WO2011044246A1 - Use of toll-like receptor and agonist for treating cancer - Google Patents

Use of toll-like receptor and agonist for treating cancer Download PDF

Info

Publication number
WO2011044246A1
WO2011044246A1 PCT/US2010/051646 US2010051646W WO2011044246A1 WO 2011044246 A1 WO2011044246 A1 WO 2011044246A1 US 2010051646 W US2010051646 W US 2010051646W WO 2011044246 A1 WO2011044246 A1 WO 2011044246A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
flagellin
tlr
agent
toll
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/051646
Other languages
English (en)
French (fr)
Inventor
Andrei V. Gudkov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Statera Biopharma Inc
Original Assignee
Cleveland Biolabs Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to UAA201204208A priority Critical patent/UA110605C2/uk
Priority to EA201290140A priority patent/EA021842B1/ru
Priority to US13/500,552 priority patent/US9205095B2/en
Priority to AU2010303464A priority patent/AU2010303464B2/en
Priority to ES10822611.9T priority patent/ES2457518T3/es
Priority to CA2777198A priority patent/CA2777198C/en
Priority to HK14112425.4A priority patent/HK1199058B/xx
Priority to MX2012004095A priority patent/MX2012004095A/es
Application filed by Cleveland Biolabs Inc filed Critical Cleveland Biolabs Inc
Priority to BR112012011331A priority patent/BR112012011331B8/pt
Priority to AP2012006253A priority patent/AP2012006253A0/xx
Priority to CN201080055226.1A priority patent/CN104136614B/zh
Priority to EP10822611.9A priority patent/EP2486134B1/en
Priority to JP2012533282A priority patent/JP5796014B2/ja
Publication of WO2011044246A1 publication Critical patent/WO2011044246A1/en
Priority to IL219060A priority patent/IL219060A/en
Priority to ZA2012/02500A priority patent/ZA201202500B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/59Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/164Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22Hormones
    • A61K38/2257Prolactin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22Hormones
    • A61K38/27Growth hormone [GH], i.e. somatotropin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001102Receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • A61P33/02Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/20Vector systems having a special element relevant for transcription transcription of more than one cistron

Definitions

  • This invention relates to methods of treating cancer and infectious diseases.
  • Toll-like receptors are responsible for the recognition of most common patterns of bacterial and viral pathogens. Their activation results in recruitment of innate and subsequently adaptive immune response. Receptor cells of the immune system to the site of presence of antigens is the key step in effective immune response. That is why immunization involves the use of different types of adjuvants. Although the majority of tumors express tumor- specific antigens, they are using a number of mechanisms allowing then to escape immune recognition. It was recently demonstrated in mouse models that activation of TLR5 by its ligand and agonist, bacterial flagellin, results in the induction of antitumor effect against those tumors that express functional TLR5. This opens a general opportunity for considering TLR5 agonists for cancer immunotherapy.
  • the present invention may be directed to a vector comprising a first and second nucleic acid, wherein the first nucleic acid encodes a toll-like receptor and the second nucleic acid encodes a toll-like receptor agonist.
  • the first nucleic acid may encode for a secreted form of a toll-like receptor.
  • the second nucleic acid may be a secreted form of flagellin.
  • the toll-like receptor agonist may be flagellin.
  • the vector may be a mammalian expression vector.
  • the vector may be expressed from an adenovirus, a lentivirus or a liposome.
  • the secreted form of flagellin may be CBLB502S.
  • the toll-like receptor may be TLR-5.
  • the present invention may be directed to a method of treating cancer in a mammal comprising administering to a mammal in need thereof a agent comprising the vector comprising a first and second nucleic acid, wherein the first nucleic acid encodes a toll-like receptor and the second nucleic acid encodes a toll-like receptor agonist.
  • the cancer may be a tumor.
  • the tumor may be derived from the group consisting of prostate, breast, colon, esophagus, stomach, lung, pancreatic, renal, thyroid, ovaries, throat, or the cervix.
  • the tumor may be derived from the group consisting of sarcomas, melenomas, leukemias, and lymphomas.
  • the agent may be administered in trans or outside from the tumor of the mammal.
  • the agent may be administered directly into a tumor of the mammal.
  • the agent may be administered in combination with an immunostimulant.
  • the immunostimulant may be selected from the group consisting of growth hormone, prolactin and vitamin D.
  • the growth hormone may be somatotrophin.
  • the agent may be administered in combination with a cytokine.
  • the cytokine may be a stem cell factor.
  • the present invention is also directed to a method for treating an infection in a mammal comprising administering to a mammal in need thereof the agent of agent comprising the vector comprising a first and second nucleic acid, wherein the first nucleic acid encodes a toll-like receptor and the second nucleic acid encodes a toll-like receptor agonist.
  • the cancer may be a tumor.
  • the infection may be derived from the group consisting of viruses, bacteria, protozoan parasites and fungi.
  • FIG. 1A-1C depicts schematic maps of adenoviral vectors expressing TLR5,
  • Figure 2 depicts the results of the ratio of tumor volume in mice over a number of days in tumor cells (A549) transduced with a control vector (without TLR5) or vector expressing TLR5 wherein the mice are treated three days with either CBLB502 or PBS.
  • Figure 3 depicts suppression of tumor growth by injection of adenovirus comprising vector coexpressing CBLB502S and Toll-like receptor wherein the adenovirus is injected into syngeneic mice CT26 colon carcinoma tumor and studying the in-cis and in-trans effects of the adenoviral vector constructs.
  • Figure 4 shows the domain structure of bacterial flagellin. The Ca backbone trace, hydrophobic core distribution and structural information of F41. Four distinct hydrophobic cores that define domains Dl, D2a, D2b and D3. All the hydrophobic side-chain atoms are displayed with the Ca backbone.
  • Side-chain atoms are color coded: Ala, yellow; Leu, He or Val, orange; Phe and Tyr, purple (carbon atoms) and red (oxygen atoms), c, Position and region of various structural features in the amino-acid sequence of flagellin.
  • Figure 5 shows a schematic of Salmonella flagellin domains, its fragments, and its interaction with TLR5. Dark bars denote regions of the flagellin gene used to construct fragments comprising A, B, C, A' and B' .
  • Figure 6 depicts flagellin derivatives. The domain structure and approximate boundaries (amino acid coordinates) of selected flagellin derivatives (listed on the right). FliC flagellin of Salmonella dublin is encoded within 505 amino acids (aa).
  • Figure 7 shows the nucleotide and amino acid sequence for the following flagellin variants: AA' (SEQ ID NO: 7-8), AB' (SEQ ID NO: 9-10), BA' (SEQ ID NO: 11-12), BB' (SEQ ID NO: 13-14), CA' (SEQ ID NO: 15-16), CB' (SEQ ID NO: 17-18), A (SEQ ID NO: 19- 20), B (SEQ ID NO: 21-22), C (SEQ ID NO: 23-24), GST-A' (SEQ ID NO: 25-26), GST-B' (SEQ ID NO: 27-28), AA'nl-170 (SEQ ID NO: 29-30), AA'nl-163 (SEQ ID NO: 33-34), AA'n54-170 (SEQ ID NO: 31-32), AA'n54-163 (SEQ ID NO: 335-36), AB'nl-170 (SEQ ID NO: 37-38), AB'nl-163 (SEQ ID NO: 39-40
  • the pRSETb leader sequence is shown in Italic (leader includes Met, which is also amino acid 1 of FliC).
  • the N terminal constant domain is underlined.
  • the amino acid linker sequence is in Bold.
  • the C terminal constant domain is underlined. GST, if present, is highlighted.
  • Figure 8 shows a comparison of amino acid sequences of the conserved amino (Fig. 8A) and carboxy (Fig. 8B) terminus from 21 species of bacteria.
  • the 13 conserved amino acids important for TLR5 activity are shown with shading.
  • Figure 9 shows the nucleic acid and amino acid sequence for the human Toll-like receptor 5 protein.
  • the inventors have made the surprising discovery that the provision of a toll-like receptor, such as toll-like receptor 5 (TLR-5), in combination with a toll-like receptor agonist, such as flagellin, results in a cis and in-trans effect that recruits cells involved in both the innate (cis effect) and adaptive (trans effect) immune response to specifically kill cancer cells and cells infected with a pathogen via the NF- ⁇ apoptosis pathway.
  • TLR-5 toll-like receptor 5
  • flagellin results in a cis and in-trans effect that recruits cells involved in both the innate (cis effect) and adaptive (trans effect) immune response to specifically kill cancer cells and cells infected with a pathogen via the NF- ⁇ apoptosis pathway.
  • the idea implemented in this invention was to (i) overcome the dependence of TLR-mediated immunization strategies on pre-existing TLR expression in a tumor by transducing the tumor with a construct driving expression of TLR; and (ii) to direct the immune response to the tumor by creating local pool of TLR agonist.
  • drug formulations comprising TLR simultaneously induce expression and activate TLR, thereby exposing tumor cells to the host immune system imitating the situation of massive bacterial penetration through the intestinal wall.
  • the method can be used to treat tumors derived from the prostate, breast, colon, esophagus, stomach, lung, pancreatic, renal, thyroid, ovaries, throat, or the cervix cancer as well as treating sarcomas, melenomas, leukemias, and lymphomas.
  • Applications of this method are not limited to cancer treatments, as this method can also be used to treat infections derived from viruses, bacteria, protozoan parasites and fungi.
  • Variations of providing the TLR and TLR agonist may include vectors, co-expressing the TLR receptor and a secretable form of flagellin that activates TLR activity in the same compromised mammalian cell.
  • the method of the present invention may also include vector constructs that express the TLR receptor in a mammalian cell and the TLR agonist being administered in trans to the cell.
  • an adenoviral vector may require modification of flagellin to reach its effective synthesis and secretion by mammalian cells.
  • each intervening number there between with the same degree of precision is explicitly contemplated.
  • the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6,9, and 7.0 are explicitly contemplated.
  • administering may mean a single dose or multiple doses of an agent or agent.
  • Analog may mean, in the context of a peptide or polypeptide, a peptide or polypeptide comprising one or more non-standard amino acids or other structural variations from the conventional set of amino acids.
  • Antibody may mean an antibody of classes IgG, IgM, IgA, IgD or IgE, or fragments, or derivatives thereof, including Fab, F(ab')2, Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies and derivatives thereof.
  • the antibody may be a monoclonal antibody, polyclonal antibody, affinity purified antibody, or mixtures thereof which exhibits sufficient binding specificity to a desired epitope or a sequence derived therefrom.
  • the antibody may also be a chimeric antibody.
  • the antibody may be derivatized by the attachment of one or more chemical, peptide, or polypeptide moieties known in the art.
  • the antibody may be conjugated with a chemical moiety.
  • a “derivative” may mean a peptide or polypeptide different other than in primary structure (amino acids and amino acid analogs). Derivatives may differ by being glycosylated, one form of post-translational modification. For example, peptides or polypeptides may exhibit glycosylation patterns due to expression in heterologous systems. If at least one biological activity is retained, then these peptides or polypeptides are derivatives according to the invention.
  • Other derivatives may include fusion peptides or fusion polypeptides having a covalently modified N- or C-terminus, PEGylated peptides or polypeptides, peptides or polypeptides associated with lipid moieties, alkylated peptides or polypeptides, peptides or polypeptides linked via an amino acid side-chain functional group to other peptides, polypeptides or chemicals, and additional modifications as would be understood in the art.
  • a "fragment” may mean a portion of a reference peptide or polypeptide.
  • a "homolog” may mean a peptide or polypeptide sharing a common evolutionary ancestor.
  • a "leader sequence” may be a nucleic acid encoding any peptide sequence that is linked and translated with a peptide or polypeptide of interest to allow the peptide or polypeptide of interest be properly routed through a eukaryotic cell's endoplasmic reticulum and Golgi complexes for the purposed of extracellular secretion from the cell's membrane.
  • the leader peptide sequence may be derived from alkaline phosphatase.
  • the leader sequence may have a DNA sequence comprising atgctgctgctgctgctgctgctgggcctgaggctacagctct ccctgggc.
  • a liposome may mean a tiny bubble (vesicle) made out of the same material as a cell membrane.
  • a liposome be filled with drugs and used to deliver drugs for cancer and other diseases.
  • a liposome may be filled with a vector.
  • a liposome membrane may be made of phospholipids, which are molecules that have a head group and a tail group. The head of the liposome may be attracted to water, and the tail, which is made of a long hydrocarbon chain, is repelled by water. The tails may be repelled by water, and line up to form a surface away from the water.
  • the lipids in the plasma membrane may be chiefly phospholipids like
  • Liposomes may be composed of naturally- derived phospholipids with mixed lipid chains (like egg phosphatidylethanolamine), or of pure surfactant components like DOPE (dioleoylphosphatidylethanolamine).
  • a "peptide” or “polypeptide” may mean a linked sequence of amino acids and may be natural, synthetic, or a modification or combination of natural and synthetic.
  • substantially identical may mean that a first and second amino acid sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%,or 99% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 amino acids .
  • Treating each may mean to alleviate, suppress, repress, eliminate, prevent or slow the appearance of symptoms, clinical signs, or underlying pathology of a condition or disorder on a temporary or permanent basis.
  • Preventing a condition or disorder involves administering a agent of the present invention to a subject prior to onset of the disease.
  • Suppressing a condition or disorder involves administering a agent of the present invention to a subject after induction of the condition or disorder but before its clinical appearance.
  • Repressing the condition or disorder involves administering a agent of the present invention to a subject after clinical appearance of the disease.
  • a “variant” may mean means a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity.
  • Representative examples of "biological activity” include the ability to bind to a toll-like receptor and to be bound by a specific antibody.
  • Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity.
  • a conservative substitution of an amino acid i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change.
  • hydrophobicity and charge It is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of +2 are substituted.
  • the hydrophilicity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity.
  • U.S. Patent No. 4,554,101 incorporated fully herein by reference.
  • substitutions can result in peptides retaining biological activity, for example immunogenicity, as is understood in the art. Substitutions may be performed with amino acids having hydrophilicity values within +2 of each other. Both the hyrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties. [0032] A "vector" may mean a nucleic acid sequence containing an origin of replication.
  • a vector may be a plasmid, a yeast or a mammalian artificial chromosome.
  • a vector may be a RNA or DNA vector.
  • a vector may be either a self -replicating extrachromosomal vector or a vector which integrates into a host genome.
  • TLR toll-like receptor
  • PRR pattern recognition receptor
  • the TLR may recognize molecules that are conserved molecular products derived from pathogens that include Gram-positive, Gram-negative bacteria, fungi, and viruses, but are distinguishable from host molecules, collectively referred to as pathogen-associated molecular patterns (PAMPs).
  • PAMPs pathogen-associated molecular patterns
  • DAMPs damage-associated molecular pattern
  • a PAMP or DAMP may be a TLR agonist as further described below.
  • the TLR may be a fragment, variant, analog, homolog or derivative that recruits adapter molecules within the cytoplasm of cells in order to propagate a signal.
  • the TLR may be from a human or other mammalian species such as rhesus monkey, mouse, or rat.
  • the TLR may be at least 30-99% identical to a TLR that recruits adapter molecules within the cytoplasm of cells in order to propagate a signal.
  • the TLR may be one of the between ten and fifteen types of TLR that are estimated to exist in most mammalian species.
  • the TLR may be one of the 13 TLR (named simply TLR1 to TLR 13) that have been identified in humans and mice together, or may be an equivalent form that has been found in other mammalian species.
  • the TLR may be one of the 11 members (TLR1-TLR11) that have been identified in humans.
  • the TLR may be expressed by different types of immune cells, and may be located on the cell surface or in the cell cytoplasm.
  • the TLR may be expressed on cancer cells.
  • the TLR may be expressed by normal epithelial cells in the digestive system, normal keratinocytes in the skin, alveolar and bronchial epithelial cells, and epithelial cells of the female reproductive tract. These cells lining an organ may be the first line of defense against invasion of micoorganisms, and TLRs expressed in epithelial cells may have a crucial role in the regulation of proliferation and apoptosis.
  • the TLR-expressing cancer cell may be selected from the following table: Table 1 TLR expression in Human Cancer cells
  • the TLR expressed on cancer cells may upregulate the NF- ⁇ cascade and produce anti- apoptotic proteins that contribute to carcinogenesis and cancer cell proliferation.
  • TLR signaling pathways are known to be involved in signaling. These proteins are known as myeloid differentiation factor 88 (MyD88), Tirap (also called Mai), Trif, and Tram.
  • MyD88 myeloid differentiation factor 88
  • Tirap also called Mai
  • Trif Trif
  • the adapters activate other molecules within the cell, including certain protein kinases (IRAKI, IRAK4, TBK1, and IKKi) that amplify the signal, and ultimately lead to the induction or suppression of genes that orchestrate the inflammatory response.
  • IRAKI, IRAK4, TBK1, and IKKi protein kinases
  • TLR signaling pathways during pathogen recognition may induce immune reactions via extracellular and intracellular pathways mediated by MyD88, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-KB), and mitogen- associated protein kinase (MAPK).
  • NF-KB nuclear factor kappa-light-chain-enhancer of activated B cells
  • MAPK
  • TLRs together with the Interleukin-1 receptors form a receptor superfamily, known as the "Interleukin-1 Receptor/Toll-Like Receptor Superfamily.” All members of this family have in common a so-called TIR (Toll-IL-1 receptor) domain.
  • TIR Toll-IL-1 receptor
  • Three subgroups of TIR domains may exist. Proteins with subgroup I TIR domains are receptors for interleukins that are produced by macrophages, monocytes and dendritic cells and all have extracellular Immunoglobulin (Ig) domains. Proteins with subgroup II TIR domains are classical TLRs, and bind directly or indirectly to molecules of microbial origin.
  • a third subgroup of proteins containing TIR domains (III) consists of adaptor proteins that are exclusively cytosolic and mediate signaling from proteins of subgroups 1 and 2.
  • the TLR may be a fragment, variant, analog, homolog or derivative that retains either a subgroup I TIR domain, subgroup II TIR domain, or subgroup III TIR domain.
  • the TLR may function as a dimer.
  • TLR2 forms heterodimers with TLR1 or TLR6, each dimer having a different ligand specificity.
  • the TLR may also depend on other co-receptors for full ligand sensitivity, such as in the case of TLR4's recognition of LPS, which requires MD-2.
  • CD14 and LPS Binding Protein (LBP) are known to facilitate the presentation of LPS to MD-2.
  • the TLR may be TLR1, which recognizes PAMPs with a specificity for gram-positive bacteria. TLR1 has also been designated as CD281.
  • the TLR may be Toll-like receptor 5.
  • the protein encoded by the TLR-5 may play a fundamental role in pathogen recognition and activation of innate immunity.
  • TLR-5 may recognize PAMPs that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity.
  • TLR-5 may recognize bacterial flagellin, a principal component of bacterial flagella and a virulence factor.
  • the activation of the TLR may mobilize the nuclear factor NF- ⁇ and stimulate tumor necrosis factor-alpha production.
  • the TLR agonist may be a PAMP, which may be conserved molecular product derived from a pathogen.
  • the pathogen may be a Gram-positive bacterium, Gram-negative bacterium,, fungus, or virus.
  • the TLR agonist may be a damage- associated molecular pattern (DAMP) ligand, which may be an endogenous molecule released from injured or dying cells.
  • DAMP or PAMP may initiate an immune response through TLR signals and recruit adapter molecules within the cytoplasm of cells in order to propagate a signal.
  • the TLR agonist may be an agonist for the TLR, which may be a ligand from the following in Table 2: Table 2 TLRs and Ligands
  • the TLR agonist may be a fragment, variant, analog, homology or derivative of a PAMP or DAMP that binds a TLR and induces TLR-mediated activity, such as activation of NF-KB activity.
  • the TLR agonsist fragment, variant, analog, homolog, or derivative may be at least 30- 99% identical to amino acids of a TLR-agonist and induce TLR-mediated activity.
  • the TLR agonist may target a TLR such as TLR-5.
  • the TLR agonist may be an agonist of TLR-5 and stimulate TLR-5 activity.
  • the TLR agonist may be an anti-TLR5 antibody or other small molecule.
  • the TLR agonist may be flagellin.
  • the flagellin may also be a flagellin or flagellin-related polypeptide.
  • the flagellin may be from any source, including a variety of Gram-positive and Gram-negative bacterial species.
  • the flagellin may be a flagellin polypeptide from any Gram-positive or Gram-negative bacterial species including, but not limited to, a flagellin polypeptide disclosed in U.S. Pat. Pub. No. 2003/000044429, the contents of which are fully incorporated herein by reference.
  • the flagellin may have an amino acid sequence from a bacterial species depicted in Figure 7 of U.S. Patent Publication No. 2003/0044429.
  • the nucleotide sequences encoding the flagellin polypeptides listed in Figure 7 of U.S. 2003/0044429 are publicly available at sources including the NCBI Genbank database.
  • the flagellin may also be a flagellin peptide corresponding to an Accession number listed in the BLAST results shown in Fig. 25 of U.S. Patent Pub.
  • the flagellin may also be a flagellin polypeptide as disclosed in U.S. Patent Appl. Publication No. 2009/0011982, the contents of which are fully incorporated herein.
  • the flagellin maybe anyone of a flagellin polypeptide as disclosed in Figures 6 and 7 herein.
  • the flagellin may be a fragment, variant, analog, homology or derivative of a flagellin that binds TLR5 and induces TLR5-mediated activity, such as activation of NF- ⁇ activity.
  • a fragment, variant, analog, homolog, or derivative of flagellin may be at least 30-99% identical to amino acids of a flagellin that binds TLR5 and induces TLR5-mediated activity.
  • the flagellin may be from a species of Salmonella, a representative example of which is S.dublin (encoded by GenBank Accession Number M84972).
  • the flagellin related-polypeptide may be a fragment, variant, analog, homolog, or derivative of M84972, or combination thereof, that binds to TLR5 and induces TLR5-mediated activity, such as activation of NF-kB activity.
  • a fragment, variant, analog, homolog, or derivative of flagellin may be obtained by rational-based design based on the domain structure of Flagellin and the conserved structure recognized by TLR5.
  • the flagellin may comprise at least 10, 11, 12, or 13 of the 13 conserved amino acids shown in Fig. 5 (positions 89, 90, 91, 95, 98, 101, 115, 422, 423, 426, 431, 436 and 452).
  • the flagellin may be at least 30-99% identical to amino acids 1 174 and 418 505 of M84972.
  • the flagellin may be the major component of bacterial flagellum.
  • the flagellin may be composed of three domains (Fig. 4). Domain 1 (Dl) and domain 2 (D2) may be discontinuous and may be formed when residues in the amino terminus and carboxy terminus are juxtaposed by the formation of a hairpin structure. The amino and carboxy terminus comprising the Dl and D2 domains may be most conserved, whereas the middle hypervariable domain (D3) may be highly variable.
  • Studies with a recombinant protein containing the amino Dl and D2 and carboxyl Dl and D2 separated by an Escherichia coli hinge (ND1-2/ECH/CD2) indicate that Dl and D2 may be bioactive when coupled to an ECH element.
  • This chimera may induce IkBa degradation, NF-kB activation, and NO and IL-8 production in two intestinal epithelial cell lines.
  • the non-conserved D3 domain may be on the surface of the flagellar filament and may contain the major antigenic epitopes.
  • the potent proinflammatory activity of flagellin may reside in the highly conserved N and C Dl and D2 regions (See Figure 4).
  • the flagellin may induce NF-kB activity by binding to Toll-like receptor 5 (TLR5).
  • TLR5 Toll-like receptor 5
  • the TLR may recognize a conserved structure that is particular to the flagellin.
  • the conserved structure may be composed of a large group of residues that are somewhat permissive to variation in amino acid content.
  • Smith et al., Nat Immunol. 4: 1247-53 (2003), the contents of which are incorporated herein by reference, have identified 13 conserved amino acids in flagellin that are part of the conserved structure recognized by TLR5.
  • the 13 conserved amino acids of flagellin that may be important for TLR5 activity are shown in Fig. 5.
  • flagellin Numerous deletional mutants of flagellin have been made that retain at least some TLR5 stimulating activity.
  • the flagellin may be such a deletional mutant, and may be a deletional mutant disclosed in the Examples herein.
  • the flagellin may comprise a sequence translated from GenBank Accession number D13689 missing amino acids 185-306 or 444-492, or from
  • the flagellin may comprise transposon insertions and changes to the variable D3 domain.
  • the D3 domain may be substituted in part, or in whole, with a hinge or linker polypeptide that allows the Dl and D2 domains to properly fold such that the variant stimulates TLR5 activity.
  • the variant hinge elements may be found in the E.coli MukB protein and may have a sequence as set forth in SEQ ID NOS: 3 and 4, or a variant thereof.
  • the flagellin as described above may further comprise a leader sequence.
  • the flagellin further comprising a leader sequence may be CBLB502S.
  • This invention also relates to an agent comprising a therapeutically effective amount of a TLR and TLR agonist.
  • the agent may deliver the TLR separately from the TLR agonist.
  • the agent may be a vector.
  • the vector may comprise a first nucleic acid encoding the TLR and a second nucleic acid comprising the TLR agonist.
  • the vector may be capable of transducing mammalian cells.
  • the vector may be capable of bi-cistronic expression of the TLR and/or TLR agonist using strong promoters.
  • the vector may comprise only a gene encoding the TLR, which may be controlled by a strong promoter.
  • the vector may be delivered into a mammalian cell by a virus or liposome related vector system.
  • the virus vector system may be an adenovirus or a cytomegalovirus .
  • the agent may be a liposome harboring the vector.
  • the liposome maybe capable of transducing mammalian cells and delivering the vector for expression.
  • the agent may be a drug formulation that simultaneously induces expression and activates the TLR, thereby exposing tumor or infected cells to the host immune system imitating the situation of a massive penetration through the intestinal wall.
  • the agent may be a drug formulation that expresses the TLR in combination with the TLR agonist, and may be delivered systematically in solution for administration such as intramuscularly.
  • the agent may be a drug formulation that expresses the TLR in combination with the TLR agonist, which may be expressed from the same vector, such as an adenoviral or cytomegalovirus vector system.
  • the agent may be a drug formulation that expresses the TLR in combination with the TLR agonist expressed in the form of a nano-particle, which may carry a functional agonist to the cell surface of a mammalian cell.
  • the agent may be a pharmaceutical agent comprising the drug formulation described above, which may be produced using methods well known in the art.
  • the agent may also comprise a coagent.
  • the vector may comprise a first nucleic acid encoding TLR5 and a second nucleic acid comprising flagellin.
  • the vector may be capable of expressing TLR5 and/or flagellin using a strong promoter.
  • the expression vector may further comprise a leader sequence cloned upstream of the gene encoding the TLR or TLR5 and/or flagellin.
  • the expression vector may be pCD515 based vector system.
  • the expression vector may be pCD515-CMV-hTLR5-EF 1-502 as described in Figure 1A.
  • the expression vector may be pCD515-CMV-hTLR5 as described in Figure IB.
  • the expression vector may be pCD515-CMV-Sseap-502 as described in Figure 1C.
  • the agent may be drug formulation that simultaneously induces expression and activates a TLR thereby exposing tumor or infected cells to the host immune system imitating the situation of a massive penetration through the intestinal wall.
  • the drug formulation may be in the form of a viral expression system harboring the vector.
  • the drug formulation may be an adenovirus expression functional human TLR5 in combination with:
  • the TLR agonist delivered systematically in solution for administration, such as intramuscularly;
  • the TLR agonist expressed from the same adenoviral vector as the TLR; or
  • the TLR agonist expressed in the form of nano-particles carrying functional TLR agonist, such as flagellin, which may be derived from CBLB502, on their surface.
  • the nano- particle may be on the basis of a bacteriophage T7, or fully formed to retain its biological activity.
  • the nano-formulation may provide for dose-dependent, NF-KB-responsive reporter activation, and may result in cell internalization by endocytosis for effective immunization approach (Mobian AP-A).
  • Administration of the agents using the method described herein may be orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, or combinations thereof.
  • Parenteral administration includes, but is not limited to, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intrathecal, and intraarticular.
  • the agent may be administered as a suitably acceptable formulation in accordance with normal veterinary practice. The veterinarian can readily determine the dosing regimen and route of administration that is most appropriate for a particular animal.
  • the agents may be administered to a human patient, cat, dog, large animal, or an avian.
  • the agent may be administered simultaneously or metronomically with other treatments.
  • the term "simultaneous” or “simultaneously” as used herein, means that the agent and other treatment be administered within 48 hours, preferably 24 hours, more preferably 12 hours, yet more preferably 6 hours, and most preferably 3 hours or less, of each other.
  • “metronomically” as used herein means the administration of the agent at times different from the other treatment and at a certain frequency relative to repeat administration.
  • the agent may be administered at any point prior to another treatment including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 hr,
  • the agent may be administered at any point prior to a second treatment of the agent including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 h
  • the agent may be administered at any point after another treatment including about lmin, 2 mins., 3 mins., 4 mins., 5 mins., 6 mins., 7 mins., 8 mins., 9 mins., 10 mins., 15 mins., 20 mins., 25 mins., 30 mins., 35 mins., 40 mins., 45 mins., 50 mins., 55 mins., 1 hr, 2 hr, 3 hr, 4 hr, 6 hr, 8 hr, 10 hr, 12 hr, 14 hr, 16 hr, 18 hr, 20 hr, 22 hr, 24 hr, 26 hr, 28 hr, 30 hr, 32 hr, 34 hr, 36 hr, 38 hr, 40 hr, 42 hr, 44 hr, 46 hr, 48 hr, 50 hr, 52 hr, 54 hr
  • the agent may be administered at any point prior after a second treatment of the agent including about 120 hr, 118 hr, 116 hr, 114 hr, 112 hr, 110 hr, 108 hr, 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr, 38 hr, 36 h
  • the method may comprise administering the agent.
  • Agents provided herein may be in the form of tablets or lozenges formulated in a conventional manner.
  • tablets and capsules for oral administration may contain conventional excipients may be binding agents, fillers, lubricants, disintegrants and wetting agents.
  • Binding agents include, but are not limited to, syrup, accacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone.
  • Fillers may be lactose, sugar, microcrystalline cellulose, maizestarch, calcium phosphate, and sorbitol.
  • Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica.
  • Disintegrants may be potato starch and sodium starch glycollate.
  • Wetting agents may be sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.
  • Agents provided herein may also be liquid formulations such as aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs.
  • the agents may also be formulated as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain additives such as suspending agents, emulsifying agents, nonaqueous vehicles and preservatives.
  • Suspending agent may be sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats.
  • Emulsifying agents may be lecithin, sorbitan monooleate, and acacia.
  • Nonaqueous vehicles may be edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol.
  • Preservatives may be methyl or propyl p-hydroxybenzoate and sorbic acid.
  • Agents provided herein may also be formulated as suppositories, which may contain suppository bases such as cocoa butter or glycerides. Agents provided herein may also be formulated for inhalation, which may be in a form such as a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifluoromethane or trichlorofluoromethane. Agents provided herein may also be formulated as transdermal formulations comprising aqueous or nonaqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.
  • aqueous or nonaqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.
  • Agents provided herein may also be formulated for parenteral administration such as by injection, intratumor injection or continuous infusion.
  • Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents.
  • the agent may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water.
  • Agents provided herein may also be formulated as a depot preparation, which may be administered by implantation or by intramuscular injection.
  • the agents may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (as a sparingly soluble salt, for example), c.
  • the method may comprise administering a therapeutically effective amount of the agent to a patient in need thereof.
  • the therapeutically effective amount required for use in therapy varies with the nature of the condition being treated, the length of time desired to activate TLR activity, and the age/condition of the patient.
  • doses employed for adult human treatment typically are in the range of 0.001 mg/kg to about 200 mg/kg per day.
  • the dose may be about 1 mg/kg to about 100 mg/kg per day.
  • the desired dose may be conveniently administered in a single dose, or as multiple doses administered at appropriate intervals, for example as two, three, four or more sub-doses per day. Multiple doses may be desired, or required.
  • the dosage may be at any dosage such as about 0.1 mg/kg, 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, 1 mg/kg, 25 mg/kg, 50 mg/kg, 75 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 225 mg/kg, 250 mg/kg, 275 mg/kg, 300 mg/kg, 325 mg/kg, 350 mg/kg, 375 mg/kg, 400 mg/kg, 425 mg/kg, 450 mg/kg, 475 mg/kg, 500 mg/kg, 525 mg/kg, 550 mg/kg, 575 mg/kg, 600 mg/kg, 625 mg/kg, 650 mg/kg, 675 mg/kg, 700 mg/kg, 725 mg/kg, 750 mg/kg, 775 mg/kg, 800 mg/kg, 825 mg/kg,
  • the method provide immunotherapy against cancer by conversion of tumor cells into a TLR agonist-responsive state with targeted intratumor stimulation of TLR, thereby focusing an immune response on the tumor.
  • the method may be be used to treat primary tumors prior to surgical removal in order to reduce the risk of metastasis development, as well as treat of other tumor nodules.
  • the method may comprise intratumor injection.
  • the method may have the step of injecting the agent into a primary tumor prior to surgical removal to reduce the risk of metastasis development, as well as treat other tumor nodules.
  • the method may be used to treat any tumor that is accessible for adenovirus intratumor injection.
  • a variety of cancers may be treated according to this invention, including carcinoma, bladder (including accelerated and metastatic bladder cancer), breast, colon (including colorectal cancer), kidney, liver, lung (including small and non-small cell lung cancer and lung adenocarcinoma), ovary, prostate, testes, genitourinary tract, lymphatic system, rectum, larynx, pancreas (including exocrine pancreatic carcinoma), esophagus, stomach, gall bladder, cervix, thyroid, and skin (including squamous cell carcinoma); hematopoietic tumors of lymphoid lineage including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkins lymphoma, non-Hodgkins lymphoma, hairy cell lymphoma, histiocytic lymphoma, and Burketts lymphoma; hematopoietic tumor
  • mesenchymal origin including fibrosarcoma, rhabdomyoscarcoma, and osteosarcoma
  • other tumors including melanoma, xenoderma pigmentosum, keratoactanthoma, seminoma, thyroid follicular cancer, teratocarcinoma, and cancers of the gastrointestinal tract or the abdominopelvic cavity.
  • the method may be combined with other methods for treating cancer, including use of an immuno stimulant, cytokine, or chemo therapeutic.
  • the immunostimulant may be a growth hormone, prolactin or vitamin D.
  • the method may be used to treat a viral, bacterial, protozoan parasite or fungal infection.
  • the method may be used to treat any infectious disease by using intracellular injection resulting in autocrine activation of TLR signaling of infected cells with minimal systemic effect and thereby enabling to attract innate immune response specific to the infected cells.
  • the method may be combined with other therapies for treating viral, bacterial, protozoan parasite or fungi infections.
  • the method may comprise administering the agent.
  • the method may comprise administration of a vaccine comprising the agent, and may be used in combination with any other vaccination, which may comprise a construct expressing an antigen of choice.
  • Example 1
  • Vector constructs were created for expressing Toll-like receptor 5 (TLR-5) and flagellin CBLB502.
  • Vector pCD515 was used as a backbone for these constructs.
  • the cDNA sequence of human TLR-5 and the DNA encoding the toll-like receptor agonist's CBLB502 were individually fused with leader peptide derived from alkaline phosphatase enabling routing of the expressed protein through the endoplasmic reticulum (ER) and Golgi towards extracellular secretion.
  • the pCD515-CMV-hTLR5-EFl-502s vector construct expressed the secreted form of CBLB502 flagellin (CBLB502S) and the toll-like receptor 5 (TLR5) at the cell surfcace.
  • CBLB502S CBLB502 flagellin
  • TLR5 toll-like receptor 5
  • the adenovirus construct comprises the leader nucleic acid sequence (Atgctgctgctgctgctgctgctgctgggcctgaggctacagctctccctgggc) derived from alkaline phosphatase and was cloned upstream of the truncated Salmonella flagellin (fliC) gene (see Burdelya et al., Science 320:226-230 (2008) to encode a secretable form of flagellin (i.e., CBLB502S). An EF1 (elongation factor la) promoter was cloned upstream of this cassette encoding CBLB502S.
  • fliC truncated Salmonella flagellin
  • the TLR5 gene was derived from human and has the amino acid sequence as shown in Figure 9.
  • a CMV promoter was cloned upstream of the TLR5 gene. This construct co-expresses TLR5 and CBLB502S. This construct is shown in Figure 1A.
  • the pCD515-CMV-hTLR5 expression vector was constructed to express the form of human TLR-5 (see Figure 9).
  • the adenovirus construct comprises a strong CMV promoter cloned upstream of the hTLR5 cassette. This construct is shown in Figure IB.
  • the pCD515-CMV-Sseap-502 expression vector was constructed to express the secreted flagellin CBLB502 and the toll-like .
  • the adenovirus construct comprises a strong CMV promoter cloned upstream of the leader sequence SEAP 502 flagellin (fliC) gene. This construct is shown in Figure 1C. [Need cloning information] Example 2
  • Two reporter mammalian cell lines both expressing NF-kB-responsive GFP and differing in their TLR5 status, were transduced with vector constructs pCD515, pCD515-CMV- hTLR5-EFl-502s, pCD515-CMV-hTLR5-502, pCD515-CMV-hTLR5, and pCD515-CMV- Sseap-502 (see Table 3 below).
  • TLR5 and TLR5 agonist CBLB502S were sufficient to induce expression of NF-kB reporter in 293-null cells that do not express any of known TLRs and which cannot be activated by TLR5 agonist alone. This experiment demonstrates that TLR5 and flagellin CBLB502S can work in trans or in cis to activate TLR5 signaling.
  • TLR5 tumor cell types, which originally were TLR5 deficient, highly responsive to TLR5 stimulation resulting in breaking tumor immuno-tolerance, powerful attraction of innate immune response that promotes effective development of adaptive immune response with subsequent general antitumor effect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicinal Preparation (AREA)
PCT/US2010/051646 2009-10-06 2010-10-06 Use of toll-like receptor and agonist for treating cancer Ceased WO2011044246A1 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
UAA201204208A UA110605C2 (uk) 2009-10-06 2010-06-10 Застосування toll-подібного рецептора і агоніста toll-подібного рецептора для лікування раку
BR112012011331A BR112012011331B8 (pt) 2009-10-06 2010-10-06 vetor compreendendo ácidos nucleicos que codificam um receptor tipo toll e um agonista do mesmo
AU2010303464A AU2010303464B2 (en) 2009-10-06 2010-10-06 Use of toll-like receptor and agonist for treating cancer
ES10822611.9T ES2457518T3 (es) 2009-10-06 2010-10-06 Uso de receptores semejantes a Toll y agonista para tratar cáncer
CA2777198A CA2777198C (en) 2009-10-06 2010-10-06 Use of toll-like receptor and agonist for treating cancer
HK14112425.4A HK1199058B (en) 2009-10-06 2010-10-06 Use of toll-like receptor and agonist for treating cancer
MX2012004095A MX2012004095A (es) 2009-10-06 2010-10-06 Uso del receptor tipo toll y agonista para tratar el cancer.
EA201290140A EA021842B1 (ru) 2009-10-06 2010-10-06 Применение toll-подобного рецептора и агониста для лечения рака
AP2012006253A AP2012006253A0 (en) 2009-10-06 2010-10-06 Use of toll-like receptors and agonist for treating cancer.
CN201080055226.1A CN104136614B (zh) 2009-10-06 2010-10-06 Toll‑样受体和激动剂用于治疗癌症的用途
US13/500,552 US9205095B2 (en) 2009-10-06 2010-10-06 Viral vector encoding a toll-like receptor and encoding a toll-like receptor agonist
EP10822611.9A EP2486134B1 (en) 2009-10-06 2010-10-06 Use of toll-like receptor and agonist for treating cancer
JP2012533282A JP5796014B2 (ja) 2009-10-06 2010-10-06 がんを処置するためのトール様受容体およびトール様受容体アゴニストの使用
IL219060A IL219060A (en) 2009-10-06 2012-04-04 Like-toll receptors and agonist for cancer treatment
ZA2012/02500A ZA201202500B (en) 2009-10-06 2012-04-05 Use of toll-like receptor and agonist for treating cancer

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US24925309P 2009-10-06 2009-10-06
US61/249,253 2009-10-06
US24959609P 2009-10-07 2009-10-07
US61/249,596 2009-10-07

Publications (1)

Publication Number Publication Date
WO2011044246A1 true WO2011044246A1 (en) 2011-04-14

Family

ID=43857117

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/051646 Ceased WO2011044246A1 (en) 2009-10-06 2010-10-06 Use of toll-like receptor and agonist for treating cancer

Country Status (16)

Country Link
US (1) US9205095B2 (https=)
EP (1) EP2486134B1 (https=)
JP (2) JP5796014B2 (https=)
KR (1) KR20120104177A (https=)
CN (1) CN104136614B (https=)
AP (1) AP2012006253A0 (https=)
AU (1) AU2010303464B2 (https=)
BR (1) BR112012011331B8 (https=)
CA (1) CA2777198C (https=)
EA (1) EA021842B1 (https=)
ES (1) ES2457518T3 (https=)
IL (1) IL219060A (https=)
MX (1) MX2012004095A (https=)
MY (1) MY163110A (https=)
WO (1) WO2011044246A1 (https=)
ZA (1) ZA201202500B (https=)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8871215B2 (en) 2004-12-22 2014-10-28 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US9006180B2 (en) 2008-08-01 2015-04-14 Cleveland Biolabs, Inc. Methods for treating tourniquet-induced injuries
WO2015080631A1 (en) * 2013-11-27 2015-06-04 Obschestvo S Ogranichennoy Otvetstvennost`Yu "Panacela Labs" Improved expression vector for toll-like receptor and agonist and use for treating cancer
US9376473B2 (en) 2011-01-10 2016-06-28 Cleveland Biolabs, Inc. Use of Toll-Like Receptor agonist for treating cancer
CN107073092A (zh) * 2014-07-30 2017-08-18 克利夫兰生物实验室公司 基于鞭毛蛋白的剂及包括有效接种的用途
EP3281641A4 (en) * 2015-04-07 2018-12-19 Cytlimic Inc. Medicine
US10183056B2 (en) 2014-10-16 2019-01-22 Cleveland Biolabs, Inc. Methods and compositions for the treatment of radiation-related disorders
US10526388B2 (en) 2015-03-09 2020-01-07 Cytlimic Inc. Peptide derived from GPC3, pharmaceutical composition for treatment or prevention of cancer using the same, immunity inducer, and method for producing antigen-presenting cells
US10537626B2 (en) 2014-10-07 2020-01-21 Cytlimic Inc. HSP70-derived peptide, pharmaceutical composition for treating or preventing cancer using same, immunity inducer, and method for producing antigen presenting cell
WO2020041720A1 (en) 2018-08-24 2020-02-27 Codiak Biosciences, Inc. Extracellular vesicles targeting dendritic cells and uses thereof
WO2020163370A1 (en) 2019-02-04 2020-08-13 Codiak Biosciences, Inc. Membrane protein scaffolds for exosome engineering
WO2020191361A2 (en) 2019-03-21 2020-09-24 Codiak Biosciences, Inc. Extracellular vesicles for vaccine delivery
WO2020191377A1 (en) 2019-03-21 2020-09-24 Codiak Biosciences, Inc. Extracellular vesicle conjugates and uses thereof
WO2020191369A1 (en) 2019-03-21 2020-09-24 Codiak Biosciences, Inc. Process for preparing extracellular vesicles
WO2021003445A1 (en) 2019-07-03 2021-01-07 Codiak Biosciences, Inc. Extracellular vesicles targeting t cells and uses thereof
WO2021062317A1 (en) 2019-09-25 2021-04-01 Codiak Biosciences, Inc. Extracellular vesicle compositions
WO2021184017A1 (en) 2020-03-13 2021-09-16 Codiak Biosciences, Inc. Extracellular vesicles for treating neurological disorders
WO2021189047A2 (en) 2020-03-20 2021-09-23 Codiak Biosciences, Inc. Extracellular vesicles for therapy
WO2021237100A1 (en) 2020-05-21 2021-11-25 Codiak Biosciences, Inc. Methods of targeting extracellular vesicles to lung
WO2021248133A1 (en) 2020-06-05 2021-12-09 Codiak Biosciences, Inc. Anti-transferrin extracellular vesicles
WO2022066898A2 (en) 2020-09-23 2022-03-31 Codiak Biosciences, Inc. Methods of producing extracellular vesicles
WO2022066928A2 (en) 2020-09-23 2022-03-31 Codiak Biosciences, Inc. Process for preparing extracellular vesicles
WO2022066883A1 (en) 2020-09-23 2022-03-31 Codiak Biosciences, Inc. Extracellular vesicles comprising kras antigens and uses thereof
US11291718B2 (en) 2016-10-11 2022-04-05 Cytlimic Inc. Method for treating cancer by administering a toll-like receptor agonist and LAG-3 IgG fusion protein
US11857614B2 (en) 2018-03-19 2024-01-02 Cj Bioscience, Inc. Enterococcus gallinarum flagellin polypeptides
EP4620482A1 (en) * 2024-03-18 2025-09-24 Istituto Europeo di Oncologia S.r.l. Flagellin-related peptides and uses thereof
WO2025196053A1 (en) * 2024-03-18 2025-09-25 Istituto Europeo Di Oncologia S.R.L. Flagellin-related peptides and uses thereof
US12440536B2 (en) 2018-05-18 2025-10-14 The University Of Hong Kong Compositions of toll-like receptor 5 (TLR5) agonist and methods of use thereof

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014098649A1 (en) * 2012-12-18 2014-06-26 Obschestvo S Ogranichennoy Otvetstvennostyu "Panacela Labs" Compositions and methods using toll-like receptor 5 and toll-like receptor agonist
KR101634380B1 (ko) 2015-06-23 2016-06-28 한국생산기술연구원 Tlr5 아고니스트 단백질의 생산방법
CN105801709B (zh) * 2016-04-29 2019-10-08 北京纽莱福生物科技有限公司 CBLB502-Fc融合蛋白及其制备方法
WO2018088933A1 (en) * 2016-11-14 2018-05-17 Limited Liability Company "Panacela Labs" Anti-tumor effects of a viral vector encoding a toll-like receptor and a toll-like receptor agonist
CN113608416B (zh) * 2016-12-28 2024-07-30 Asml荷兰有限公司 量测图像与设计之间的模拟辅助的对准
WO2018210279A1 (zh) * 2017-05-16 2018-11-22 科济生物医药(上海)有限公司 Toll样受体激动剂与免疫效应细胞的联用
WO2019018768A1 (en) 2017-07-20 2019-01-24 Spogen Biotech Inc. BIOACTIVE POLYPEPTIDES FOR PLANT PROTECTION, GROWTH AND PRODUCTIVITY ENHANCEMENTS
WO2021246666A1 (ko) * 2020-06-04 2021-12-09 가톨릭대학교 산학협력단 플라젤린으로부터 유도된 tlr5 작용제를 유효성분으로 포함하는 항암제 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050147627A1 (en) * 2001-04-20 2005-07-07 The Institute For Systems Biology Toll-like receptor 5 ligands and methods of use
US20080063657A1 (en) * 2005-01-19 2008-03-13 Powell Thomas J Compositions comprising pathogen-associated molecular patterns and antigens and methods of use thereof
US20090011982A1 (en) * 2004-12-22 2009-01-08 Gudkov Andrei V Flagellin Related Polypeptides and Uses Thereof
US20090246303A1 (en) * 2003-12-02 2009-10-01 Gudkov Andrei V Method for Reducing The Effects of Chemotherapy Using Flagellin Related Polypeptides

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050147627A1 (en) * 2001-04-20 2005-07-07 The Institute For Systems Biology Toll-like receptor 5 ligands and methods of use
US20090246303A1 (en) * 2003-12-02 2009-10-01 Gudkov Andrei V Method for Reducing The Effects of Chemotherapy Using Flagellin Related Polypeptides
US20090011982A1 (en) * 2004-12-22 2009-01-08 Gudkov Andrei V Flagellin Related Polypeptides and Uses Thereof
US20080063657A1 (en) * 2005-01-19 2008-03-13 Powell Thomas J Compositions comprising pathogen-associated molecular patterns and antigens and methods of use thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
APPLEQUIST ET AL.: "Activation of Innate Immunity, Inflammation and Potentiation of DNA Vaccination through Mammalian Expression of the TLR5 Agonist Flagellin.", J IMMUNOL, vol. 175, no. 6, 15 September 2005 (2005-09-15), pages 3882 - 3891, XP002397612 *
DATABASE GENBANK [online] 4 October 2006 (2006-10-04), STRAUSBERG ET AL., retrieved from http://www.ncbi.nlm.nih.gov/protein/AA109119.1 Database accession no. AA10119 *
GEWIRTZ ET AL.: "Cutting Edge: Bacterial Flagellin Activates Basolaterally Expressed TLR5 to Induce Epithelial Proinflammatory Gene Expression.", THE JOURNAL OF IMMUNOLOGY, vol. 167, no. 4, 15 August 2001 (2001-08-15), pages 1882 - 1885, XP002500275 *
HAWN ET AL.: "A Common Dominant TLR5 Stop Codon Polymorphism Abolishes Flagellin Signaling and Is Associated with Susceptibility to Legionnaires' Disease.", J. EXP. MED., vol. 198, no. 10, 17 November 2003 (2003-11-17), pages 1563 - 1572 *
MURTHY ET AL.: "Identification of Conserved Domains in Salmonella muenchen Flagellin That Are Essential for Its Ability to Activate TLR5 and to Induce an Inflammatory Response in Vitro", J. BIOL. CHEM., vol. 279, no. 7, 13 February 2004 (2004-02-13), pages 5667 - 5675, XP008117350, DOI: doi:10.1074/jbc.M307759200 *
See also references of EP2486134A4 *

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10086038B2 (en) 2004-12-22 2018-10-02 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US8932609B2 (en) 2004-12-22 2015-01-13 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US10898543B2 (en) 2004-12-22 2021-01-26 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US9139623B2 (en) 2004-12-22 2015-09-22 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US9228000B1 (en) 2004-12-22 2016-01-05 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US8871215B2 (en) 2004-12-22 2014-10-28 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US9457061B2 (en) 2004-12-22 2016-10-04 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US10543251B2 (en) 2004-12-22 2020-01-28 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US9827289B2 (en) 2004-12-22 2017-11-28 Cleveland Clinic Foundation Flagellin related polypeptides and uses thereof
US9006180B2 (en) 2008-08-01 2015-04-14 Cleveland Biolabs, Inc. Methods for treating tourniquet-induced injuries
US10034926B2 (en) 2011-01-10 2018-07-31 Cleveland Biolabs, Inc. Use of toll-like receptor agonist for treating cancer
US11628201B2 (en) 2011-01-10 2023-04-18 Cleveland Biolabs, Inc. Use of toll-like receptor agonist for treating cancer
US9376473B2 (en) 2011-01-10 2016-06-28 Cleveland Biolabs, Inc. Use of Toll-Like Receptor agonist for treating cancer
US10780152B2 (en) 2011-01-10 2020-09-22 Cleveland Biolabs, Inc. Use of toll-like receptor agonist for treating cancer
US10265390B2 (en) 2011-01-10 2019-04-23 Cleveland Biolabs, Inc. Use of toll-like receptor agonist for treating cancer
WO2015080631A1 (en) * 2013-11-27 2015-06-04 Obschestvo S Ogranichennoy Otvetstvennost`Yu "Panacela Labs" Improved expression vector for toll-like receptor and agonist and use for treating cancer
RU2682762C2 (ru) * 2013-11-27 2019-03-21 Общество С Ограниченной Ответственностью "Панацела Лабс" Улучшенный вектор, экспрессирующий toll-подобный рецептор и агонист, и применение в терапии рака
US10669316B2 (en) 2014-07-30 2020-06-02 Genome Protection, Inc. Flagellin compositions and uses
US11542306B2 (en) 2014-07-30 2023-01-03 Genome Protection, Inc. Flagellin-based agents and uses including effective vaccination
CN107073092A (zh) * 2014-07-30 2017-08-18 克利夫兰生物实验室公司 基于鞭毛蛋白的剂及包括有效接种的用途
US11034733B2 (en) 2014-07-30 2021-06-15 Genome Protection, Inc. Flagellin compositions and uses
US10336793B2 (en) 2014-07-30 2019-07-02 Genome Protection, Inc. Flagellin-based agents and uses including effective vaccination
US10730915B2 (en) 2014-07-30 2020-08-04 Genome Protection, Inc. Flagellin-based agents and uses including effective vaccination
US10975127B2 (en) 2014-07-30 2021-04-13 Genome Protection, Inc. Flagellin-based agents and uses including effective vaccination
US10202426B2 (en) 2014-07-30 2019-02-12 Genome Protection, Inc. Flagellin compositions and uses
US10537626B2 (en) 2014-10-07 2020-01-21 Cytlimic Inc. HSP70-derived peptide, pharmaceutical composition for treating or preventing cancer using same, immunity inducer, and method for producing antigen presenting cell
US11304997B2 (en) 2014-10-07 2022-04-19 Cytlimic Inc. HSP70-derived peptide, pharmaceutical composition for treating or preventing cancer using same, immunity inducer, and method for producing antigen-presenting cell
US12448413B2 (en) 2014-10-07 2025-10-21 Nec Corporation HSP70-derived peptide, pharmaceutical composition for treating or preventing cancer using same, immunity inducer, and method for producing antigen presenting cell
US10183056B2 (en) 2014-10-16 2019-01-22 Cleveland Biolabs, Inc. Methods and compositions for the treatment of radiation-related disorders
US10526388B2 (en) 2015-03-09 2020-01-07 Cytlimic Inc. Peptide derived from GPC3, pharmaceutical composition for treatment or prevention of cancer using the same, immunity inducer, and method for producing antigen-presenting cells
US10875900B2 (en) 2015-03-09 2020-12-29 Cytlimic Inc. Peptide derived from GPC3, pharmaceutical composition for treatment or prevention of cancer using same, immunity inducer, and method for producing antigen-presenting cells
US10590179B2 (en) 2015-03-09 2020-03-17 Cytlimic Inc. Peptide derived from GPC3, pharmaceutical composition for treatment or prevention of cancer using same, immunity inducer, and method for producing antigen-presenting cells
US10842848B2 (en) 2015-04-07 2020-11-24 Cytlimic Inc. Method for treating cancer by adminstering poly I:C and LAG-3-IgG fusion protein
EP3281641A4 (en) * 2015-04-07 2018-12-19 Cytlimic Inc. Medicine
EP3797794A1 (en) * 2015-04-07 2021-03-31 Cytlimic Inc. Medicine comprising a toll like receptor 3 agonist and a lag-3 protein
US11491204B2 (en) 2015-04-07 2022-11-08 Cytlimic Inc. Composition comprising poly I:C and LAG-3-IGG fusion protein
US11291718B2 (en) 2016-10-11 2022-04-05 Cytlimic Inc. Method for treating cancer by administering a toll-like receptor agonist and LAG-3 IgG fusion protein
US11759518B2 (en) 2016-10-11 2023-09-19 Nec Corporation Medicine for treating cancer by administering a toll-like receptor agonist and LAG-3 IgG fusion protein
US11857614B2 (en) 2018-03-19 2024-01-02 Cj Bioscience, Inc. Enterococcus gallinarum flagellin polypeptides
US12440536B2 (en) 2018-05-18 2025-10-14 The University Of Hong Kong Compositions of toll-like receptor 5 (TLR5) agonist and methods of use thereof
WO2020041720A1 (en) 2018-08-24 2020-02-27 Codiak Biosciences, Inc. Extracellular vesicles targeting dendritic cells and uses thereof
WO2020163370A1 (en) 2019-02-04 2020-08-13 Codiak Biosciences, Inc. Membrane protein scaffolds for exosome engineering
WO2020191377A1 (en) 2019-03-21 2020-09-24 Codiak Biosciences, Inc. Extracellular vesicle conjugates and uses thereof
WO2020191369A1 (en) 2019-03-21 2020-09-24 Codiak Biosciences, Inc. Process for preparing extracellular vesicles
EP4671268A2 (en) 2019-03-21 2025-12-31 Lonza Sales AG METHOD FOR PREPARING EXTRACELLULAR VESICLES
US12502427B2 (en) 2019-03-21 2025-12-23 Lonza Sales Ag Extracellular vesicles for vaccine delivery
WO2020191361A2 (en) 2019-03-21 2020-09-24 Codiak Biosciences, Inc. Extracellular vesicles for vaccine delivery
WO2021003445A1 (en) 2019-07-03 2021-01-07 Codiak Biosciences, Inc. Extracellular vesicles targeting t cells and uses thereof
WO2021062317A1 (en) 2019-09-25 2021-04-01 Codiak Biosciences, Inc. Extracellular vesicle compositions
WO2021184017A1 (en) 2020-03-13 2021-09-16 Codiak Biosciences, Inc. Extracellular vesicles for treating neurological disorders
WO2021189047A2 (en) 2020-03-20 2021-09-23 Codiak Biosciences, Inc. Extracellular vesicles for therapy
WO2021237100A1 (en) 2020-05-21 2021-11-25 Codiak Biosciences, Inc. Methods of targeting extracellular vesicles to lung
WO2021248133A1 (en) 2020-06-05 2021-12-09 Codiak Biosciences, Inc. Anti-transferrin extracellular vesicles
WO2022066928A2 (en) 2020-09-23 2022-03-31 Codiak Biosciences, Inc. Process for preparing extracellular vesicles
WO2022066898A2 (en) 2020-09-23 2022-03-31 Codiak Biosciences, Inc. Methods of producing extracellular vesicles
WO2022066883A1 (en) 2020-09-23 2022-03-31 Codiak Biosciences, Inc. Extracellular vesicles comprising kras antigens and uses thereof
WO2025196053A1 (en) * 2024-03-18 2025-09-25 Istituto Europeo Di Oncologia S.R.L. Flagellin-related peptides and uses thereof
EP4620482A1 (en) * 2024-03-18 2025-09-24 Istituto Europeo di Oncologia S.r.l. Flagellin-related peptides and uses thereof

Also Published As

Publication number Publication date
JP5796014B2 (ja) 2015-10-21
EP2486134A1 (en) 2012-08-15
CA2777198A1 (en) 2011-04-14
JP2015165821A (ja) 2015-09-24
CA2777198C (en) 2018-07-24
HK1199058A1 (en) 2015-06-19
BR112012011331A2 (pt) 2015-09-15
AU2010303464A1 (en) 2012-04-12
ZA201202500B (en) 2013-06-26
ES2457518T3 (es) 2014-04-28
MY163110A (en) 2017-08-15
CN104136614A (zh) 2014-11-05
JP2013506437A (ja) 2013-02-28
EP2486134B1 (en) 2014-01-08
IL219060A (en) 2017-02-28
US9205095B2 (en) 2015-12-08
BR112012011331B8 (pt) 2021-05-25
BR112012011331B1 (pt) 2021-03-02
CN104136614B (zh) 2018-04-06
IL219060A0 (en) 2012-06-28
EA201290140A1 (ru) 2012-11-30
US20120208871A1 (en) 2012-08-16
EA021842B1 (ru) 2015-09-30
AP2012006253A0 (en) 2012-06-30
MX2012004095A (es) 2012-09-12
KR20120104177A (ko) 2012-09-20
EP2486134A4 (en) 2013-02-13
AU2010303464B2 (en) 2014-05-01

Similar Documents

Publication Publication Date Title
EP2486134B1 (en) Use of toll-like receptor and agonist for treating cancer
US11628201B2 (en) Use of toll-like receptor agonist for treating cancer
US8609625B2 (en) Method for enhancing immune response in the treatment of infectious and malignant diseases
TWI774651B (zh) 包含融合有免疫球蛋白Fc之介白素-7的用於預防或治療人類乳頭狀瘤病毒相關疾病的藥學組成物
RU2682762C2 (ru) Улучшенный вектор, экспрессирующий toll-подобный рецептор и агонист, и применение в терапии рака
WO2022216949A1 (en) Fusion protein for antigen presentation
CN100529065C (zh) 一种包含bpi基因的重组病毒及含有其的药物组合物及其用途
CN116196402A (zh) 表达双特异性抗体的溶瘤腺病毒联合cart在肿瘤治疗中的应用
HK1199058B (en) Use of toll-like receptor and agonist for treating cancer
RU2858296C2 (ru) Полипептиды, содержащие мутантные формы человеческого vegf-а с реаранжировками дисульфидных связей, и композиции, содержащие их
HK1262641A1 (en) Pharmaceutical composition comprising immunoglobulin fc-fused interleukin-7 fusion protein for preventing or treating human papillomavirus-caused diseases
MXPA02003986A (en) Chimeric immunogenic compositions and nucleic acids encoding them

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10822611

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010303464

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2777198

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 20127008759

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 219060

Country of ref document: IL

Ref document number: 3123/CHENP/2012

Country of ref document: IN

Ref document number: 2012533282

Country of ref document: JP

Ref document number: MX/A/2012/004095

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 13500552

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 201290140

Country of ref document: EA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2010303464

Country of ref document: AU

Date of ref document: 20101006

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010822611

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: A201204208

Country of ref document: UA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012011331

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012011331

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120409