콜, 살리신산페닐, 살리신산옥틸, 살리신산벤질, 살리신산부틸페닐, 살리신산호모멘틸, 계피산벤질, 파라메톡시계피산-2-에톡시에틸, 파라메톡시계피산옥틸, 디파라메톡시계피산모노-2-에틸헥산글리세릴, 파라메톡시계피산이소프로필, 디이소프로필·디이소프로필계피산에스테르 혼합물, 우로카닌산, 우로카닌산에틸, 히드록시메톡시벤조페논, 히드록시메톡시벤조페논술폰산 및 그 염, 디히드록시메톡시벤조페논, 디히드록시메톡시벤조페논디술폰산나트륨, 디히드록시벤조페논, 테트라히드록시벤조페논, 4-tert-부틸-4'-메톡시디벤조일메탄, 2,4,6-트리아닐리노-π-(카르보-2'-에틸헥실-1'-옥시)-1,3,5-트리아진, 2-(2-히드록시-5-메틸페닐)벤조트리아졸 등을 들 수 있다.
살균제로서는 히노키티올, 트리클로산, 트리클로로히드록시디페닐에테르, 크로르헥시딘글루콘산염, 페녹시에탄올, 레조르신, 이소프로필메틸페놀, 아줄렌, 살리칠산, 진크필리티온, 염화벤잘코늄, 감광소 301 호, 모노니트로과이어콜나트륨, 운데시렌산 등을 들 수 있다.
산화 방지제로서는 부틸히드록시아니솔, 갈릭산프로필, 엘리소르빈산 등을 들 수 있다.
pH 조정제로서는 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등을 들 수 있다.
알코올로서는 세틸알코올 등의 고급 알코올을 들 수 있다.
또한, 이외에 첨가해도 되는 배합 성분은 이에 한정되는 것은 아니며, 또, 상기 어느 성분도 본 발명의 목적 및 효과를 손상시키지 않는 범위 내에서 배합 가능하지만, 총중량에 대하여 바람직하게는 0.01 - 5% 중량, 보다 바람직하게는 0.01 - 3% 중량로 배합된다.
본 발명의 화장료는 용액, 유화물, 점성형 혼합물 등의 형상을 취할 수 있다.
본 발명의 화장료 조성물에 포함되는 성분은 유효성분으로서 상기 복합생약 추출물 이외에 화장료 조성물에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예를 들면, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 및 담체를 포함한다.
본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어 유액, 크림, 화장수, 팩, 파운데이션, 로션, 미용액, 모발화장료 등을 들 수 있다.
구체적으로, 본 발명의 화장료 조성물은 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스쳐 로션, 영양로션, 맛사지크림, 영양크림, 모이스처크림, 핸드크림, 파운데이션, 에센스, 영양에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션 및 바디클린저의 제형을 포함한다.
본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물섬유, 식물섬유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
본 발명의 제형이 용액 또는 유탁액의 경우에는 담체 성분으로서 용매, 용매화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
본 발명의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 리놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
본 발명의 부평초, 사상자, 백부근으로 조성된 생약 추출물은 가려움증 감소, 피부염증, 홍반, 부종 두께 증가와 같은 병리적 손상의 발생 억제를 확인함으로써 알러지성 또는 비알러지성 피부 질환의 치료 및 예방에 유용한 조성물을 제공할 수 있다.
도 1은 NC/Nga 마우스에서 귀 피부의 조직학적 검사결과이며, 동물에게는 식염수(Naive) 또는 MJ201(250mg/kg/day)을 6주간 투여하고. 귀 생검을 염증성 세포 및 비만세포를 검사하기 위하여 염색법(hematoxylin and eosin (H&E) (left panel) 및 Toluidine blue (right panel))을 수행하고 염색된 조직을 밝은 현미경(Nikon,Japan,orignalmagnification,x200)으로 관찰한 것이며 (H&E - a; Naive, b; Control, c; CsA, d; MJ201, Toluidine blue - e; Naive, f; Control, g; CsA, h; MJ201);
도 2는 NC/Nga 마우스에서 배부피부의 조직학적 검사결과이며, 동물에게는 식염수(Naive) 또는 MJ201(250 mg/kg/day)을 6주간 투여하고. 등 피부 생검을 염증성 세포 및 비만세포를 검사하기 위하여 염색법(hematoxylin and eosin (H&E) (left panel) 및 toluidine blue (right panel))을 수행하고 염색된 조직을 밝은 현미경(Nikon,Japan,orignalmagnification,x200)으로 관찰한 것이며 (H&E - a; Naive, b; Control, c; CsA, d; MJ201, Toluidine blue - e; Naive, f; Control, g; CsA, h; MJ201);
도 3는 NC/Nga 생쥐의 혈중 WBC (백혈구)의 세포 수에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 혈액을 채취하여 Hematological parameters로 혈액내의 WBC (백혈구)의 세포 수를 측정하여 분석한 결과이며,
도 4는 NC/Nga 생쥐의 혈중 WBC (백혈구)의 세포 수에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 혈액을 채취하여 Hematological parameters로 WBC 내의 WBC Differential Counting (Neutrophills, Monocytes)을 하여 %로 나타내어 분석한 결과이며,
도 5는 NC/Nga mouse의 배부피부의 세포 수에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 1마리당 일정량의 배부 피부 조직을 잘게 chopping 한 후 분리한 세포를 현미경으로 계수한 결과이며,
도 6은 NC/Nga mouse의 ALN의 세포 수에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 1마리당 ALN(auxiliary lymph node) 2개를 적출한 후 세포를 분리하여 세포를 현미경으로 계수한 결과이며,
도 7는 NC/Nga mouse의 ALN에서 분리한 세포의 형광 유세포에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 1마리당 ALN(auxiliary lymph node) 2개를 적출한 후 세포를 분리하여 각각에 anti-CD4-FITC, anti-CD8-PE를 넣고 30분간 얼음에서 반응시켜 면역 형광 염색을 실시한 후 flow cytometry(FACs)로 분석한 결과이며,
도 8는 NC/Nga mouse의 ALN에서 분리한 세포의 형광 유세포에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 1마리당 ALN(auxiliary lymph node) 2개를 적출한 후 세포를 분리하여 각각에 anti-CD3-PE, anti-CD69-FITC, anti-B220- FITC, anti-CD23-PE를 넣고 30분간 얼음에서 반응시켜 면역 형광 염색을 실시한 후 flow cytometry(FACs)로 분석한 결과이며,
도 9는 NC/Nga mouse의 ALN에서 분리한 세포의 형광 유세포에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 1마리당 ALN(auxiliary lymph node) 2개를 적출한 후 세포를 분리하여 각각에 anti-CD11b-FITC를 넣고 30분간 얼음에서 반응시켜 면역 형광 염색을 실시한 후 flow cytometry(FACs)로 분석한 결과이며,
도 10은 NC/Nga mouse의 배부피부에서 분리한 세포의 형광 유세포에 미치는 영향을 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 1마리당 일정량의 배부 피부 조직을 잘게 chopping 한 후 세포를 분리하여 각각에 anti-CD4-FITC, anti-CD11b-FITC, anti-Gr-1-PE를 넣고 30분간 얼음에서 반응시켜 면역 형광 염색을 실시한 후 flow cytometry(FACs)로 분석한 결과이며,
도 11은 NC/Nga mouse의 배부피부에서 분리한 세포의 형광 유세포 에 미치는 영향을 본 것으로 DNCB로 유발된 NC/Nga 생쥐에서 1마리당 일정량의 배부 피부 조직을 잘게 chopping 한 후 세포를 분리하여 각각에 anti-CCR3-PE를 넣고 30분간 얼음에서 반응시켜 면역 형광 염색을 실시한 후 flow cytometry(FACs)로 분석한 결과이며,
도 12는 NC/Nga mouse의 혈액에서 분리한 혈청내의 사이토카인(IgE)에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐를 ethyl ether로 마취한 상태에서 심장 천자법을 이용하여 채혈한 다음 혈청을 얻어 IgE 농도를 ELISA kit을 이용하여 측정한 결과이며,
도 13은 NC/Nga mouse의 혈액에서 분리한 혈청내의 사이토카인(IL)에 미치는 효과를 본 것으로 DNCB로 유발된 NC/Nga 생쥐를 ethyl ether로 마취한 상태에서 심장 천자법을 이용하여 채혈한 다음 혈청을 얻어 IL-5, 13 농도를 ELISA kit을 이용하여 측정한 결과이며,
도 14는 NC/Nga mouse의 비장세포의 배양액 내 사이토카인에 미치는 영향을 본 것으로 NC/Nga 생쥐에서 비장을 적출하여 세포를 분리한 후 anti-CD3 (1㎍/㎖) 항체가 coating된 96well culture plate에서 48시간 동안 배양한 후 배양액을 취하여 IL-4, IFN-γ 농도를 ELISA kit을 이용하여 측정한 결과이며,
도 15는 NC/Nga mouse의 관능평가에 대한 MJ201의 효과를 나타낸 것으로 약물 처리 후 1주, 3주, 5주 때에 아토피성 피부염에서 일반적으로 사용되는 임상적 육안 평가법으로 관능평가를 실시하여 평가 항목은 홍반 (Erythema), 가려움과 건조 피부 (Pruritus & Dry skin), 부종과 혈종 (Edema & Hematoma), 짓무름 (Excoriation), 태선화 (Lichenification) 등으로 5가지로 각각의 항목은 없음 (0), 약함 (1), 중증도 (2), 심함 (3)으로 채점한 결과이며,
도 16은 NC/Nga 마우스에서의 긁는 행동에 대한 MJ201의 효과를 나타낸 결과이며, 긁은 행동을 20분간 긁는 행위 발생수를 판독한 것이며(* <0.05,**π<0.01,***π<0.001);
도 17는 NC/Nga 마우스 피부에서의 IL-31에 대한 추출물의 효과를 나타낸 도이며, IL-31 및 β-actin mRNA 의 발현 수준을 RT-PCR으로 측정한 도이며;
도 18는 CD4+ T 세포에서의 IL-31 mRNA 발현에 대한 MJ201의 효과를 나타낸 도이며, 동물들은 접촉성 피부염을 유발시키기 위하여 DNCB로 처치하고 연속 4일간 식염수(Naive) 또는 MJ201(250mg/kg/day)을 투여하고, CD4+ T 세포들 비장으로부터 분리하고 6시간동안 항(anti)-CD3 및 항(anti)-CD28 항체로 자극하고 IL-31 mRNA 수준을 정량적 실시간 (real-time) PCR으로 특정한 것이며;
도 19는 CD4+ T 세포에서의 IL-2 생산에 대한 MJ201의 효과를 나타낸 도이며, MJ201 (250㎎/㎏/day)을 4일간 BALB/c 마우스에 경구투여하고, 동물들을 익일에 희생시키고 CD4+ T 세포를 분리하고 6시간 동안 항(anti)-CD3 및 항(anti)-CD28 항체로 자극하고 배양 상등액에서의 IL-2 수준을 ELISA로 측정하였으며;
도 20는 IgE 생성에 대한 MJ201의 효과를 나타낸 도이며, IgE의 혈청 수준을 ELISA로 측정하였으며, 개개 막대(bar)는 IgE 수준의 혈중 평균(mean S.E.M.)을 표시한 것이며(* π<0.05,**π<0.01,***π<0.001);
도 21는 활성화된 EL-4 T 세포에서 IL-31 mRNA 발현에 대한 MJ201의 효과를 나타낸 도이며, EL-4 T 세포는 60 ㎍/㎖의 MJ201으로 1시간 동안 전처리하고, 6시간 동안 PMA (50ng/㎖) 및 이노마이신(Ionomycin; 0.25μM)으로 자극시키고, IL-31 mRNA 수준을 정량적 실시간 PCR으로 측정하고;
도 22는 활성화된 EL-4 T 세포에서 IL-2 생산에 대한 MJ201의 효과를 나타낸 도이며, EL-4 T 세포는 60㎍/㎖의 MJ201으로 1시간 동안 전처리하고, 6시간 동안 PMA (50ng/㎖) 및 이노마이신(Ionomycin; 0.25μM)으로 자극시키고, IL-2 생산 수준을 정량적 실시간 PCR으로 측정한 것이다(*p<0.05, **p<0.01, ***p<0.001).
이하, 본 발명을 하기의 실시예 및 실험예에 의해 상세히 설명한다.
단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해 한정되는 것은 아니다.
실시예 1. 식물추출물 MJ201의 제조
삼각 플라스크에 허브포유사(http://www.herbforyou.net, Daejeon, Korea)에서 구입한 건조 상태의 3가지 약제를 동등한 비율로 혼합하였다. 이 약제혼합물 300g에 95% 에탄올과 증류수를 80 : 20으로 혼합한 80% 에탄올로 실온에서 1일간 방치하여 추출하였다. 이 같은 방법으로 3회 반복 추출하여 얻은 추출액을 여과한 후 회전식감압농축기 (Rotary evaporator)를 이용하여 감압농축 시킨 후 냉동 건조한 후 생약의 에탄올 추출물 70g을 얻고 MJ201이라 명명하였다. MJ201은 파우더 형태로 -20℃에 보관하였다.
참고예 1. 재료 및 방법
1. 재료
(1) 동물 및 세포주
NC/Nga 생쥐 (Male, 6주령), BALB/c 생쥐 (Female, 4주령)는 대한바이오링크(Korea)에서 구입하였으며, 고형사료 (삼양사료 Co.)와 물을 충분히 공급하고 실온 22 ±2, 습도 50~70%, 조명시간 12시간 (08:00~20:00), 조도 150~300Lux로 설정하여 1주일간 실험실 환경에 적응시킨 후 실험에 사용하였다. EL-4 T lymphoma 세포는 한국세포주은행 (Seuol, Korea)에서 구매하였으며 RPMI 1640에 10% fetal bovine serum (FBS)와 penicillin 100U/㎖, streptomycin 100㎍/㎖를 첨가하여 37℃, 5% CO2에서 배양하였다.
(2) 시약 및 기기
1) 시약
본 실험에 사용된 시약으로 MJ201(허브포유), anti-CD3/anti-CD28 (BDbiosciences Co., Korea), Phorbol 12-myristate 13-acetate(PMA), Ionomycin, 이소프로판올, 클로로포름(Sigma Co., U.S.A), Trizol, DEPC water (Invitrogen Co., U.S.A), VarioMACS(Miltenyi Biotec Co., Germany), SYBRPCR Master Mix, TaqManExpression Master Mix(Applied Biosystems Co., U.S.A), Prime Script RT reagent kit (TAKARA Co., JAPAN), Maxime PCR PreMix Kit(iNtRON Biotechnology Co., Korea), IgE ELISA kit for mouse (SAIBAYAGI Co., Itd. JAPAN), RPMI-1640, dulbecco's phosphate buffered saline (D-PBS), fetal bovine serum (FBS), penicillin and streptomycin은 Gibco사 제품을 사용하였다.
2) 기기
본 실험에 사용된 기기는 Microplate spectrophotometer (Molecular Devices,U.S.A), CO2 배양기 (incubator; FormascientificCo.,U.S.A), cleanbench (VisionscientificCo.,Korea), autoclave (Sanyo,Japan), micro-pipet (Gilson,France), waterbath (VisionscientificCo.,Korea), vortexmixer (VisionscientificCo.,Korea), real-time PCR (Applied Biosystems Co., U.S.A), centrifuge (Sigma Co., U.S.A), Microscopy (Nikon, JAPAN) 등을 사용하였다.
실험예 1. NC/Nga 아토피 피부염에 미치는 효과실험
상기 실시예에서 수득한 시료의 경구 투여가 NC/Nga 아토피 피부염에 미치는 효과를 확인하기 위하여 하기와 같이 실험을 실시하였다.(Matsuda, H et al., Development of atopic dermatitis like skin lesions with IgE hyperproduction in NC/Nga mice. Int Immunol. 9, 461-466, 1997)
1.1. 아토피 피부염 모델 (NC/Nga 생쥐)
1.1.1. Nc/Nga 생쥐에서 피부염 유도 및 시료처리
6주령이 된 NC/Nga 생쥐의 등을 귀 하단부에서부터 꼬리 상단 부까지 전체를 제모 한 후 피부의 미세 상처가 치유되도록 24시간 방치 하였다. 1% TNCB 용액 (아세톤 : 올리브오일 = 3 : 1 ) 100㎕를 제모 한 부위에 도포하고, 1주 후 0.2% DNCB 용액을 3주 동안 100㎕ 처리하였다. 실험은 4개의 그룹으로 나누고, 정상군, 대조군에는 생리식염수를, 양성대조군인 CsA 투여군은 격일로 12.5㎎/㎏의 용량으로 복강 주사하였으며, 실험군에는 MJ201을 250㎎/㎏의 용량으로 매일 5주간 경구 투여하였다.
1.1.2. 조직 검사
실험 종료 후에 귀 끝부분, 등 피부를 떼어내어 10% paraformaldehyde에서 24시간동안 고정하였다. 그 조직을 파라핀으로 포맷하였고, 5㎛ 두께로 block을 만들었다. Hematoxyline and Eosin(H&E)염색법을 이용하여 epidermis, dermis, keratinocytes, neutrophils/eosinophil을 염색하였으며, 톨루이딘 블루(toluidine blue)염색법을 이용하여 비만세포의 침윤을 관찰 하였다.
1.1.3. 피부 조직에 미치는 효과
MJ201이 아토피 피부염에 미치는 효과를 조사하기 위하여 NC/Nga 생쥐의 등에 TNCB를 처리하여 피부염을 유발하면서 6주간 매일 250mg/kg의 용량으로 경구 투여하였다. 실험 종료 후 귀의 일부와 등 피부를 절단 한 후 H&E 염색과 toluidine 염색을 실시하였다. H&E 염색에서 대조군의 epidermis와 dermis는 부종으로 현저하게 확장되었고, 백혈구 침윤도 관찰 되었다 (도. 1. b 및 도 2. b). 이에 비해 MJ201 투여군은 대조군에 비하여 epidermis와 dermis의 두께가 감소되고 백혈구의 침윤도 억제되었다 (도 1. d 및 도 2. d). Toluidine 염색법에 의하여 비만세포를 염색하였을 때, 대조군에서는 dermis 주변에 비만세포가 현저히 침윤한 것을 관찰 할 수 있었다 (도 1. f 및 도 2. f). 반면에 MJ201 투여군에서는 그림에서 나타난 바와 같이 비만 세포를 거의 관찰 할 수 없었다 (도 1. h 및 도 2. h).
1-2. NC/Nga 생쥐의 혈중 WBC (백혈구)의 세포수에 미치는 효과
1.2.1. NC/Nga 생쥐의 혈액분석
DNCB로 유발된 NC/Nga 생쥐에서 혈액을 채취하여 Hematological parameters로 혈액내의 WBC (백혈구)의 세포수를 측정하고 WBC 내의 WBC Differential Counting (Neutrophills, Monocytes)을 하여 %로 나타내어 분석하였다.
결과 : 전체 백혈구 수의 감소 효과(도 3)와 염증성 마커인 Neutrophills 및 Monocytes의 감소 효과(도 4)로 보아 면역세포 조절 작용이 있는 것으로 사료된다.
1.2.2. NC/Nga mouse의 피부 1g에서 분리한 세포의 수
DNCB로 유발된 NC/Nga 생쥐에서 1마리당 일정량의 배부 피부 조직을 잘게 chopping 한 후 collagenase 1 mg/㎖ (in 2% FBS + RPMI 1640)을 넣고 37℃ shaker (140 rpm, 20 min) 배양기에서 배양하여 상층액을 회수하는 방법으로 4회 반복하였다. 이들 세포들에 ACK 용액 (8.3 g NHCl, 1 g KHCO3 in 1 L of demineralized water + 0.1 mM EDTA)을 실온에서 5분 동안 처리하여 적혈구를 용해시키고, 다시 D-PBS로 2회 세척한 후 cell strainer를 통과시킨 세포를 현미경으로 계수하였다.
결과 : NC/Nga 생쥐의 피부 1g 내의 세포수가 감소한 것으로 보아 피부에 침윤되는 염증성 면역세포의 억제 조절이 있는 것으로 사료된다. (도 5)
1.2.3. NC/Nga mouse의 ALN에서 분리한 세포의 수
DNCB로 유발된 NC/Nga 생쥐에서 1마리당 ALN(auxiliary lymph node) 2개를 적출하여 100 mesh로 세포를 분리하여 D-PBS로 5분간 원심분리 (1500 rpm)하고 2회 세척한 후 cell strainer를 통과시킨 세포를 현미경으로 계수하였다.
결과 : NC/Nga 생쥐의 ALN의 세포수가 감소한 것으로 보아 림프절에서 분화되는 염증성 면역세포의 억제 조절이 있는 것으로 사료된다. (도 6)
1.2.4. NC/Nga mouse의 ALN에서 분리한 세포의 형광 유세포 분석
DNCB로 유발된 NC/Nga 생쥐에서 1마리당 ALN(auxiliary lymph node) 2개를 적출하여 100 mesh로 세포를 분리하여 D-PBS로 5분간 원심분리 (1500 rpm)하고 2회 세척한 후 cell strainer를 통과시킨 세포를 5 ×105 cells/㎖ 농도로 조정한 후 4℃에서 면역형광염색을 실시하였다. 각각에 anti-CD4-FITC, anti-CD8-PE,(도 7) anti-CD3-PE, anti-CD69-FITC, anti-B220-FITC, anti-CD23-PE,(도 8), anti-CD11b-FITC(도 9)를 넣고 30분간 얼음에서 반응시킨 후 3회 이상 인산완충 생리식염수로 수세하고 flow cytometry(FACs)로 분석하였다.
결과 : 활성화된 CD4+, CD8+ T세포의 감소(도 7)와 T세포의 초기 활성화 마커인 CD3+CD69+ 및 B세포의 초기 활성화 마커인 B220+CD23의 감소(도 8), CD11b+ 마크로파지 세포 감소 효과(도 9)로 보아 관련 면역세포의 감소효과가 있는 것으로 사료된다.
1.2.5. NC/Nga mouse의 배부피부에서 분리한 세포의 형광 유세포 분석
- DNCB로 유발된 NC/Nga 생쥐에서 1마리당 일정량의 배부 피부 조직을 잘게 chopping 한 후 collagenase 1 mg/㎖ (in 2% FBS + RPMI 1640)을 넣고 37℃ shaker (140 rpm, 20 min) 배양기에서 배양하여 상층액을 회수하는 방법으로 4회 반복하였다. 이들 세포들에 ACK 용액 (8.3 g NH4Cl, 1 g KHCO3 in 1 L of demineralized water + 0.1 mM EDTA)을 실온에서 5분 동안 처리하여 적혈구를 용해시키고, 다시 D-PBS로 2회 세척한 후 cell strainer를 통과시킨 세포를 5 ×105 cells/㎖ 농도로 조정한 후 4℃에서 면역형광염색을 실시하였다. 각각에 anti-CD4-FITC, anti-CD11b-FITC, anti-Gr-1-PE,(도 10) anti-CCR3-PE,(도 11) 를 넣고 30분간 얼음에서 반응시킨 후 3회 이상 인산완충 생리식염수로 수세하고 flow cytometry(FACs)로 분석하였다.
결과 : 활성화된 CD4+ T세포와 성숙된 과립구의 마커인 CD11b+Gr-1+(도 10) 및 케모카인 리셉터인 CCR3+(도 11)의 감소로 보아 관련 면역세포의 감소 효과가 있는 것으로 사료된다.
1.2.6 NC/Nga mouse의 혈액에서 분리한 혈청내의 사이토카인 분석
DNCB로 유발된 NC/Nga 생쥐를 ethyl ether로 마취한 상태에서 심장 천자법을 이용하여 채혈한 다음 6,500 rpm에서 20분간 원심 분리하여 혈청을 분리하였다. IL-5, 13, IgE 농도는 ELISA kit를 이용하여 다음과 같이 측정하였다. 항체를 coating 완충 용액에 희석하여 microwell에 coating한 후 4℃에서 overnight 하였다. 각 well을 3회 washing 완충 용액으로 세척한 후 혈청(100배 희석)을 100㎕씩 분주하였다. 이를 1시간 동안 실온에서 방치하고 washing 완충 용액으로 2회 세척한 다음, avidin-HRP conjugated antibody 100㎕를 처리하고 1시간 실온에서 방치한 후 다시 세척하였다. 여기에 TMB substrate를 100㎕씩 분주하고 암소에서 30분간 방치한 다음 50㎕ 의 stop 용액을 처리한 후 ELISA reader 450nm에서 흡광도를 측정하였다.
결과 : 혈청 내 피부염 표식자인 IgE(도 12) 및 Th2 사이토카인인 IL-5, 13(도 13)이 농도 의존적으로 내려가는 것으로 보아 염증성 사이토카인의 억제 효과가 있는 것으로 사료된다.
1.2.7. NC/Nga mouse의 비장세포의 배양액 내 사이토카인 분석
NC/Nga 생쥐에서 비장을 적출하여 100 mesh로 세포를 분리하여 DMEM(5% FBS)으로 5분간 원심분리 (1200 rpm)한 후 ACK 용액 (8.3 g NH4Cl, 1 g KHCO3 in 1 L of demineralized water + 0.1 mM EDTA)을 실온에서 5분 동안 처리하여 적혈구를 용해시켜 분리하였다. 분리한 비장세포(1 ×105 cells/well)를 anti-CD3 (1 ㎍/㎖) 항체가 coating된 96well culture plate에서 48시간 동안 배양한 후 배양액을 취하여 ELISA kit을 이용하여 IL-4, IFN-γ를 측정하였다. 측정 방법은 혈청 내 사이토카인 측정 방법과 동일하다.
결과 : Th1 사이토카인인 IFN-γ와 Th2 사이토카인인 IL-4가 둘 다 감소된 것으로 보아 T 세포에서 발현되는 사이토카인의 조절 효과가 있는 것으로 사료된다. (도 14)
1.2.8. NC/Nga mouse의 관능평가
- 약물 처리 후 3주, 5주 때에 아토피성 피부염에서 일반적으로 사용되는 임상적 육안 평가법으로 관능평가를 실시하였다. 평가 항목은 홍반 (Erythema), 가려움과 건조 피부 (Pruritus & Dry skin), 부종과 혈종 (Edema & Hematoma), 짓무름 (Excoriation), 태선화 (Lichenification) 등으로 5가지이다. 각각의 항목은 없음 (0), 약함 (1), 중증도 (2), 심함 (3)으로 채점하였다.
결과 : 관능평가로 보아 3주 때부터 효과가 지속되어 5주에 효과가 가장 높고 농도 의존적으로 효과를 나타내는 것으로 확인되었다. (도 15)
실험예 2. 소양증에 미치는 효과실험
상기 실시예에서 수득한 시료의 경구 투여가 소양증에 미치는 효과를 확인하기 위하여 하기와 같이 긁는 행위(Scratching behavior) 평가 실험을 실시하였다 (Oku H, Ishiguro, K Antipururitic and antidermatitic effects of extract and compounds of Impatients bal Samin L in atopic dermatitis model NC mice Phytother Res 15, 506-510, 2001; Grimstad O et al., Anti-interleukin 31-antibodies ameliorate scratching behavior in NC/Ngamice; a model of atopic dermatitis Exp Dermatol 18(1), 35-43, 2009).
소양증에 미치는 효과를 측정하기 위하여 MJ201를 투여 후 20분 동안 몸을 긁는 회수를 세어서 scratching behavior로 나타내었으며 일주일에 1번씩 5주 동안 관찰하였다 (단, 핥는 행위는 제외).
가려움증에 미치는 효과
소양증에 미치는 효과를 조사하기 위하여 MJ201 투여 후 20분간 긁는 횟수를 측정하였다. 실험 기간이 경과함에 따라 정상군, 대조군, 양성 대조군, 생약, 모든 군에서 긁는 횟수가 증가하는 것을 관찰 할 수 있었으며 4주차에 그 수치가 최고치에 이르렀다. 정상군은 20분당 약 20번이 관찰 되었고, 대조군에서는 약 40번으로 그 수치가 현저히 증가되었으며, 양성대조군인 CsA(CyclosporinA) (Calbiochem, La Jolla, CA. USA) 투여군에서는 약 30번, MJ201 투여군에서도 30번으로 양성 대조군과 비슷한 수준으로 가려움증이 감소한 다는 것을 확인하였다. (도 16)
실험예 3. NC/Nga 생쥐의 피부 조직에서 IL-31 mRNA 발현에 미치는 효과 및 혈액 분석 실험
3-1. NC/Nga 생쥐의 피부 조직에서 IL-31 mRNA 발현에 미치는 효과
상기 실시예에서 수득한 시료의 NC/Nga 생쥐의 피부 조직에서 IL-31 mRNA 발현에 미치는 효과를 확인하기 위하여 하기와 같이 RT-PCR 실험을 실시하였다 ( Takaoka A, Arai I et al., Expression of IL-31 gene transcripts in NC/Nga mice with atopic dermatitis Eur J Pharmacol 516(2), 180-181 2005).
NC/Nga 생쥐의 귀 피부 조직을 떼어내어 Trizol 시약을 500㎕을 넣고 튜브에 넣은 후 클로로포름을 100㎕ 넣은 후 잘 섞었다. 원심분리하여 층이 분리되면 aqueous phase 용액을 200㎕ 취해서 튜브에 옮긴 후, 동량의 이소프로판올을 넣어 상온에서 10분간 방치한 후 원심분리하였다. 상층액을 제거하고 75% 에탄올을 1㎖ 넣어 잘 섞어준 후 원심분리하여 생등액을 완전히 제거하고 투명해질 때까지 말린 후 DEPC water로 RNA의 양에 따라 20~50㎕ 넣어 녹였다. RNA를 정량 하여 200ng/㎕로 맞춘 후 Prime ScriptTMRT reagent kit를 사용하여 제조사의 지시에 따라 cDNA를 합성하였다. cDNA를 만든 후 Maxime PCR PreMix Kit에 cDNA를 넣은 후 94℃ 30초, 57℃ 30초, 72℃ 30초로 25~30회 RT-PCR을 하였다 (표 1 참조).
표 1
Mouse IL-31 primer sets
forward; 5' - TCGGTCAT AT GC CA CTGGAG -3'
reverse; 5' - GCACAGTC CTTTGGAGTTAAGTC -3'
Mouse β-actin primer sets
forward; 5' - CGGGGACCTGACTGACTACC -3'
reverse; 5' - AGGAAGGCTGGAAGAGTGC -3'
NC/Nga 생쥐의 피부 조직에서 IL-31 mRNA 발현에 미치는 효과
피부 조직으로부터 mRNA를 분리하여 IL-31의 발현 정도를 비교 한 결과, 대조군에서는 정상군에 비하여 그 발현 양이 현저히 증가하였고, 양성 대조군인 CsA 투여군은 IL-31 mRNA 발현이 현저히 억제되었으며, MJ201 투여군에서도 IL-31 mRNA 발현이 억제되었다. (도 17)
실험예 4. 접촉성 피부염 모델 실험
상기 실시예에서 수득한 MJ201 추출물의 경구 투여가 접촉성 피부염 생쥐의 면역계에 미치는 효과를 확인하기 위하여 하기와 같이 접촉성 피부염 모델 실험을 실시하였다(손미예, 남상해, 두충 추출물이 DNCB로 유발된 알레르기성 접촉피부염과 산화적 손상에 미치는 영향. 한국식품영양과학회지 36(12), 1517-1522, 2007; 임금선등 BALB/c 및 Nc/Nga 마우스의 아토피성 피부 질환 모델에서 생약조성물 SPZZC의 치료 효능. 약학회지 52(3), 232-239, 2008).
4-1. BALB/c 생쥐의 피부염 유도 및 시료처리
4주령이 된 BALB/c 생쥐의 등을 귀 하단부에서부터 꼬리 상단부까지 전체를 제모한 후 피부의 미세 상처가 치유되도록 24시간 방치 하였다. 0.5%의 DNCB용액 (아세톤 : 올리브오일 = 4 : 1) 200㎕를 제모한 부위에 도포하고, 5일 후 1%의 DNCB용액 100㎕를 귀에 도포하여 피부염을 야기하였다. 실험은 5 마리씩 3개의 그룹으로 나누고, 정상군, 대조군에는 생리식염수를, 실험군으로 MJ201 (250㎎/㎏/day)을 1일 1회씩 4일 동안 각각 경구 투여하였다.
4-2. 혈청 내 IgE 생산량 측정
투여 처치 종료 후 ether로 마취한 상태에서 심장 천자법을 이용하여 채혈한 다음 원심 분리하여 혈청을 분리하였다. 혈청 내 IgE 생성량 측정은 ELISA kit를 이용하여 다음과 같이 측정하였다. 항체가 coating되어 있는 microwell을 3회 washing 완충 용액으로 세척한 후 혈청 (10배 희석) 50㎕씩 분주하였다. 이를 2시간 동안 실온에서 반응 시키고 washing 완충 용액으로 3회 세척한 다음 biotin-conjugated antibody 50㎕로 실온에서 2시간 처리하고 HRP-avidin용액 50㎕로 다시 1시간 반응 시킨 후 세척하였다. 여기에 TMB기질 (chromogenic substrate)을 50㎕씩 분주하고 암소에서 20분간 방치한 다음 50㎕의 stop 용액을 처리하였다. 반응 용액은 ELISA reader 450nm에서 흡광도를 측정하였다.
4-3. Splenocyte CD4+ T cell 분리
MJ201을 4일 동안 투여한 후 이틀 후에 BALB/c 마우스를 경추 탈구하여 치사시킨 후, 비장을 무균적으로 적출하여 빙냉의 RPMI 배지에 나일론 체 (70uM) 위에서 비장 조직을 갈아서 면역세포를 방출시켰다. 세포 현탁액을 원심분리한 후 세포침전물에 RBC lysis buffer를 가하여 적혈구를 용혈 시킨 후, PBS로 2회 세척하고 RPMI 1640-FBS (10% FBS 함유된 RPMI-1640) 배지를 이용하여 세포 농도를 1×107cells/㎖ 조정하여 세포용액을 조제하였다.
이 세포액에 MACS CD4+T cell kit지시에 따라 biotin-antibody cocktail과 anti-biotin microBeads, MACS buffer를 넣고 반응 시킨 후 MACS Column에 세포를 로딩하여 CD4+ T cell을 얻었다. 이를 2×106cells/로 조정하여 6well에 2㎖씩 분주한 후 anti-CD3/anti-CD28과 함께 37℃, 5% CO2배양기에서 6시간 배양하였다.
4-4. Real-time PCR
Splenocyte CD4+ T cell를 6 well에 2×106cells/로 분주한 후 anti-CD3/anti-CD28으로 6시간 동안 자극한 뒤 세포를 얻었다. EL-4 T cell 1×106cells/㎖로 60mm 플레이트에 4㎖씩 분주한 후 MJ201을 60㎍/㎖로 처리하고 1시간 후에 PMA(50ng/㎖)와 ionomycin(0.25μM)으로 자극한 뒤 6시간 후에 세포를 얻었다. RT-PCR과 동일한 방법으로 cDNA를 만든 후 IL-31, GAPDH primer를 적정농도로 각각 희석하여 넣고, Power SYBR Green PCR Master Mix, TaqManExpression Master Mix와 cDNA를 넣은 후 real-time PCR을 95℃ 10분 실행 후 95℃ 15초, 60℃ 1 분으로 40회 실행시켰다 (표 2 참조).
표 2
Mouse IL-31 primer sets
forward; 5- ATACAGCTGCCGTGTTTCAG -3
reverse; 5- AGCCATCTTATCACCCAAGAA -3
Mouse GAPDH Pre-Developed TaqMan Assay Reagents (Applied Biosystems Co., U.S.A, Cat. No. 435239E)
4-5. 통계 처리
각 실험군 결과 값은 통계프로그램(unpaired student's T-test)을 사용하여 통계 처리하였으며, P<0.05 이하의 수준에서 유의성 검정을 실시하였다 (* π<0.05,**π<0.01,***π<0.001).
상기한 바와 같은 실험 결과,
4-6. CD4+ T cell에서 IL-31 mRNA 및 IL-2 생산에 미치는 효과,
DNCB를 피부에 도포하여 접촉성 피부염을 유발한 생쥐의 비장으로부터 CD4+ T 세포를 분리하고 mRNA를 얻은 후, IL-31의 발현 정도를 비교 한 결과, 대조군 에서는 정상군에 비하여 그 발현 양이 현저히 증가하였고, MJ201을 투여한 군에서는 IL-31 mRNA 발현이 억제되었다 (도 18). DNCB를 피부에 도포하여 접촉성 피부염을 유발한 생쥐의 비장으로부터 CD4+ T 세포를 분리하고 anti-CD3 와 anti-CD28로 활성화된 CD4+ T 세포의 상층액을 얻은 후, IL-2의 생성 정도를 비교 한 결과, 대조군은 정상군에 비해 IL-2의 생산이 2배 정도 증가 하였고, MJ201 투여군에서는 IL-2 생산이 감소하여 정상군과 비슷한 정도로 나타났다 (도 19 참조).
4-7. IgE 생산량에 미치는 효과
대조군의 혈청 중 IgE의 농도는 651.79 ± 46.68ng/㎖으로 정상군(319.47 ±58.44ng/㎖) 보다 유의적으로 증가하였고, MJ201 투여군은 362.76 ± 62.56ng/㎖으로 유의적으로 감소하였다. (도 20)
4-8. MJ201의 T 세포 활성 억제 작용
(1) EL-4 T cell에서 및 IL-2의 생성에 미치는 효과
PMA와 Ionomycin으로 활성화된 EL-4 T 세포에 MJ201(60㎍/㎖)을 처리하여 mRNA를 얻은 후, IL-31의 발현 정도를 비교 한 결과, PBS만을 처리한 정상 세포에 비하여 PI를 처리한 대조군에서는 IL-31의 발현 양이 현저히 증가하였고, MJ201을 처리한 세포에서는 IL-31 mRNA 발현이 억제 되었다 (도 21). PMA와 Ionomycin으로 활성화된 EL-4 T 세포에 MJ201을 처리하여 상층액을 얻은 후, IL-2의 발현 정도를 비교 한 결과, 대조군은 정상군에 비해 IL-2의 발현이 증가 하였고, MJ201 투여군은 대조군보다 유의적으로 감소하였다 (도 22).
본 발명의 추출물을 포함하는 조성물의 제형예를 설명하나, 본 발명은 이를 한정하고자 함이 아닌 단지 구체적으로 설명하고자 함이다.
제형예 1. 산제의 제조
MJ201 추출물 20 mg
유당 100 mg
탈크 10 mg
상기의 성분들을 혼합하고 기밀포에 충진하여 산제를 제조한다.
제형예 2. 정제의 제조
MJ201 추출물 10 mg
옥수수전분 100 mg
유당 100 mg
스테아린산 마그네슘 2 mg
상기의 성분들을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조한다.
제형예 3. 캅셀제의 제조
MJ201 추출물 10 mg
결정성 셀룰로오스 3 mg
락토오스 14.8 mg
마그네슘 스테아레이트 0.2 mg
통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 캡슐제를 제조한다.
제형예 4. 주사제의 제조
MJ201 추출물 10 mg
만니톨 180 mg
주사용 멸균 증류수 2974 mg
Na2HPO4,12H2O 26 mg
통상의 주사제의 제조방법에 따라 1 앰플당(2) 상기의 성분 함량으로 제조한다.
제형예 5. 액제의 제조
MJ201 추출물 20 mg
이성화당 10 g
만니톨 5 g
정제수 적량
통상의 액제의 제조방법에 따라 정제수에 각각의 성분을 가하여 용해시키고 레몬향을 적량 가한 다음 상기의 성분을 혼합한 다음 정제수를 가하여 전체를 정제수를 가하여 전체 100로 조절한 후 갈색병에 충진하여 멸균시켜 액제를 제조한다.
제형예 6. 건강 식품의 제조
MJ201 추출물 1000
비타민 혼합물 적량
비타민 A 아세테이트 70
비타민 E 1.0
비타민 B1 0.13
비타민 B2 0.15
비타민 B6 0.5
비타민 B12 0.2
비타민 C 10
비오틴 10
니코틴산아미드 1.7
엽산 50
판토텐산 칼슘 0.5
무기질 혼합물 적량
황산제1철 1.75
산화아연 0.82
탄산마그네슘 25.3
제1인산칼륨 15
제2인산칼슘 55
구연산칼륨 90
탄산칼슘 100
이하, 본 발명의 제형예로서 크림, 맛사지크림, 로션, 스킨로션, 에센스, 팩, 클렌징폼의 제형을 예시하고 있으나, 본 발명의 화장품 조성물을 포함하는 제형은 이에 한정되는 것은 아니다.
제형예 7. 크림조성물
Figure PCTKR2011010247-appb-I000001
제형예 8. 맛사지크림 조성물
유상과 수상을 각각 75 로 가열 용해 혼합한 후 실온으로 냉각한다.
Figure PCTKR2011010247-appb-I000002
제형예 9. 로션 조성물
유상과 수상을 각각 75℃ 로 가열 혼합 유화한 후 실온으로 냉각한다.
Figure PCTKR2011010247-appb-I000003
제형예 10. 스킨로션 조성물
*수상과 에탄올상을 각각 제조 혼합한 후 여과한다.
Figure PCTKR2011010247-appb-I000004
제형예 11. 에센스 조성물
수상과 에탄올상을 각각 제조 혼합한 후 여과한다.
Figure PCTKR2011010247-appb-I000005
제형예 12. 팩 조성물
수상과 에탄올상을 각각 분산 용해하여 혼합시킨 후 실온으로 냉각한다.
Figure PCTKR2011010247-appb-I000006
제형예 13. 클렌징폼 조성물
수상과 오일상을 각각 분산 용해하여 혼합 검화한 후 실온으로 냉각한다.
Figure PCTKR2011010247-appb-I000007
부평초, 사상자, 백부근으로 조성된 생약 추출물 (MJ201)을 NC/Nga 아토피 피부염 생쥐에 경구 투여 하였을 때 가려움증이 현저히 감소하고 피부 조직의 홍반과 부종이 억제 된 것을 확인하였고 epidermis와 dermis의 두께가 증가하는 것을 억제하며 호산구와 비만세포의 유입이 현저히 감소하는 것을 확인하였다. 접촉성 피부염을 유도하며 MJ201을 생쥐에 경구 투여한 결과 IgE 생산이 유의적으로 감소하였으며, 분리된 CD4+ T 세포로부터 IL-31의 발현과 IL-2의 생산이 감소 하는 것을 확인하였다. 또한 PMA와 ionomycin에 의해 활성화된 EL-4 T 세포의 IL-31발현과 IL-2의 생성이 유의적으로 감소하는 것을 확인 한 바, MJ201은 다양한 피부 질환의 가려움증을 감소시키고 피부염증, 홍반, 부종, 두께 증가와 같은 병리적 손상이 발생하는 것을 억제함으로써 다양한 피부 질환 치료제로 응용할 수 있다.

Claims (11)

  1. 부평초(Spirodela polyrrhiza), 사상자(Torilis japonica DC) 및 백부근(Stemona japonica MIQ)의 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 치료용 약학조성물.
  2. 제 1항에 있어서,
    상기 복합 생약 추출물은 부평초, 사상자 및 백부근의 건조 혼합중량비(%)가 1~10 : 1~10 : 1~10로 구성됨을 특징으로 하는 조성물.
  3. 제 1항에 있어서,
    상기 추출물은 정제수를 포함한 물, 주정, 탄소수 1 내지 4의 저급 알콜, 아세톤, 클로로포름, 메틸렌클로리드, 헥산 또는 이들의 혼합용매에 가용한 추출물임을 특징으로 하는 조성물.
  4. 제 1항에 있어서,
    상기 알러지성 피부질환으로는 과민증, 알러지성 비염, 천식, 알러지성 결막염, 알러지성 피부염, 아토피성 피부염, 알러지성 접촉성 피부염, 두드러기, 곤충 알러지, 식품알러지 또는 약품 알러지이며; 비알러지성 피부질환은 자극성 피부염, 지루성 피부염, 화폐성 습진, 울체성 피부염, 만성 단순성 태선, 한포진 및 노인성 습진으로부터 선택된 비알러지성 습진, 원발성 단순 접촉성 피부염, 완선, 또는 건선인 조성물.
  5. 제 1항에 있어서,
    상기 약학 조성물은 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 제형인 조성물.
  6. 부평초, 사상자 및 백부근으로 조성된 생약 추출물(MJ201)을 알러지성 또는 비알러지성 피부 질환 환자에게 투여함을 포함하는, 알러지성 또는 비알러지성 피부 질환 환자를 치료하기 위한 치료방법.
  7. 알러지성 또는 비알러지성 피부 질환 치료용 약제를 제조하기 위한 부평초, 사상자 및 백부근으로 조성된 생약 추출물(MJ201)의 용도.
  8. 부평초, 사상자, 백부근의 복합 생약 추출물을 유효성분으로 함유하는 알러지 질환의 예방 및 개선용 건강기능식품.
  9. 제 8항에 있어서,
    상기 식품은 식품류, 분말, 과립, 정제, 캡슐, 시럽제, 음료, 껌, 차, 비타민 복합제, 건강기능성 식품류 형태인 건강기능식품.
  10. 부평초, 사상자 및 백부근으로 조성된 생약 추출물 (MJ201)의 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 화장료 조성물.
  11. 제 10항에 있어서,
    상기 화장료 조성물은 화장수, 스킨, 로션, 영양로션, 영양크림, 마사지 크림, 에센스, 또는 팩의 제형인 조성물.
PCT/KR2011/010247 2011-01-13 2011-12-28 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 조성물 및 이의 용도 WO2012096463A2 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR1020110003477A KR101189938B1 (ko) 2011-01-13 2011-01-13 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 피부외용 약학 조성물 및 화장료 조성물
KR10-2011-0003478 2011-01-13
KR10-2011-0003477 2011-01-13
KR1020110003478A KR101231446B1 (ko) 2011-01-13 2011-01-13 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 치료용 약학 조성물 및 건강기능식품

Publications (2)

Publication Number Publication Date
WO2012096463A2 true WO2012096463A2 (ko) 2012-07-19
WO2012096463A3 WO2012096463A3 (ko) 2012-11-22

Family

ID=46507538

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/010247 WO2012096463A2 (ko) 2011-01-13 2011-12-28 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 조성물 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2012096463A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109655543A (zh) * 2018-12-21 2019-04-19 广东方制药有限公司 一种利用uplc特征图谱鉴别百部药材基源的方法
CN115297880A (zh) * 2020-03-13 2022-11-04 (株)美迪合伙来音 用于治疗或改善皮肤溃疡的包括含龙眼肉组合生药提取物的局部用组合物及其用途

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0517330A (ja) * 1991-07-03 1993-01-26 Fujii Kk にきび治療薬
KR20010081417A (ko) * 2000-02-14 2001-08-29 성재갑 사상자 추출물을 함유하는 피부 가려움증 완화용 조성물
KR20050052838A (ko) * 2003-12-01 2005-06-07 주식회사 태평양 생약재 추출물을 함유하는 피부 외용제 조성물
KR100881884B1 (ko) * 2007-05-10 2009-02-06 조선대학교산학협력단 복합 생약 추출물을 유효성분으로 함유하는 피부염 질환의예방 및 치료용 조성물

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109655543A (zh) * 2018-12-21 2019-04-19 广东方制药有限公司 一种利用uplc特征图谱鉴别百部药材基源的方法
CN109655543B (zh) * 2018-12-21 2022-05-17 广东一方制药有限公司 一种利用uplc特征图谱鉴别百部药材基源的方法
CN115297880A (zh) * 2020-03-13 2022-11-04 (株)美迪合伙来音 用于治疗或改善皮肤溃疡的包括含龙眼肉组合生药提取物的局部用组合物及其用途

Also Published As

Publication number Publication date
WO2012096463A3 (ko) 2012-11-22

Similar Documents

Publication Publication Date Title
WO2021137677A1 (ko) 식물 추출물을 함유하는 조성물
KR101116852B1 (ko) 후박 추출물 또는 이로부터 분리된 ４-ｏ-메틸호노키올을유효성분으로 함유하는 항염, 항알러지 및 주름 개선용조성물
WO2021107706A1 (ko) 밀크 엑소좀의 새로운 용도
WO2016060525A1 (ko) 쥐꼬리망초 속 식물의 추출물 또는 분획물을 포함하는 조성물
WO2020122360A1 (ko) 트리신 함량이 증가된 고장초 효소 처리 추출물의 제조방법 및 이로 제조된 미백, 주름 개선, 항염증, 항알러지, 보습용 조성물
WO2014163298A1 (ko) 강력한 피부 보호효과를 나타내는 노니 잔사 추출물을 분리하는 추출방법 및 이를 함유한 피부노화 치료 및 예방 및 피부 보호용 조성물
WO2017146414A1 (ko) α-테르피네올을 유효성분으로 함유하는 피부 보습 및 피부 주름 개선용 조성물
WO2022260454A1 (ko) 장수만리화 추출물을 포함하는 아토피 피부염 치료용 또는 피부 장벽 강화용 또는 노화 방지용 조성물
WO2018004141A1 (ko) 시멘, 베헨산, 2-메톡시나프탈렌, 티몰 및 이들의 염으로 이루어진 군에서 선택된 어느 하나 이상을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2017213346A1 (ko) 디오스민 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2014003232A1 (ko) 황칠나무 추출물을 유효성분으로 포함하는 발모 촉진용 조성물
WO2021080297A1 (ko) 달맞이꽃 추출물을 유효성분으로 포함하는 비만 또는 비만으로부터 유도된 대사증후군의 예방 또는 치료용 조성물
WO2020256464A1 (ko) 항염 활성을 갖는 아피오스 아메리카나 괴경 추출물의 분획물의 알코올성 위염 예방 또는 치료제로서의 용도 및 이의 제조방법
WO2012096463A2 (ko) 복합 생약 추출물을 유효성분으로 함유하는 알러지성 또는 비알러지성 피부 질환의 예방 및 개선용 조성물 및 이의 용도
WO2018062820A1 (ko) 피토에스트로겐을 유효성분으로 포함하는 탈모방지 및 모발 성장 촉진용 조성물
WO2020085826A1 (ko) 육두구 추출물 또는 메이스리그난을 유효성분으로 함유하는 환경오염인자로부터 유도되는 피부자극 완화 및 피부보호용 조성물
WO2017183924A1 (ko) 단풍나무 잎 추출물을 포함하는 안구건조증의 예방 또는 치료용 조성물
WO2020138834A1 (ko) 조팝나무 추출물을 포함하는 피부질환 예방 또는 치료용 조성물
WO2015037855A1 (en) A composition comprising an extract of combined herbs consisting of acanthopanax koreanum nakai and crinum asiaticum var. japonicum showing preventing activity of baldness and stimulating activity of hair growth
WO2016122091A1 (ko) 심비디움(cymbidium) 추출물을 유효성분으로 함유하는 알레르기 질환 또는 접촉성 피부염 예방 및 치료용 약학조성물
WO2020145619A1 (ko) 운데칸 또는 운데칸알을 유효성분으로 포함하는 항알러지, 아토피 피부염 개선, 또는 피부 재생용 조성물
WO2020130478A1 (ko) 자스몬을 유효성분으로 포함하는 항알러지, 아토피 피부염 개선, 또는 피부 재생용 조성물
WO2021002642A1 (ko) 뱀독을 포함하는 류마티스 관절염의 예방 또는 치료용 조성물
WO2016190689A2 (ko) 근육 질환 예방, 개선 또는 치료용 또는 근 기능 개선용 조성물
WO2023128630A1 (ko) 담팔수 추출물을 포함하는 피부 개선용 화장료 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11855497

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11855497

Country of ref document: EP

Kind code of ref document: A2