WO2015080631A1 - Improved expression vector for toll-like receptor and agonist and use for treating cancer - Google Patents

Abstract

The present invention is directed to methods and agents used for treating cancer or infectious diseases by providing toll-like receptors such as toll-like receptor 5 (TLR-5) in combination with providing a toll-like receptor agonists such as flagellin to specifically kill cancer cells and cells infected with a pathogen via the NF-В apoptosis pathway. The present invention also relates to unglycosylated forms of flagellin. adenoviral vectors exhibiting improved efficacies by virtue of use of the UbiC promoter to drive flagellin expression, and uses thereof for treating cancers with high Coxsackie Virus and Adenovirus Receptor levels.

Description

IMPROVED EXPRESSION VECTOR FOR TOLL-LIKE RECEPTOR AND

AGONIST AND USE FOR TREATING CANCER

FIELD OF THE INVENTION

[0001] This invention relates to methods of treating cancer. BACKGROUND OF THE INVENTION

[0002] Toll-like receptors are responsible for the recognition of most common patterns of bacterial and viral pathogens. Their activation results in recruitment of innate and subsequently adaptive immune response. Receptor cells of the immune system to the site of presence of antigens is the key step in effective immune response. That is why immunization involves the use of different types of adjuvants. Although the majority of tumors express tumor-specific antigens, they arc using a number of mechanisms allowing then to escape immune recognition. It was recently demonstrated in mouse models that activation of TLR5 by its ligand and agonist, bacterial flagellin. results in the induction of antitumor effect against those tumors that express functional TLR5. This opens a general opportunity for considering TLR5 agonists for cancer immunotherapy. There are two major obstacles on the way to reduction of this idea to practice. First, is the rare incidence of tumors expressing functional TLR5 limiting applicability of this approach to only a small subset of tumors. Second, systemic administration of TLR5 agonist leads to activation of TLR5 signaling in all cells that have functional receptor making response unfocused and not tumor-specific. Accordingly, there is a need in the art for a mechanism or method for autocrine activation of TLR receptor signaling in infected or tumor cells with minimal systemic effect thus enabling to attract innate immune response specifically to the infected cell or tumor. There is also a need in the art to provide improved ways of delivering TLR5 and its ligand to cancer cells.

SUMMARY OF THE INVENTION

[0003] Provided herein is a vector comprising first and second nucleic acid. The first nucleic acid may encode a toll-like receptor and the second nucleic acid may encode a toll- like receptor agonist. The first nucleic acid may also encode a secreted form a tol l-like receptor. The toll-like receptor may be TLR-5. The sequence of the TLR-5 may comprise the sequence of SEQ ID NO: 99.

[0004] The toll-like receptor agonist may be flagel lin. The flagell in may be a secreted form of flagellin. The sequence of the flagel l in may comprise the sequence of SEQ ID NO: 101 . The flagellin may also lack glycosylation. and may comprise the sequence of SEQ ID NO: 1 02.

[0005] The vector may be an expression vector, which may be a mammal ian expression vector. The vector may be expressed from an adenovirus, a lentivirus, or a l iposome. The vector may comprise a Ubiquitin C promoter, which may be operably linked to the second nucleic acid.

[0006] Further provided herein is a method of treating cancer in a mammal, which may comprise administering to a mammal in need thereof an agent comprising the vector. The cancer may express a high level of Coxsackie Virus and Adenovirus Receptor protein. The cancer may be bladder, prostate cancer, small intestine, thyroid, testicular, or colon. The cancer may be a tumor. The agent may be adm inistered in trans from the tumor. The agent may be administered directly in to the tumor. The agent may also be adm inistered in combination with an immimostimulanl. which may be growth hormone, prolactin, or vitamin D. The growth may be somatotroph in. The agent may be administered in combination with a cytokine, which may be a stem cel l factor.

BRIEF DESCRIPTION OF THE DRAWINGS

|0007] Figure I A- I C depicts schematic maps of adenoviral vectors expressing TLR5, CBLB502S and their combination (TLR5 + CBLB502S). The Sseap-502 leading sequence in Figure 1 C has SEQ ID NO: 100.

[0008] Figure 2 depicts the resu lts of the ratio of tumor vol ume in m ice over a number of days in tumor cel ls (A549) transduced with a control vector (without TLR5) or vector expressing TLR5 wherein the m ice are treated three days with either CB LB502 or PBS.

[0009] Figure 3 depicts suppression of tumor growth by injection of adenovirus comprising vector coexpressing CBLB502S and Tol l-l ike receptor wherein the adenovirus is injected into syngeneic mice CT26 colon carcinoma tumor and studying the in-cis and in-trans effects of the adenoviral vector constructs.

[0010] Figure 4 shows the domain structure of bacterial flagellin. The Ca backbone trace, hydrophobic core distribution and structural information of F41. Four distinct hydrophobic cores that define domains Dl, D2a. D2b and D3. All the hydrophobic side-chain atoms are displayed with the Ca backbone. Side-chain atoms are color coded: Ala, yellow; Leu, lie or Val, orange; Phe and Tyr, purple (carbon atoms) and red (oxygen atoms), c, Position and region of various structural features in the amino-acid sequence of flagellin. Shown are, from top to bottom: the F4I fragment in blue; three b-folium folds in brown; the secondary structure distribution with a-helix in yellow, b-structure in green, and b-turn in purple; tic mark at every 50th residue in blue; domains DO. Dl, D2 and D3; the axial subunit contact region within the proto-element in cyan; the well-conserved amino-acid sequence in red and variable region in violet; point mutations in F41 that produce the elements of different supercoils. Letters at the bottom indicate the morphology of mutant elements: L (DI07E, R124A, R124S, G426A), L-type straight; R (A449V), R-type straight; C (D3I3Y, A414V, A427V, N433D), curly33.

[0011] Figure 5 shows a schematic of Salmonella flagellin domains, its fragments, and its interaction with TLR5. Dark bars denote regions of the flagellin gene used to construct fragments comprising A, B, C. A' and B\

[0012] Figure 6 depicts flagellin derivatives. The domain structure and approximate boundaries (amino acid coordinates) of selected flagellin derivatives (listed on the right). FliC flagellin of Salmonella dublin is encoded within 505 amino acids (aa).

[0013] Figure 7 shows the nucleotide and amino acid sequence for the following flagellin variants: AA' (SEQ ID NO: 7-8), AFT (SEQ ID NO: 9-10), BA- (SEQ ID NO: 11-12), BB' (SEQ ID NO: 13-14), CA' (SEQ ID NO: 15-16), CB' (SEQ ID NO: 17-18), A (SEQ ID NO: 19-20), B (SEQ ID NO: 21-22), C (SEQ ID NO: 23-24), GST-A' (SEQ ID NO: 25-26), GST- B' (SEQ ID NO: 27-28), AA^"nl-170 (SEQ ID NO: 29-30). AA'nl-163 (SEQ ID NO: 33-34), AA'n54-170 (SEQ ID NO: 31-32). AA'n54-163 (SEQ ID NO: 335-36), AB'nl-170 (SEQ ID NO: 37-38), AB'nl-163 (SEQ ID NO: 39-40), AA'nl-129 (SEQ ID NO: 41-42), AA'n54-129 (SEQ ID NO: 43-44), AB'nl-129 (SEQ ID NO: 45-46), AB n54-129 (SEQ ID NO: 47-48), AA'nl-100 (SEQ ID NO: 49-50). AB^'nl-100 (SEQ ID NO: 51-52), AA'nl-70 (SEQ ID NO: 53-54) and AB 'n l -70 (SEQ ID NO: 55-56). The pRSETb leader sequence is shown in Italic (leader includes Met, which is also amino acid 1 of Fl iC). The N terminal constant domain is underlined. The amino acid l inker sequence is in Bold. The C terminal constant domain is underlined. GST, if present, is h ighl ighted.

[0014] Figures 8A and 8B show a comparison of amino acid sequences of the conserved amino (Fig. 8A) and carboxy (Fig. 8B) terminus from 21 species of bacteria. The 1 3 conserved amino acids important for TLR5 activity are shown with shading. The amino acid sequences are identified by their accession numbers from TrEMBL (first letter = Q) or Svviss- Prot (first letter = P). The amino terminus sequences have SEQ I D NOs: 57-77, respectively, for each of the 21 bacterial species, and the carboxy terminus sequences have SEQ ID NOs: 78-98. respectively.

[0015] Figure 9 shows the amino acid sequence for the human Toll-like receptor 5 protein (SEQ ID NO: 99).

[0016] Figure 10 shows the amino acid sequence of a flagel l in variant called CBLB502s (SEQ ID NO: 1 01 ) with four glycosylation sites having an asparagine (N) at positions equivalent to positions 19, 1 01. 128. and 475 in SEQ I D NO: I .

[0017] Figure 1 1 shows the infection efficiency of an adenovirus comprising vector coexpressing CBLB502S and Tol l-l ike receptor in cancer cells. Figure 1 1 A shows the efficiency of Ad-mCherry infection ( fluorescence in second and fourth rows) determined in mouse prostate tumor cel l l ine (TRAM P-C2) 24h and 48h after infection. Multiplicity of infection (MOI. a number of viral particles per cell) is shown at the top of Figure 1 1 A. Figure 1 1 B shows the expression of CAR in C2 cel ls (immunofluorescent staining with anti-CAR antibodies).

[0018] Figure 1 2 shows CA R expression in normal and tumor human prostate tissues. A part of human prostate tumor microarray (T-tumor, N-normal prostate tissue samples) stained with anti-CAR antibodies.

[0019] Figure 13 shows immunofluorescent staining with anti-CAR antibodies. The membrane-associated CA R receptor is indicated by arrows. MOSEC (ovary carcinoma. Fig. 1 3A) and CT26 (colon carcinoma, Fig. 1 3B).

[0020] Figure 14 shows Western blotting analysis of MOSEC (mouse ovarian carcinoma) cells infected with an adenovirus expressing flagel l in and Tl .R-5. Figure 14A shows detection with anti-TLR5 antibodies, 1- un-infected cells, 2 - infected cells. Figure 14B shows detection with anti-CBLB502 antibodies, 1 - untreated lysate of infected cells, 2 - lysate of infected cells treated with a mixture of de-glycosylation enzymes (New England Biolabs).

[0021] Figure 15 shows a schematic presentation of adenoviral constructs. P - promoter, T - transcription terminator. Fig. 15A represents the structure of the 1st generation construct, called Mobilan.

[0022] Figure 16 shows the expression of CBLB502s (Fig. 16A) and hTLR5 (Fig. 16B) in HEK.293 cells infected with original Mobilan and derivatives thereof (Fig.l6B-D).

[0023] Figure 17 shows production of CBLB502s by reporter cells treated with UbiC-l and UbiC-2 Mobilan stocks. Capture ELISA method was used to detect CBLB502s in HEK293-hTLR5-LacZ cell cultures 15 hours after infection with two Mobilan. The fraction of secreted 502s (Fig. 17A) was measured cell culture supernatants prior to addition of cell lysis buffer; after lysis, another set of test samples was collected which represents both secreted and intracellular CBLB502s (Fig. I7B).

[0024] Figure 18 shows a comparison of Mobilan adenovirus stocks using in vitro reporter cell activation assay. Two separately manufactured Mobilan stocks, UbiC-l and UbiC-2. were diluted to the same titers according to their specifications and were tested for activation of HEK293-hTLR5-LacZ reporter cells.

[0025] Figure 19 shows the results of experiments performed in 4T1 tumors grown subcutaneously, and injected with the indicated test viruses and controls (control - buffer, M- Cherry - adenovirus expressing fluorescent protein) at day 0. Fig. I9A shows % surviving animals (tumor volume less than 2000 mm '. Fig. 19B

DETAILED DESCRIPTION

[0026] The provision of a toll-like receptor, such as toll-like receptor 5 (TLR-5), in combination with a toll-like receptor agonist, such as flagellin, results in a cis and in-trans effect that recruits cells involved in both the innate (cis effect) and adaptive (trans effect) immune response to specifically kill cancer cells and cells infected with a pathogen via the NF-KB apoptosis pathway. The inventors have made the surprising discovery that an unglycosylated mutant form of ilagellin when expressed in combination with TLR-5 in mammalian cells exhibits much higher specific activity than glycosylated forms of flagellin. The inventors have also discovered that using the Ubiquitin C promoter (UbiC) to drive expression of flagellin or both flagellin and TLR-5 from an adenovirus vector, leads to unexpectedly superior efficacy in treating cancer. Furthermore, the inventors have discovered that providing flagellin and TLR-5 together from an adenovirus vector to cancers expressing high levels of Coxsackie Virus and Adenovirus Receptor (CAR) results in surprisingly improved infection efficiency.

1. Definitions.

[0027] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and the appended claims, the singular forms "a." "an^"' and "the^"' include plural referents unless the context clearly dictates otherw ise.

[0028] For recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6- 9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6,9, and 7.0 are explicitly contemplated.

[0029] '^■Administer" may mean a single dose or multiple doses of an agent or agent.

[0030] "Analog" may mean, in the context of a peptide or polypeptide, a peptide or polypeptide comprising one or more non-standard amino acids or other structural variations from the conventional set of amino acids.

[0031] "Antibody^" may mean an antibody of classes IgG, IgM, IgA. IgD or lgE. or fragments, or derivatives thereof, including Fab. F(ab')2. Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies and derivatives thereof. The antibody may be a monoclonal antibody, polyclonal antibody, affinity purified antibody, or mixtures thereof which exhibits sufficient binding specificity to a desired epitope or a sequence derived therefrom. The antibody may also be a chimeric antibody. The antibody may be derivatized by the attachment of one or more chemical, peptide, or polypeptide moieties known in the art. The antibody may be conjugated with a chemical moiety.

[0032] A "derivative" may mean a peptide or polypeptide different other than in primary structure (amino acids and amino acid analogs). Derivatives may differ by being glycosylated, one form of post-translational modification. For example, peptides or polypeptides may exhibit glycosylation patterns due to expression in heterologous systems. If at least one biological activity is retained, then these peptides or polypeptides are derivatives according to the invention. Other derivatives may include fusion peptides or fusion polypeptides having a covalently modified N- or C-term inus, PEGylated peptides or polypeptides, peptides or polypeptides associated with lipid moieties, alkylated peptides or polypeptides, peptides or polypeptides linked via an am ino acid side-chain functional group to other peptides, polypeptides or chemicals, and additional modifications as would be understood in the art.

[0033] A "fragment" may mean a portion of a reference peptide or polypeptide.

[0034] A "homolog" may mean a peptide or polypeptide sharing a common evolutionary ancestor.

[0035] A "leader sequence^" may be a nucleic acid encod ing any peptide sequence that is linked and translated with a peptide or polypeptide of interest to allow the peptide or polypeptide of interest be properly routed through a eukaryotic cel l 's endoplasmic reticulum and Golgi complexes for the purposed of extracellular secretion from the cel l's membrane. The leader peptide sequence may be derived from alkaline phosphatase. The leader sequence may have a DNA sequence comprising atgctgctgctgctgctgctgctgggcctgaggctacagctct ccctgggc.

[0036] A "l iposome" may mean a tiny bubble (vesicle) made out of the same material as a cell membrane. A l iposome be fi lled with drugs and used to del iver drugs for cancer and other diseases. A l iposome may be fi l led w ith a vector. A l iposome mem brane may be made of phosphol ipids, wh ich are molecu les that have a head group and a tai l group. The head of the liposome may be attracted to water, and the tai l, which is made of a long hydrocarbon chain, is repelled by water. The tai ls may be repel led by water, and l ine up to form a surface away from the water. The lipids in the plasma membrane may be chiefly phosphol ipids l ike phosphatidylethanolamine and phosphatidylchol ine. Liposomes may be composed of naturally-derived phosphol ipids with mixed l ipid chains (l ike egg phosphatidylethanolamine), or of pure surfactant components l ike DOPE (dioleoylphosphatidylethanolamine).

[0037] A "peptide" or "polypeptide" may mean a l inked sequence of amino acids and may be natural, synthetic, or a modification or combination of natural and synthetic.

[0038] "Substantial ly identical^'" may mean that a first and second amino acid sequence are at least 60%. 65%, 70%. 75%. 80%, 85%. 90%. 95%. 96%. 97%, 98%.or 99% over a region of 10, 15, 20, 25, 30, 35.40, 45, 50.55, 60, 65.70.75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 amino acids .

[0039] "Treating," "treatment,^"' or "to treat" each may mean to alleviate, suppress, repress, eliminate, prevent or slow the appearance of symptoms, clinical signs, or underlying pathology of a condition or disorder on a temporary or permanent basis. Preventing a condition or disorder involves administering a agent of the present invention to a subject prior to onset of the disease. Suppressing a condition or disorder involves administering a agent of the present invention to a subject alter induction of the condition or disorder but before its clinical appearance. Repressing the condition or disorder involves administering a agent of the present invention to a subject after clinical appearance of the disease.

[0040] A "variant" may mean means a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity. Representative examples of "biological activity" include the ability to bind to a toll-like receptor and to be bound by a specific antibody. Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity. A conservative substitution of an amino acid. i.e.. replacing an amino acid with a different amino acid of similar properties (e.g., hydr ph i 1 icity. degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes can be identified, in part, by considering the hydropathic index of amino acids, as understood in the art. Kyte el ai, J. Mol. Biol. 157:105-132 (1982). The hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of ±2 are substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of that peptide, a useful measure thai has been reported to correlate well with antigenicity and immunogenicity. U.S. Patent No. 4,554,101, incorporated fully herein by reference. Substitution of amino acids having similar hydrophilicity values can result in peptides retaining biological activity, for example immunogenicity. as is understood in the art. Substitutions may be performed with amino acids having hydrophilicity values within ±2 of each other. Both the hyrophobicity index and the hydrophi l icity value of amino acids are influenced by the particular side chain of that am ino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative sim i larity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity. hydrophil icity, charge, size, and other properties.

[0041] Λ "vector'^" may mean a nucleic acid sequence containing an origin of replication. A vector may be a plasm id, a yeast or a mammal ian artificial chromosome. A vector may be a RNA or D A vector. A vector may be either a self-repl icating extrachromosomal vector or a vector which integrates into a host genome.

2. Toll-Like Receptor

[0042] Provided herein is a tol l-like receptor (TLR), which may be a type of pattern recognition receptor (PRR). The TLR may recognize molecules that are conserved molecular products derived from pathogens that incl ude Gram-positive, Gram-negative bacteria, fungi, and viruses, but are distinguishable from host molecules, col lectively referred to as pathogen- associated molecular patterns (PA M Ps). The TLR may also recognize endogenous molecules released from injured or dying cells, col lectively referred to as damage-associated molecular pattern (DAM Ps). A PAM P or DA MP may be a TLR agon ist as further described below. The TLR may be a fragment, variant, analog, homolog or derivative that recruits adapter molecules within the cytoplasm of cells in order to propagate a signal . The TLR may be from a human or other mammal ian species such as rhesus monkey, mouse, or rat. The TLR may be at least 30-99% identical to a TLR that recruits adapter molecules within the cytoplasm of cells in order to propagate a signal .

[0043] The TLR may be one of the between ten and fifteen types of TLR that are estimated to exist in most mammal ian species. The TLR may be one of the 1 3 TLR (named simply TLR 1 to TLR 1 3) that have been identified in humans and mice together, or may be an equivalent form that has been found in other mammalian species. The TLR may be one of the 1 1 members (TLR 1 -TLR 1 1 ) thai have been identified in humans.

[0044] The TLR may be expressed by different types of immune cells, and may be located on the cel l surface or in the cell cytoplasm. The TLR may be expressed on cancer cells. The TLR may be expressed by normal epithelial cells in the digestive system, normal keratinocytes in the skin, alveolar and bronchial epithelial cells, and epithelial cells of the female reproductive tract. These cells lining an organ may be the first line of defense against invasion of micoorganisms, and TLRs expressed in epithelial cells may have a crucial role in the regulation of proliferation and apoptosis.

[0045] The TLR-expressing cancer cell may be selected from the following table:

Table 1 TLR expression in Human Cancer cells

[0046] The TLR expressed on cancer cells may upregulate the NF- Β cascade and produce anti-apoptotic proteins that contribute to carcinogenesis and cancer cell proliferation.

[0047] Four adapter molecules of TLRs are known to be involved in signaling. These proteins are known as myeloid differentiation factor 88 (MyD88), Tirap (also called Mai), Trif, and Tram. The adapters activate other molecules within the cell, including certain protein kinases (IRAKI, IRAK4, TBK1, and IKKi) that amplify the signal, and ultimately lead to the induction or suppression of genes that orchestrate the inflammatory response. TLR signaling pathways during pathogen recognition may induce immune reactions via extracellular and intracellular pathways mediated by MyD88, nuclear factor kappa-light- chain-enhancer of activated B cells (NF-KB). and mitogen-associaled protein kinase (MAPK). In all, thousands of genes are activated by TLR signaling, and collectively, the TLR constitute one of the most pleiotropic, yet tightly regulated gateways for gene modulation.

[0048] TLRs together with the Interleukin-1 receptors form a receptor superfamily, known as the "Interleukin-1 Receptor/Toll-Like Receptor Superfamily." All members of this family have in common a so-called TIR (Toll-IL-1 receptor) domain. Three subgroups of TIR domains may exist. Proteins with subgroup I TIR domains are receptors for interleukins that are produced by macrophages, monocytes and dendritic cells and all have extracellular Immunoglobulin (Ig) domains. Proteins with subgroup II TIR domains are classical TLRs, and bind directly or indirectly to molecules of microbial origin. A third subgroup of proteins containing TIR domains (III) consists of adaptor proteins that are exclusively cytosolic and mediate signaling from proteins of subgroups 1 and 2. The TLR may be a fragment, variant, analog, homolog or derivative that retains either a subgroup I TIR domain, subgroup II TIR domain, or subgroup III TIR domain.

[0049] The TLR may function as a dimer. For example, although most TLRs appear to function as homodimers, TLR2 forms heterodimers with TLR 1 or TLR6. each dimer having a different ligand specificity. The TLR may also depend on other co-receptors for full ligand sensitivity, such as in the case of TLR4's recognition of LPS, which requires MD-2. CD14 and LPS Binding Protein (LBP) are known to facilitate the presentation of LPS to MD-2. a. TLR1

[0050] The TLR may be TL 1. which recognizes PAMPs with a specificity for gram- positive bacteria. TLR1 has also been designated as CD281.

b. TLR5

[0051] The TLR may be Toll-like receptor 5. The protein encoded by the TLR-5 may play a fundamental role in pathogen recognition and activation of innate immunity. TLR-5 may recognize PAMPs that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. TLR-5 may recognize bacterial flagellin, a principal component of bacterial flagella and a virulence factor. The activation of the TLR may mobilize the nuclear factor NF- Β and stimulate tumor necrosis factor-alpha production.

3. Toll-like Receptor Agonist

[0052] Also provided herein is a TLR agonist. The TLR agonist may be a PAMP, which may be conserved molecular product derived from a pathogen. The pathogen may be a Gram- positive bacterium, Gram-negative bacterium,, fungus, or virus. The TLR agonist may be a damage-associated molecular pattern (DAMP) ligand, which may be an endogenous molecule released from injured or dying cells. A DAMP or PAMP may initiate an immune response

-1 I- through TLR signals and recruit adapter molecules within the cytoplasm of cells in order to propagate a signal. The TLR agonist may be an agonist for the TLR, which may be a ligand from the following in Table 2:

Table 2 TLRs and Ligands

PAMP or DAMP that binds a TLR and induces TLR-mediated activity, such as activation of

NF-KB activity. The TLR agonsist fragment, variant, analog, homolog, or derivative may be at least 30-99% identical to amino acids of a TLR-agonist and induce TLR-mediated activity.

[0054] The TLR agonist may target a TLR such as TLR-5. The TLR agonist may be an agonist of TLR-5 and stimulate TLR-5 activity. The TLR agonist may be an anti-TLR5 antibody or other small molecule. The TLR agonist may be flagellin.

[0055] The flagellin may also be a flagellin or flagellin-related polypeptide. The flagellin may be from any source, including a variety of Gram-positive and Gram-negative bacterial species. The flagellin may be a flagellin polypeptide from any Gram-positive or Gram-negative bacterial species including, but not limited to. a flagellin polypeptide disclosed in U.S. Pat. Pub. No.2003/000044429, the contents of which are fully incorporated herein by reference. For example, the flagellin may have an amino acid sequence from a bacterial species depicted in Figure 7 of U.S. Patent Publication No.2003/0044429. The nucleotide sequences encoding the flagellin polypeptides listed in Figure 7 of U.S. 2003/0044429 are publicly available at sources including the NCBI Genbank database. The flagellin may also be a flagellin peptide corresponding to an Accession number listed in the BLAST results shown in Fig.25 of U.S. Patent Pub.2003/000044429, or a variant thereof. The flagellin may also be a flagellin polypeptide as disclosed in U.S. Patent Appl. Publication No. 2009/0011982, the contents of which are fully incorporated herein. The flagellin maybe anyone of a flagellin polypeptide as disclosed in Figures 6 and 7 herein.

[0056] The flagellin may be a fragment, variant, analog, homology or derivative of a flagellin that binds TLR5 and induces TLR5-mediated activity, such as activation of NF-KB activity. A fragment, variant, analog, homolog. or derivative of flagellin may be at least 30- 99% identical to amino acids of a flagellin that binds TLR5 and induces TLR5-mediated activity.

[0057] The flagellin ma be from a species of Salmonella, a representative example of which is S.dublin (encoded by GenBank Accession Number M84972). The flagellin related- polypeptide may be a fragment, variant, analog, homolog, or derivative of M84972, or combination thereof, that binds to TLR5 and induces TLR5-mediated activity, such as activation of NF-kB activity. A fragment, variant, analog, homolog, or derivative of flagellin may be obtained by rational-based design based on the domain structure of Flagellin and the conserved structure recognized by TLR5.

[0058] The flagellin may comprise at least 10. I I, 12, or 13 of the 13 conserved amino acids shown in Fig. 5 (positions 89.90.91. 95.98. 101, 115, 422.423, 426.431.436 and 452). The flagellin may be at least 30-99% identical to amino acids 1 174 and 418505 of M84972. Fig.26 of U.S. Patent Appl Publication No.2009/0011982. the contents of which are fully incorporated herein, lists the percentage identity of the amino- and carboxy-terminus of flagellin with known TLR-5 stimulating activity, as compared to M84972.

[0059] The flagellin may be the major component of bacterial flagellum. The flagellin may be composed of three domains (Fig. 4). Domain 1 (Dl) and domain 2 (D2) may be discontinuous and may be formed when residues in the amino terminus and carboxy terminus are juxtaposed by the formation of a hairpin structure. The amino and carboxy terminus comprising the Dl and D2 domains may be most conserved, whereas the middle hypervariable domain (D3) may be highly variable. Studies with a recombinant protein containing the amino Dl and D2 and carboxyl Dl and D2 separated by an Escherichia coli hinge (ND1-2/ECH/CD2) indicate that Dl and D2 may be bioactive when coupled to an ECH element. This chimera, but not the hinge alone, may induce IkBa degradation, NF-kB activation, and NO and IL-8 production in two intestinal epithelial cell lines. The non- conserved D3 domain may be on the surface of the flagellar filament and may contain the major antigenic epitopes. The potent proinflammatory activity of flagellin may reside in the highly conserved N and C Dl and D2 regions (See Figure 4).

[0060] The flagellin may induce NF-kB activity by binding to Toll-like receptor 5 (TLR5). The TLR may recognize a conserved structure that is particular to the flagellin. The conserved structure may be composed of a large group of residues that are somewhat permissive to variation in amino acid content. Smith et al.. Nat Immunol.4:1247-53 (2003), the contents of which are incorporated herein by reference, have identified 13 conserved amino acids in flagellin that are part of the conserved structure recognized by TLR5. The 13 conserved amino acids of flagellin that may be important for TLR5 activity are shown in Fig. 5.

[0061] Numerous deletional mutants of flagellin have been made that retain at least some TLR5 stimulating activity. The flagellin may be such a deletional mutant, and may be a deletional mutant disclosed in the Examples herein. The flagellin may comprise a sequence translated from GenBank Accession number D 13689 missing amino acids 185-306 or 444- 492, or from GenBank Accession number 84973 missing amino acids 179-41 . or a variant thereof.

[0062] The flagellin may comprise transposon insertions and changes to the variable D3 domain. The D3 domain may be substituted in part, or in whole, with a hinge or linker polypeptide that allows the Dl and D2 domains to properly fold such that the variant stimulates TLR5 activity. The variant hinge elements may be found in the E.coli MukB protein and may have a sequence as set forth in SEQ ID NOS: 3 and 4, or a variant thereof. [0063] The flagel lin as described above may further comprise a leader sequence. The flagellin further comprising a leader sequence may be CBLB502S (SEQ I D NO: 1 01 ).

[0064] The flagel lin may have reduced or lack glycosylation, and may comprise a mutation at a glycosylation site, which may increase the specific activity of the flagel lin. The glycosylation site may comprise the amino acid sequence N S, NGT. NQT, or NMS. The mutation may comprise a mutation of the asparagine (N) residue within the glycosylation site to a different residue. With reference to positions within the flagel l in sequence represented by SEQ ID NO: I , the glycosylation site mutation may be located at N 19, N 10 1 , N 128, or N475. The N residue may be replaced by any other amino acid, including alanine, prol ine, or glutamine. In particular, the flagel l in may comprise a N to Q mutation at a glycosylation site. The flagell in may comprise the sequence of SEQ I D NO: 1 02. which has the same sequence shown in Figure 1 0, except that the N residues, wh ich are with in the circled predicted glycosylation sites, at the equivalent to positions 1 9. 1 0 1 , 1 28. and 475 of SEQ I D NO: 1 , are changed to Q.

4. Agent

[0065] This invention also relates to an agent comprising a therapeutically effective amount of a TLR and TLR agonist. The agent may deliver the TLR separately from the TLR agonist. The agent may be a vector. The vector may comprise a first nucleic acid encoding the TLR and a second nucleic acid comprising the TLR agonist. The vector may be capable of transducing mammal ian cells.

[0066] The vector may be capable of bi-cistronic expression of the TLR and/or TLR agonist by virtue of the TLR and/or TLR agonist being operably l inked to a strong promoter. The vector may comprise only a gene encod ing the TLR. which may be operably l inked to a strong promoter. The promoter may be a ubiquitin C (UbiC) promoter, a cytomegalovirus (CMV) promoter, or an elongation factor 1 alpha promoter (EF 1 A). The UbiC promoter may have the sequence of the UbiC promoter contained in pDSL hpUGI H (American Type Culture Collection Accession No. 1 0326379). The vector may be del ivered into a mammal ian cell by a virus or liposome related vector system. The v i rus vector system may be an adenovirus or a cytomegalovirus.

[0067] The agent may be a l i posome harboring the vector. The l iposome maybe capable of transducing mammalian cel ls and del iveri ng the vector for expression. [0068] The agent may be a drug formu lation that simultaneously induces expression and activates the TLR, thereby exposing tumor or infected cel ls to the host immune system imitating the situation of a massive penetration through the intestinal wall . The agent may be a drug formulation that expresses the TLR in combination with the TLR agonist, and may be delivered systematical ly in solution for admin istration such as intramuscularly. The agent may be a drug formulation that expresses the TLR in combination with the TLR agonist, which may be expressed from the same* vector, such as an adenoviral or cytomegalovirus vector system. The agent may be a drug formulation that expresses the TLR in combination with the TLR agonist expressed in the form of a nano-particle, which may carry a functional agonist to the cel l surface of a mammal ian cell .

[0069] The agent may be a pharmaceutical agent comprising the drug formulation described above, which may be produced using methods wel l known in the art. The agent may also comprise a coagent.

[0070] The vector may comprise a first nucleic acid encoding TLR5 and a second nucleic acid comprising flagel l in. The vector may be capable of expressing TLR5 and/or flagel l in using a strong promoter. The expression vector may further comprise a leader sequence cloned upstream of the gene encoding the TLR or TLR5 and/or flagel l in. The expression vector may be pCD5 1 5 based vector system. The expression vector may be pCD5 1 5-CMV- hTLR5-EF l -502 as described in Figu re 1 A . The expression vector may be pCD5 1 -C V- hTLR5 as described in Figure I B. The expression vector may be pCD5 1 5-CMV-Sseap-502 as described in Figure I C .

[0071] The expression vector may comprise sequences encod ing the TLR and the TLR agonist in the same open read ing frame, such that the TLR and TLR agonist are expressed as a translational fusion. The sequences coding for the TLR and TLR agonist may be separated by a self-cleaving 2a peptide and a furin protease site for in vivo removal of the 2a peptide at the C-terminus of the TLR agonist, in a manner as described by Fang J, et al., 2005. Nat Biotechnol.;23(5):584-90, the contents of which are incorporated herein by reference. The expression vector may comprise a TLR and TLR agonist in the same open reading frame as shown in Figure 1 5D.

[0072] The agent may be drug formulation that simu ltaneously induces expression and activates a TLR thereby exposing tumor or infected cel ls to the host i mmune system imitating the situation of a massive penetration through the intestinal wall. The drug formulation may be in the form of a viral expression system harboring the vector. The drug formulation may be an adenovirus-expressed functional human TLR5 in combination with:

[0073] the TLR agonist, delivered systematically in solution for administration, such as intramuscularly;

[0074] the TLR agonist, expressed from the same adenoviral vector as the TLR; or

[0075] the TLR agonist, expressed in the form of nano-particles carrying functional TLR agonist, such as flagellin, which may be derived from CBLB502, on their surface. The nano- particle may be on the basis of a bacteriophage T7, or fully formed to retain its biological activity. The nano-formulation may provide for dose-dependent. ΝΡ-κΒ-responsive reporter activation, and may result in cell internalization by endocytosis for effective immunization approach (Mobian AP-A).

a. Administration

[0076] Administration of the agents using the method described herein may be orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, or combinations thereof. Parenteral administration includes, but is not limited to, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intrathecal, and intraarticular. For veterinary use, the agent may be administered as a suitably acceptable formulation in accordance with normal veterinary practice. The veterinarian can readily determine the dosing regimen and route of administration that is most appropriate for a particular animal. The agents may be administered to a human patient, cat. dog. large animal, or an avian.

[0077] The agent may be administered simultaneously or metronomically with other treatments. The term "simultaneous" or "simultaneously" as used herein, means that the agent and other treatment be administered within 48 hours, preferably 24 hours, more preferably 12 hours, yet more preferably 6 hours, and most preferably 3 hours or less, of each other. The term "metronomically" as used herein means the administration of the agent at times different from the other treatment and at a certain frequency relative to repeat administration.

[0078] The agent may be administered at any point prior to another treatment including about 120 hr, 118 hr, 116 hr. 114 hr. 112 hr. I 10 hr. 108 hr. 106 hr, 104 hr, 102 hr, 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr.88 hr.86 hr, 84 hr.82 hr.80 hr.78 hr.76 hr.74 hr.72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr. 54 hr, 52 hr. 50hr, 48 hr, 46 hr, 44 hr, 42 hr. 40 hr, 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 1 8 hr, 1 6 hr, 14 hr, 12 hr, 10 hr, 8 hr, 6 hr, 4 hr, 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins., 35 mins., 30 mins., 25 mins., 20 mins., 15 mins, 10 mins, 9 mins, 8 mins, 7 m ins.. 6 mins., 5 mins., 4 mins., 3 mins, 2 mins. and 1 mins. The agent may be administered at any point prior to a second treatment of the agent includ ing about 120 hr, 1 1 8 hr, 1 1 6 hr. 1 14 hr, 1 1 2 hr. 1 10 hr, 108 hr, 106 hr. 104 hr, 1 02 hr. 1 00 hr. 98 hr, 96 hr. 94 hr. 92 hr, 90 hr, 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr. 70 hr, 68 hr. 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr. 44 hr. 42 hr, 40 hr, 38 hr, 36 hr. 34 hr, 32 hr, 30 hr, 28 hr, 26 hr. 24 hr, 22 hr, 20 hr, 1 8 hr, 1 6 hr. 14 hr. 1 2 hr. 10 hr. 8 hr, 6 hr, 4 hr, 3 hr. 2 hr, 1 hr, 55 mins.. 50 mins., 45 mins., 40 mins., 35 mins., 30 mins.. 25 mins.. 20 mins.. 1 5 m ins., 1 0 mins., 9 mins., 8 mins., 7 mins., 6 mins., 5 mins.. 4 m ins., 3 mins, 2 mins, and 1 mins.

[0079] The agent may be administered at any point after another treatment including about l min, 2 mins., 3 mins., 4 m ins., 5 mins., 6 mins.. 7 mins., 8 mins., 9 mins., 10 mins., 1 5 mins., 20 mins., 25 mins.. 30 mins.. 35 mins.. 40 mins.. 45 mins., 50 mins., 55 mins., 1 hr, 2 hr, 3 hr, 4 hr. 6 hr, 8 hr, 1 0 hr, 12 hr. 1 4 hr, 1 6 hr, 1 8 hr. 20 hr, 22 hr, 24 hr, 26 hr, 28 hr. 30 hr, 32 hr, 34 hr, 36 hr, 38 hr, 40 hr. 42 hr, 44 hr, 46 hr, 48 hr. 50 hr, 52 hr, 54 hr. 56 hr, 58 hr, 60 hr, 62 hr, 64 hr. 66 hr. 68 hr. 70 hr. 72 hr, 74 hr. 76 hr. 78 hr. 80 hr. 82 hr. 84 hr, 86 hr. 88 hr. 90 hr, 92 hr, 94 hr, 96 hr. 98 hr. 1 00 hr, 102 hr, 1 04 hr. 106 hr. 1 08 hr, 1 10 hr, I 12 hr. 1 14 hr, 1 16 hr, 1 18 hr, and 120 hr. The agent may be administered at any point prior after a second treatment of the agent including about 120 hr, I 1 8 hr. 1 16 hr, 1 14 hr, 1 12 hr. 1 10 hr, 108 hr, 106 hr, 104 hr, 102 hr. 100 hr, 98 hr, 96 hr, 94 hr, 92 hr, 90 hr. 88 hr, 86 hr, 84 hr, 82 hr, 80 hr, 78 hr, 76 hr, 74 hr, 72 hr, 70 hr, 68 hr, 66 hr, 64 hr, 62 hr, 60 hr, 58 hr, 56 hr, 54 hr, 52 hr, 50hr, 48 hr, 46 hr, 44 hr, 42 hr, 40 hr. 38 hr, 36 hr, 34 hr, 32 hr, 30 hr, 28 hr, 26 hr, 24 hr, 22 hr, 20 hr, 1 8 hr, 1 6 hr, 14 hr, 1 2 hr. 10 hr, 8 hr, 6 hr, 4 hr, 3 hr, 2 hr, 1 hr, 55 mins., 50 mins., 45 mins., 40 mins.. 35 mins., 30 mins., 25 mins., 20 mins., 1 5 mins., 10 mins., 9 mins., 8 mins., 7 mins., 6 mins., 5 mins., 4 m ins.. 3 m ins, 2 mins, and 1 mins.

b. Formulation

[0080] The method may comprise admin istering the agent. Agents provided herein may be in the form of tablets or lozenges formulated in a conventional manner. For example, tablets and capsules for oral admin istration may contain conventional excipients may be binding agents, fillers, lubricants, disintegrants and wetting agents. Binding agents include, but are not limited to, syrup, accacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone. Fillers may be lactose, sugar, microcrystalline cellulose, maizestarch, calcium phosphate, and sorbitol. Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica. Disintegrants may be potato starch and sodium starch glycol late. Wetting agents may be sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.

[0081 J Agents provided herein may also be liquid formulations such as aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs. The agents may also be formulated as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain additives such as suspending agents, emulsifying agents, nonaqueous vehicles and preservatives. Suspending agent may be sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydroxyethylcellulose. carboxymethyl cellulose, aluminum stearate gel. and hydrogenated edible fats. Emulsifying agents may be lecithin, sorbitan monooleate, and acacia. Nonaqueous vehicles may be edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol. Preservatives may be methyl or propyl p-hydroxybenzoate and sorbic acid.

[0082] Agents provided herein may also be formulated as suppositories, which may contain suppository bases such as cocoa butter or glycerides. Agents provided herein may also be formulated for inhalation, which may be in a form such as a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifluoromethane or trichlorofluoromethane. Agents provided herein may also be formulated as transdermal formulations comprising aqueous or nonaqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.

[0083J Agents provided herein may also be formulated for parenteral administration such as by injection, intratumor injection or continuous infusion. Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents. The agent may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water. [0084] Agents provided herein may also be formu lated as a depot preparation, which may be administered by implantation or by intramuscular injection. The agents may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (as a sparingly soluble salt, for example),

c. Dosage

[0085] The method may comprise administering a therapeutically effective amount of the agent to a patient in need thereof. The therapeutical ly effective amount required for use in therapy varies with the nature of the cond ition being treated, the length of time desired to activate TL activity, and the age/condition of the patient. In general, however, doses employed for adult human treatment typical ly are in the range of 0.00 1 mg/kg to about 200 mg/kg per day. The dose may be about 1 mg/kg to about 1 00 mg/kg per day. The desired dose may be conveniently administered in a single dose, or as multiple doses administered at appropriate intervals, for example as two. three, four or more sub-doses per day. Mu ltiple doses may be desired, or required.

[0086] The dosage may be at any dosage such as about 0. 1 mg/kg. 0.2 mg/kg, 0.3 mg/kg, 0.4 mg/kg, 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg. 0.8 mg/kg. 0.9 mg/kg. I mg/kg, 25 mg/kg, 50 mg/kg, 75 mg/kg, 100 mg/kg, 1 25 mg/kg, 150 mg/kg, 1 75 mg/kg, 200 mg/kg, 225 mg/kg, 250 mg/kg, 275 mg/kg, 300 mg/kg, 325 mg/kg. 350 mg/kg, 375 mg/kg, 400 mg/kg, 425 mg/kg, 450 mg/kg, 475 mg/kg, 500 mg/kg. 525 mg/kg, 550 mg/kg. 575 mg/kg, 600 mg/kg, 625 mg/kg, 650 mg/kg, 675 mg/kg, 700 mg/kg, 725 mg/kg, 750 mg/kg, 775 mg/kg, 800 mg/kg, 825 mg/kg, 850 mg/kg, 875 mg/kg, 900 mg/kg, 925 mg/kg, 950 mg/kg, 975 mg/kg or 1 mg/kg.

5. Method for Treating Cancer

[0087] Provided herein is a method for treating cancer by admin istering to a mammal in need thereof the agent. The method provide immunotherapy agai nst cancer by conversion of tumor cells into a TLR agonist-responsive state with targeted intratumor stimulation of TLR, thereby focusing an immune response on the tumor. The method may be used to treat primary tumors prior to surgical removal in order to reduce the risk of metastasis development, as wel l as treat of other tumor nodu les. The method may comprise intratumor injection. The method may have the step of injecting the agent into a primary tumor prior to surgical removal to reduce the risk of metastasis development, as well as treat other tumor nodules. The method may be used to treat any tumor that is accessible for adenovirus intratumor injection.

[0088] A variety of cancers may be treated according to this invention, including carcinoma, bladder (including accelerated and metastatic bladder cancer), breast, colon (including colorectal cancer), kidney, liver, lung (including small and non-small cell lung cancer and lung adenocarcinoma), ovary, prostate, testes, genitourinary tract, lymphatic system, rectum, larynx, pancreas (including exocrine pancreatic carcinoma), esophagus, stomach, gall bladder, cervix, thyroid, and skin (including squamous cell carcinoma); hematopoietic tumors of lymphoid lineage including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkins lymphoma, non-Hodgkins lymphoma, hairy cell lymphoma, histiocytic lymphoma, and Burketts lymphoma; hematopoietic tumors of myeloid lineage including acute and chronic myelogenous leukemias. myelodysplastic syndrome, myeloid leukemia, and promyelocytic leukemia; tumors of the central and peripheral nervous system including astrocytoma, neuroblastoma, glioma, and schwannomas; tumors of mesenchymal origin including fibrosarcoma, rhabdomyoscarcoma, and osteosarcoma; and other tumors including melanoma, xenoderma pigmentosum, keratoactanthoma, seminoma, thyroid follicular cancer, teratocarcinoma. and cancers of the gastrointestinal tract or the abdominopelvic cavity.

[0089] The cancer may express a high level of CAR protein, which may be expressed in the membranes of cancer cells. The high level may be high in comparison to hematopoietic, soft tissue, skin, head and neck, brain, cervical, breast, and esophageal cancers, which may express low levels of CAR. The high level may also be high in comparison to lung, ovary, stomach, kidney, melanoma, liver, endocrine, and mesothelioma cancers. The high level may be at least 2, 3.4.5, 6, 7, 8.9, or 10 times higher than the level of CAR expressed in NCI- H 1437, NC1-H2122. or CT26 cells. The cancer may be bladder, prostate cancer, small intestine, thyroid, testicular, or colon.

[0090] The cancer expressing a high level of CAR may exhibit a higher efficiency of infection for the agent when the agent comprises a viral expression vector, such as an adenovirus. As a result, the multiplicity of infection in the cancer cells for a viral agent as described herein may be at least 100 times or 1000 times higher in cancer cells expressing a high level of CAR in comparison to cancer cells expressing a low level of CAR, and a lower effective amount of the agent may therefore be used in cancer cells expressing a high level of CAR. The effective amount of the viral agent may be less than about 10⁹. 10⁸. 10⁷, 10⁶, or 10⁵ viral particles.

[0091] The method may be combined with other methods for treating cancer, including use of an immunostimulant, cytokine, or chemotherapeutic. The immunostimulant may be a growth hormone, prolactin or vitamin D.

6. Treatment of Infected Cells

[0092] Provided herein is a method for treating an infectious disease by the simultaneous delivery of transduced cells by the agent. The method may be used to treat a viral, bacterial, protozoan parasite or fungal infection. The method may be used to treat any infectious disease by using intracellular injection resulting in autocrine activation of TLR signaling of infected cells with minimal systemic effect and thereby enabling to attract innate immune response specific to the infected cells. The method may be combined with other therapies for treating viral, bacterial, protozoan parasite or fungi infections.

[0093] The method may comprise administering the agent. The method may comprise administration of a vaccine comprising the agent, and may be used in combination with any other vaccination, which may comprise a construct expressing an antigen of choice.

Example 1

Synthesis of Bi-cistronic expression TLR5/flagellin vector and Treatment of Tumor Cells

[0094] Vector constructs were created for expressing Toll-like receptor 5 (TLR-5) and flagellin CBLB502. Vector pCD5 I 5 was used as a backbone for these constructs. The cDNA sequence of human TLR-5 and the DNA encoding the toll-like receptor agonist's CBLB502 were individually fused with leader peptide derived from alkaline phosphatase enabling routing of the expressed protein through the endoplasmic reticulum (ER) and Golgi towards extracellular secretion.

[0095] The pCD515-CMV-hTLR5-EF I -502s vector construct expressed the secreted form of CBLB502 flagellin (CBLB502S) and the toll-like receptor 5 (TLR5) at the cell surface. This adenoviral vector required modification of the CBLB502 to reach its effective synthesis and secretion by mammalian cells. The adenovirus construct comprises the leader nucleic acid sequence (Atgctgctgctgctgctgctgctgggcctgaggctacagctctccctgggc) (SEQ ID NO: 100) derived from alkaline phosphatase and was cloned upstream of the truncated Salmonella flagellin (fliC) gene (see Burdelya et al.. Science 320:226-230 (2008) to encode a secretable form of flagellin (i.e., C LB502S). An EF1 (elongation factor la) promoter was cloned upstream of this cassette encoding CBLB502S. The TLR5 gene was derived from human and has the amino acid sequence as shown in Figure 9 (SEQ ID NO: 99). A CMV promoter was cloned upstream of the TLR5 gene. This construct co-expresses TLR5 and CBLB502S. This construct is shown in Figure 1 A.

[0096] The pCD515-CM V-hTLR5 expression vector was constructed to express the form of human TLR-5 (see Figure 9). The adenovirus construct comprises a strong CMV promoter cloned upstream of the hTLR5 cassette. This construct is shown in Figure I B.

[0097] The pCD515-CMV-Sseap-502 expression vector was constructed to express the secreted flagellin CBLB502 and the toll-like . The adenovirus construct comprises a strong CMV promoter cloned upstream of the leader sequence SEAP 502 flagellin (fliC) gene. This construct is shown in Figure 1C.

Example 2

Synthesis of Bi-cistronic expression TL 5/flagellin vector and Treatment of Tumor Cells

[0098] Two reporter mammalian cell lines, both expressing NF-kB-responsive GFP and differing in their TLR5 status, were transduced with vector constructs pCD515, pCD5l5- CMV-hTLR5-EFl-502s, pCD515-CMV-hTLR5-502. pCD5 I 5-CM V-hTLR5, and pCD515- CMV-Sseap-502 (see Table 3 below).

Table 3 Activity of adenoviral constructs as TLR5 signaling activators

Treatment Report Linc-293- Reporter Line- 11 it 11 293-TLR

CBLB502 +

—

Ad5 (control) (pCD515) — —

Ad5 (TLR5) (pCD515-CMV-hTLR5) — -

Ad5(TLR5) + CBLB502 (pCD515- -t- +

CMV-hTLR5-EFl-502)

Ad5 (CBLB502S) (pCD5!5-CMV- +

- Sseap-502)

Ad5 (TLR5) (pCD5 1 5-CMV-hTLR5) + +

Ad5(CBLB502S) (pCD5 1 5-CMV- hTLR5-EF l -502s)

Ad5 (CBLB502S + TLR5) (pCD5 1 5- + +

CMV-hTLR5-EF l -502s)

[0099] Vector co-expressing TLR5 and TLR5 agonist CBLB502S was sufficient to induce expression of NF-kB reporter in 293-null cells that do not express any of known TLRs and which cannot be activated by TLR5 agonist alone. This experiment demonstrates that TLR5 and flagell in CBLB502S can work in trans or in cis to activate TLR5 signaling.

Example 3

[0100) To test antitumor effects of bi-cistronic adenovirus having (pCD5 1 5-C V- hTLR5-EF l -502s), 10 ml of the adenoviral suspension ( 1 01 2- 1 01 1 l U/ml) were injected into one of two s.c. growing syngeneic tumors in Balb/c mice originating from CT26 mouse colon carcinoma cells when tumors reached 3-5mm in diameter and tumor size was monitored unti l control non-injected tumors reached size l imit requ iring term ination of the experiment. Control mice were injected (again, one tumor out of two per mouse) with adenoviral vector expressing red fluorescent protein (RFP). The results of a representative experiment are shown in Figure 4. Almost complete lack of growth of tumors in jected with (pCD5 1 5-CMV- hTLR5-EF l -502s) was accompan ied with reduced growth of the un injected tumor within the same animal as compared with the tumors in control animals injected with RFP-expressing adenovirus. This result indicates (i) powerful in-cis and (ii) visible in-trans effect of pCD5 1 5- C V-hTLR5-EF l -502s indicative of recruitment of both innate (cis effect) and adaptive (trans effect) immune response. Neither of the other control viruses l isted in Table I (i.e., AD5 (control) and Ad5 (TLR5)) injected alone had growth suppressive effects on tumors.

[0101] Thus, enforced ectopic expression of TLR5 makes tumor cell types, which originally were TLR5 deficient, high ly responsive to TLR5 stimulation resulting in breaking tumor immuno-tolerance, powerful attraction of innate immune response that promotes effective development of adaptive immune response with subsequent general antitumor effect. Example 4

CAR expression levels influence the efficiency of adenoviral vector expression in cancer cells

[0102] This example shows that tumors expressing higher levels of CAR are more efficiently treated with an adenovirus comprising a vector expressing both flagellin and TLR- 5. Membrane expression of the Coxsackie virus and Adenovirus Receptor (CAR) is required for efficient infection by adenovirus serotype 5 and its derivatives such as an adenovirus comprising a vector expressing both flagellin and TLR-5. It has been reported for several tumor types (e.g.. melanoma and rhabdomyosarcoma) that the level of CAR expression decreases with tumor progression, while the opposite situation was observed in estrogen- dependent breast cancers. Using a panel of mouse and human tumor cell lines, the correlation of high level of CAR expression (by staining with CAR antibodies) was determined by measuring the infection efficiency of Ad-mCherry (a control adenovirus expressing fluorescent mCherry protein). This was determined by the counting of a number of red fluorescence-positive cells by microscopy or by FACS analysis. Cells were infected with Ad- mCherry at different multiplicity of infection (MOI) and the efficiency of infection was analyzed at different time points. Among mouse CAR-positive cells it was found that ovary cancer (MOSEC), breast cancer (4T1, LM3), prostate cancer (TRAMP-C2) cells strongly expressed membrane CAR and could efficiently be infected with Ad-mCherry (Fig. 11).

|0103] To find out which types of human tumors strongly express CAR, tissue tumor arrays consisting of tumor samples of different tissue origin and normal tissues (Roswell Park Pathology Core) were stained with CAR antibodies. A primary analysis of CAR expression in the tumors showed that the tested tumors can be divided into three categories: (I) low CAR expression (hematopoietic, soft tissue, skin, head and neck, brain, cervical, breast, esophageal; (II) high CAR expression: (bladder, prostate cancer, small intestine, thyroid, testicular, colon); and, (III) average CAR expression (lung, ovary, stomach, kidney, melanoma, liver, endocrine, mesothelioma). Consequently, specific Prostate tumor tissue arrays (consisting of 134 samples of tumor prostate, 1 4 samples of normal prostate and 68 samples of normal tissues) were stained with CAR antibodies. Ninety percent of prostate tumors were CAR positive (as well as normal prostate tissues) (Fig. 12). [0104] The efficiency of adenovirus infection associated with higher CAR expression was confirmed in prostate cells. The antitumor effect for an adenovirus comprising a vector expressing both flagellin and TLR-5 was observed in CT26 colon carcinoma cells only when a high dose of the virus (3 10¹⁰ virus particles, vp) was injected into CT26 tumors, whereas with no significant effect was observed with lower doses (5xl0⁹ vp). This was likely due to insufficient functional expression by CT26 cells of CAR. Indeed, CAR expression is much lower on the surface of CT26 cells as compared to the MOSEC cell line (Fig. 13). In addition, a 100- 1.000-fold higher MOI was required when infecting CT26 cells, as compared to MOSEC, with Ad-mCherry in order to detect mCherry expression (not shown). Testing of additional cell lines confirmed that while all tested lines showed bright cytoplasmic staining with anti-CAR antibodies, staining of membrane-associated CAR was well-correlated with the ability to infect the cells with adenovirus at a lower multiplicity of infection (MOI).

[0105] Thus, prostate tumors, as well as other tumors expressing high levels of CAR, is a good candidate type of tumor for treatment with an adenovirus comprising a vector expressing both flagellin and TLR-5.

Example 5

Glycosylation of flagellin affects the efficacy of combined flagellin and TLR-5 for treating cancer

[0106] This example shows that glycosylated flagellin has lower activity in mammalian cells than unglycosylated flagellin. Western blot analysis (Fig. 14) was used to assess the expression level of both TLR5 and CBLB502s in Mobilan-infected MOSEC cells. This analysis confirmed that both proteins are expressed (Fig. 14), although the overall level of expression was not very high (as compared to Western blot signals from standard proteins, not shown). CBLB502s was detected in both lysates of infected cells (Fig. 14B) and in the culture media (not shown), thus confirming its secretion, which is presumably required for signaling since the region of TLR5 involved in flagellin-binding lies in its extracellular domain. However, the observed size of CBLB502s in both lysates and media was at least 6-7 kDa larger than expected. This was shown to be due to glycosylation by observation of an appropriate shift in the gel mobility of CBL.B502s after treatment of lysates with commercially available de-glycosylating enzymes Fig. 14B). Flagellin glycosylation may explain the observed relatively low specific biological activity of flagellin produced in MOSEC cells infected with an adenovirus expressing both flagell in and TLR-5. Indeed, based on a combination of our two routine flagellin-specific assays, ELISA and a signaling bio- assay (using HEK293-hTLR5-LacZ reporter cel ls), the speci fic activity of CBLB502s secreted from MOSEC cel ls was ~50-fold lower than that of the bacterially produced CBLB502s reference standard. Analysis of the amino acid sequence of flagel lin predicted the presence of four eukaryotic N-linked glycosylation sites (Fig. 1 0). Notably, one of these sites is located in an area involved in the primary TLR5-flagel l in interaction i nterface and may therefore reduce the affinity and activity of flagell in.

Example 6

Promoters affect the efficacy of an adenovirus expressing flagellin and TLR-5

[0107] This examples shows that expressing flagell in from an adenoviral vector using the UbiC promoter results in improved efficacy for treating cancer using an adenovirus expressing flagell in and TLR-5. A number of modifications were introduced into an adenovirus construct encoding both TLR-5 and flagell in (called Mobilan and shown in Fig. 15A) to optimize the level of expression, efficiency of secretion, stability and biological activity of both components of the CBLB502s-TLR5 signaling complex. Generated constructs were first tested in diagnostic cel l lines and. then, in tumor models in m ice.

[0108] To prevent glycosylation of CBLB502s (shown in Fig. 10) expressed in mammalian cells, appropriate mutations were introduced into its nucleotide sequence to replace the four asparagine residues in the identified potential glycosylation sites with glutamines (all sites mutated at the same). The mutant protein was cal led CBLB502NQs (Fig. 1 5)(SEQ I D NO: 102). H is-tagged mutant proteins were produced in E. coli, purified and tested for specific biological activity as compared to the original CBLB502s in a cell-based bio-assay (measuring NF-kB-dependent reporter expression). The modified coding sequence was optimized for expression in human cel ls, synthesized (by custom order from GenScript) and used to generate new versions of the Mobilan vector.

[0109] In addition to modi fyi ng the CBLB502s component of Mobilan to eliminate its glycosylation potential as descri bed above ( Fig. I SA), we tested the fol lowing Mobi lan modifications of the Mobi lan construct: ( i) addition of a polyadenylation site downstream of the hTLR5 sequence for mRNA stabi lization (Fig. 1 5 B); (ii) replacement of the EF l promoter with an alternative promoter UbiC (Fig. 1 5C); and (iii) expression of CBLB502NQs and hTLR5 as a translational fusion with a "self-cleaving" 2a peptide and a furin protease site for in vivo removal of the remaining 2a peptide at the C-terminus of CBLB502NQs (Fig. 15D). Small-scale Ad preps were produced and characterized for (i) relative amounts of hTLR5 and CBLB502s produced by infected cells in culture (by Western blot and ELISA, Figs. 16 and 17), and (ii) specific biological activity of CBLB502s secreted into the culture medium (activation of NF- B-dependent signaling in reporter cell line. Fig. 18). Finally, all Mobilan versions were tested in vivo for their ability to inhibit growth of 4T1 mouse mammary tumors in syngeneic mouse model (Fig. 19). These experiments indicate that using UbiC results in an improved Mobilan vector.

Claims

1. A vector comprising a first and second nucleic acid, wherein the first nucleic acid encodes a toll-like receptor and the second nucleic acid encodes a toll-like receptor agonist.

2. The vector of claim 1 , wherein the toll-like receptor agonist is flagellin.

3. The vector of claim 1, wherein the vector is an expression vector.

4. The vector of claim 3, wherein the vector is a mammalian expression vector.

5. The vector of claim 3, wherein the vector is expressed from an adenovirus, a lentivirus or a liposome.

6. The vector of claim 1 , wherein the first nucleic acid encodes a secreted form of a toll-like receptor.

7. The vector of claim 2 wherein the flagellin is a secreted form of flagellin.

8. The vector of claim 7, wherein the sequence of the flagellin comprises the sequence of SEQ ID NO: 101.

9. The vector of claim 2, where the flagellin lacks glycosylation.

10. The vector of claim 9. wherein the flagellin comprises the sequence of SEQ ID NO: 102.

11. The vector of claim 1. wherein the toll-like receptor is TLR-5.

12. The vector of claim 11 , wherein the sequence of the TLR-5 comprises SEQ ID NO: 99).

13. The vector of claim 1, wherein the vector comprises a Ubiquitin C promoter operably linked to the second nucleic acid.

14. A method of treating cancer in a mammal comprising administering to a mammal in need thereof an agent comprising the vector of claim 1, wherein the cancer expresses a high level of CAR protein.

15. The method of claim 14, wherein the cancer is selected from the group consisting of bladder, prostate cancer, small intestine, thyroid, testicular, and colon.

16. The method of claim 15. wherein the cancer is a tumor.

17. The method of claim 16. wherein the agent is administered in trans from the tumor of the mammal.

18. The method of claim 16, wherein the agent is administered directly into a tumor of the mammal.

19. The method of claim 14, wherein the agent is administered in combination with an immunostimulant.

20. The method of claim 14, wherein the immunostimulant is selected from the group consisting of growth hormone, prolactin and vitamin D.

21. The method of claim 20. wherein the growth hormone is somatotrophin.

22. The method of claim 14, wherein the agent is administered in combination with a cytokine.

23. The method of claim 22, wherein the cytokine is stem cell factor.