RU2682762C2 - Improved vector expressing toll-like receptor and agonist, and use in cancer therapy - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, specifically to bicistronic vectors for the expression of toll-like receptors, and can be used in medicine for treating cancer. Bicistronic vector is constructed for expression of a toll-like receptor and its agonist in a mammal, cells of which have a high level of Coxsackie and adenovirus (CAR) receptor expression. Vector contains the first and second nucleic acids and the ubiquitin C promoter operably linked to the second nucleic acid. First nucleic acid encodes a toll-like receptor – TLR5, and the second nucleic acid encodes a toll-like receptor agonist – flagellin.EFFECT: invention provides specific destruction of cancer cells by NF-κB-mediated apoptosis.15 cl, 19 dwg, 6 ex, 3 tbl

Description

FIELD OF THE INVENTION

[0001] The present invention relates to methods for treating cancer.

BACKGROUND OF THE INVENTION

[0002] Toll-like receptors are responsible for recognizing the most common structures of bacterial and viral pathogens. Their activation leads to an increase in the innate and subsequently acquired immune response. Key factors in an effective immune response are cells of the immune system with receptors that recognize the location of antigens. For this reason, immunization involves the use of adjuvants of various types. Despite the expression of tumor-specific antigens in most tumors, they use a number of mechanisms to allow them to avoid immune recognition. Recently, in mouse models, it was demonstrated that as a result of TLR5 activation by its ligand and agonist, i.e. bacterial flagellin, an antitumor effect is induced against those tumors that express functional TLR5. This opens up wide possibilities for the use of TLR5 agonists in cancer immunotherapy. There are two main obstacles to putting this idea into practice. The first of these is the rare occurrence of tumors expressing functional TLR5, which limits the application of this approach to only a small subgroup of tumors. Secondly, systemic administration of a TLR5 agonist leads to activation of TLR5 signaling in all cells that have a functional receptor, which makes the response not focused and not tumor-specific. Therefore, there is a need in the art for a mechanism or method for autocrine activation of TLR signaling in infected or tumor cells with minimal systemic effect and thereby the ability to attract a natural immune response specifically to an infected cell or tumor. There is also a need for improved methods for delivering TLR5 and its ligand to cancer cells.

SUMMARY OF THE INVENTION

[0003] The invention provides a vector containing the first and second nucleic acids. The first nucleic acid can encode a toll-like receptor, and the second nucleic acid can encode a toll-like receptor agonist. The first nucleic acid can also encode the secreted form of the toll-like receptor. The toll-like receptor may be TLR5. The TLR5 sequence may be the sequence of SEQ ID NO: 99.

[0004] A toll-like receptor agonist may be flagellin. Flagellin may be a secreted form of flagellin. The flagellin sequence may be the sequence of SEQ ID NO: 101. Flagellin may also not be glycosylated and may contain the sequence of SEQ ID NO: 102.

[0005] The vector may be an expression vector, which may be a mammalian expression vector. The source of expression of the vector may be an adenovirus, lentivirus or liposome. The vector may contain a promoter of ubiquitin C, which can be operatively linked to a second nucleic acid.

[0006] The invention also provides a method for treating cancer in mammals, which may include administering a vector-containing agent to a mammal in need thereof. Cancer cells can be characterized by a high level of expression of the receptor protein of the Coxsackie virus and adenovirus. Cancer can be cancer of the bladder, prostate, small intestine, thyroid gland, testicle, or colon. The cancer may be a tumor. The agent may be administered from outside the tumor. The agent may be administered directly to the tumor. The agent may also be administered in combination with an immunostimulant, which may be growth hormone, prolactin, or vitamin D. Growth hormone may be somatotropin. The agent may be administered in combination with a cytokine, which may be a stem cell factor.

BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1A-1C are schematic maps of adenoviral vectors expressing TLR5, CBLB502 and a combination thereof (TLR5 + CBLB502). The Sseap-502 leader sequence of FIG. 1C is SEQ ID NO: 100.

[0008] FIG. Figure 2 shows the relative tumor volume in mice for several days using tumor cells (A549) transduced as a control vector (without TLR5) or a vector expressing TLR5, and CBLB502 or PBS was received as a treatment for mice for three days.

[0009] FIG. Figure 3 shows the inhibition of tumor growth by introducing an adenovirus containing a vector simultaneously expressing CBLB502 and a toll-like receptor, wherein adenovirus was introduced into the colon carcinoma of CT26 syngeneic mice, and the cis and trans effects of adenoviral vector constructs were examined.

[0010] FIG. 4 shows the domain structure of bacterial flagellin; trace Ca basics, distribution of the hydrophobic core and structure information F41; four different hydrophobic cores that define domains D1, D2a, D2b and D3. All hydrophobic atoms in the side chain are shown with a Ca base. Atoms in the side chain are encoded in different colors: Ala - yellow; Leu, Ilé or Val - in orange; Phe and Tyr — magenta (carbon atoms) and red (oxygen atoms); “C” means the position and region of various structural properties in the amino acid sequence of flagellin. Top to bottom: F41 fragment - in blue; three beta folds in brown; the distribution of the secondary structure with the alpha helix is yellow, the beta structure is green, the beta rotation is magenta; a tick at each 50th remainder - in blue; domains D0, D1, D2 and D3; the area of axial contact between the subunits in the proto-element is blue; highly conserved amino acid sequence in red, variable region in purple; point mutations in F41 that produce elements of various supercoils. The letters below indicate the morphology of mutant elements: L (D107E, R124A, R124S, G426A), L-type line; R (A449V), R-type straight; C (D313Y, A414V, A427V, N433D), curly33.

[0011] FIG. Figure 5 schematically shows the Salmonella flagellin domains, its fragments, and their interaction with TLR5. Dark touches indicate the regions of the flagellin gene used to construct fragments containing A, B, C, A 'and B'.

[0012] FIG. 6 shows flagellin derivatives; domain structure and approximate borders (amino acid coordinates) of individual flagellin derivatives (right). The flagellin gene FliC of the Salmonella dublin strain is encoded in 505 amino acids (aa).

[0013] FIG. 7 shows the nucleotide and amino acid sequences for the following flagellin variants: AA '(SEQ ID NO: 7-8), AB' (SEQ ID NO: 9-10), BA '(SEQ ID NO: 11-12), BB' ( SEQ ID NO: 13-14), CA '(SEQ ID NO: 15-16), CB' (SEQ ID NO: 17-18), A (SEQ ID NO: 19-20), B (SEQ ID NO: 21-22), C (SEQ ID NO: 23-24), GST-A '(SEQ ID NO: 25-26), GST-B' (SEQ ID NO: 27-28), AA'n1-170 ( SEQ ID NO: 29-30), AA'n1-163 (SEQ ID NO: 33-34), AA'n54-170 (SEQ ID NO: 31-32), AA'n54-163 (SEQ ID NO: 335 -36), AB'n1-170 (SEQ ID NO: 37-38), AB'n1-163 (SEQ ID NO: 39-40), AA'n1-129 (SEQ ID NO: 41-42), AA 'n54-129 (SEQ ID NO: 43-44), AB'n1-129 (SEQ ID NO: 45-46), AB'n54-129 (SEQ ID NO: 47-48), AA'n1-100 ( SEQ ID NO: 49-50), AB'n1-100 (SEQ ID NO: 51-52), AA'n1-70 (SEQ ID NO: 53-54) and AB'n1-70 (SEQ ID NO: 55 -56). The leader sequence of pRSETb is indicated in italics (the leader includes Met, which also represents amino acid 1 FliC). The N-terminal constant region is underlined. The linker amino acid sequence is shown in bold. The C-terminal constant region is underlined. GST, if present, is highlighted in bright font.

[0014] FIG. 8A and 8B show a comparison of the conserved N-terminal (FIG. 8A) and C-terminal (FIG. 8B) sequences in 21 species of bacteria. 13 conservative amino acids important for TLR5 activity are highlighted in hatching. Identification numbers of amino acid sequences are indicated in TrEMBL (first letter = Q) or Swiss-Prot (first letter = P). For each of the 21 bacterial species, the N-terminal sequences are SEQ ID NOs: 57-77, respectively, and the C-terminal sequences are SEQ ID NOs: 78-98, respectively.

[0015] FIG. 9 shows the amino acid sequence of a human toll-like receptor 5 (SEQ ID NO: 99).

[0016] FIG. 10 shows the amino acid sequence of one of the variants of flagellin known as CBLB502 (SEQ ID NO: 101) with four glycosylation sites in which asparagine (N) is at positions corresponding to positions 19, 101, 128 and 475 in the sequence of SEQ ID NO: 1 .

[0017] FIG. 11 shows the efficacy of infection with an adenovirus containing a vector coexpressing CBLB502 and a toll-like receptor in cancer cells. In FIG. 11A shows the efficacy of Ad-mCherry infection (second and fourth row fluorescence) determined in the mouse prostate tumor cell line (TRAMP-C2) 24 and 48 hours after infection. At the top of FIG. 11A shows the multiplicity of infection (MOI, number of viral particles per cell). In FIG. 11B shows the expression of CAR in C2 cells (immunofluorescence staining using anti-CAR antibodies).

[0018] FIG. 12 shows CAR expression in healthy and tumor cells of the human prostate. Part of the micropanel of a human prostate tumor (T - tumor, N - samples of healthy prostate tissue) is stained using antibodies to CAR).

[0019] FIG. 13 shows immunofluorescence staining using anti-CAR antibodies. The membrane-bound CAR receptor is indicated by arrows. FIG. 13A - MOSEC (ovarian carcinoma), FIG. 13B - CT26 (colon carcinoma).

[0020] FIG. Figure 14 shows Western blot analysis of MOSEC cells (mouse ovarian carcinoma) infected with adenovirus expressing flagellin and TLR5. In FIG. 14A shows detection with anti-TLR5 antibodies: 1 — uninfected cells, 2 — infected cells. In FIG. 14B shows detection with anti-CBLB502 antibodies: 1 — untreated lysate of infected cells, 2 — lysate of infected cells treated with a mixture of deglycosylation enzymes (obtained from New England Biolabs).

[0021] FIG. 15 schematically shows adenoviral constructs; P - promoter, T - transcription terminator. In FIG. 15A shows the structure of a 1st generation structure called Mobilan.

[0022] FIG. 16 shows the expression of CBLB502 (FIG. 16A) and hTLR5 (FIG. 16B) in HEK293 cells infected with the original Mobilan and its derivatives (FIG. 16B-D).

[0023] FIG. 17 shows the production of CBLB502 by reporter cells treated with Mobilan UbiC-1 and UbiC-2 stock solutions. To detect CBLB502 in HEK293-hTLR5-LacZ cell cultures 15 hours after infection with two Mobilan species, an ELISA capture assay was used. The secreted CBLB502 fraction was measured (Fig. 17A) in cell culture supernatants before adding cell lysis buffer; after lysis, another series of samples was taken for research, which included both secreted and intracellular CBLB502 (Fig. 17B).

[0024] FIG. Figure 18 shows a comparison of Mobilan adenovirus stock solutions by in vitro activation analysis of reporter cells. Two separately prepared Mobilan UbiC-1 and UbiC-2 stock solutions were diluted to obtain identical titers according to their specifications and tested for activation of HEK293-hTLR5-LacZ reporter cells.

[0025] FIG. 19 shows the results of experiments performed on 4T1 subcutaneous grown tumors, on which the indicated test viruses and control substances were injected on day 0 (control buffer, M-Cherry adenovirus expressing fluorescent protein). In FIG. 19A shows the percentage of surviving animals (tumor volume less than 2000 mm ³ ).

DETAILED DESCRIPTION

[0026] The presence of a toll-like receptor, such as toll-like receptor 5 (TLR5), in combination with a toll-like receptor agonist, such as flagellin, results in cis and trans effects involving cells involved in congenital (cis effect) and acquired (trans effect) specific immune response leading to the destruction of cancer cells and pathogen infected cells by NF-κB-mediated apoptosis. The inventors have unexpectedly found that when mammalian cells express an non-glycosylated mutant form of flagellin in combination with TLR5, it exhibits significantly greater specific activity than glycosylated forms of flagellin. The inventors have also found that using the ubiquitin C promoter (UbiC) to stimulate expression of flagellin adenovirus vector or expression of adenovirus vector and flagellin, and TLR5 unexpectedly increases the effectiveness of cancer treatment. In addition, the inventors have found that the combined use of flagellin and TLR5 expressed by an adenoviral vector for the treatment of cancers with a high expression level of the Coxsackie virus receptor and adenovirus (CAR) unexpectedly increases the effectiveness of the treatment.

1. Definitions

[0027] The terminology used in the present invention is intended solely to describe specific embodiments of the invention, and not to limit it. Used in the description and the attached claims, the singular form includes the plural, unless the context clearly dictates otherwise.

[0028] The given numerical ranges in direct form include each intermediate number with a similar degree of accuracy. For example, the range 6-9 includes the numbers 7 and 8 in addition to 6 and 9, and the range 6.0-7.0 includes the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6 5, 6.6, 6.7, 6.8, 6.9 and 7.0.

[0029] The term “administer” may refer to a single dose or multiple doses of any agent.

[0030] The term "analogue" as applied to a peptide or polypeptide may mean a peptide or polypeptide containing one or more non-standard amino acids or other structural varieties of a typical set of amino acids.

[0031] The term "antibody" can mean an antibody of the classes IgG, IgM, IgA, IgD or IgE, or fragments or derivatives thereof, including Fab, F (ab ') 2, Fd and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies and their derivatives. The antibody may be a monoclonal antibody, a polyclonal antibody, an affinity purified antibody, or mixtures thereof, which exhibit sufficient binding specificity for the desired epitope or sequence derived from it. The antibody may also be a chimeric antibody. An antibody can be obtained by attaching one or more chemical, peptide or polypeptide fragments known in the art. The antibody may be conjugated to a chemical moiety.

[0032] The term "derivative" may mean a peptide or polypeptide that differs in anything other than the primary structure (from amino acids and analogs of amino acids). Derivatives may differ by glycosylation - one of the forms of post-translational modification. For example, peptides or polypeptides may exhibit glycosylation profiles due to expression in heterologous systems. Such peptides or polypeptides are derivatives in accordance with the present invention, if they retained at least one type of biological activity. Other derivatives may include hybrid peptides or hybrid polypeptides having a covalently modified N- or C-terminus, pegylated peptides or polypeptides, peptides or polypeptides linked to lipid fragments, alkylated peptides or polypeptides, peptides or polypeptides linked to other peptides, polypeptides or chemicals through an amino acid side chain functional group; and further modifications known in the art.

[0033] The term "fragment" may mean a portion of the parent peptide or polypeptide.

[0034] The term "homologue" may mean a peptide or polypeptide having a common evolutionary precursor.

[0035] The term "leader sequence" can mean a nucleic acid encoding any peptide sequence that is linked to and translates the peptide or polypeptide of interest, allowing the peptide or polypeptide of interest to pass through the eukaryotic cell endoplasmic reticulum and Golgi complexes for extracellular secretion in an appropriate way from the cell membrane. The leader peptide sequence can be isolated from alkaline phosphatase. The leader sequence may have the following DNA sequence: atgctgctgctgctgctgctgctgggcctgaggctacagctctccctgggc.

[0036] The term "liposome" may mean a very small bubble (vesicle) of the same material as the cell membrane. A liposome can be filled with drugs and used to deliver drugs against cancer and other diseases. The liposome may be filled with a vector. The liposomal membrane may consist of phospholipids, which are molecules having a head group and a tail group. The head group of a liposome can have a positive affinity for water, and its tail group, which consists of a long hydrocarbon chain, has a negative affinity for water. Tail groups can be repelled by water and line up to form a surface outside the water. The lipids in the plasma membrane can be mainly phospholipids, such as phosphatidylethanolamine and phosphatidylcholine. Liposomes may consist of naturally occurring phospholipids with mixed lipid chains (such as egg phosphatidylethanolamine) or pure surface-active components such as DOPE (dioleoylphosphatidylethanolamine).

[0037] The term "peptide" or "polypeptide" may mean a linked amino acid sequence, it may be naturally occurring, synthetic, or a modification or combination of a natural and synthetic peptide or polypeptide.

[0038] The term "predominantly identical" may mean that the first and second amino acid sequences consist of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% , 97%, 98% or 99% of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 amino acids.

[0039] Each of the terms “treating,” “treating,” or “treating” may mean alleviating, suppressing, containing, eliminating, preventing, or slowing the onset of symptoms, clinical signs, or underlying pathology of a condition or disease on a temporary or permanent basis. Prevention of a condition or disease includes administering to a subject an agent of the present invention prior to the onset of the disease. Suppressing a condition or disease involves administering to a subject an agent of the present invention after a condition or disease has been excited, but before its clinical manifestation. Suppressing a condition or disease involves administering to a subject an agent of the present invention after the clinical manifestation of the disease.

[0040] The term "variant" may mean a peptide or polypeptide whose amino acid sequence is characterized by the insertion, deletion or conservative substitution of amino acids, but which retains the biological activity of at least one type. Typical examples of “biological activity” include the ability to bind a toll-like receptor and be bound by a specific antibody. A variant may also mean a protein whose amino acid sequence is predominantly identical to the original protein, the amino acid sequence of which retains the biological activity of at least one type. It is generally accepted that a conservative substitution of an amino acid, i.e., replacing an amino acid with another amino acid with identical properties (for example, hydrophilicity, degree and distribution of charged regions) usually involves a slight change. These minor changes can be identified based in part on the hydrophobicity index of amino acids, as is known in the art (see Kyte et al., J. Mol. Biol. 157: 105-132 (1982). The hydrophobicity index of an amino acid is based on its estimated hydrophobicity and charge It is known from the technique that amino acids with similar hydrophobicity indices can be substituted and retain protein function. According to one of the features, amino acids having a hydrophobicity index of ± 2 are substituted. The hydrophilicity of amino acids can also be used to detect Substitutions that lead to the preservation of biological function by proteins. Taking into account the hydrophilicity of amino acids in relation to a peptide allows us to calculate the highest average local hydrophilicity of such a peptide, which is a useful indicator that is known to correlate well with antigenicity and immunogenicity (see US Pat. No. 4,554,101, in order references wholly incorporated into the present application.) Substitution of amino acids having similar hydrophilicity indices may result in peptides retaining their biological activity by example, immunogenicity, as is well known in the art. Substitutions can be carried out by amino acids having hydrophilicity indices with a deviation within ± 2 from each other. Both the hydrophobicity index and the hydrophilicity index of amino acids are influenced by the specific side chain of such an amino acid. In accordance with this observation, it is assumed that amino acid substitutions that are compatible with biological function depend on the relative similarity of amino acids, in particular, the side chains of these amino acids, which is identified on the basis of hydrophobicity, hydrophilicity, charge, size, and other properties.

[0041] The term "vector" may mean a nucleic acid sequence containing a replication source. The vector may be a mammalian plasmid, yeast, or artificial chromosome. The vector may be an RNA or DNA vector. The vector can be either a self-replicating extrachromosomal vector, or a vector that integrates into the host genome.

3. Toll-like receptor

[0042] The invention provides a toll-like receptor (TLR), which may be one of the types of pattern recognition receptor (PRR). The Toll-like receptor can recognize molecules that are conservative molecular products isolated from pathogens that include gram-positive, gram-negative bacteria, fungi and viruses, but are distinguishable from the host molecules and are collectively referred to as the molecular structure associated with the pathogen (RAMP, from English - pathogen-associated molecular patterns). A toll-like receptor can also recognize endogenous molecules that are released from damaged or dying cells and are collectively referred to as the damage-associated molecular pattern (DAMP). PAMP or DAMP may be a toll-like receptor agonist, as further described below. A toll-like receptor can be a fragment, variant, analog, homolog or derivative that attracts adapter molecules within the cytoplasm of cells to propagate the signal. The source of the toll-like receptor may be a human or a mammal of another species, such as a rhesus monkey, mouse or rat. The toll-like receptor may be at least 30-99% identical to the toll-like receptor, which attracts adapter molecules in the cytoplasm of cells to propagate the signal.

[0043] The toll-like receptor may be one of 10-15 types of toll-like receptors that are thought to exist in most mammalian species. The toll-like receptor may be one of 13 toll-like receptors (simply called TLR1-TLR13), which are found in both humans and mice, or the equivalent form found in mammals of other species. The Toll-like receptor may be one of 11 TLRs (TLR1-TLR11) found in humans.

[0044] The Toll-like receptor can be expressed by various types of immune cells, and it can be located on the surface of cells or in the cell cytoplasm. Toll-like receptors can express cancer cells. Toll-like receptors can express normal digestive system epithelial cells, normal keratinocytes, pulmonary alveoli and bronchial epithelial cells, as well as female genital tract epithelial cells. These organ lining cells can serve as the first line of defense against invasion of microorganisms, and toll-like receptors expressed by epithelial cells can play a crucial role in the regulation of proliferation and apoptosis.

[0045] An expressing TLR cancer cell may be selected from the following table:

[0046] A toll-like receptor expressed by cancer cells can activate the NF-κB cascade and produce antiapoptotic proteins that promote carcinogenesis and proliferation of cancer cells.

[0047] Four TLR adapter molecules are known to be involved in signal transduction. These proteins are known as myeloid differentiation factor 88 (MyD88), Tirap (also called Mal), Trif, and Tram. The adapter molecules activate other molecules in the cell, including some protein kinases (IRAK1, IRAK4, TBK1 and IKKi), which amplify the signal, which ultimately leads to the induction or suppression of genes that coordinate the inflammatory response. TLR signaling pathways during pathogen recognition can induce immune responses via the extracellular and intracellular pathways via MyD88, NF-κB transcription factor, and mitogen-associated protein kinase (MAPK). When transmitting TLR signals, thousands of genes are activated, and TLRs as a whole form one of the most pleiotropic, but at the same time strictly regulated gene modulation pathways.

[0048] Toll-like receptors, together with interleukin-1 receptors, form the superfamily of receptors, known as the "superfamily of interleukin-1 / toll-like receptors". All members of this superfamily share a common so-called TIR domain (Toll-IL-1 receptor). Three subgroups of TIR domains may exist. Proteins containing the TIR domains of subgroup I are interleukin receptors that are produced by macrophages, monocytes and dendritic cells, all of which have extracellular immunoglobulin (Ig) domains. Proteins containing the TIR domains of subgroup II are classical TLRs and directly or indirectly bind molecules of microbial origin. The third subgroup of proteins containing TIR domains (III) consists of adapter proteins, which are exclusively cytosolic and mediate the transmission of signals from proteins of subgroups 1 and 2. A toll-like receptor can be a fragment, variant, analog, homolog or derivative, which retains the TIR domain of subgroup I, the TIR domain of subgroup II, or the TIR domain of subgroup III.

[0049] A toll-like receptor may act as a dimer. For example, although most Toll-like receptors appear to act as homodimers, TLR2 forms heterodimers with TLR1 or TLR6, with each dimer having a different ligand specificity. The overall sensitivity of the toll-like receptor to the ligand may also depend on other coreceptors, as in the case when TLR4 recognizes lipopolysaccharide (LPS), which requires MD-2. It is known that CD14 and LPS-binding protein (LBP) facilitate the presentation of MD-2 lipopolysaccharide.

a. TLR1

[0050] The Toll-like receptor may be TLR1, which recognizes RAMP and has specificity for gram-positive bacteria. TLR1 is also referred to as CD281.

b. TLR5

[0051] The Toll-like receptor may be TLR5. The protein that encodes TLR5 can play a fundamental role in recognizing pathogens and activating innate immunity. TLR5 can recognize PAMRs that are expressed on infectious agents and mediate the production of cytokines necessary to create effective immunity. TLR5 can recognize bacterial flagellin, which is the main component of bacterial flagella and virulence factor. TLR activation can mobilize the transcription factor NF-κB and stimulate the production of tumor necrosis factor-alpha.

4. TRL agonist

[0052] The present invention also provides a TLR agonist. A TLR agonist may be PAMP, which may be a conserved molecular product isolated from a pathogen. The pathogen may be a gram-positive bacterium, a gram-negative bacterium, a fungus or a virus. The TLR agonist may be a ligand with a molecular structure associated with damage (DAMP), which may be an endogenous molecule released from damaged or dying cells. DAMP or PAMP can initiate an immune response through TLR signals and attract adapter molecules in the cytoplasm of cells to propagate the signal. The TLR agonist may be a ligand from the following Table 2.

[0053] A TLR agonist can be a fragment, variant, analogue, homolog or derivative of PAMP or DAMP that binds TLR and induces TLR-mediated activity, such as activation of the action of NF-κB. A fragment, variant, analogue, homolog or derivative of a TLR agonist can be at least 30-99% identical to the amino acids of a TLR agonist and induce TLR-mediated activity.

[0054] A TLR agonist can target a TLR, such as TLR5. A TLR agonist may be a TLR5 agonist and may stimulate TLR5 activity. The TLR agonist may be an anti-TLR5 antibody or other small molecule. The TLR agonist may be flagellin.

[0055] Flagellin may also be flagellin or a flagellin-associated polypeptide. Flagellin can have any source of origin, including a variety of gram-positive and gram-negative bacteria. Flagellin may be a flagellin-based polypeptide isolated from gram-positive or gram-negative bacteria, including without limitation a flagellin-based polypeptide described in the publication of patent application US 2003/000044429, the contents of which are incorporated by reference in their entirety in the present application. For example, flagellin may have the amino acid sequence of bacteria shown in FIG. 7 publication of patent application US 2003/0044429. The nucleotide sequences encoding flagellin-based polypeptides as shown in FIG. 7 publication of patent application US 2003/0044429, are freely available in sources such as the Genbank database of the National Center for Biotechnological Information (NCBI). Flagellin may also be a flagellin-based peptide corresponding to the identification number indicated in the BLAST results in FIG. 25 publication of patent application US 2003/000044429, or a variant thereof. Flagellin may also be a flagellin-based polypeptide described in the publication of US patent application US 2009/0011982, the contents of which are incorporated by reference in their entirety into the present application. Flagellin may be any of the flagellin-based polypeptides of FIG. 6 and 7 from the description of the present invention.

[0056] Flagellin may be a fragment, variant, analogue, homolog, or flagellin derivative that binds TLR5 and induces TLR5-mediated activity, such as activation of the action of NF-κB. A fragment, variant, analog, homolog or derivative of flagellin may be at least 30-99% identical to the amino acids of flagellin, which binds TLR5 and induces TLR5-mediated activity.

[0057] Flagellin may be from one of the species of Salmonella bacteria, one of the typical examples of which is S.dublin (identification number M84972 in GenBank). The flagellin-associated polypeptide may be a fragment, variant, analog, homolog or derivative of flagellin M84972 or a combination thereof that binds TLR5 and induces TLR5-mediated activity, such as activation of the action of NF-κB. A fragment, variant, analog, homolog or derivative of flagellin can be obtained by constructive development based on the domain structure of flagellin and the conservative structure recognized by TLR5.

[0058] Flagellin may contain at least 10, 11, 12, or 13 of the 13 conservative amino acids shown in FIG. 5 (positions 89, 90, 91, 95, 98, 101, 115, 422, 423, 426, 431, 436 and 452). Flagellin may be at least 30-99% identical to amino acids 1-174 and 418-505 of flagellin M84972. In FIG. 26 of the publication of US patent application US 2009/0011982, the entire contents of which are incorporated into this application, shows the percent identity of the amino terminus and the carboxy terminus of flagellin with the known TLR5 stimulating activity and flagellin M84972.

[0059] Flagellin may be a major component of a bacterial flagellum. Flagellin may consist of three domains (Fig. 4). Domain 1 (D1) and domain 2 (D2) may not be continuous and may form when residues at the amino end and carboxy end come into contact when a hairpin-like structure forms. The amino end and carboxy end containing the D1 and D2 domains may be the most conserved, while the median hypervariable region (D3) can be highly variable. Studies of a recombinant protein containing the D1 and D2 domains at the amino end and the D1 and D2 domains at the carboxy end separated by a hinge from Escherichia coli (ND1-2 / ECH / CD2) show that D1 and D2 can exhibit bioactivity upon linkage in element of the unified social tax. This chimera, and not the hinge per se, can induce IkBa degradation, NF-κB activation, and NO and IL-8 production in two intestinal epithelial cell lines. The non-conservative D3 domain may be present on the surface of the flagellum filament and may contain large antigenic epitopes. The highly conserved N- and C-ends containing D1 and D2 may exhibit potent anti-inflammatory activity of flagellin (see Fig. 4).

[0060] Flagellin can induce NF-κB activity by binding toll-like receptor 5 (TLR5). TLR can recognize the conservative structure that is characteristic of flagellin. A conservative structure can form a large group of residues, to some extent allowing changes in the content of amino acids. In the work of Smith et al., Nat Immunol. 4: 1247-53 (2003), the contents of which are incorporated by reference into this application, 13 conservative amino acids that are part of the conservative structure recognized by TLR5 are identified in flagellin. In FIG. Figure 5 shows 13 conservative flagellin amino acids that may be important for stimulating TLR5 activity.

[0061] Numerous deletion flagellin mutants have been created that retain at least a portion of TLR5 stimulating activity. Flagellin may be such a deletion mutant, in particular, a deletion mutant described in the Examples of the present invention. Flagellin may contain a sequence translated from a sequence under identification number D13689 in GenBank by deletion of amino acids 185-306 or 444-492, or a sequence translated from a sequence under identification number M84973 in GenBank by deletion of amino acids 179-415, or a variant thereof.

[0062] Flagellin may contain transposon insertions and changes in the D3 variable domain. The D3 domain can be partially or completely replaced by a hinge or linker polypeptide, which allows the D1 and D2 domains to fold properly in order to stimulate TLR5 activity. Variants of the hinge element can be found in the E. coli MukB protein, and they may have a sequence such as SEQ ID NOS: 3 and 4 or a variant thereof.

[0063] The flagellin described above may further comprise a leader sequence. Flagellin further comprising a leader sequence may be CBLB502 (SEQ ID NO: 101).

[0064] Flagellin may also have a reduced level of glycosylation or may not be glycosylated, and may also contain a mutation at the glycosylation site, which may enhance the specific activity of flagellin. The glycosylation site may contain the amino acid sequence of NKS, NGT, NQT or NMS. The mutation may be an asparagine (N) residue at a glycosylation site that has mutated into a different residue. The mutation at the glycosylation site can be located at positions N19, N101, N128 or N475 of the flagellin sequence of SEQ ID NO: 1. The N-residue can be replaced by any other amino acid, including alanine, proline or glutamine. In particular, flagellin may contain an N mutation in Q at the glycosylation site. Flagellin may contain the sequence of SEQ ID NO: 102, which is the same as in FIG. 10, except that the N-residues that are located at the circle of the predicted glycosylation sites at positions equivalent to positions 19, 101, 128 and 475 of the sequence SEQ ID NO: 1 are changed to Q.

5. Means

[0065] The present invention also relates to an agent comprising a therapeutically effective amount of a TLR and a TLR agonist. The agent may deliver the TLR separately from the TLR agonist. The tool may be a vector. The vector may comprise a first nucleic acid encoding a TLR and a second nucleic acid representing a TLR agonist. A vector may be able to transform mammalian cells.

[0066] A vector may be capable of bicistronic expression of a TLR and / or a TLR agonist due to the fact that a TLR and / or TLR agonist is capable of operatively binding a strong promoter. A vector may contain only a gene encoding a TLR, which may be able to operatively bind a strong promoter. The promoter may be a ubiquitin C promoter (UbiC), a cytomegalovirus (CMV) promoter, or a translation elongation factor 1 alpha promoter (EF1A). The UbiC promoter may have the sequence contained in pDSL_hpUGIH (ID 10326379 in the American Type Culture Collection). A vector can be delivered to a mammalian cell by a virus or liposome vector system. The vector system of the virus may be an adenovirus or cytomegalovirus.

[0067] The agent may be a liposome that contains a vector. A liposome may be able to transform mammalian cells and deliver a vector for expression.

[0068] The agent may be a drug composition that simultaneously induces expression and activates TLR, thereby exposing tumor or infected cells to the host immune system, which mimics the situation of mass penetration through the intestinal wall. The agent may be a drug composition that expresses a TLR in combination with a TLR agonist and can be systemically delivered in a solution for administration, such as intramuscular administration. The agent may be a drug composition that expresses TLRs in combination with a TLR agonist that can be expressed by the same vector, such as an adenovirus or cytomegalovirus vector system. The agent may be a drug composition that expresses a TLR in combination with a nanoparticle TLR agonist that can transfer a functional agonist to the surface of a mammalian cell.

[0069] The agent may be a pharmaceutical agent containing the above-described drug composition, which can be manufactured by methods well known in the art. The tool may also contain a concomitant agent.

[0070] The vector may comprise a first nucleic acid encoding TLR5 and a second nucleic acid representing flagellin. The vector may be capable of expressing TLR5 and / or flagellin using a strong promoter. The expression vector may further comprise a leader sequence cloned to a gene encoding TLR or TLR5 and / or flagellin. The expression vector may be a pCD515-based vector system. The expression vector may be pCD515-CMV-hTLR5-EF1-502 shown in FIG. 1A. The expression vector may be pCD515-CMV-hTLR5 shown in FIG. 1B. The expression vector may be pCD515-CMV-Sseap-502 shown in FIG. 1C.

[0071] The expression vector may comprise a sequence encoding a TLR and a TLR agonist in the same open reading frame, whereby TLR and a TLR agonist are expressed as a hybrid translation vector. Sequences encoding a TLR and a TLR agonist can be separated by a self-cleaving peptide 2a and a furin protease site to remove in vivo peptide 2a at the C-terminus of a TLR agonist, as described by Fang J et al., 2005, Nat Biotechnol .; 23 (5): 584-90, the contents of which are hereby incorporated by reference. The expression vector may comprise a TLR and a TLR agonist in the same open reading frame, as shown in FIG. 15D.

[0072] The agent may be a dosage form that simultaneously induces expression and activates TLR, thereby exposing tumor or infected cells to the host immune system, which mimics the situation of mass penetration through the intestinal wall. The dosage form may be in the form of a viral expression system containing a vector. The dosage form may be a functional adenovirus expressed by human TLR5 in combination:

[0073] with a TLR agonist systemically delivered in an administration solution, such as intramuscular administration;

[0074] with a TLR agonist expressed by the same adenoviral vector as the TLR, or

[0075] with a TLR agonist expressed in the form of nanoparticles bearing on their surface a functional TLR agonist, such as flagellin, which can be isolated from CBLB502. The basis of the nanoparticles can be a T7 bacteriophage, or they can completely retain their biological activity. The nanoparticle composition may provide a dose-dependent, NF-κB susceptible activation of the reporter gene and may lead to internalization of cells by endocytosis for effective immunization (Mobian AP-A).

but. Product Introduction

[0076] The administration of the agents described in the invention can be carried out orally, parenterally, sublingually, transdermally, rectally, through the mucous membrane, topically, by inhalation, buccally or by a combination of the above. Parenteral administration includes, without limitation, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intrathecal and intraarticular administration. For veterinary use, the agent may be administered in the form of an acceptable composition in accordance with accepted veterinary practice. The veterinarian can easily determine the dosage and route of administration that is most suitable for a particular animal. The agents may be administered to humans, cats, dogs, large animals or birds.

[0077] The agent may be administered simultaneously with other therapies or periodically in antiphase with other therapies. The term “simultaneous” or “simultaneously” as used means that the agent and other therapy are administered at intervals of 48 hours, preferably 24 hours, more preferably 12 hours, even more preferably 6 hours, most preferably 3 hours or less. Used the term "periodically in antiphase" means the introduction of funds at moments different from the moments of application of other therapy, and with a certain repetitive frequency.

[0078] The agent may be administered at any time prior to other therapy, including approximately 120 hours, 118 hours, 116 hours, 114 hours, 112 hours, 110 hours, 108 hours, 106 hours, 104 hours, 102 hours, 100 hours, 98 hours, 96 hours, 94 hours, 92 hours, 90 hours, 88 hours, 86 hours, 84 hours, 82 hours, 80 hours, 78 hours, 76 hours, 74 hours, 72 hours, 70 hours, 68 hours, 66 hours, 64 hours, 62 hours, 60 hours, 58 hours, 56 hours, 54 hours, 52 hours, 50 hours, 48 hours, 46 hours, 44 hours, 42 hours, 40 hours, 38 hours, 36 hours, 34 hours , 32 hours, 30 hours, 28 hours, 26 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 3 hours, 2 hours, 1 hour, 55 minutes, 50 minutes, 45 minutes, 40 minutes, 35 minutes, 30 minutes, 25 minutes, 20 minutes, 15 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes and 1 minute. The tool can be administered at any time prior to the second therapy, including approximately 120 hours, 118 hours, 116 hours, 114 hours, 112 hours, 110 hours, 108 hours, 106 hours, 104 hours, 102 hours, 100 hours, 98 hours, 96 hours, 94 hours, 92 hours, 90 hours, 88 hours, 86 hours, 84 hours, 82 hours, 80 hours, 78 hours, 76 hours, 74 hours, 72 hours, 70 hours, 68 hours, 66 hours, 64 hours, 62 hours, 60 hours, 58 hours, 56 hours, 54 hours, 52 hours, 50 hours, 48 hours, 46 hours, 44 hours, 42 hours, 40 hours, 38 hours, 36 hours, 34 hours, 32 hours , 30 hours, 28 hours, 26 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 3 hours, 2 hours, 1 hour, 55 minutes, 50 minutes, 45 minutes, 40 minutes, 35 minutes, 30 minutes, 25 minutes, 20 minutes, 15 minutes, 10 minutes, 9 minutes, 8 minutes , 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes and 1 minute.

[0079] The agent may be administered at any time after another therapy, including after about 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes , 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, 24 hours, 26 hours, 28 hours, 30 hours, 32 hours, 34 hours, 36 hours, 38 hours, 40 hours, 42 hours, 44 hours, 46 hours, 48 hours, 50 hours, 52 hours, 54 hours, 56 hours, 58 hours, 60 hours, 62 hours, 64 hours, 66 hours, 68 hours, 70 hours, 72 hours, 74 asa, 76 hours, 78 hours, 80 hours, 82 hours, 84 hours, 86 hours, 88 hours, 90 hours, 92 hours, 94 hours, 96 hours, 98 hours, 100 hours, 102 hours, 104 hours, 106 hours, 108 hours, 110 hours, 112 hours, 114 hours, 116 hours, 118 hours and 120 hours. The agent can be administered at any time after the second therapy, including after approximately 120 hours, 118 hours, 116 hours, 114 hours, 112 hours, 110 hours, 108 hours, 106 hours, 104 hours, 102 hours, 100 hours, 98 hours , 96 hours, 94 hours, 92 hours, 90 hours, 88 hours, 86 hours, 84 hours, 82 hours, 80 hours, 78 hours, 76 hours, 74 hours, 72 hours, 70 hours, 68 hours, 66 hours, 64 hours, 62 hours, 60 hours, 58 hours, 56 hours, 54 hours, 52 hours, 50 hours, 48 hours, 46 hours, 44 hours, 42 hours, 40 hours, 38 hours, 36 hours, 34 hours, 32 hours, 30 hours, 28 hours, 26 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours owls, 4 hours, 3 hours, 2 hours, 1 hour, 55 minutes, 50 minutes, 45 minutes, 40 minutes, 35 minutes, 30 minutes, 25 minutes, 20 minutes, 15 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes and 1 minute.

b. Structure

[0080] The method may comprise administering an agent. The agents of the present invention may be in the form of tablets or lozenges having a conventionally formulated composition. For example, tablets and capsules for oral administration may contain conventional excipients, such as binders, excipients, lubricants, disintegrants and moisturizers. Binders include, but are not limited to, syrup, gum arabic, gelatin, sorbitol, tragacanth, starch gum and polyvinylpyrrolidone. Excipients may be lactose, sugar, microcrystalline cellulose, corn starch, calcium phosphate and sorbitol. Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silicon dioxide. Disintegrants may include potato starch and sodium starch glycolate. The humidifier may be sodium lauryl sulfate. The tablets may be coated by methods well known in the art.

[0081] The agents of the present invention may also be in the form of liquid formulations, such as aqueous or oily suspensions, solutions, emulsions, syrups and elixirs. The agents may also be in the form of a dry product for reconstitution with water or another suitable vehicle before use. Such liquid preparations may contain additives such as suspending agents, emulsifiers, non-aqueous vehicles and preservatives. The suspending agent may be sorbitol syrup, methyl cellulose, glucose / sugar syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, gelled aluminum stearate and hydrogenated edible fats. Emulsifiers can be lecithin, sorbitan monooleate and Arabian gum. Non-aqueous vehicles may be edible fats, almond oil, fractionated coconut oil, ester oils, propylene glycol and ethyl alcohol. Preservatives may be methyl or propyl p-hydroxybenzoate and sorbic acid.

[0082] The agents of the present invention may also be in the form of suppositories, which may contain a base such as coconut oil or glycerides. The agents of the present invention may also be in the form of an inhalation composition, which is a solution, suspension or emulsion that can be administered as a dry powder or aerosol using a compressed medium such as dichlorodifluoromethane or trichlorofluoromethane. The agents of the present invention may also be in the form of transdermal formulations containing aqueous or non-aqueous carriers, such as creams, ointments, lotions, pastes, a drug-containing patch, dressing or coating.

[0083] The agents of the present invention may also be in the form of compositions for parenteral administration, such as by injection, intratumoral injection, or continuous infusion. Formulations for injection may be in the form of suspensions, solutions or emulsions in oily or aqueous vehicles and may contain substances including, without limitation, suspending, stabilizing and dispersing substances. The agent may also be in powder form for reconstitution with an acceptable vehicle, including, but not limited to, sterile pyrogen-free water.

[0084] The agents of the present invention may also be in the form of a depot preparation that can be administered by implantation or intramuscular injection. The composition of the funds may include applicable polymeric or hydrophobic materials (such as, for example, an emulsion in an acceptable oil), ion-exchange resins, or sparingly soluble derivatives (such as, for example, a sparingly soluble salt).

from. Dosage

[0085] The method may include administering a therapeutically effective amount of the drug to a patient in need thereof. The therapeutically effective amount required for use in therapy varies depending on the nature of the corresponding condition, the time desired to activate the TLR, and the patient's age / condition. However, usually the doses used to treat adult patients range from 0.001 mg / kg to about 200 mg / kg per day. The dose may be from about 1 mg / kg to about 100 mg / kg per day. The desired dose may conveniently be administered once as a whole or divided into several administrations at appropriate intervals, for example, by breaking the dose into two, three, four or more doses per day. Repeated administration may be desirable or necessary.

[0086] Any dosage is possible, for example, about 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 25 mg / kg, 50 mg / kg, 75 mg / kg, 100 mg / kg, 125 mg / kg , 150 mg / kg, 175 mg / kg, 200 mg / kg, 225 mg / kg, 250 mg / kg, 275 mg / kg, 300 mg / kg, 325 mg / kg, 350 mg / kg, 375 mg / kg , 400 mg / kg, 425 mg / kg, 450 mg / kg, 475 mg / kg, 500 mg / kg, 525 mg / kg, 550 mg / kg, 575 mg / kg, 600 mg / kg, 625 mg / kg , 650 mg / kg, 675 mg / kg, 700 mg / kg, 725 mg / kg, 750 mg / kg, 775 mg / kg, 800 mg / kg, 825 mg / kg, 850 mg / kg, 875 mg / kg , 900 mg / kg, 925 mg / kg, 950 mg / kg, 975 mg / kg or 1 mg / kg.

7. A method of treating cancer

[0087] The invention provides a method for treating cancer by administering an agent to a mammal in need thereof. The method provides for cancer immunotherapy by ensuring the transition of tumor cells to a TLR agonist-susceptible state through targeted intratumoral TLR stimulation, thereby concentrating the immune response to tumors. The method can be used to treat primary tumors before surgical removal in order to reduce the risk of developing metastases, as well as treat other tumor nodules. The method may include intratumoral injection. The method may include the step of injecting the agent into the primary tumor before surgical removal in order to reduce the risk of developing metastases, as well as treating other tumor nodules. The method can be used to treat any tumor available for intratumoral injection of adenovirus.

[0088] According to the present invention, it is possible to treat various types of cancer, including carcinoma, bladder cancer (including rapidly progressive and metastatic cancer of the bladder), breast, colon (including colorectal cancer), kidney, liver, lung ( including small cell and non-small cell lung cancer and pulmonary adenocarcinoma), ovaries, prostate, testes, genital tract, lymphatic system, rectum, larynx, pancreas (including exocrine pancreatic carcinoma); esophagus, stomach, gall bladder, cervix, thyroid gland and skin (including squamous cell carcinoma); hematopoietic tumors of the lymphoid membrane, including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkins lymphoma, non-Hodgkin lymphoma, hairy cell lymphoma, histiocytic lymphoma and Burkets lymphoma; hematopoietic tumors of the myeloid line, acute and chronic myelogenous leukemias, myelodysplastic syndrome, myeloid leukemia and promyelocytic leukemia, tumors of the central and peripheral nervous system, including astrocytoma, neuroblastoma, glioma and schwannoma; tumors of mesenchymal origin, including fibrosarcoma, rhabdomyosarcoma and osteosarcoma, and other tumors, including melanoma, xeroderma pigmentosa, keratoactantoma, seminoma, follicular thyroid cancer, teratocarcinoma and gastrointestinal or abdominal cancers.

[0089] Cancer can be characterized by a high level of expression of the CAR protein in the shells of cancer cells. High levels can be high compared to cancers of the hematopoietic system, soft tissues, skin, head and neck, brain, cervix, breast and esophagus, at which CAR expression levels may be low. High levels can also be high compared to cancer of the lung, ovary, stomach, kidney, melanoma, liver, endocrine system, and mesothelioma. A high level may be at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times the level of CAR expression in NCI-H1437, NCI-H2122, or CT26 cells. Cancer can be cancer of the bladder, prostate, small intestine, thyroid gland, testicle, or colon.

[0090] In cancer with a high level of CAR expression, there may be a higher efficacy of the agent if it contains a viral expression vector such as an adenovirus. As a result, the multiplicity of infection of cancer cells with the viral agent described in the invention can be at least 100 or 1000 times higher in cancer cells with a high level of CAR expression than cancer cells with a low level of CAR expression, due to which in cancer cells with a high level of expression of CAR can be used less effective amount of funds. An effective amount of the viral agent may be less than about 109, 108, 107, 106 or 105 viral particles.

[0091] The method may be combined with other methods of treating cancer, including the use of an immunostimulant, cytokine, or chemotherapy. The immunostimulant may be growth hormone, prolactin, or vitamin D.

2. Treatment of infected cells

[0092] The present invention provides a method for treating an infectious disease by simultaneously delivering transduced cells with the agent of the invention. The method can be used to treat a viral, bacterial infection, infection caused by protozoan parasites or fungi. The method can be used to treat any infectious disease by intracellular injection, which leads to autocrine activation of the transmission of TLR signals of infected cells with minimal systemic effect, thereby stimulating an innate immune response specific for infected cells. The method can be combined with other therapies for the treatment of viral, bacterial infections, infections caused by protozoan parasites or fungi.

[0093] The method may include administering an agent. The method may include administering a vaccine containing the agent, and may be used in combination with vaccination with any other vaccines that may contain a construct expressing the selected antigen.

Example 1

Synthesis of bicistronic expressing TLR5 / flagellin vector and treatment of tumor cells

[0094] Vector constructs have been created for the expression of toll-like receptor 5 (TLR5) and flagellin CBLB502. The pCD515 vector was used as the main chain of these constructs. Separately, the human TLR5 cDNA sequence was hybridized with DNA encoding the toll-like receptor CBLB502 agonist with a leader peptide isolated from alkaline phosphatase, which allowed directing the expressed protein through the endoplasmic reticulum (ER) and Golgi complexes for extracellular secretion.

[0095] The pCD515-CMV-hTLR5-EF1-502s vector construct expressed the secreted flagellin form of CBLB502 (CBLB502) and toll-like receptor 5 (TLR5) on the cell surface. To achieve effective synthesis and secretion of this adenoviral vector by mammalian cells, a modification of CBLB502 was required. The adenovirus construct had a leader nucleic acid sequence (Atgctgctgctgctgctgctgctgggcctgaggctacagctctccctgggc) (SEQ ID NO: 100) isolated from alkaline phosphatase and was cloned to the truncated Salmonella flagellin (fliC) gene (see Burdelya, 22, 22-230, etc. 2008) to encode the secreted form of flagellin (i.e. CBLB502). The EF1 promoter (elongation factor 1a) was cloned to that cassette encoding CBLB502. The TLR5 gene that has the amino acid sequence shown in Fig. 9 (SEQ ID NO: 99). Cloned p CMV romotor in position up to the TLR5 gene.This construct, which simultaneously expresses TLR5 and CBLB502, is shown in Fig. 1A.

[0096] The expression vector pCD515-CMV-hTLR5 was constructed to express human TLR5 (see FIG. 9). The adenovirus construct contained a strong CMV promoter cloned up to the hTLR5 cassette. This construction is shown in FIG. 1B.

[0097] A pCD515-CMV-Sseap-502 expression vector was constructed to express CBLB502 secreted flagellin and a toll-like receptor. The adenovirus construct contained a strong CMV promoter cloned to the leader sequence SEAP 502 of the flagellin gene (fliC). This construction is shown in FIG. 1C.

Example 2

Synthesis of bicistronic expressing TLR5 / flagellin vector and treatment of tumor cells

[0098] Two mammalian cell reporter lines were transduced that expressed NF-κB susceptible GFP and differed in their TLR5 status, vector constructs pCD515, pCD515-CMV-hTLR5-EF1-502s, pCD515-CMV-hTLR5-502, pCD515- CMV-hTLR5 and pCD515-CMV-Sseap-502 (see Table 3 below).

Table 3. Activity of adenovirus constructs as TLR5 mediated signaling activators

The activity of adenoviral constructs as signaling activators TLR5

[0099] A vector simultaneously expressing TLR5 and a CBLB502 TLR5 agonist was sufficient to induce expression of an NF-κB reporter in a 293-null cell line that does not express any of the known TLRs and cannot be activated only by a TLR5 agonist. This experiment shows that TLR5 and flagellin CBLB502 can activate the TLR5 signaling pathway in both trans and cis positions.

Example 3

[0100] In order to test the antitumor effects of a bicistronic adenovirus containing the pCD515-CMV-hTLR5-EF1-502s vector construct, Balb / c mice were injected with 10 ml of adenovirus suspension (1012-1011 IU / ml) in one of the two syngeneic tumors, subcutaneously grown from colon carcinoma cells of CT26 mice when the tumors reached 3-5 mm in diameter, and the size of the tumors was monitored until the control tumors without injection reached the maximum size requiring termination of the experiment. Adenovirus vector expressing red fluorescent protein (RFP) was injected into the colon of mice (and in this case, into one of two tumors in each mouse). In FIG. 4 presents the results of one of the typical experiments. In the same animal, there was an almost complete absence of tumor growth into which pCD515-CMV-hTLR5-EF1-502s was introduced, and a decrease in tumor growth without administration compared to tumors in control animals injected with RFP expressing adenovirus. This result demonstrates (i) a powerful effect in the cis position and (ii) a noticeable effect in the trans position pCD515-CMV-hTLR5-EF1-502s, which is a sign of strengthening both innate (cis effect) and acquired (trans effect) of the immune response. None of the other control viruses listed in Table 1 (i.e., AD5 (control) and Ad5 (TLR5)), administered alone, had a growth inhibitory effect on the tumor.

[0101] Thus, forced ectopic expression of TLR5 gives various types of tumor cells with an initial TLR5 deficiency a high susceptibility to stimulation of TLR5, which leads to impaired immunological tolerance of the tumor, a powerful stimulation of the innate immune response, which contributes to the effective development of the acquired immune response with subsequent general antitumor effect.

Example 4

The effect of CAR expression levels on the efficiency of expression of an adenoviral vector in cancer cells

[0102] This example demonstrates higher efficacy in treating tumors with higher levels of CAR expression by an adenovirus containing a vector expressing both flagellin and TLR5. For effective infection of serotype 5 adenovirus and its derivatives, such as an adenovirus containing a vector expressing both flagellin and TLR5, membrane expression of the Coxsackie virus receptor and adenovirus (CAR) is required. It is known that in several types of tumors (for example, melanoma and rhabdomyosarcoma), the level of CAR expression decreases as they develop, whereas in the case of estrogen-dependent breast cancer, the opposite situation is observed. A set of mouse and human tumor cell lines was used, and the correlation of high levels of CAR expression (by staining with anti-CAR antibodies) was determined by measuring the efficiency of infection with Ad-mCherry adenovirus (control adenovirus expressing mCherry fluorescent protein). This was done by counting the number of cells that respond positively to red fluorescence under a microscope or by FACS analysis. Cells were infected with Ad-mCherry adenovirus with varying degrees of infection multiplicity (MOI), and infection efficiency was analyzed at different time points. From CAR-positive mouse cells, strong expression of membrane CAR was detected by ovarian cancer cells (MOSEC), breast cancer (4T1, LM3) and prostate cancer (TRAMP-C2), which could be effectively infected with Ad-mCherry adenovirus (Fig. 11) .

[0103] To determine the types of human tumors that express CAR, stained with anti-CAR antibodies tumor tissue arrays consisting of samples of tumors of different tissue origin and healthy tissues (Roswell Park Pathology Core). The initial analysis of CAR expression in tumors showed that the tested tumors can be divided into three categories: (I) low levels of CAR expression (hematopoietic system, soft tissues, skin, head and neck, brain, cervix, mammary gland, esophagus; (II ) with a high level of CAR expression: (bladder, prostate cancer, small intestine, thyroid gland, testes, colon) and (III) with an average level of CAR expression (lungs, ovary, stomach, kidneys, melanoma, liver, endocrine system, mesothelioma). Accordingly, they were stained with anti-CAR antibodies specific arrays of prostate tumor tissue (consisting of 134 samples of a prostate tumor, 134 samples of a healthy prostate and 68 samples of healthy tissue). 90% of prostate tumors (as well as healthy prostate tissue) were CAR-positive (Fig. 12).

[0104] The efficacy of adenovirus infection, accompanied by higher expression of CAR, on prostate cells was confirmed. The antitumor effect of an adenovirus containing a vector expressing both flagellin and TLR5 was observed in CT26 colon carcinoma cells only when a high dose of the virus (3 × 1010 virus particles, hf) was introduced into the CT26 tumor, while at lower doses ( 5 × 109 hf) no significant effect was observed. This is probably due to insufficient functional expression of CAR by CT26 cells. In fact, CAR expression is significantly lower on the surface of CT26 cells than in MOSEC cells (Fig. 13). In addition, infection of CT26 cells with Ad-mCherry adenovirus and detection of mCherry expression (not shown) required a 100-1000 times higher level of infection multiplicity than in the case of MOSEC cells. Testing of additional cell lines confirmed that, despite the bright cytoplasmic staining of the cells of all the tested lines with anti-CAR antibodies, the staining of membrane-associated CARs correlated well with the ability to infect cells with adenovirus with lesser multiplicity of infection (MOI).

[0105] Thus, prostate tumors, as well as other tumors with high levels of CAR expression, are good candidates for the treatment of adenovirus containing a vector expressing both flagellin and TLR5.

Example 5

Flagellin glycosylation affects the effectiveness of the combination of flagellin and TLR5 for cancer treatment

[0106] This example demonstrates that glycosylated flagellin has less activity in mammalian cells than non-glycosylated flagellin. To assess the expression level of both TLR5 and CBLB502 in Mobilan infected MOSEC cells, Western blot analysis was used (Fig. 14). This analysis confirmed the expression of both proteins (Fig. 14), although the overall expression level was not very high (not shown in comparison with standard protein signals according to Western blot analysis). Both in lysates of infected cells (Fig. 14B) and in nutrient media (not shown), CBLB502 was detected, which confirms its secretion, which is supposedly necessary for signal transmission, since the TLR5 region involved in flagellin binding is located in its extracellular domain . However, the observed size of CBLB502 in both lysates and culture media was at least 6-7 kDa greater than expected. By observing a corresponding shift in the mobility of the CBLB502 gel after treatment of the lysates with marketed glycosylating enzymes (Fig. 14B), this was demonstrated to be a consequence of glycosylation. Glycosylation of flagellins can explain the observed relatively low specific biological activity of flagellin produced in MOSEC cells infected with adenovirus expressing both flagellin and TLR5. In fact, according to the combined ELISA and signaling bioassay analysis (using HEK293-hTLR5-LacZ reporter cells), which are two standard analyzes specific for flagellin, the specific activity of CBLB502 secreted by MOSEC cells was approximately 50 less than the activity bacteria-produced control standard CBLB502. By analyzing the amino acid sequence of flagellin, the presence of four eukaryotic N-linked glycosylation sites was predicted (Fig. 10). It is noteworthy that since one of these sites is located on a site participating in the interface of the primary level of interaction of TLRS-flagellin, it can reduce the affinity and activity of flagellin.

Example 6

Promoters affect the effectiveness of adenovirus expressing flagellin and TLR5

[0107] This example shows that expression of flagellin with an adenoviral vector using the UbiC promoter increases the effectiveness of cancer treatment using adenovirus expressing flagellin and TLR5. A number of modifications were introduced into the adenoviral construct encoding both TLR5 and flagellin (called Mobilan and shown in Fig. 15A) in order to optimize the expression level, secretion efficiency, stability and biological activity of both components of the CBLB502-TLR5 signaling complex. First, they tested in the created constructs on diagnostic cell lines, and then on mouse tumor models.

[0108] In order to prevent the glycosylation of CBLB502 (shown in Fig. 10), which is expressed in mammalian cells, corresponding mutations were introduced into its nucleotide sequence to replace glutamines with four asparagine residues at the identified potential glycosylation sites (all sites mutated simultaneously). The mutant protein was named CBLB502NQs (Fig. 15) (SEQ ID NO: 102). His-tagged mutant proteins were produced in E. coli, purified and tested for specific biological activity in comparison with the original CBLB502 by cell analysis of biological samples (measuring NF-κB-dependent expression of the reporter). The modified coding sequence for expression in human cells was optimized, synthesized (optional in GenScript) and used to create new versions of the Mobilan vector.

[0109] In addition to modifying the CBLB502 component of Mobilan to exclude its glycosylation potential, as described above (see Fig. 15A), we tested the following modifications to the Mobilan construct: (i) with the addition of a polyadenylation site in position after the hTLR5 sequence to stabilize mRNA ( Fig. 15B); (ii) substituting the EF1α promoter with an alternative UbiC promoter (Fig. 15C); and (iii) expressing CBLB502NQs and hTLR5 in the form of a transcript hybridized to a "self-cleaving" petid 2a and furin protease site to remove in vivo peptide 2a remaining at the C-terminus of CBLB502NQs (Fig. 15D). Small-scale Ad-preps were obtained that were characterized in terms of: (i) the relative amounts of hTLR5 and CBLB502 produced by infected cells in culture (by analysis by Western blotting and ELISA, Fig. 16 and 17), and (ii) specific biological activity of CBLB502 secreted into the nutrient medium (activation of NF-κB-dependent signaling in the reporter cell line, Fig. 18). Finally, all versions of Mobilan were tested for their ability to inhibit the in vivo growth of syngeneic 4T1 breast tumors modeled on mice (Fig. 19). These experiments show that the use of UbiC results in an improved Mobilan vector.

Claims (15)

1. A bicistronic vector for the expression of a toll-like receptor and its agonist in a mammal for treating cancer whose cells have a high expression level of the Coxsackie virus and adenovirus (CAR) receptor, containing the first and second nucleic acids and a ubiquitin C promoter operably linked to the second nucleic acid, while the first nucleic acid encodes a toll-like receptor - TLR5 with the amino acid sequence of SEQ ID NO: 99, and the second nucleic acid encodes a toll-like receptor agonist - flagellin with amino acids a different sequence of SEQ ID NO: 101 or 102. 2. The vector according to claim 1, which is expressed from adenovirus, lentivirus or liposome. 3. The vector according to claim 1, in which flagellin lacks glycosylation. 4. Vector according to any one of paragraphs. 1 or 3, in which the second nucleic acid encodes flagellin with the amino acid sequence of SEQ ID NO: 101. 5. The vector according to any one of paragraphs. 1 or 3, in which the second nucleic acid encodes flagellin with the amino acid sequence of SEQ ID NO: 102. 6. A method of treating cancer in a mammal, comprising administering to the mammal an agent comprising a vector according to any one of claims. 1-5, with cancer cells having a high level of CAR expression. 7. The method according to p. 6, in which the cancer is selected from the group comprising cancer of the bladder, prostate, small intestine, thyroid gland, testicle and colon. 8. The method according to any one of paragraphs. 6-7, in which the tool is administered systemically or directly into a tumor of a mammal. 9. A method of treating cancer in a mammal, comprising administering to the mammal an agent comprising a vector according to any one of claims. 1-5, in combination with an immunostimulant, with cancer cells having a high level of CAR expression. 10. The method according to p. 9, in which the immunostimulant is selected from the group comprising growth hormone, prolactin and vitamin D. 11. The method of claim 10, wherein the growth hormone is somatotropin. 12. The method according to any one of paragraphs. 9-11, in which the cancer is selected from the group comprising cancer of the bladder, prostate, small intestine, thyroid gland, testicle and colon. 13. A method of treating cancer in a mammal, comprising administering to the mammal an agent comprising a vector according to any one of claims. 1-5, in combination with a cytokine, with cancer cells having a high level of CAR expression. 14. The method of claim 13, wherein the cytokine is a stem cell factor. 15. The method according to any one of paragraphs. 13-14, in which the cancer is selected from the group comprising cancer of the bladder, prostate, small intestine, thyroid gland, testicle and colon.

Images