WO2011025077A1 - 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법 - Google Patents

높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법 Download PDF

Info

Publication number
WO2011025077A1
WO2011025077A1 PCT/KR2009/004855 KR2009004855W WO2011025077A1 WO 2011025077 A1 WO2011025077 A1 WO 2011025077A1 KR 2009004855 W KR2009004855 W KR 2009004855W WO 2011025077 A1 WO2011025077 A1 WO 2011025077A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
brazein
brazzein
variant
pet26b
Prior art date
Application number
PCT/KR2009/004855
Other languages
English (en)
French (fr)
Inventor
공광훈
Original Assignee
중앙대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 중앙대학교 산학협력단 filed Critical 중앙대학교 산학협력단
Priority to US13/392,378 priority Critical patent/US8592181B2/en
Priority to PCT/KR2009/004855 priority patent/WO2011025077A1/ko
Priority to JP2012526611A priority patent/JP5625061B2/ja
Publication of WO2011025077A1 publication Critical patent/WO2011025077A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C07K14/43—Sweetening agents, e.g. thaumatin, monellin

Definitions

  • the present invention relates to a novel brazein multiple variant having a high sweet taste and its use, and more particularly, a brazein variant having a higher sweetness than a wild type brazein (minor type) protein, a method for preparing the same, and a same It relates to a food composition for enhancing sugar content.
  • White sugar is a simple carbohydrate called sucrose (sugar), a disaccharide known as saccharose (chemical term for sugar).
  • sucrose sucrose
  • saccharose chemical term for sugar
  • WHO World Health Organization
  • the US government (New York City, July 2003, New Jersey, September 2004, Illinois, March 2006, Connecticut) April 2006) banned the sale of sugar-based foods and high content beverages.
  • the National Obesity Countermeasure Committee was formed to announce a policy to label sugar risk warnings, and from 2010, food advertisements above the sugar standard will be regulated. Therefore, the emergence of a new sweetener that can replace sugar is required.
  • saccharin which is about 500 times sweeter than sugar. Saccharin has the advantage of being excreted without being broken down in the body, but it has caused controversy that it is carcinogenic. Eventually, it was concluded that it is harmless to the human body, but it is not used much recently because of the disadvantage of using aftertaste.
  • sodium cyclohexylsulfamate was found to be sweet. It was called cyclamate under the brand name and began to be used in the early 1950s, and dominated the world sweetener market in the 1960s.
  • Taumatin is a protein contained in the fruit of the perennial plant (Thaumatococcus daniellii), a miracle fruit in West Africa, and is 2,000 to 3,000 times sweeter than sugar.
  • Monellin is a protein derived from the fruit of a vine-like plant called Serendipiti berry, which grows in the rain forests of Africa. It is 3,000 times sweeter than sugar. But it is not easy to cultivate and it is difficult to extract from the fruit.
  • the heat stability of the low heat stability during the food processing process loses the three-dimensional protein structure has a disadvantage that does not give a sweet taste.
  • research is being conducted to improve the thermal stability using protein engineering techniques to overcome these disadvantages.
  • Brazzein is a sweet protein originally extracted from the fruit of Pentadipladra brazzeana Baillon in West Africa (Ming et al., FEBS Letters , 355: 106-108, 1994). Brazein has a sweet taste of about 500 to 2,000 times more than sucrose (Jin et al., Chem. Senses. 28: 491-498, 2003), major type and minor type ( minor type). The major type of plant-derived brazein has 54 amino acids, including pyroglutamic acid residues at its amino terminus.
  • brazein has only 53 amino acid residues without the pyroglutamic acid residue at the amino terminus and has about twice the sweetness of the main type of brazein (Assadi-Porter et al., Arch .. Biochem. Biophys 376: 259-265, 2000).
  • Brazein is the smallest sweet protein, has a molecular weight of about 6.5 kDa, and is a monomer composed of one subunit. It consists of a single polypeptide and consists of one ⁇ -helix and two ⁇ -sheets. Brazein has eight cysteine residues to form four disulfide bonds in the molecule, resulting in very high thermal stability. In addition, the solubility and pH stability in water are very high (Gao et al., Int. J. Biol. Macromol . 24: 351-359, 1999).
  • U.S. Patent UP 6,274,707 B1 and Asadi Porter et al. (Assadi-Porter et al., Arch .. Biochem. Biophys. 376: 259-265, 2000) recombine such brazein by genetic engineering using E. coli. It describes a method for producing brazein, by synthesizing a gene encoding brazein and inserting it into a recombinant vector containing a SNase to generate a new transformation vector, which is then introduced into Escherichia coli and the final SNase and A method of expressing and purifying linked fusion proteins is disclosed.
  • brazein expressed by fusion with SNase produces an inclusion body, refolds it, and removes SNase and methionine by using cyanobromide (CNBr). Due to the separation and purification, it is technically complicated and difficult to commercialize by mass production. Accordingly, the present inventors have applied for a polynucleotide including Escherichia coli pelB signal sequence and brazein gene and a method for producing brazein using the same through prior studies (Korean Patent Application No. 2006-97619). There is a bar.
  • the present inventors prepared variants and multiple variants of amino acids at specific positions which are expected to not affect the structure of the amino acids constituting the brazein in order to find a natural sweetener with high thermal stability and excellent sweetness, among which The present invention has been completed by searching for and developing variants and multiple variants having higher sweetness while having properties such as thermal stability and pH stability and high water solubility equivalent to those of conventional brazein.
  • an object of the present invention is a novel brazein variant and multiple variants having properties such as high thermal stability, pH stability and high water solubility, which are equivalent to those of the conventional brazein subtype, and exhibiting a sweet taste of at least 2 times to 20 times or more. And uses thereof.
  • the present invention provides a novel brazein variant whose sweet taste is superior to conventional natural brazein.
  • the present invention provides a polynucleotide encoding the brazein variants and multiple variants.
  • the present invention provides a recombinant expression vector containing the polynucleotide, E. coli transformed with the vector and a method for producing a brazein variant using the E. coli.
  • the present invention provides a food composition for enhancing sugar content comprising a brazein variant and multiple variants as an active ingredient.
  • the present invention is characterized by providing novel brazein variants and multiple variants with superior sugar content compared to conventional natural forms.
  • the fifth amino acid lysine residue of the brazein subtype, the 28th amino acid aspartic acid residue, the 30th amino acid histidine residue, 35th A recombinant vector encoding 40 brazein variants in which the amino acid glutamic acid residue, the 40th amino acid glutamic acid residue, or the 42nd amino acid arginine residue, was substituted with another amino acid was prepared.
  • each of the brazein variants was expressed and purified. As a result, a high purity brazein variant was obtained.
  • the braze variant and braze subtype protein activity (sweetness) and thermal stability prepared above were measured.
  • the histidine residue, the 30th amino acid, of the brazein subtype protein is an arginine residue
  • the glutamic acid residue, the 35th amino acid is an aspartic acid residue
  • the 40th glutamic acid residue, an alanine residue, an aspartic acid residue, a lysine residue, and an arginine residue was selected for the production of multiple varieties of braze for higher sweetness with higher activity (sweetness) and comparable thermal stability than brazein subtype proteins, and can be used as an excellent sweetener by itself. I could see that.
  • the brazein variant of the above prepared by combining appropriately the 9th secondary variant, 4 kinds of tertiary variant and the 29th lysine residue of the brazein subtype based on the tertiary variant And a recombinant vector encoding a total of 17 Brazain multiple variants of four quaternary variants in which the lysine residue was inserted between the 30th histidine residue and the expression, purification and activity in the same manner as in the above example. (Sweetness) was measured.
  • brazein variant having the same stability as the brazein subtype protein and showing a sweet taste of at least 4 to up to 20 times as compared to the brazein subtype protein.
  • the brazein multiple variants prepared using the selected brazein variants can also be used as an excellent sweetener.
  • the present invention provides a brazine variant in which the thirty amino acid histidine residue, the thirty-third amino acid glutamic acid residue, or the 40 th glutamic acid residue is substituted with another amino acid. do.
  • the brazein variant of the invention is a brazein variant having the amino acid sequence of SEQ ID NO: 100, wherein, for example, the thirtieth amino acid histidine residue is replaced with an arginine residue.
  • a brazein variant having the amino acid sequence of SEQ ID NO: 109 in which a glutamic acid residue is substituted with an aspartic acid residue, or the 40th glutamic acid residue is an alanine residue or an aspartic acid, respectively. acid), lysine residues or arginine residues may be a brazein variant having an amino acid sequence of SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115 or SEQ ID NO: 117.
  • the brazein variant of the present invention comprises a modification of two or more of the above-mentioned 30th amino acid histidine residue, the 35th amino acid glutamic acid residue, or the 40th glutamic acid residue. It may be multiple variants, for example SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, sequence It may be a brazein variant having an amino acid sequence of SEQ ID NO: 152, SEQ ID NO: 153 or SEQ ID NO: 154.
  • the brazein variant of the present invention is a lysine between the 29th lysine residue and the 30th histidine residue of the brazein variant having the amino acid sequence of SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153 and SEQ ID NO: 154. (lysine) residue is inserted and may preferably have the amino acid sequence of SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157 or SEQ ID NO: 158.
  • the polynucleotide may be a polynucleotide encoding the amino acid sequence of SEQ ID NO: 100, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, or SEQ ID NO: 117, and preferably for the amino acid sequence of SEQ ID NO: 100
  • polynucleotide encoding the brazein multiple variant of the present invention is SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, or polynucleotide encoding the amino acid sequence of SEQ ID NO: 158, preferably SEQ ID NO: The nucleotide sequence of SEQ ID NO: 123 for the amino acid sequence of 142, the nucleotide sequence of SEQ ID NO: 124 for the amino acid sequence of SEQ ID NO: 143, the nucleotide sequence of SEQ ID NO: 125 for the amino acid
  • the present invention provides a promoter and a recombinant expression vector for expression of brazein variants and multiple variants comprising the polynucleotide operably linked thereto.
  • the term 'promoter' refers to a DNA sequence that regulates the expression of a nucleic acid sequence operably linked in a particular host cell. 'Operably linked' means that one nucleic acid fragment is combined with another nucleic acid fragment. Its function or expression is affected by other nucleic acid fragments. In addition, it may further comprise any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.
  • the promoter may be a promoter (constitutive promoter) to induce the expression of the target gene at all times at all times or a promoter (inducible promoter) to induce the expression of the target gene at a specific position, time, for example E.
  • coli pelB Promoter U6 promoter, cytomegalovirus (CMV) promoter, SV40 promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199, 1991; Monahan et al., Gene Therapy, 7: 24-30, 2000 ) , CaMV 35S promoter (Odell et al ., Nature 313: 810-812, 1985), Rsyn7 promoter (US patent application Ser. No. 08 / 991,601), rice actin promoter (McElroy et al ., Plant Cell 2: 163 -171, 1990), ubiquitin promoters (Christensen et al ., Plant Mol. Biol.
  • ALS promoters US Patent Application No. 08 / 409,297
  • U.S. Patents 5,608,149 The promoters disclosed in 5,608,144 5,604,121 5,569,597, 5,466,785, 5,399,680 5,268,463, 5,608,142, and the like can all be used.
  • the promoter may use the E. coli pelB promoter.
  • E. coli pelB signal sequence is a type of cell membrane gap signal sequence of E. coli (Rietsch et al., Proc. Natl. Acad. Sci. USA, 93: 130408-13053, 1996, Raina et al., Ann. Rev. Microbiol. 51 : 179-202, 1997, Sone et al., J. Biol. Chem. 272: 10349-10352, 1997), when the brazein of the present invention is synthesized, it moves to the cell membrane gap of E. coli to induce accurate disulfide bonds, Inhibiting the formation of insoluble aggregates of brazein protein, it is possible to facilitate the purification process by minimizing unnecessary E. coli-derived protein.
  • E. coli-derived protein E.
  • coli pelB signal sequence of the present invention preferably has a nucleotide sequence of SEQ ID NO: 137, and is linked to have the same frame when translated into a protein on the 5 'top of the nucleotide sequence of the brazein variant of the present invention.
  • a "recombinant expression vector” is a vector capable of transcription of a target protein or a target RNA in a host cell, and refers to a gene construct including an essential regulatory element operably linked to express a gene insert.
  • Vectors of the invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like.
  • Suitable expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control sequences such as promoters, operators, initiation codons, termination codons, polyadenylation signals, and enhancers (promoter) and can be prepared in various ways depending on the purpose. Can be.
  • the expression vector also includes a selection marker for selecting a host cell containing the vector and, in the case of a replicable expression vector, a replication origin.
  • Recombinant expression vector for the expression of the brazein variant of the present invention is preferably pET26B (+)-Brazzein (H30R), pET26B (+)-Brazzein (E35D), pET26B (+)-Brazzein (E40A), pET26B ( +)-Brazzein (E40D), pET26B (+)-Brazzein (E40K) or pET26B (+)-Brazzein (E40R), each with pET26B (+)-Brazzein (Met-) as a template SEQ ID NO: 19 for pET26B (+)-Brazzein (H30R), SEQ ID NO: 28 for pET26B (+)-Brazzein (E35D), SEQ ID NO: 32 for pET26B (+)-Brazzein (E40A), pET26B ( +)-Brazzein (E40D) for SEQ ID NO: 33, pET26B (+)-Brazzein (E40K) for SEQ
  • the recombinant expression vector for the expression of the brazein secondary variant of the brazein multiple variant of the present invention is preferably pET26B (+)-Brazzein (H30R_E35D), pET26B (+)-Brazzein (H30R_E40A), pET26B ( +)-Brazzein (H30R_E40D), pET26B (+)-Brazzein (H30R_E40K) or pET26B (+)-Brazzein (H30R_E40R), each with pET26B (+)-Brazzein (H30R) as a template, SEQ ID NO: 28 for pET26B (+)-Brazzein (H30R_E35D), SEQ ID NO: 32 for pET26B (+)-Brazzein (H30R_E40A), SEQ ID NO: 33 for pET26B (+)-Brazzein (H30R_E40D) +)-Brazzein (H30R_E40K
  • the recombinant expression vector for the expression of another brazein of the braze multiple variant of the present invention is preferably pET26B (+)-Brazzein (E35D_E40A), pET26B (+)-Brazzein (E35D_E40D), pET26B (+)-Brazzein (E35D_E40K) or pET26B (+)-Brazzein (E35D_E40R), respectively, with pET26B (+)-Brazzein (E35D) as the template, pET26B (+)-Brazzein (E35D_E40A) ), SEQ ID NO: 32, pET26B (+)-Brazzein (E35D_E40D), SEQ ID NO: 33, pET26B (+)-Brazzein (E35D_E40K), SEQ ID NO: 34, and pET26B (+)-Brazzein (E35D_E40R) Cases can be prepared by site-directed mutagenesis using S
  • the recombinant expression vector for expression of the brazein third variant of the brazein multiple variant of the present invention is preferably pET26B (+)-Brazzein (H30R_E35D_E40A), pET26B (+)-Brazzein (H30R_E35D_E40D), pET26B ( +)-Brazzein (H30R_E35D_E40K) or pET26B (+)-Brazzein (H30R_E35D_E40R), each of which is pET26B (+)-Brazzein (H30R_E35D) as a template, and H30R_E_A_E_E_A_E_A_E_A_E_A_E_E_35A_E_35A_E40K) SEQ ID NO: 32, pET26B (+)-Brazin (H30R_E35D_E40D), SEQ ID NO: 33, pET26B (+)-Brazz
  • the recombinant expression vector for the expression of the braze quaternary variant of the brazein multiple variants of the present invention is preferably pET26B (+)-Brazzein (29ins30 Lys_H30R_E35D_E40A), pET26B (+)-Brazzein (29ins30 Lys_H30R_E35D_E40D) pET26B (+)-Brazzein (29ins30 Lys_H30R_E35D_E40K) or pET26B (+)-Brazzein (29ins30 Lys_H30R_E35D_E40R), respectively, using as primers of SEQ ID NO: 136, which is pET26B (+)-Brazzein (29R30E26_35) +)-Brazzein (H30R_E35D_E40A), pET26B (+)-Brazzein (29ins30 Lys_H30R_E35D_E40D), pET26B
  • the present invention also provides E. coli comprising the recombinant expression vector.
  • the E. coli is transformed according to a conventional transformation method with the recombinant expression vector, wherein the transformation includes any method of introducing a nucleic acid into a host cell, and is suitable for the host cell as known in the art. Standard techniques can be selected and performed. These methods include electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microprojectile bombardment, electroporation, PEG-mediated fusion (PEG) mediated fusion, microinjection, liposome-mediated methods, etc., but are not limited thereto.
  • the present invention provides a method for producing a variant of brazein comprising culturing the transformed Escherichia coli, separating the cell membrane gap protein from the cultured Escherichia coli, and heat treatment to purify the brazein.
  • E. coli transformed to include the polynucleotide of the present invention may be cultured under appropriate media and conditions so that the polynucleotide encoding the brazein variant is expressed, which is the same as or similar to the culture conditions of conventional E. coli. While the transformed Escherichia coli is cultured, brazein including a pelB signal sequence is expressed by an expression control sequence in an expression vector, and the expression of brazein in the present invention is IPTG (isopropyl-beta-D-thiogalactopyranoside). Even without compounds that promote the expression of conventional inducible promoters. The brazein containing the expressed pelB signal sequence is moved to the cell membrane gap of E. coli by the signal sequence, and the signal sequence is removed by the signal peptidase of E. coli to synthesize brazein.
  • IPTG isopropyl-beta-D-thiogalactopyranoside
  • a known method of separating proteins from the cell membrane gap of Escherichia coli can be used (Snyder et al., J. Bacteriology, 177: 953963, 1995).
  • the cultured E. coli was collected, suspended in 30 mM Tris-HCl (Pri-HCl, pH 8) solution containing 20% sucrose, and EDTA (pH). 8) A solution and MgSO 4 can be used to elute the protein of the cell membrane gap of E. coli.
  • the method of separating brazein of the present invention from the cell membrane gap protein of E. coli can be carried out through various separation and purification methods known in the art, for example, salting out (ammonium sulfate precipitation and sodium phosphate precipitation), solvent precipitation
  • the brazein of the present invention can be isolated by applying techniques such as (precipitation of protein fractions using acetone, ethanol, etc.), dialysis, gel filtration, ion exchange chromatography, reverse phase column chromatography and affinity chromatography, alone or in combination. have. Since the brazein of the present invention is heat stable, the method for separating the brazein may be preferably performed by heat treatment.
  • the heat treatment is preferably heat-denatured protein other than braze by heating at 70-90 ° C. for 15-60 minutes, and then heat-denatured protein and brazein by centrifugation at 18000 g at 4 ° C. for 30 minutes. Can be separated.
  • Brazein multiple variant enzymatic properties having the amino acid sequence of SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157 or SEQ ID NO: 158 are as follows.
  • Brazein's subtype of protein-based brazein multiple variants sweetness ratio 4-20 times or more
  • the brazein variant according to the present invention and the brazein multiple variant prepared based on the same are proteins of the subtype of brazein that is expressed and purified in the present patent application (Korean Patent Application No. 2006-97619), that is, a natural type.
  • the thermal stability, acid resistance and water solubility of the brazein subtype protein and the expression and purification of brazein in Korean Patent Application No. 10-2007-0117013 are similar to those of the natural type brazein. It is characterized by having a novel amino acid sequence that exhibits a higher sweetness.
  • brazein variants exhibit higher sweetness and effect than the brazein variants known by the US patents (US 6,274,707B1; US 7,153,535).
  • the brazein variants of the present invention may be used in place of natural sweeteners such as sugar, fructose, oligosaccharides or artificial sweeteners such as aspartame. Therefore, the present invention also relates to the use of the brazein variant for the production of sweeteners, to the use of the brazein variant to enhance food sugar content, to a sweetener comprising the brazein variant, and to a food comprising the brazein variant as a sweetener. To provide a composition.
  • the food composition of the present invention includes all forms such as functional foods, nutritional supplements, health foods and food additives.
  • Food compositions of this type can be prepared in various forms according to conventional methods known in the art.
  • beverages including alcoholic beverages
  • fruits and processed foods e.g. canned fruit, canned foods, jams, marmalade, etc.
  • fish meat and processed foods
  • meat and processed foods e.g. ham, sausage cornbeans, etc.
  • Breads and noodles e.g. udon, soba, ramen, spaghetti, macaroni, etc.
  • fruit juices various drinks, cookies, malts, dairy products (e.g. butter, cheese), edible vegetable oils, margarine, vegetable protein, retort
  • It can be prepared by adding the brazein variant of the present invention to food, frozen foods, various seasonings (eg, miso, soy sauce, sauce, etc.).
  • the food composition containing the brazein variant of the present invention in the form of food additives such as sweeteners, it may be prepared and used in powder or concentrate form.
  • the preferred content of the brazein variant of the present invention in the food composition of the present invention may include about 0.01 to 10% by weight relative to the total weight of the food.
  • the brazein variant of the present invention has properties such as thermal stability and acid resistance and water solubility superior to the conventional braze, and has a sweet taste of at least two to up to 3.3 times or more than the conventional brazein Multiple variants have the same stability and at least four to up to twenty times the sweetness of the brazein subtype proteins as well as the brazein variants. Therefore, the brazein variant of the present invention can replace other sweeteners such as sugar (sucrose) in a small amount, and can be used in various ways as a sweetener in food compositions and the like.
  • FIG. 1 is a schematic diagram showing a process for preparing a recombinant expression vector for expressing a brazein variant according to the present invention.
  • FIG. 2 to 4 is a schematic diagram showing a process for producing a brazein variant and a brazein multiple variant according to the present invention.
  • Lane 1 Relative activity of brazein minor type after heat treatment
  • Lane 5 relative activity of brazein variant (E40A) after heat treatment
  • Figure 6 shows the results of electrophoresis to identify the brazein multiple variants according to the present invention.
  • Lane 7 purified brazein secondary variant (E35D_E40D)
  • Lane 8 purified brazein secondary variant (E35D_E40K)
  • Lane 10 purified brazein tertiary variant (H30R_E35D_E40A)
  • Lane 11 purified brazein tertiary variant (H30R_E35D_E40D)
  • Lane 12 purified brazein tertiary variant (H30R_E35D_E40K)
  • Lane 13 purified brazein tertiary variant (H30R_E35D_E40R)
  • Lane 14 purified brazein quaternary variant (29ins30 Lys_H30R_E35D_E40A)
  • Lane 15 purified brazein quaternary variant (29ins30 Lys_H30R_E35D_E40D)
  • Lane 16 purified brazein quaternary variant (29ins30 Lys_H30R_E35D_E40K)
  • Lane 17 purified brazein quaternary variant (29ins30 Lys_H30R_E35D_E40R)
  • Figure 7 shows the results of the reverse phase chromatography to compare the degree of purification and structural differences of the brazein variants according to the present invention.
  • the brazein variant of the present invention has properties such as thermal stability and acid resistance and water solubility superior to the conventional braze, and has a sweet taste of at least two to up to 3.3 times or more than the conventional brazein Multiple variants have the same stability and at least four to up to twenty times the sweetness of the brazein subtype proteins as well as the brazein variants. Therefore, the brazein variant of the present invention can replace other sweeteners such as sugar (sucrose) in a small amount, and can be used in various ways as a sweetener in food compositions and the like.
  • brazein variant having a higher sweetness than brazein
  • one specific amino acid constituting a minor type of brazein was selected and mutated to another specific amino acid.
  • the primers were designed in consideration of the external residue length and electrical properties of the specific amino acids (see Table 1) constituting the brazein subtype protein. Using the primers of Table 1 and the QuikChange TM Site-Directed Mutagenesis Kit (Stratagene, USA), the nucleotides encoding 40 brazein variants that substituted specific positions of the brazein subtype protein according to the manufacturer's instructions were identified. An expression vector was obtained. At this time, the underlined portion of the primer sequence of Table 1 below shows the changed sequence for the brazein variant.
  • E. coli XL1-Blue a supercompetent cell, was transformed.
  • the transformed XL1-Blue was selected by incubating for 12 hours in an LB-agar plate containing 50 ⁇ g / ml kanamycin, and the selected colonies were cultured in LB-agar medium. DNA was isolated from. It was confirmed through genetic analysis that the nucleotides encoding the pelB signal sequence and each of the brazein variants were linked to the separated DNA.
  • E35D E35K E. coli pelB + Brazein (E35K) gene SEQ ID NO: 69 E35H E. coli pelB + Brazein (E35H) gene SEQ ID NO: 70 E35R E. coli pelB + Brazein (E35R) gene SEQ ID NO: 71 E40A E. coli pelB + Brazein (E40A) gene SEQ ID NO: 72 E40D E. coli pelB + Brazein (E40D) gene SEQ ID NO: 73 E40K E. coli pelB + Brazein (E40K) gene SEQ ID NO: 74 E40H E.
  • E40H E40R E. coli pelB + Brazein (E40R) gene SEQ ID NO: 75 E40R E. coli pelB + Brazein (E40R) gene SEQ ID NO: 76 R42A E. coli pelB + Brazein (R42A) gene SEQ ID NO: 77 R42K E. coli pelB + Brazein (R42K) gene SEQ ID NO: 78 R42H E. coli pelB + Brazein (R42H) gene SEQ ID NO: 79 R42D E. coli pelB + Brazein (R42D) gene SEQ ID NO: 80 R42E E. coli pelB + Brazein (R42E) gene SEQ ID NO: 81
  • E. coli BL21 (star), in which 32 expression vectors for the brazein primary variant prepared in ⁇ Example 1> were introduced, was used as a protein inducer in 1 L of LB medium containing 30 ⁇ l / ml of kanamycin. Incubated at 37 ° C. for 12 hours without the addition of phosphorous IPTG (isopropyl ⁇ -D-thoigalactopyranoside) to express each brazein variant in each transformed Escherichia coli.
  • IPTG isopropyl ⁇ -D-thoigalactopyranoside
  • Example 2-1 Each Escherichia coli cultured in Example 2-1 was collected by centrifugation at 8,000 g for 10 minutes. After collection, the cells were suspended in 30 mM Tris-HCl (pH 8.0) solution containing 20% Sucrose, and 0.5 M EDTA (pH 8.0) solution was added to a final concentration of 1 mM. Stir slowly at room temperature for 10 minutes. It was centrifuged at 10,000 g, 4 ° C. for 10 minutes, the supernatant was removed, then cold 5 mM MgSO 4 was added and stirred slowly on ice for 10 minutes. In this process, proteins of the periplasm are released into the buffer solution. Thereafter, the supernatant was separated by centrifugation at 10,000 g and 4 ° C.
  • brazein primary variant represented by the sequence number of Table 3 below, and the degree of purification was primarily confirmed through SDS-PAGE.
  • brazein protein was purified to a high molecular weight of about 6.5kDa.
  • Refined Reverse phase chromatography on Varina's High Performance Liquid Chromatography to analyze the structural differences after confirming the degree of purification of the subtype proteins of brazein and each of the brazein variants purified from Example 2-2. Analysis was performed using a Vydac 214TP54 (USA) column, which is a reverse-phase chromatography column.
  • Solvent conditions include a solvent A containing 0.05% triflouroacetic acid in water and solvent B containing 0.05% triflouroacetic acid in acetonitrile at a flow rate of 1 ml per minute. Solvent B was eluted in a gradual linear gradient from 10% to 50% for 30 minutes. The eluted solution observed the change of absorbance at 210 nm.
  • brazein variants were eluted after 15 minutes of retention time, which indicates that there is almost no structural difference between the expressed brazein variants.
  • the recombinant brazein in the present invention is not a compound of the saccharide family having a cyclic ring, sweetness cannot be measured using a sugar meter, and activity was measured using human taste.
  • the glucose measurement was conducted on 20 subjects who were trained to have a similar level of sucrose with a solution of sucrose. The minimum concentration of sucrose was approximately similar. Measured.
  • brazein represented by SEQ ID NO: 99 H30K
  • brazein represented by SEQ ID NO: 100 H30R
  • brazein represented by SEQ ID NO: 109 E35D
  • SEQ ID NO: 113 SEQ ID NO: 113.
  • brazein (E40D) showed the highest sweetness increase rate.
  • brazein variant showing a high sweet taste that is, brazein (H30K) represented by SEQ ID NO: 99, brazein (H30R) represented by SEQ ID NO: 100, SEQ ID NO: Brazein (E35D) represented by 109, brazein (E40A) represented by SEQ ID NO: 113, brazein (E40A) represented by SEQ ID NO: 113, brazein (E40D) represented by SEQ ID NO: 114, and SEQ ID NO: 115.
  • a brazein variant such as the indicated brazein (E40K), the variant represented by SEQ ID NO: 116 (E40H) and the variant represented by SEQ ID NO: 117 (E40R), was prepared in 50 mM Tris-HCl (Ph 8.0) solution. After melting for 4 hours at 80 ° C., the degree of sweetness change was measured in 20 test subjects in the same manner as in ⁇ Example 3-1> based on the sweetness before heat treatment for each of the primary varieties of brazein. And show the result as relative active Control are shown in Fig.
  • brazein (E35D) represented by SEQ ID NO: 109
  • SEQ ID NO: 113 Brazein variants such as brazein (E40A), brazein (E40D) represented by SEQ ID NO: 114, brazein (E40K) represented by SEQ ID NO: 115, and variant (E40R) represented by SEQ ID NO: 117
  • the thermal stability of was maintained as it is.
  • brazein primary variants H30R, E35D, E40A, E40D, E40R, E40K having a high sweet taste.
  • the template expression vector containing the polynucleotide encoding the brazyin primary variant
  • the primers used for the primary variant preparation are used in Tables 5 to 7 below to prepare the brazein secondary variants.
  • Tables 5 to 7 below By using the site-directed mutagenesis method of Example 1, a total of nine polynucleotides encoding the brazein secondary variant were prepared.
  • 29ins30 Lys_ means that the lysine residues are inserted at positions 29 and 30.
  • the underlined portion of the primer sequence refers to the sequence changed for the brazein variant.
  • E35D_E40R E35D_E40R
  • H30R_E35D Bactet al. coli pelB + Brazein (H30R_E35D) gene (SEQ ID NO: 123) tac gat gct aag aga SEQ ID NO: 32 H30R_E35D_E40A tac gat gac aag aga SEQ ID NO: 33 H30R_E35D_E40D tac gat aaa aag aga SEQ ID NO: 34 H30R_E35D_E40K tac gat cgt aag aga SEQ ID NO: 36 H30R_E35D_E40R
  • H30R_E35D_E40D Brazein gene (SEQ ID NO: 133)
  • H30R_E35D_E40K Brazein gene (SEQ ID NO: 134)
  • H30R_E35D_E40R Brazein gene (SEQ ID NO: 135) gataag aaa catgct SEQ ID NO: 136 29ins30 Lys_H30R_E35D_E40R
  • the template expression vector containing polynucleotide encoding the brazein secondary variant
  • primers used for preparing the primary variant are shown in Table 5 above. Using four sites, a total of four polynucleotides encoding brazein tertiary variants were prepared by the site-directed mutagenesis method.
  • brazein quaternary variant was prepared by inserting a lysine residue between the lysine residue at position 29 and the arginine residue at position 30 of the tertiary variant.
  • the template expression vector containing a polynucleotide encoding a brazein tertiary variant described in Table 5
  • a primer encoding a lysine residue represented by SEQ ID NO: 136 and a primer having a sequence complementary thereto was synthesized and a total of four polynucleotides encoding the brazein quaternary variants were prepared by the site-directed mutagenesis method of ⁇ Example 1>. This was named by the SEQ ID NO and nucleotide name specified in Table 8 below.
  • E35D_E40R Brazein gene SEQ ID NO: 131 H30R_E35D_E40A E. coli pelB + Brazein (H30R_E35D_E40A) gene SEQ ID NO: 132 H30R_E35D_E40D E. coli pelB + Brazein (H30R_E35D_E40D) gene SEQ ID NO: 133 H30R_E35D_E40K E. coli pelB + Brazein (H30R_E35D_E40K) gene SEQ ID NO: 134 H30R_E35D_E40R E.
  • H30R_E35D_E40R Brazein gene SEQ ID NO: 135 29ins30 Lys_H30R_E35D_E40A E. coli pelB + Brazein (29ins30 Lys_H30R_E35D_E40A) gene SEQ ID NO: 138 29ins30 Lys_H30R_E35D_E40D E. coli pelB + Brazein (29ins30 Lys_H30R_E35D_E40D) gene SEQ ID NO: 139 29ins30 Lys_H30R_E35D_E40K E.
  • the brazein protein was purified to high purity, the molecular weight was about 6.5kDa.
  • all of the brazein multiple variants are at least 4 times up to about 20 times higher (at least about 8,000 times up to about 40,000 times higher than 1g / 100ml sucrose) when compared to the proteins of the brazein subtype. It was shown to indicate sweetness.
  • brazein primary variants were prepared. Among them, 6 kinds of brazein (H30R, E35D, E40A, E40D, E40R, E40K), which show the same heat stability and high sweetness of at least 2 times and up to 3.3 times as compared to the protein of brazein type 1 Primary variants were selected. Selected brazein primary variants were used to prepare brazein multiple variants that exhibited the same thermal stability and higher sweetness as compared to subtype proteins.
  • brazein multiple variants except for the Brazain quaternary variant, in which the lysine residue was inserted between the lysine residue at position 29 and the arginine residue at position 30 of the brazein tertiary variant, form the same structure as the protein of the brazein subtype. It was. Structural differences of the brazein quaternary variants are believed to be influenced by the inserted lysine residues. However, all of the multiple varieties of brazein, including the brazein variant, showed the same thermal stability as the brazein subtype protein, and it was confirmed that the sweetness increased from 4 times to 40 times.
  • the brazein gene synthesized in ⁇ Example 6-1> was used as a template, and the brazein gene was amplified using two primers synthesized in ⁇ Example 6-2>.
  • the PCR reaction was performed with 1.5 ⁇ l of the template gene (synthesized brazein gene, SEQ ID NO: 159), 2 ⁇ l of the forward primer (SEQ ID NO: 160), 1 ⁇ l of the reverse primer (SEQ ID NO: 161), 25 mM MgCl 2 3 ⁇ l, 2.5 mM dNTP 4 ⁇ l, 10 ⁇ Ex-taq buffer 5 ⁇ l, Ex-taq polymerase (Takara, Japan) 1 ⁇ l, H 2 PCR was performed using a final volume of 50 ⁇ l containing 31.5 ⁇ l of O as the reaction solution.
  • the PCR reaction was premodified at 94 ° C. for 2 minutes, and then reacted 30 times at 98 ° C. for 30 seconds, 58 ° C. for 2 minutes, and 74 ° C. for 3 minutes, followed by a final reaction at 74 ° C. for 10 minutes.
  • the azerose gel amplified by 2.0% agarose gel electrophoresis was confirmed, and the azerose gel amplified from the azerose gel recovered using a QIAquick Gel extraction kit (Qiagen, USA) And purified.
  • the extracted brazein gene was inserted into the pGEM-T Easy vector (Promega, USA) (called pGEM-T Easy-Brazzein), and the pGEM-T Easy vector into which the braze gene was inserted was transformed into E. coli JM109. .
  • PGEM-T Easy vectors with genes were obtained in large quantities.
  • the pGEM-T Easy-Brazzein vector cloned in Example 6-3 was digested at 37 ° C. for 6 hours using restriction enzymes Nco I and Xho I (using 10 ⁇ K buffer and 0.1% BSA).
  • Expression vector pET26B (+) vector with T7 promoter was also cut under the same conditions.
  • the portion of the brazein gene and the cleaved pET26B (+) vector in the pGEM-T Easy-Brazzein vector were purified using the QIAquick Gel extraction kit (Qiagen, USA). The mixture was reacted for 12 hours at 16 ° C. using T4 DNA ligase (Takara, Japan), and then transformed into JM109 supercompetent cells (see FIGS. 2 to 4).
  • the recombinant expression vector produced as a result of ligation was named pET26B (+)-Brazzein.
  • the recombinant brazein of the present invention is transferred to the periplasm of Escherichia coli as a translation process progresses after transcription, and then fused with recombinant braze by a signal peptidase in E. coli.
  • the pelB signal sequence is removed.
  • Met which is translated by ATG inside the restriction enzyme Nco I in the primer, is not removed by signal peptidase.
  • Primers of SEQ ID NO: 162 (CAGCCGGCGATGGCCGACAAATGCAAAAAA) and SEQ ID NO: 163 (TTTTTTGCATTTGTCGGCCATCGCCGGCTG) were synthesized with a length of about 15 bp, which is the same as the base sequence of brazein on both sides of the base to be removed in the brazein gene. They are capable of binding complementary to each single strand of brazein, except for ATG, which is each removed.
  • the pET26B (+)-Brazzein vector was used as a template, and described above according to the manufacturer's instructions using a QuikChange TM Site-Directed Mutagenesis Kit (Stratagene, USA) using primers of SEQ ID NO: 162 and SEQ ID NO: 163. As described above, pET26B (+)-Brazzein (Met-) was obtained from which ATG was removed from the pET26B (+)-Brazzein vector.
  • E. coli XL1-Blue a supercompetent cell.
  • Transformed Escherichia coli XL1-Blue was selected by incubating for 12 hours in an LB-agar plate containing 50 ⁇ g / ml kanamycin, and the selected colony was cultured in LB-agar medium to separate DNA from E. coli.
  • the vector identified as a variant from which ATG was removed by sequencing the isolated DNA was transformed into E. coli BL21 (DE3) -Star and used for mass expression.
  • the recombinant expression vector generated by site-specific mutation was named pET26B (+)-Brazzein (Met-).
  • the brazein variant of the present invention has properties such as heat stability and acid resistance and water solubility that are superior to the conventional brazein, and has a sweet taste of at least 2 to up to 3.3 times or more than the brazein, and in the case of the brazein multiple variants Like the Jane variant, it has the same stability and at least four to up to twenty times the sweetness of the protein of the brazein subtype. Therefore, the brazein variant of the present invention can replace other sweeteners such as sugar (sucrose) in a small amount, and can be used in various ways as a sweetener in food compositions and the like.
  • sweeteners such as sugar (sucrose) in a small amount

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Seasonings (AREA)

Abstract

본 발명은 높은 단맛을 가지는 신규한 브라제인 변이체 및 이의 용도에 관한 것으로서, 보다 상세하게는 야생형의 브라제인 단백질보다 높은 단맛을 나타내는 브라제인 변이체 및 다중 변이체, 이의 제조방법 및 이를 포함하는 당도 증진용 식품 조성물에 관한 것이다. 본 발명의 브라제인 변이체 및 다중 변이체는 종래의 브라제인과 비교하였을 때 동등한 열안정성 및 pH 안정성 및 높은 수용성 등의 특성을 가지면서 종래의 브라제인에 비해 최소 2배 이상의 단맛을 가지고 있다. 따라서, 본 발명의 브라제인 변이체는 적은 양으로도 더 많은 양의 설탕(수크로오스)과 같은 다른 감미료와 혼용 사용이 가능하며 더 나아가 이를 대체할 수 있으며, 식품 제조시 첨가물로서 다양하게 이용될 수 있다.

Description

높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법
본 발명은 높은 단맛을 가지는 신규한 브라제인 다중 변이체 및 이의 용도에 관한 것으로서, 보다 상세하게는 야생형의 브라제인 부타입(minor type)의 단백질보다 높은 단맛을 나타내는 브라제인 변이체, 이의 제조방법 및 이를 포함하는 당도 증진용 식품 조성물에 관한 것이다.
백색 설탕(정백당)은 수크로오스(sucrose, 설탕)라는 간단한 탄수화물의 하나로 사카로오스(saccharose, 설탕의 화학적 용어)라고도 하는 이당류이다. 오랜 기간 동안 설탕은 감미료로서 흔하게 사용되어 왔다. 하지만 설탕의 유해성 문제로 최근 세계보건기구(WHO)에서는 설탕 사용을 현재의 10%로 제한하자는 권고안을 제시하였으며, 미국의 주 정부(뉴욕시 2003.7월, 뉴저지주 2004.9월, 일리노이주 2006.3월, 코네티컷주 2006.4월)에서는 설탕 주성분 식품 및 고함유 음료 판매를 전면 금지시켰다. 또한, 한국의 경우, 국가비만대책위원회를 구성하여 설탕 위험 경고문구 표기 방침 발표하였으며 2010년 이후부터 설탕 기준치 이상 식품 광고 규제를 실시할 예정이다. 따라서 설탕을 대체할 수 있는 새로운 감미료의 등장이 요구되고 있다.
1879년 미국의 아이라 렘슨과 독일의 콘스탄틴 팔베르크는 설탕보다 약 500배 단맛을 내는 사카린(saccharin)을 발견하였다. 사카린은 체내에서 분해되지 않고 배설되는 장점을 가졌으나 발암성 물질이라는 논란을 불러일으켰다. 결국 인체에 무해하다고 결론이 났지만, 뒷맛이 쓰다는 단점 때문에 최근에는 많이 사용되지 않는다. 1937년 미국 일리노이대에서 사이클로헥실설파민산 나트륨이 단맛을 내는 것을 발견하였다. 상품명으로 사이클라메이트(cyclamate)로 불리면서 1950년 초부터 사용이 시작돼, 1960년대 세계 감미료 시장을 석권했다. 그러나 발암성 물질로 판명되면서 우리나라에서는 1970년대부터 사용이 전면 금지되었다. 최근에 가장 널리 사용되는 인공감미료는 1965년 제임스 쉬레터에 의해 발견된 아스파탐(aspartame)이다. 아스파탐은 설탕보다 약 180~200배 정도 높은 당도를 가지고 있다. 현재 시판되는 대다수의 다이어트 음료에는 아스파탐이 포함되어 있는데, 체내에 들어가면 대사과정 중 페닐알라닌을 생성한다. 따라서 페닐알라닌을 분해하는 특정 효소 (phenylalanine hydroxylase)가 선천적으로 결핍된 페닐케톤뇨증 환자들은 이용할 수 없다는 단점을 지닌다.
이 같은 인공 감미료 뿐만 아니라 천연 감미료를 개발하기 위한 연구도 계속되어 왔으며, 그 결과로서, 허브로 분류되고 있는 국화과의 다년생 식물(Stevia rabaudiana)의 잎에는 스테비오사이드(stevioside)라는 물질이 존재한다. 파라과이와 브라질의 국경 지대 원주민들은 이 물질을 4백년 이상 감미료로 사용했다. 우리나라의 소주에 첨가되기도 하는데, 설탕보다 200배 단맛을 갖고 있다.
한편, 최근에는 열대 과일에서 추출한 감미 단백질에 대한 관심이 증대하고 있다. 타우마틴(Thaumatin)은 서아프리카에서 기적의 과일이라고 불리는 다년생 식물(Thaumatococcus daniellii)의 과실 중에 포함되어 있는 단백질로서, 설탕보다 2,000~3,000배나 단맛을 나타낸다. 모넬린(Monellin)은 아프리카의 다우림 지대에 생육하는 세렌디퍼티 베리(Serendipiti berry)라고 하는 넝쿨상 식물의 열매로부터 얻어지는 단백질로 설탕보다 무려 3,000배가 달다. 그러나 재배가 쉽지 않으며 열매로부터의 추출도 어렵다. 더욱이 열안정성이 낮아서 식품가공과정에서 열처리를 하면 삼차원적인 단백질 구조를 잃어버려 단맛을 내지 못하는 단점을 갖고 있다. 현재에는 이런 단점을 극복하기 위해서 단백질공학기술을 이용하여 열안정성을 증진시키는 연구가 진행되고 있다.
한편, 브라제인(brazzein)은 서아프리카의 펜타디플란드라 브라제나 바이론(Pentadipladra brazzeana Baillon)의 열매에서 처음 추출된 감미 단백질이다(Ming et al., FEBS Letters, 355: 106-108, 1994). 브라제인은 수크로오스(sucrose)와 비교했을 때 약 500배 내지 2,000배 이상의 단맛을 나타내며(Jin et al., Chem. Senses. 28: 491-498, 2003), 주 타입(major type)과 부 타입(minor type)의 2가지 형태가 있다. 식물에서 추출한 브라제인의 대부분인 주 타입은 아미노 말단 부위에 피로글루탐산(pyroglutamic acid) 잔기를 포함하여 54개의 아미노산을 가진다. 반면 부 타입의 브라제인은 아미노 말단 부위의 피로글루탐산 잔기 없이 53개의 아미노산 잔기만을 가지며 주 타입의 브라제인에 비해 약 2배 정도 강한 단맛을 보인다(Assadi-Porter et al., Arch.. Biochem. Biophys. 376: 259-265, 2000). 브라제인은 감미 단백질 중 가장 작은 크기로 약 6.5 kDa의 분자량을 갖고 있으며, 1개의 서브유닛(subunit)으로 구성된 단량체(monomer)이다. 단일 폴리펩티드(single polypeptide)로 이루어져 있으며 1개의 α-나선(helix)과 2개의 β-병풍구조(sheet)로 구성된다. 브라제인은 8개의 시스테인(cysteine) 잔기를 가져 분자 내에 4개의 이황화 결합(disulfide bond)를 형성하고 있어 열안정성이 매우 높다. 또한 물에 대한 용해도 및 pH 안정성이 매우 높다(Gao et al., Int. J. Biol. macromol. 24: 351-359, 1999).
미국특허(UP 6,274,707 B1) 및 아사디 포터 등(Assadi-Porter et al., Arch.. Biochem. Biophys. 376: 259-265, 2000)은 상기와 같은 브라제인을 대장균을 이용한 유전공학적 방법으로 재조합 브라제인을 생산하는 방법을 기술하고 있는데, 브라제인을 암호화하고 있는 유전자를 합성하여 이를 SNase를 포함하고 있는 재조합 벡터에 삽입하여 새로운 형질전환 벡터를 생성한 후, 이를 다시 대장균에 도입하여 최종 SNase와 연결된 융합 단백질을 발현, 정제하는 방법이 개시되어 있다. 그러나, SNase와 융합되어 발현된 브라제인은 불용성응집체(Inclusion body)를 생성하며 이를 다시 리폴딩(refolding)시키고 시아노브로마이드(cyanobromide, CNBr)을 이용하여 SNase와 메티오닌(Met)을 제거하는 방법으로 분리, 정제하기 때문에 기술적으로 복잡하고 어려워 대량 생산에 의한 상업화가 곤란한 단점이 있었다. 이에 본 발명자들은 기존 연구의 단점을 해결하고자 선행연구를 통해 대장균 pelB 신호서열 및 브라제인 유전자를 포함하는 폴리뉴클레오티드 및 이를 이용한 브라제인의 제조방법을 특허 출원(한국특허출원 제2006-97619호)한 바 있다.
이에 본 발명자는 열안정성이 높고, 우수한 단맛을 나타내는 천연 감미료를 찾기 위해 브라제인을 구성하고 있는 아미노산 중 구조에 영향을 주지 않을 것이라 예상되는 특정 위치의 아미노산의 변이체 및 다중 변이체를 제조하였고, 이 중 종래의 브라제인과 동등한 열안정성 및 pH 안정성 및 높은 수용성 등의 특성을 가지면서 더 높은 단맛을 나타내는 변이체 및 다중 변이체를 탐색 및 개발함으로써 본 발명을 완성하였다.
따라서 본 발명의 목적은 종래의 브라제인 부타입의 단백질과 동등한 높은 열안정성 및 pH 안정성 및 높은 수용성 등의 특성을 가지면서 적게는 2배에서 많게는 20배 이상의 단맛을 나타내는 새로운 브라제인 변이체 및 다중 변이체 및 이의 용도를 제공하는 것이다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 단맛이 종래의 천연형의 브라제인보다 우수한 새로운 브라제인 변이체를 제공한다.
본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 브라제인 변이체 및 다중 변이체를 암호화하는 폴리뉴클레오티드를 제공한다.
본 발명의 또다른 목적을 달성하기 위하여, 본 발명은 상기 폴리뉴클레오티드를 포함하는 재조합 발현벡터, 상기 벡터로 형질전환된 대장균 및 상기 대장균을 이용한 브라제인 변이체의 제조방법을 제공한다.
본 발명의 또다른 목적을 달성하기 위하여, 본 발명은 브라제인 변이체 및 다중 변이체를 유효성분으로 포함하는 당도 증진용 식품 조성물을 제공한다.
이하, 본 발명을 상세히 설명한다.
본 발명은 당도가 종래의 천연형에 비해 우수한 새로운 브라제인 변이체 및 다중 변이체를 제공하는 것을 특징으로 한다.
본 발명의 일 실시예에서는 위치-지정 돌연변이유도(site-directed mutagenesis)법에 의하여 브라제인 부타입의 5번째 아미노산인 라이신 잔기, 28번째 아미노산인 아스파르트산 잔기, 30번째 아미노산인 히스티딘 잔기, 35번째 아미노산인 글루타민산 잔기, 40번째 아미노산인 글루타민산 잔기 또는 42번째 아미노산인 아르기닌 잔기를 다른 아미노산으로 치환한 40종의 브라제인 변이체를 암호화하는 재조합 벡터를 제조하였다.
본 발명의 다른 실시예에서는 상기에서 제조한 재조합벡터를 이용하여 각각의 브라제인 변이체를 발현하고 이를 정제하였고 그 결과, 순도 높은 브라제인 변이체를 얻을 수 있었다.
본 발명의 또다른 실시예에서는 상기에서 제조한 브라제인 변이체와 브라제인 부타입 단백질 활성(단맛)과 열안정성을 측정하였다. 그 결과, 브라제인 부타입의 단백질의 30번째 아미노산인 히스티딘 잔기가 아르기닌 잔기로, 35번째 아미노산인 글루타민산 잔기가 아스파르트산 잔기로, 40번째 글루타민산 잔기가 알라닌 잔기, 아스파르트산 잔기, 라이신 잔기 및 아르기닌 잔기로 치환한 변이체가 브라제인 부타입 단백질에 비해서 활성(단맛)이 높고 대등한 열안정성을 가져 더 높은 단맛을 나타내기 위한 브라제인 다중 변이체의 제작을 위하여 선별되었으며, 그 자체로 우수한 감미료로 사용될 수 있음을 알 수 있었다.
본 발명의 또다른 실시예에서는 상기에서 제조한 브라제인 변이체를 적절히 조합하여 브라제인 9종의 2차 변이체, 4종의 3차 변이체 및 3차 변이체를 바탕으로 브라제인 부타입의 29번째 라이신 잔기와 30번째 히스티딘 잔기사이에 라이신 잔기를 삽입(insertion)한 4종의 4차 변이체 총 17종의 브라제인 다중 변이체를 암호화하는 재조합 벡터를 제조하여 상기의 실시예와 동일한 방법으로 발현, 정제 및 활성(단맛)을 측정하였다. 그 결과 순도 높은 브라제인 변이체를 얻을 수 있었으며, 브라제인 부타입 단백질과 동일한 안정성을 가지며 브라제인 부타입 단백질과 비교하였을 때 최소 4에서 최대 20배 이상의 단맛을 나타내는 브라제인 변이체를 제작할 수 있었다. 이를 통해 상기에서 선별된 브라제인 변이체를 이용하여 제작한 브라제인 다중 변이체 역시 우수한 감미료로 사용될 수 있음을 알 수 있었다.
따라서, 본 발명은 브라제인 부타입의 30번째 아미노산인 히스티딘(histidine) 잔기, 35번째 아미노산인 글루타민산(glutamic acid) 잔기 또는 40번째 글루타민산(glutamic acid) 잔기가 다른 아미노산으로 치환된 브라제인 변이체를 제공한다.
한 구체예에서, 본 발명의 브라제인 변이체는 예를 들어, 30번째 아미노산인 히스티딘(histidine) 잔기가 아르기닌(arginine) 잔기로 치환된 서열번호 100의 아미노산 서열을 가지는 브라제인 변이체, 35번째 아미노산인 글루타민산(glutamic acid) 잔기가 아스파르트산(aspartic acid) 잔기로 치환된 서열번호 109의 아미노산 서열을 가지는 브라제인 변이체, 또는 40번째 글루타민산(glutamic acid) 잔기가 각각 알라닌(alanine) 잔기, 아스파르트산(aspartic acid) 잔기, 라이신(lysine)잔기 또는 아르기닌(arginine) 잔기로 치환된 서열번호 113, 서열번호 114, 서열번호 115 또는 서열번호 117의 아미노산 서열을 가지는 브라제인 변이체 일 수 있다.
다른 구체예에서, 본 발명의 브라제인 변이체는 상기에서 언급한 30번째 아미노산인 히스티딘(histidine) 잔기, 35번째 아미노산인 글루타민산(glutamic acid) 잔기 또는 40번째 글루타민산(glutamic acid) 잔기가 둘 이상 변형된 다중 변이체일 수 있으며, 예를 들면 서열번호 142, 서열번호 143, 서열번호 144, 서열번호 145, 서열번호 146, 서열번호 147, 서열번호 148, 서열번호 149, 서열번호 150, 서열번호 151, 서열번호 152, 서열번호 153 또는 서열번호 154의 아미노산 서열을 가지는 브라제인 변이체일 수 있다.
또한 본 발명의 브라제인 변이체는 서열번호 151, 서열번호 152, 서열번호 153 및 서열번호 154의 아미노산 서열을 가지는 브라제인 변이체의 29번째 라이신(lysine)잔기와 30번째 히스티딘(histidine) 잔기 사이에 라이신(lysine)잔기가 삽입된 것으로 바람직하게는 서열번호 155, 서열번호 156, 서열번호 157 또는 서열번호 158의 아미노산 서열을 가질 수 있다.
한편, 본 발명은 상기 브라제인 변이체를 암호화하는 폴리뉴클레오티드를 제공한다. 상기 폴리뉴클레오티드는 서열번호 100, 서열번호 109, 서열번호 113, 서열번호 114, 서열번호 115 또는 서열번호 117의 아미노산 서열을 암호화하는 폴리뉴클레오티드일 수 있으며, 바람직하게는 서열번호 100의 아미노산 서열에 대해서는 서열번호 59의 염기서열, 서열번호 109의 아미노산 서열에 대해서는 서열번호 68의 염기서열, 서열번호 113의 아미노산 서열에 대해서는 서열번호 72의 염기서열, 서열번호 114의 아미노산 서열에 대해서는 서열번호 73의 염기서열, 서열번호 115의 아미노산 서열에 대해서는 서열번호 74의 염기서열, 서열번호 117의 아미노산 서열에 대해서는 서열번호 76의 염기서열을 가질 수 있다.
또한, 본 발명의 상기 브라제인 다중 변이체를 암호화하는 폴리뉴클레오티드는 서열번호 142, 서열번호 143, 서열번호 144, 서열번호 145, 서열번호 146, 서열번호 147, 서열번호 148, 서열번호 149, 서열번호 150, 서열번호 151, 서열번호 152, 서열번호 153, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157 또는 서열번호 158의 아미노산 서열을 암호화하는 폴리뉴클레오티드일 수 있으며, 바람직하게는 서열번호 142의 아미노산 서열에 대해서는 서열번호 123의 염기서열, 서열번호 143의 아미노산 서열에 대해서는 서열번호 124의 염기서열, 서열번호 144의 아미노산 서열에 대해서는 서열번호 125의 염기서열, 서열번호 145의 아미노산 서열에 대해서는 서열번호 126의 염기서열, 서열번호 146의 아미노산 서열에 대해서는 서열번호 127의 염기서열, 서열번호 147의 아미노산 서열에 대해서는 서열번호 128의 염기서열, 서열번호 148의 아미노산 서열에 대해서는 서열번호 129의 염기서열, 서열번호 149의 아미노산 서열에 대해서는 서열번호 130의 염기서열, 서열번호 150의 아미노산 서열에 대해서는 서열번호 131의 염기서열, 서열번호 151의 아미노산 서열에 대해서는 서열번호 132의 염기서열, 서열번호 152의 아미노산 서열에 대해서는 서열번호 133의 염기서열, 서열번호 153의 아미노산 서열에 대해서는 서열번호 134의 염기서열, 서열번호 154의 아미노산 서열에 대해서는 서열번호 135의 염기서열, 서열번호 155의 아미노산 서열에 대해서는 서열번호 138의 염기서열, 서열번호 156의 아미노산 서열에 대해서는 서열번호 139의 염기서열, 서열번호 157의 아미노산 서열에 대해서는 서열번호 140의 염기서열, 서열번호 158의 아미노산 서열에 대해서는 서열번호 141의 염기서열을 가질 수 있다.
아울러, 본 발명은 프로모터 및 이와 작동가능하게 연결된 상기 폴리뉴클레오티드를 포함하는 브라제인 변이체 및 다중 변이체 발현용 재조합 발현벡터를 제공한다.
상기 ‘프로모터’란 특정한 숙주 세포에서 작동 가능하게 연결된 핵산 서열의 발현을 조절하는 DNA 서열을 의미하며, ‘작동 가능하게 연결된다(operably linked)’는 것은 하나의 핵산 단편이 다른 핵산 단편과 결합되어 그의 기능 또는 발현이 다른 핵산 단편에 의해 영향을 받는 것을 말한다. 아울러, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및 전사 및 해독의 종결을 조절하는 서열을 추가로 포함할 수 있다. 상기 프로모터로는 모든 시간대에 상시적으로 목적 유전자의 발현을 유도하는 프로모터(constitutive promoter) 또는 특정한 위치, 시기에 목적 유전자의 발현을 유도하는 프로모터(inducible promoter)를 사용할 수 있으며, 그 예로는 대장균 pelB 프로모터, U6 프로모터, CMV(cytomegalovirus) 프로모터, SV40 프로모터, CAG 프로모터(Hitoshi Niwa et al., Gene, 108:193-199, 1991; Monahan et al., Gene Therapy, 7:24-30, 2000), CaMV 35S 프로모터(Odell et al., Nature 313:810-812, 1985), Rsyn7 프로모터(미국특허출원 제08/991,601호), 라이스 액틴(rice actin) 프로모터(McElroy et al., Plant Cell 2:163-171, 1990), 유비퀴틴 프로모터(Christensen et al., Plant Mol. Biol. 12:619-632, 1989), ALS 프로모터(미국 특허출원 제08/409,297) 등이 있다. 이외에도 미국특허 제5,608,149; 제5,608,144호 제5,604,121호 제5,569,597호, 제5,466,785호, 제5,399,680호 제5,268,463호 및 제5,608,142호 등에 개시된 프로모터들을 모두 사용할 수 있다. 바람직하게는 상기 프로모터는 대장균 pelB 프로모터를 사용할 수 있다.
대장균 pelB 신호서열은 대장균의 세포막 간극 신호서열의 일종으로(Rietsch et al., Proc. Natl. Acad. Sci. USA, 93: 130408-13053, 1996, Raina et al., Ann. Rev. Microbiol. 51: 179-202, 1997, Sone et al., J. Biol. Chem. 272: 10349-10352, 1997), 본 발명의 브라제인이 합성되면 대장균의 세포막 간극으로 이동시켜 정확한 이황화 결합을 유도하게 하고, 브라제인 단백질의 불용성 응집체 형성을 억제하며, 불필요한 대장균 유래의 단백질을 최소로 하여 정제과정을 용이하게 할 수 있다. 본 발명의 대장균 pelB 신호서열은 바람직하게는 서열번호 137의 염기서열을 가지며, 본 발명의 브라제인 변이체의 뉴클레오티드 서열의 5‘ 상단에 단백질로의 번역시 동일한 프레임을 가지도록 연결된다.
본 발명에서 “재조합 발현벡터”란 숙주세포에서 목적 단백질 발현(expression) 또는 목적 RNA을 전사(transcription)할 수 있는 벡터로서, 유전자 삽입물이 발현되도록 작동가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 제작물을 말한다.
본 발명의 벡터는 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터 및 바이러스 벡터 등을 포함하나 이에 제한되지 않는다. 적합한 발현벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널 및 인핸서(촉진유전자) 같은 발현 조절 서열 외에도 막 표적화 또는 분비를 위한 시그널 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다. 또한 발현벡터는 벡터를 함유하는 숙주 세포를 선택하기 위한 선택 마커를 포함하고, 복제 가능한 발현벡터인 경우 복제 기원을 포함한다.
상기에서 본 발명의 브라제인 변이체 발현을 위한 재조합 발현벡터는 바람직하게는 pET26B(+)-Brazzein(H30R), pET26B(+)-Brazzein(E35D), pET26B(+)-Brazzein(E40A), pET26B(+)-Brazzein(E40D), pET26B(+)-Brazzein(E40K) 또는 pET26B(+)-Brazzein(E40R)일 수 있으며, 이는 각각 pET26B(+)-Brazzein(Met-)를 주형(template)으로 하여 pET26B(+)-Brazzein(H30R)의 경우는 서열번호 19, pET26B(+)-Brazzein(E35D)의 경우는 서열번호 28, pET26B(+)- Brazzein(E40A)의 경우는 서열번호 32, pET26B(+)-Brazzein(E40D)의 경우는 서열번호 33, pET26B(+)-Brazzein(E40K)의 경우는 서열번호 34, pET26B(+)- Brazzein(E40R)의 경우는 서열번호 36을 이용한 위치-지정 돌연변이유도(site-directed mutagenesis)법에 의하여 제조할 수 있다.
또한, 상기에서 본 발명의 브라제인 다중 변이체 중 브라제인 2차 변이체의 발현을 위한 재조합 발현벡터는 바람직하게는 pET26B(+)-Brazzein(H30R_E35D), pET26B(+)-Brazzein(H30R_E40A), pET26B(+)-Brazzein(H30R_E40D), pET26B(+)-Brazzein(H30R_E40K) 또는 pET26B(+)-Brazzein(H30R_E40R)일 수 있으며, 이는 각각 pET26B(+)-Brazzein(H30R)을 주형(template)으로 하여, pET26B(+)-Brazzein(H30R_E35D)의 경우는 서열번호 28, pET26B(+)- Brazzein(H30R_E40A)의 경우는 서열번호 32, pET26B(+)-Brazzein(H30R_E40D)의 경우는 서열번호 33, pET26B(+)- Brazzein(H30R_E40K)의 경우는 서열번호 34, pET26B(+)-Brazzein(H30R_E40R)의 경우는 서열번호 36을 이용하여 위치-지정 돌연변이유도(site-directed mutagenesis)법에 의하여 제조할 수 있다.
또한, 상기에서 본 발명의 브라제인 다중 변이체 중 브라제인 또다른 2차 변이체의 발현을 위한 재조합 발현벡터는 바람직하게는 pET26B(+)- Brazzein(E35D_E40A), pET26B(+)-Brazzein(E35D_E40D), pET26B(+)- Brazzein(E35D_E40K) 또는 pET26B(+)-Brazzein(E35D_E40R)일 수 있으며, 이는 각각 pET26B(+)-Brazzein(E35D)를 주형(template)으로 하여, pET26B(+)- Brazzein(E35D_E40A)의 경우는 서열번호 32, pET26B(+)-Brazzein(E35D_E40D)의 경우는 서열번호 33, pET26B(+)-Brazzein(E35D_E40K)의 경우는 서열번호 34, pET26B(+)-Brazzein(E35D_E40R)의 경우는 서열번호 36을 이용하여 위치-지정 돌연변이유도(site-directed mutagenesis)법에 의하여 제조할 수 있다.
또한, 상기에서 본 발명의 브라제인 다중 변이체 중 브라제인 3차 변이체의 발현을 위한 재조합 발현벡터는 바람직하게는 pET26B(+)-Brazzein(H30R_E35D_E40A), pET26B(+)-Brazzein(H30R_E35D_E40D), pET26B(+)-Brazzein(H30R_E35D_ E40K) 또는 pET26B(+)-Brazzein(H30R_E35D_E40R)일 수 있으며, 이는 각각 pET26B(+)-Brazzein(H30R_E35D)을 주형(template)으로 하여 pET26B(+)- Brazzein(H30R_E35D_E40A)의 경우는 서열번호 32, pET26B(+)- Brazzein(H30R_E35D_E40D)의 경우는 서열번호 33 , pET26B(+)- Brazzein(H30R_E35D_E40K)의 경우는 서열번호 34 ,pET26B(+)- Brazzein(H30R_E35D_E40R)의 경우는 서열번호 36을 이용하여 위치-지정 돌연변이유도(site-directed mutagenesis)법에 의하여 제조할 수 있다.
또한, 상기에서 본 발명의 브라제인 다중 변이체 중 브라제인 4차 변이체의 발현을 위한 재조합 발현벡터는 바람직하게는 pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40A), pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40D) , pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40K) 또는 pET26B(+)- Brazzein(29ins30 Lys_H30R_E35D_E40R)일 수 있으며, 이는 각각 서열번호 136의 프라이머로 사용하여 pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40A)의 경우는 pET26B(+)-Brazzein(H30R_E35D_E40A)를, pET26B(+)-Brazzein (29ins30 Lys_H30R_E35D_E40D)의 경우는 pET26B(+)-Brazzein (H30R_ E35D_E40D)를, pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40K)의 경우는 pET26B(+)-Brazzein(H30R_E35D_E40K)를 , pET26B(+)-Brazzein (29ins30 Lys_H30R_E35D_E40R)의 경우는 pET26B(+)-Brazzein(H30R_E35D_E40R)를 각각 주형(template)으로 하여 위치-지정 돌연변이유도(site-directed mutagenesis)법에 의하여 제조할 수 있다.
본 발명은 또한, 상기 재조합 발현벡터를 포함하는 대장균을 제공한다. 상기 대장균은 상기 재조합 발현벡터로 통상의 형질전환방법에 따라 형질전환되고, 이 때, 형질전환은 핵산을 숙주세포에 도입하는 어떤 방법도 포함되며, 당 분야에서 공지된 바와 같이 숙주세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 전기충격유전자전달법(electroporation), 인산 칼슘(CaPO4) 침전, 염화 칼슘(CaCl2) 침전, 미세사출법(microprojectile bombardment), 전기천공법(electroporation), PEG-매개 융합법(PEG-mediated fusion), 미세주입법(microinjection), 리포좀 매개법(liposome-mediated method) 등이 포함되나 이로 제한되지 않는다.
본 발명은 상기 형질전환된 대장균을 배양하고, 배양된 대장균에서 세포막간극 단백질을 분리하고, 브라제인을 정제하기 위해 열처리하는 것을 포함하는 브라제인 변이체의 제조방법을 제공한다.
본원발명의 폴리뉴클레오티드를 포함하도록 형질전환된 대장균은 브라제인 변이체를 코딩하는 폴리뉴클레오티드가 발현되도록 적절한 배지 및 조건 하에서 배양될 수 있으며, 이는 통상적인 대장균의 배양 조건과 동일 또는 유사하다. 상기 형질전환된 대장균이 배양되는 동안, 발현벡터내의 발현 조절 서열에 의해 pelB 신호서열을 포함하는 브라제인이 발현되고, 이러한 본원발명에서의 브라제인의 발현은 IPTG(isopropyl-beta-D-thiogalactopyranoside)와 같은 통상적인 유도성 프로모터의 발현을 촉진하는 화합물 없이도 이루어진다. 발현된 pelB 신호서열을 포함하는 브라제인은 신호서열에 의해 대장균의 세포막간극으로 이동하게 되고, 대장균의 시그널 펩티다제(signal peptidase)에 의해 신호서열이 제거되어 브라제인이 합성되게 된다.
형질전환된 세포에서 발현된 브라제인을 대장균의 세포막 간극에서 분리하기 위해서는 대장균의 세포막 간극에서 단백질을 분리하는 공지의 방법(Snyder et al., J. Bacteriology, 177: 953963, 1995)을 이용할 수 있으며, 이에 한정되지는 않으나, 예를 들어, 배양된 대장균을 집균한 뒤, 20% 수크로우즈(Sucrose)가 포함된 30 mM 트리스-염산(Tri-HCl, pH 8)용액으로 현탁하고, EDTA(pH 8)용액 및 MgSO4를 이용하여 대장균의 세포막 간극의 단백질을 용출시키는 방법에 의해 수행될 수 있다.
대장균의 세포막 간극 단백질에서 본 발명의 브라제인을 분리하는 방법은 당업계에 공지된 다양한 분리 및 정제방법을 통해 수행할 수 있으며, 예를 들어, 염석(황산암모늄 침전 및 인산나트륨 침전), 용매 침전(아세톤, 에탄올 등을 이용한 단백질 분획 침전), 투석, 겔 여과, 이온 교환 크로마토그래피, 역상 컬럼 크로마토그래피 및 친화성 크로마토그래피 등의 기법을 단독 또는 조합으로 적용시켜 본 발명의 브라제인을 분리할 수 있다. 본 발명의 브라제인은 열에 안정하므로 바람직하게는 브라제인을 분리하는 방법은 열처리를 하여 수행될 수 있다. 이에 한정되지는 않으나 열처리는 바람직하게는 70 내지 90℃에서 15 내지 60분간 가열하여 브라제인을 제외한 다른 단백질을 열변성시킨 뒤 4℃에서 18000g에서 30분간 원심분리를 통하여 열변성된 단백질과 브라제인을 분리할 수 있다.
참고로, 상기에서 언급한 뉴클레오티드 및 단백질 작업에는 다음의 문헌을 참조할 수 있다(Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.(1982); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press(1989); Deutscher, M., Guide to Protein Purification Methods Enzymology, vol. 182. Academic Press. Inc., San Diego, CA(1990)).
상기한 바와 같이 본 발명에서 더 높은 단맛을 가지며 높은 열안정성을 가지는 서열번호 100, 서열번호 109, 서열번호 113, 서열번호 114, 서열번호 115 또는 서열번호 117의 아미노산 서열을 가지는 브라제인 변이체 및 서열번호 142, 서열번호 143, 서열번호 144, 서열번호 145, 서열번호 146, 서열번호 147, 서열번호 148, 서열번호 149, 서열번호 150, 서열번호 151, 서열번호 152, 서열번호 153, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157 또는 서열번호 158의 아미노산 서열을 가지는 브라제인 다중 변이체 효소학적 특성을 정리하면 하기와 같다.
1) 분자량: 6.5kDa
2) 높은 열안정성 및 내산성
3) 높은 수용성
4) 브라제인의 부타입의 단백질 기준 브라제인 변이체 단맛 비율: 2~3.3배 이상
5) 1g/100ml의 수크로오스 대비 브라제인 변이체 단맛 비율: 약 4,000~약 6,600배 이상
6) 브라제인의 부타입의 단백질 기준 브라제인 다중 변이체 단맛 비율: 4~20배 이상
7) 1g/100ml의 수크로오스 대비 브라제인 다중 변이체 단맛 비율: 약 8,000~약 40,000배 이상
이와 같이 본 발명에 따른 브라제인 변이체 및 이를 기본으로 작성된 브라제인 다중 변이체는 본 발명자의 특허출원(한국특허출원 제2006-97619호)에서 발현, 정제된 브라제인의 부타입의 단백질, 즉 천연형의 브라제인의 부타입의 단백질과 한국 특허출원 출원번호 제10-2007-0117013호에서 발현, 정제된 브라제인 변이체와 비교하였을 때 열안정성 및 내산성 및 수용성의 특성은 천연형의 브라제인과 유사하면서도 더 높은 단맛을 나타내는 신규 아미노산 서열을 가지는 것을 그 특징으로 한다.
또한, 이러한 본 발명에서의
브라제인 변이체는 미국특허(US6,274,707B1; US7,153,535)에 의해 공지된 브라제인 변이체보다 더 높은 단맛을 나타내며 효과가 있다.
따라서, 본 발명의 브라제인 변이체는 설탕, 과당, 올리고당과 같은 천연감미료 또는 아스파탐과 같은 인공감미료를 대신하여 사용될 수 있다. 그러므로, 본 발명은 또한 감미료의 제조를 위한 상기 브라제인 변이체의 용도, 식품 당도 증진을 위한 상기 브라제인 변이체의 용도, 상기 브라제인 변이체를 포함하는 감미료, 및 상기 브라제인 변이체를 감미료로서 포함하는 식품 조성물을 제공한다.
본 발명의 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형의 식품 조성물은 당 업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.
예를 들면, 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지 콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 브라제인 변이체를 첨가하여 제조할 수 있다.
또한, 본 발명의 브라제인 변이체를 함유하는 식품 조성물을 감미료와 같은 식품 첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다.
본 발명의 식품 조성물 중 본 발명의 브라제인 변이체의 바람직한 함유량으로는 식품의 전체 중량에 대해 약 0.01 내지 10중량%를 포함할 수 있다.
이상 살펴본 바와 같이, 본 발명의 브라제인 변이체는 종래의 브라제인보다 우수한 열안정성 및 내산성 및 수용성 등의 특성을 가지면서 종래의 브라제인에 비해 최소 2배에서 최대 3.3배 이상의 단맛을 가지고 있으며 브라제인 다중 변이체의 경우 브라제인 변이체와 마찬가지로 브라제인 부타입의 단백질과 동일한 안정성 및 최소 4배에서 최대 20배 이상의 단맛을 가지고 있다. 따라서, 본 발명의 브라제인 변이체는 적은 양으로도 더 많은 양의 설탕(수크로오스)과 같은 다른 감미료를 대체할 수 있어 식품 조성물 등에 감미료로서 다양하게 사용될 수 있다.
도 1은 본 발명에 의한 브라제인 변이체를 발현하기 위한 재조합 발현벡터를 제작하는 과정을 나타낸 모식도이다.
도 2 내지 4는 본 발명에 의한 브라제인 변이체와 브라제인 다중 변이체를 제작하는 과정을 나타낸 모식도이다.
도 5는 본 발명에 의한 브라제인 변이체의 단맛 측정 후 높은 단맛을 나타내는 브라제인 변이체를 선별하여 열안정성을 수행한 결과이다.
레인 1: 열처리 후 브라제인 부타입(minor type)의 상대 활성도
레인 2 : 열처리 후 브라제인 변이체 (H30K)의 상대 활성도
레인 3 : 열처리 후 브라제인 변이체 (H30R)의 상대 활성도
레인 4 : 열처리 후 브라제인 변이체 (E35D)의 상대 활성도
레인 5 : 열처리 후 브라제인 변이체 (E40A)의 상대 활성도
레인 6: 열처리 후 브라제인 변이체 (E40D)의 상대 활성도
레인 7: 열처리 후 브라제인 변이체 (E40K)의 상대 활성도
레인 8: 열처리 후 브라제인 변이체 (E40H)의 상대 활성도
레인 9: 열처리 후 브라제인 변이체 (E40R)의 상대 활성도
도 6은 본 발명에 의한 브라제인 다중 변이체를 확인하기 위한 전기영동 결과를 나타낸 것이다.
레인 M : 분자량 마커
레인 1 : 정제된 브라제인 2차 변이체 (H30R_E35D)
레인 2 : 정제된 브라제인 2차 변이체 (H30R_E40A)
레인 3 : 정제된 브라제인 2차 변이체 (H30R_E40D)
레인 4 : 정제된 브라제인 2차 변이체 (H30R_E40K)
레인 5 : 정제된 브라제인 2차 변이체 (H30R_E40R)
레인 6 : 정제된 브라제인 2차 변이체 (E35D_E40A)
레인 7 : 정제된 브라제인 2차 변이체 (E35D_E40D)
레인 8 : 정제된 브라제인 2차 변이체 (E35D_E40K)
레인 9 : 정제된 브라제인 2차 변이체 (E35D_E40R)
레인 10 : 정제된 브라제인 3차 변이체 (H30R_E35D_E40A)
레인 11 : 정제된 브라제인 3차 변이체 (H30R_E35D_E40D)
레인 12 : 정제된 브라제인 3차 변이체 (H30R_E35D_E40K)
레인 13 : 정제된 브라제인 3차 변이체 (H30R_E35D_E40R)
레인 14 : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40A)
레인 15 : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40D)
레인 16 : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40K)
레인 17 : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40R)
도 7은 본 발명에 의한 브라제인 변이체의 정제도 및 구조적 차이를 비교하기 위해 역상 크로마토그래피를 수행한 결과를 나타낸 것이다.
A: 정제된 브라제인 부타입(minor type)
B : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40A)
C : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40D)
D : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40K)
E : 정제된 브라제인 4차 변이체 (29ins30 Lys_H30R_E35D_E40R)
이상 살펴본 바와 같이, 본 발명의 브라제인 변이체는 종래의 브라제인보다 우수한 열안정성 및 내산성 및 수용성 등의 특성을 가지면서 종래의 브라제인에 비해 최소 2배에서 최대 3.3배 이상의 단맛을 가지고 있으며 브라제인 다중 변이체의 경우 브라제인 변이체와 마찬가지로 브라제인 부타입의 단백질과 동일한 안정성 및 최소 4배에서 최대 20배 이상의 단맛을 가지고 있다. 따라서, 본 발명의 브라제인 변이체는 적은 양으로도 더 많은 양의 설탕(수크로오스)과 같은 다른 감미료를 대체할 수 있어 식품 조성물 등에 감미료로서 다양하게 사용될 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<실시예 1>
브라제인 1차 변이체를 암호화하는 폴리뉴클레오티드의 클로닝
브라제인보다 높은 단맛을 나타내는 브라제인 변이체를 제조하기 위해 먼저 브라제인의 부타입(minor type)을 구성하고 있는 하나의 특정 아미노산을 선택하여 다른 특정 아미노산으로 변이시키는 작업을 수행하였다.
먼저 변이시킬 특정 아미노산으로 브라제인의 구조 분석을 통하여 외부잔기(side chain)가 밖으로 향해 있으며, 극성을 가지는 잔기를 선택하였다. 이러한 구조적 정보를 바탕으로 본 발명자의 특허출원(한국특허출원 제2006-97619호)에서 사용한 대장균 내에서 브라제인의 부타입의 단백질이 합성되도록 불필요한 "ATG" 서열을 제거한 서열번호 1의 서열을 포함하는 재조합 발현벡터(pET26B(+)-Brazzein(Met-), 실시예 6 참조)를 주형으로 하기의 표 1에 명시된 40개의 프라이머와 각각의 프라이머와 상보적인 서열을 갖는 프라이머를 합성하였다. 상기 프라이머들은 브라제인 부타입 단백질을 구성하고 있는 특정 아미노산(표 1 참조)의 외부잔기 길이 및 전기적 성격을 고려하여 설계되었다. 하기 표 1의 프라이머와 QuikChangeTM Site-Directed Mutagenesis Kit(Stratagene, 미국)를 이용하여 제조사의 지침에 따라 브라제인 부타입의 단백질의 특정 위치를 치환시킨 40종의 브라제인 변이체를 암호화하고 있는 뉴클레오티드를 포함하는 발현벡터를 얻을 수 있었다. 이 때, 하기 표 1의 프라이머 서열 중 아래 밑줄 부분은 브라제인 변이체를 위해 변화된 서열을 나타낸다.
표 1
Figure PCTKR2009004855-appb-T000001
Figure PCTKR2009004855-appb-I000001
Figure PCTKR2009004855-appb-I000002
구체적으로, pET26B(+)-Brazzein(Met-) 벡터 10 ng, 각각 최종농도 0.2 mM의 dNTP 혼합물, 각각 125 ng의 상기 표 1에 명시된 프라이머, 10× 반응버퍼 5 ㎕, PfuTurbo DNA polymerase(2.5 U/㎕,Stratagene, 미국) 1 ㎕를 포함하는 전체 50 ㎕를 반응액으로 PCR을 수행하였다. 상기 PCR 반응은 95℃ 1분간 전변성시킨 다음 95℃ 30초, 55℃ 1분. 68℃ 15분을 20회 반응시키고 68℃에서 15분간 최종반응을 시켰다. 반응이 끝난 후 1.0% 아가로스(agarose) 겔 전기영동에 의해 증폭된 생성물을 확인하고 증폭이 이루어진 생성물을 37℃에서 1시간동안 DpnⅠ으로 처리하였다. 그런 후 바로 슈퍼컴페턴트 세포(supercompetent cell)인 대장균 XL1-Blue를 형질전환하였다. 상기 형질전환된 XL1-Blue는 50 ㎍/㎖의 카나마이신(kanamycin)이 함유된 LB-아가 플레이트(LB-agar plate)에서 12시간 배양하여 선별하고, 선별된 콜로니를 LB-아가 배지에서 배양하여 대장균으로부터 DNA를 분리하였다. 상기 분리된 DNA에 대해서 pelB 신호 서열과 각각의 브라제인 변이체를 암호화하고 있는 뉴클레오티드가 연결되어 있음을 유전자 분석을 통하여 확인하였다. 이는 하기 표 2의 명시되어 있는 서열번호 및 뉴클레오티드 명으로 명명하였다. 이 때, 하기 표 2 및 이하에서 변이체를 지칭하는 방법은 예를 들어 K5D의 경우 브라제인의 부(minor) 타입 단백질의 5번 위치의 라이신(Lysine)잔기를 아스파르트산(Aspartic aicd) 잔기로 치환하였음을 나타낸다. 각각의 아미노산을 지칭하는 1문자는 공지된 아미노산 코드에 따라 지정하였다.
표 2 브라제인 1차 변이체를 암호화하고 있는 폴리뉴클레오티드 명 및 서열번호
브라제인 1차 변이체 위치 각각의 브라제인 1차 변이체를 암호화하고 있는 뉴클레오티드 명 서열번호
K5A E. coli pelB +Brazzein(K5A) gene 서열번호 42
K5D E. coli pelB +Brazzein(K5D) gene 서열번호 43
K5E E. coli pelB +Brazzein(K5E) gene 서열번호 44
K5H E. coli pelB +Brazzein(K5H) gene 서열번호 45
K5R E. coli pelB +Brazzein(K5R) gene 서열번호 46
D28A E. coli pelB +Brazzein(D28A) gene 서열번호 47
D28H E. coli pelB +Brazzein(D28H) gene 서열번호 48
D28K E. coli pelB +Brazzein(D28K) gene 서열번호 49
D28R E. coli pelB +Brazzein(D28R) gene 서열번호 50
D28E E. coli pelB +Brazzein(D28E) gene 서열번호 51
K29A E. coli pelB +Brazzein(K29A) gene 서열번호 52
K29R E. coli pelB +Brazzein(K29R) gene 서열번호 53
K29H E. coli pelB +Brazzein(K29H) gene 서열번호 54
K29D E. coli pelB +Brazzein(K29D) gene 서열번호 55
K29E E. coli pelB +Brazzein(K29E) gene 서열번호 56
H30A E. coli pelB +Brazzein(H30A) gene 서열번호 57
H30K E. coli pelB +Brazzein(H30K) gene 서열번호 58
H30R E. coli pelB +Brazzein(H30R) gene 서열번호 59
H30D E. coli pelB +Brazzein(H30D) gene 서열번호 60
H30E E. coli pelB +Brazzein(H30E) gene 서열번호 61
R32A E. coli pelB +Brazzein(R32A) gene 서열번호 62
R32K E. coli pelB +Brazzein(R32K) gene 서열번호 63
R32H E. coli pelB +Brazzein(R32H) gene 서열번호 64
R32D E. coli pelB +Brazzein(R32D) gene 서열번호 65
R32E E. coli pelB +Brazzein(R32E) gene 서열번호 66
E35A E. coli pelB +Brazzein(E35A) gene 서열번호 67
E35D E. coli pelB +Brazzein(E35D) gene 서열번호 68
E35K E. coli pelB +Brazzein(E35K) gene 서열번호 69
E35H E. coli pelB +Brazzein(E35H) gene 서열번호 70
E35R E. coli pelB +Brazzein(E35R) gene 서열번호 71
E40A E. coli pelB +Brazzein(E40A) gene 서열번호 72
E40D E. coli pelB +Brazzein(E40D) gene 서열번호 73
E40K E. coli pelB +Brazzein(E40K) gene 서열번호 74
E40H E. coli pelB +Brazzein(E40H) gene 서열번호 75
E40R E. coli pelB +Brazzein(E40R) gene 서열번호 76
R42A E. coli pelB +Brazzein(R42A) gene 서열번호 77
R42K E. coli pelB +Brazzein(R42K) gene 서열번호 78
R42H E. coli pelB +Brazzein(R42H) gene 서열번호 79
R42D E. coli pelB +Brazzein(R42D) gene 서열번호 80
R42E E. coli pelB +Brazzein(R42E) gene 서열번호 81
상기 실험결과 총 종의 브라제인 변이체를 위한 발현 벡터를 제작할 수 있었으며 이를 다시 대장균 BL21(star)로 형질 전환하여 대량발현에 이용하였다(도 1 참조).
<실시예 2>
브라제인 1차 변이체의 발현 및 정제
<2-1> 브라제인 1차 변이체의 발현
상기 <실시예 1>에서 제작한 브라제인 1차 변이체를 위한 32종의 발현 벡터를 도입한 각각의 대장균 BL21(star)을 30 ㎕/㎖의 카나마이신(kanamycin)이 포함된 LB 배지 1ℓ에서 단백질 유도제인 IPTG(isopropyl β-D-thoigalactopyranoside)의 첨가없이 37℃에서 12시간 배양하여 각각의 형질전환된 대장균에서 각각의 브라제인 변이체가 발현되도록 하였다.
<2-2> 브라제인 변이체의 정제
상시 <실시예 2-1>에서 배양된 각각의 대장균을 8,000g에서 10분간 원심 분리하여 집균하였다. 집균 후, 20% 수크로우즈(Sucrose)가 포함된 30 mM 트리스-염산(Tri-HCl, pH 8.0)용액으로 현탁시킨 뒤, 0.5 M EDTA(pH 8.0)용액을 최종농도가 1 mM이 되도록 첨가하고 상온에서 10분 동안 천천히 교반시켰다. 이를 10,000g, 4℃에서 10분 동안 원심분리를 하고 상층액을 제거한 뒤, 차가운 5 mM MgSO4를 첨가하고, 얼음위에서 10분 동안 천천히 교반시켰다. 이 과정에서 세포막간극(periplasm)의 단백질이 완충용액으로 이탈되어 나온다. 이 후, 10,000g, 4℃에서 10분 동안 원심분리를 수행하여 상층액을 분리하고, 세포막간극(periplasm)에 존재하는 브라제인 변이체를 정제하기 위하여 80℃에서 30분간 열처리를 하였다. 이 후, 증류수로 24시간 동안 투석 후 동결 건조하여 하기의 표 3의 서열번호로 표시되는 정제된 브라제인 1차 변이체를 얻을 수 있었으며 정제도는 일차적으로 SDS-PAGE를 통해 확인하였다.
표 3 브라제인 1차 변이체명 및 서열번호
브라제인 1차 변이체 위치 각각의 브라제인 변이체 명 서열번호
- Brazzein(minor type) 서열번호 82
K5A Brazzein(K5A) 서열번호 83
K5D Brazzein(K5D) 서열번호 84
K5E Brazzein(K5E) 서열번호 85
K5H Brazzein(K5H) 서열번호 86
K5R Brazzein(K5R) 서열번호 87
D28A Brazzein(D28A) 서열번호 88
D28H Brazzein(D28H) 서열번호 89
D28K Brazzein(D28K) 서열번호 90
D28R Brazzein(D28R) 서열번호 91
D28E Brazzein(D28E) 서열번호 92
K29A Brazzein(K29A) 서열번호 93
K29R Brazzein(K29R) 서열번호 94
K29H Brazzein(K29H) 서열번호 95
K29D Brazzein(K29D) 서열번호 96
K29E Brazzein(K29E) 서열번호 97
H30A Brazzein(H30A) 서열번호 98
H30K Brazzein(H30K) 서열번호 99
H30R Brazzein(H30R) 서열번호 100
H30D Brazzein(H30D) 서열번호 101
H30E Brazzein(H30E) 서열번호 102
R32A Brazzein(R32A) 서열번호 103
R32K Brazzein(R32K) 서열번호 104
R32H Brazzein(R32H) 서열번호 105
R32D Brazzein(R32D) 서열번호 106
R32E Brazzein(R32E) 서열번호 107
E35A Brazzein(E35A) 서열번호 108
E35D Brazzein(E35D) 서열번호 109
E35K Brazzein(E35K) 서열번호 110
E35H Brazzein(E35H) 서열번호 111
E35R Brazzein(E35R) 서열번호 112
E40A Brazzein(E40A) 서열번호 113
E40D Brazzein(E40D) 서열번호 114
E40K Brazzein(E40K) 서열번호 115
E40H Brazzein(E40H) 서열번호 116
E40R Brazzein(E40R) 서열번호 117
R42A Brazzein(R42A) 서열번호 118
R42K Brazzein(R42K) 서열번호 119
R42H Brazzein(R42H) 서열번호 120
R42D Brazzein(R42D) 서열번호 121
R42E Brazzein(R42E) 서열번호 122
상기 실험결과, 브라제인 단백질이 순도 높게 정제되었으며, 그 분자량은 약 6.5kDa인 것으로 나타났다.
<2-3> 브라제인 1차 변이체의 정제도 확인 및 구조 변화 확인
정제되어진 브라제인의 부타입의 단백질과 상기 <실시예 2-2>로부터 정제된 각각의 브라제인 변이체의 정제도 확인 후 구조적 차이를 분석하기 위해 Varina사의 고성능 액체 크로마토그래피(High Performance Liquid Chromatography)에 역상 크로마토그래피(reverse-phase chromatography column)인 Vydac 214TP54(미국) 컬럼을 이용하여 분석하였다. 용매 조건은 물에 0.05% 트리플루오로아세트산(triflouroacetic acid)가 포함된 용매 A와 아세토나이트릴(acetonitrile)에 0.05% 트리플루오로아세트산(triflouroacetic acid)가 포함된 용매 B를 분당 1㎖의 유속으로 30분 동안 용매 B가 10%에서 50%가 되도록 순차적으로 구배(linear gradient)되도록 용출시켰다. 용출시킨 용액은 210nm에서 흡광도의 변화를 관찰하였다.
그 결과, 대부분의 브라제인 변이체가 15분의 지연시간(retention time)이 경과한 후에 용출되고 있음을 확인할 수 있었으며, 이는 발현된 브라제인 변이체의 구조적 차이가 거의 없음을 나타내는 결과이다.
<실시예 3>
브라제인 1차 변이체의 활성(단맛) 및 열안정성 측정
<3-1> 브라제인 1차 변이체의 단맛 측정
본 발명에서의 재조합 브라제인은 고리환을 가지는 당계열의 화합물이 아니기 때문에 당도계를 이용하여 단맛을 측정할 수 없어 사람의 미각을 이용하여 활성을 측정하였다. 당도측정은 수크로오스(sucrose)를 용액을 이용하여 최초 단맛을 느낄 수 있는 수크로오스 최소의 농도가 거의 유사하도록 훈련된 20명의 피실험자를 대상으로 하였고, 각각의 변이체를 이용하여 최초 단맛을 느낄 수 있는 농도를 측정하였다. 또한, 브라제인 비교 단맛 비율은 수크로오스 용액의 경우 단맛을 느끼는 최저 자극량이 1g/100㎖이었으며, 브라제인 부타입의 단백질의 경우 단맛을 느끼는 최저 자극양은 500㎍/100㎖이었으므로 이를 기준으로 산정하였다(즉, 브라제인 부타입의 경우 1/0.0005 = 2000).
표 4 각각의 브라제인 1차 변이체에 대한 단맛 테스트 결과
1차 변이체위치 서열번호 초기 단맛을 느끼는 최저 자극양 (㎍/100㎖) 수크로오스 (1g/100㎖) 대비 브라제인 1차 변이체 비교 단맛 비율(브라제인 부타입: 2000) 브라제인 부타입 비교 단맛 증가 배수
K5A 서열번호 83 6,000 167 0.08
K5D 서열번호 84 6,000 167 0.08
K5E 서열번호 85 6,000 167 0.08
K5H 서열번호 86 10,000 100 0.05
K5R 서열번호 87 10,000 100 0.05
D28A 서열번호 88 10,000 100 0.05
D28H 서열번호 89 6,000 167 0.08
D28K 서열번호 90 6,000 167 0.08
D28R 서열번호 91 6,000 167 0.08
D28E 서열번호 92 2,000 500 0.25
K29A 서열번호 93 10,000 100 0.05
K29R 서열번호 94 10,000 100 0.05
K29H 서열번호 95 10,000 100 0.05
K29D 서열번호 96 10,000 100 0.05
K29E 서열번호 97 10,000 100 0.05
H30A 서열번호 98 6,000 167 0.08
H30K 서열번호 99 250 4,000 2
H30R 서열번호 100 150 6,600 3.3
H30D 서열번호 101 3,000 334 0.16
H30E 서열번호 102 3,000 334 0.16
R32A 서열번호 103 6,000 167 0.08
R32K 서열번호 104 3,000 334 0.16
R32H 서열번호 105 3,000 334 0.16
R32D 서열번호 106 10,000 100 0.05
R32E 서열번호 107 10,000 100 0.05
E35A 서열번호 108 10,000 100 0.05
E35D 서열번호 109 150 6,600 3.3
E35K 서열번호 110 6,000 167 0.08
E35H 서열번호 111 6,000 167 0.08
E35R 서열번호 112 6,000 167 0.08
E40A 서열번호 113 150 6,600 3.3
E40D 서열번호 114 150 6,600 3.3
E40K 서열번호 115 150 6,600 3.3
E40H 서열번호 116 250 4,000 2
E40R 서열번호 117 250 4,000 2
R42A 서열번호 118 10,000 100 0.05
R42K 서열번호 119 3,000 334 0.16
R42H 서열번호 120 3,000 334 0.16
R42D 서열번호 121 10,000 100 0.05
R42E 서열번호 122 10,000 100 0.05
그 결과, 상기의 표 4에서 나타난 바와 같이 서열번호 99로 표시되는 브라제인(H30K), 서열번호 100으로 표시되는 브라제인(H30R), 서열번호 109로 표시되는 브라제인(E35D), 서열번호 113로 표시되는 브라제인(E40A), 서열번호 113으로 표시되는 브라제인(E40A), 서열번호 114로 표시되는 브라제인(E40D), 서열번호 115로 표시되는 브라제인(E40K), 서열번호 116으로 표시되는 변이체(E40H) 및 서열번호 117로 표시되는 변이체(E40R)를 브라제인 부타입의 단백질과 비교하였을 경우 최소 2배에서 최대 약 3.3배 이상(1g/100㎖의 수크로오스 대비 최소 약 4,000배에서 최대 약 6,600배)의 단맛을 나타내는 것으로 확인되었다. 특히, 브라제인(E40D)의 경우, 가장 높은 단맛 증가율을 나타내었다.
<3-2> 브라제인 1차 변이체의 열안정성 측정
상기 실시예 <3-1>에서 측정된 결과를 바탕으로 높은 단맛을 나타내는 브라제인 변이체 즉, 서열번호 99로 표시되는 브라제인(H30K), 서열번호 100으로 표시되는 브라제인(H30R), 서열번호 109로 표시되는 브라제인(E35D), 서열번호 113로 표시되는 브라제인(E40A), 서열번호 113으로 표시되는 브라제인(E40A), 서열번호 114로 표시되는 브라제인(E40D), 서열번호 115로 표시되는 브라제인(E40K), 서열번호 116으로 표시되는 변이체(E40H) 및 서열번호 117로 표시되는 변이체(E40R)와 같은 브라제인 변이체 100㎎을 50mM 트리스-염산(Tris-HCl, pH 8.0)용액에 용해시킨 후 80℃에서 4시간동안 가열 후 각각의 브라제인 1차 변이체에 대해 열처리 전의 단맛을 기준으로 상기 <실시예 3-1>과 동일한 방법으로 20명의 피실험자를 대상으로 단맛 변화 정도를 측정하고 그 결과를 상대 활성으로 나타내어 도 5에 기재하였다.
그 결과, 도 5에서 나타난 바와 같이, 서열번호 100으로 표시되는 브라제인(H30R), 서열번호 109로 표시되는 브라제인(E35D), 서열번호 113로 표시되는 브라제인(E40A), 서열번호 113으로 표시되는 브라제인(E40A), 서열번호 114로 표시되는 브라제인(E40D), 서열번호 115로 표시되는 브라제인(E40K) 및 서열번호 117로 표시되는 변이체(E40R)와 같은 브라제인 변이체에서 브라제인의 열안정성을 그대로 유지하는 것으로 나타났다.
<실시예 4>
브라제인 다중 변이체를 암호화하고 있는 폴리뉴클레오티드의 클로닝
상기 <실시예 3-2>의 결과를 바탕으로 브라제인 부타입 단백질과 유사한 안정성을 가지며 이와 비교하였을 때 높은 단맛을 나타내는 브라제인 1차 변이체(H30R, E35D, E40A, E40D, E40R, E40K)를 이용하여 더 높은 단맛을 나타내는 브라제인 2차 변이체를 작성하였다.
구체적으로 브라제인 2차 변이체를 작성하기 위해 하기 표 5 내지 표 7에 주형(브라제인 1차 변이체를 암호화하는 폴리뉴클레오티를 포함하고 있는 발현벡터)과 1차 변이체 작성을 위하여 사용한 프라이머를 이용하여 상기 <실시예 1>의 위치-지정 돌연변이유도(site-directed mutagenesis)법으로 브라제인 2차변이체를 암호화하고 있는 총 9종의 폴리뉴클레오티드를 작성하였다. 이 때, 하기 표 5 내지 표 7에서의 명명법은 예를 들어, H30R_E35D의 의미는 브라제인의 부타입(minor type) 단백질의 30번 위치의 히스티딘(Histidine) 잔기가 아르기닌(arginine) 잔기로 35번 위치의 글루타민산(glutamic acid) 잔기가 아스파르트산(aspartic aicd) 잔기로 동시에 치환되었음을 의미하며, 29ins30 Lys_는 29번과 30번 위치에 라이신 잔기가 삽입되었음을 의미한다. 또한 프라이머 서열에서 아래 밑줄 부분은 브라제인 변이체를 위해 변화된 서열을 의미한다.
표 5 브라제인 2차 변이체 제작을 위해 사용된 주형 및 프라이머
브라제인 2차 변이체를 작성을 위한 주형 (서열번호) 2차 변이체 작성을 위해 사용된 프라이머 작성된 브라제인 2차 변이체
프라이머 서열 서열번호
E. coli pelB +Brazzein(H30R) gene(서열번호 59) tct gga gac tgc ttt 서열번호 28 H30R_E35D
tac gat gct aag aga 서열번호 32 H30R_E40A
tac gat gac aag aga 서열번호 33 H30R_E40D
tac gat aaa aag aga 서열번호 34 H30R_E40K
tac gat cgt aag aga 서열번호 36 H30R_E40R
E. coli pelB +Brazzein(E35D) gene(서열번호 68) tac gat gct aag aga 서열번호 32 E35D_E40A
tac gat gac aag aga 서열번호 33 E35D_E40D
tac gat aaa aag aga 서열번호 34 E35D_E40K
tac gat cgt aag aga 서열번호 36 E35D_E40R
표 6 브라제인 3차 변이체 제작을 위해 사용된 주형 및 프라이머
브라제인 3차 변이체를 작성을 위한 주형 (서열번호) 3차 변이체 작성을 위해 사용된 프라이머 작성된 브라제인 3차 변이체
프라이머 서열 서열번호
E. coli pelB +Brazzein(H30R_E35D) gene(서열번호 123) tac gat gct aag aga 서열번호 32 H30R_E35D_E40A
tac gat gac aag aga 서열번호 33 H30R_E35D_E40D
tac gat aaa aag aga 서열번호 34 H30R_E35D_E40K
tac gat cgt aag aga 서열번호 36 H30R_E35D_E40R
표 7 브라제인 4차 변이체 제작을 위해 사용된 주형 및 프라이머
브라제인 4차 변이체를 작성을 위한 주형(서열번호) 4차 변이체 작성을 위해 사용된 프라이머 작성된 브라제인 4차 변이체
프라이머 서열 서열번호
E. coli pelB +Brazzein(H30R_E35D_E40A) gene (서열번호 132) gataagaaacatgct 서열번호 136 29ins30 Lys_H30R_E35D_E40A
E. coli pelB +Brazzein(H30R_E35D_E40D) gene(서열번호 133) gataagaaacatgct 서열번호 136 29ins30 Lys_H30R_E35D_E40D
E. coli pelB +Brazzein(H30R_E35D_E40K) gene(서열번호 134) gataagaaacatgct 서열번호 136 29ins30 Lys_H30R_E35D_E40K
E. coli pelB +Brazzein(H30R_E35D_E40R) gene(서열번호 135) gataagaaacatgct 서열번호 136 29ins30 Lys_H30R_E35D_E40R
또한, 더 높은 단맛을 나타내는 브라제인 3차 변이체를 작성하기 위하여 상기 표 5에 주형(브라제인 2차 변이체를 암호화하는 폴리뉴클레오티를 포함하고 있는 발현벡터)과 1차 변이체 작성을 위하여 사용한 프라이머를 이용하여 상기 <실시예 1>의 위치-지정 돌연변이유도(site-directed mutagenesis)법으로 브라제인 3차변이체를 암호화하고 있는 총 4종의 폴리뉴클레오티드 작성하였다.
또한 상기 <실시예 3>의 브라제인 1차 변이체의 단맛 테스트 결과를 통해 브라제인 부타입 단백질의 29번 위치의 라이신 잔기와 30번 위치의 히스티딘 잔기가 단맛을 나타내는데 있어 중요한 위치라고 가정하여 브라제인 3차 변이체의 29번 위치의 라이신 잔기와 30번 위치의 아르기닌 잔기사이에 라이신 잔기를 삽입(insertion)하여 브라제인 4차 변이체를 작성하였다. 이를 위해 상기 표 5에 기재된 주형(브라제인 3차 변이체를 암호화하는 폴리뉴클레오티를 포함하고 있는 발현벡터), 서열번호 136으로 표시되는 라이신 잔기를 암호화 하고 있는 프라이머와 이에 상보적인 서열을 가지는 프라이머를 합성하여 상기 <실시예 1>의 위치-지정 돌연변이유도(site-directed mutagenesis)법으로 브라제인 4차 변이체를 암호화하고 있는 총 4종의 폴리뉴클레오티드 작성하였다. 이를 하기 표 8의 명시되어 있는 서열번호 및 뉴클레오티드 명으로 명명하였다.
그 결과 총 17종의 브라제인 다중 변이체를 위한 발현 벡터를 제작할 수 있었으며 이를 다시 대장균 BL21(star)로 형질 전환하여 대량발현에 이용하였다.
표 8 브라제인 다중 변이체를 암호화하고 있는 폴리뉴클레오티드 명 및 서열번호
브라제인 다중 변이체 위치 각각의 브라제인 다중 변이체를 암호화하고 있는 뉴클레오티드 명 서열번호
H30R_E35D E. coli pelB +Brazzein(H30R_E35D) gene 서열번호 123
H30R_E40A E. coli pelB +Brazzein(H30R_E40A) gene 서열번호 124
H30R_E40D E. coli pelB +Brazzein(H30R_E40D) gene 서열번호 125
H30R_E40K E. coli pelB +Brazzein(H30R_E40K) gene 서열번호 126
H30R_E40R E. coli pelB +Brazzein(H30R_E40R) gene 서열번호 127
E35D_E40A E. coli pelB +Brazzein(E35D_E40A) gene 서열번호 128
E35D_E40D E. coli pelB +Brazzein(E35D_E40D) gene 서열번호 129
E35D_E40K E. coli pelB +Brazzein(E35D_E40K) gene 서열번호 130
E35D_E40R E. coli pelB +Brazzein(E35D_E40R) gene 서열번호 131
H30R_E35D_E40A E. coli pelB +Brazzein(H30R_E35D_E40A) gene 서열번호 132
H30R_E35D_E40D E. coli pelB +Brazzein(H30R_E35D_E40D) gene 서열번호 133
H30R_E35D_E40K E. coli pelB +Brazzein(H30R_E35D_E40K) gene 서열번호 134
H30R_E35D_E40R E. coli pelB +Brazzein(H30R_E35D_E40R) gene 서열번호 135
29ins30 Lys_H30R_E35D_E40A E. coli pelB +Brazzein(29ins30 Lys_H30R_E35D_E40A) gene 서열번호 138
29ins30 Lys_H30R_E35D_E40D E. coli pelB +Brazzein(29ins30 Lys_H30R_E35D_E40D) gene 서열번호 139
29ins30 Lys_H30R_E35D_E40K E. coli pelB +Brazzein(29ins30 Lys_H30R_E35D_E40K) gene 서열번호 140
29ins30 Lys_H30R_E35D_E40R E. coli pelB +Brazzein(29ins30 Lys_H30R_E35D_E40R) gene 서열번호 141
<실시예 5>
브라제인 다중 변이체를 발현 정제 및 특성 조사
상기 <실시예 4>에서 제작한 브라제인 다중 변이체 위한 17종의 발현 벡터를 도입한 각각의 대장균 BL21(star)을 이용하여 상기 <실시예 2-1>과 <실시예 2-2>와 동일 발현 및 정제를 하여 표 9 내지 표 11의 서열번호로 표시되는 정제된 브라제인 변이체를 얻을 수 있었으며 정제도는 일차적으로 SDS-PAGE를 통해 확인하였다.
표 9 브라제인 2차 변이체명 및 서열번호
브라제인 2차 변이체 위치 브라제인 2차 변이체 명 서열번호
H30R_E35D Brazzein(H30R_E35D) 서열번호 142
H30R_E40A Brazzein(H30R_E40A) 서열번호 143
H30R_E40D Brazzein(H30R_E40D) 서열번호 144
H30R_E40K Brazzein(H30R_E40K) 서열번호 145
H30R_E40R Brazzein(H30R_E40R) 서열번호 146
E35D_E40A Brazzein(E35D_E40A) 서열번호 147
E35D_E40D Brazzein(E35D_E40D) 서열번호 148
E35D_E40K Brazzein(E35D_E40K) 서열번호 149
E35D_E40R Brazzein(E35D_E40R) 서열번호 150
표 10 브라제인 3차 변이체명 및 서열번호
브라제인 3차 변이체 위치 브라제인 3차 변이체 명 서열번호
H30R_E35D_E40A Brazzein(H30R_E35D_E40A) 서열번호 151
H30R_E35D_E40D Brazzein(H30R_E35D_E40D) 서열번호 152
H30R_E35D_E40K Brazzein(H30R_E35D_E40K) 서열번호 153
H30R_E35D_E40R Brazzein(H30R_E35D_E40R) 서열번호 154
표 11 브라제인 4차 변이체명 및 서열번호
브라제인 4차 변이체 위치 브라제인 4차 변이체 명 서열번호
29ins30 Lys_ H30R_E35D_E40A Brazzein(29ins30 Lys_H30R_E35D_E40A) 서열번호 155
29ins30 Lys_ H30R_E35D_E40D Brazzein(29ins30 Lys_H30R_E35D_E40D) 서열번호 156
29ins30 Lys_ H30R_E35D_E40K Brazzein(29ins30 Lys_H30R_E35D_E40K) 서열번호 157
29ins30 Lys_ H30R_E35D_E40R Brazzein(29ins30 Lys_H30R_E35D_E40R) 서열번호 158
그 결과, 도 6에 나타난 바와 같이, 브라제인 단백질이 순도 높게 정제되었으며, 그 분자량은 약 6.5kDa인 것으로 나타났다.
또한, 상기 <실시예 2-3>와 동일한 방법으로 Varina사의 고성능 액체 크로마토그래피(High Performance Liquid Chromatography)를 이용하여 브라제인 다중 변이체의 구조적 차이를 분석하였으며, 그 결과 브라제인 4차 변이체를 제외한 대부분의 브라제인 다중 변이체는 브라제인 변이체와 동일하게 약 15분의 지연시간(retention time)이 경과한 후에 용출되고 있음을 확인할 수 있었다. 하지만 브라제인 4차 변이체의 경우 약 20분의 지연시간 후에 용출되었음을 확인하였다. 이러한 결과는 브라제인 3차 변이체의 29번 위치의 라이신 잔기와 30번 위치의 아르기긴 잔기사이 라이신 잔기가 삽입됨에 따라 본연의 브라제인 단백질과의 구조적 차이가 유발되었다고 생각되었다(도 7 참조).
또한, 상기 <실시예 3-1>과 동일한 방법으로 브라제인 다중 변이체에 대한 활성(단맛) 측정을 실시하고 그 결과를 하기 표 12에 기재하였다.
표 12 브라제인 다중 변이체에 대한 단맛 테스트 결과
다중 변이체 종류 초기 단맛을 느끼는 최저 자극양 (㎍/㎖) 수크로오스 (1g/100㎖) 대비브라제인 다중 변이체 비교 단맛 비율 브라제인 부타입 비교 단맛 증가 배수
변이체 위치(서열번호)
2차 변이체
H30R_E35D(서열번호 142) 1,250 8,000 4
H30R_E40A(서열번호 143) 1,250 8,000 4
H30R_E40D(서열번호 144) 1,250 8,000 4
H30R_E40K(서열번호 145) 1,000 10,000 5
H30R_E40R(서열번호 146) 1,000 10,000 5
E35D_E40A(서열번호 147) 1,000 10,000 5
E35D_E40D(서열번호 148) 1,000 10,000 5
E35D_E40K(서열번호 149) 1,250 8,000 4
E35D_E40R(서열번호 150) 850 12,000 6
3차 변이체
H30R_E35D_E40A(서열번호 151) 650 15,000 7.5
H30R_E35D_E40D(서열번호 152) 500 20,000 10
H30R_E35D_E40K(서열번호 153) 500 20,000 10
H30R_E35D_E40R(서열번호 154) 450 22,000 11
4차 변이체
29ins30 Lys_ H30R_E35D_E40A(서열번호 155) 400 25,000 12.5
29ins30 Lys_ H30R_E35D_E40D(서열번호 156) 350 28,000 14
29ins30 Lys_ H30R_E35D_E40K(서열번호 157) 350 28,000 14
29ins30 Lys_ H30R_E35D_E40R(서열번호 158) 250 40,000 20
상기의 표 12에서 나타난 바와 같이 모든 브라제인 다중 변이체는 브라제인 부타입의 단백질과 비교하였을 경우 최소 4배에서 최대 약 20배 이상(1g/100ml의 수크로오스 대비 최소 약 8,000배에서 최대 약 40,000배)의 단맛을 나타내는 것으로 나타났다.
또한, <실시예 3-2>와 동일한 방법으로 상기의 브라제인 다중 변이체를 이용하여 열안정성을 측정한 결과, 모든 브라제인 다중 변이체에서 브라제인 부타입의 단백질과 동일한 열안정성을 나타내었다. 브라제인 다중 변이체 중 4차 변이체의 고성능 액체 크로마토그래피(High Performance Liquid Chromatography) 분석 결과 브라제인 부타입의 단백질과 다른 구조적 특성을 나타내었음에도 불구하고 열안정성은 동일하게 유지되고 있음을 확인하였다.
이와 같은 결과를 종합하여, 브라제인 부타입(minor type)의 단백질의 구조 및 구성하고 있는 아미노산을 분석하여 외부 잔기(side chain)가 단백질 외부로 향하고 있으며, 전기적 극성을 가지고 있는 특정 아미노산을 선택하여 40종의 브라제인 1차 변이체를 작성하였다. 그 중 브라제인 부타입의 단백질과 비교하였을 때 동일한 열안정성 및 최소 2배에서 최대 3.3배까지의 높은 단맛을 나타내는 브라제인 6종의 브라제인(H30R, E35D, E40A, E40D, E40R, E40K) 1차 변이체를 선별하였다. 선별된 브라제인 1차 변이체를 이용하여 부타입의 단백질과 비교하였을 때 동일한 열안정성 및 더 높은 단맛을 나타내는 브라제인 다중 변이체를 작성하였다. 브라제인 3차 변이체의 29번 위치의 라이신 잔기와 30번 위치의 아르기닌 잔기사이 라이신 잔기를 삽입시킨 브라제인 4차 변이체를 제외한 대부분의 브라제인 다중 변이체는 브라제인 부타입의 단백질과 동일한 구조를 형성하였다. 브라제인 4차 변이체의 구조적 차이는 삽입된 라이신 잔기에 의한 영향이라고 생각되어 진다. 그러나 브라제인 4차 변이체를 포함한 모든 브라제인 다중 변이체에서 브라제인 부타입의 단백질과 동일한 열안정성을 나타내었으며, 최소 4배에서 최대 40배까지의 단맛이 증가함을 확인할 수 있었다.
<실시예 6>
재조합 발현벡터 pET26B(+)-Brazzein(Met-)의 제작
<6-1> 브라제인을 암호화하고 있는 새로운 인공 유전자 합성
펜타디플란드라 브라제나 바이론(Pentadipladra brazzeana Baillon)의 열매 추출물인 브라제인의 서열(Genbank 등록번호 P56552)에서 첫번째 서열(pyroglutamic acid)을 제외한 아미노산 서열을 바탕으로 하고, 대장균 내부에 많이 존재하는 코돈(E. coli usage codon)을 이용하여 이하와 같은 서열번호 159의 서열을 정하였다. 이 때, 볼드체로 나타낸 부분은 대장균 내부에 많이 존재하는 코돈을 바탕으로 Genbank 등록번호 P56552의 서열에서 변형시킨 부분을 나타낸다: GATAAGTGCAAGAAGGTTTACGAAAATTACCCAGTTTCTAAGTGCCAACTTGCTAATCAATGCAATTACGATTGCAAGCTTGCTAAGCATGCTAGATCTGGAGAATGCTTTTACGATGAAAAGAGAAATCTTCAATGCATTTGCGATTACTGCGAATACTAA.
상기 서열번호 159의 서열정보를 바탕으로 다카라 코리아 바이오 메디칼에 의뢰하여 인공적으로 브라제인 유전자의 폴리뉴클레오티드를 합성하였다.
<6-2> 프라이머 제작
상기 합성된 폴리뉴클레오티드를 pET26B(+)(Novagen, 미국)의 pelB 시그널 서열과 연결하기 위하여 pET26B(+)의 MCS(multi cloning site)에 포함되어 있는 제한효소자리 Nco I과 Xho I이 포함되도록 프라이머를 합성하여 이를 각각 서열번호 160(정방향 프라이머, CATG CCATGG ATAAGTGCAAGAAGGTTTAC) 및 서열번호 161(역방향 프라이머, CCG CTCGAG TTAGTATTCGCAGTAATCG)라고 하였다. 이 때, NcoⅠ과 XhoⅠ사이트는 각각 밑줄로 표시하였다.
<6-3> PCR에 의한 브라제인 유전자의 증폭
상기 <실시예 6-1>에서 합성한 브라제인 유전자를 주형으로 하고, <실시예 6-2>에서 합성한 두 개의 프라이머를 사용하여 브라제인 유전자를 증폭하였다. PCR 반응은 주형 유전자(합성한 브라제인 유전자, 서열번호 159) 1.5 ㎕, 정방향 프라이머(서열번호 160) 2 ㎕, 역방향 프라이머(서열번호 161) 1 ㎕, 25 mM MgCl2 3 ㎕, 2.5 mM dNTP 4 ㎕, 10×Ex-taq buffer 5 ㎕, Ex-taq polymerase (Takara, 일본) 1 ㎕, H2O 31.5 ㎕를 포함하는 최종 부피 50 ㎕를 반응액으로 하여 PCR을 수행하였다. PCR 반응은 94℃에서 2분간 전변성시킨 다음 98℃ 30초, 58℃ 2분, 74℃ 3분을 35회 반응시키고, 74℃에서 10분간 최종반응을 시켰다. 반응이 끝난 후 2.0% 아가로즈 겔 전기영동 (electrophoresis)에 의해 증폭된 브라제인 유전자를 확인한 뒤, 아가로즈 겔에서 증폭된 브라제인 유전자를 회수하여 QIAquick Gel extraction kit (Qiagen, 미국)를 이용하여 추출, 정제하였다. 추출한 브라제인 유전자는 pGEM-T Easy 벡터 (Promega, 미국)에 삽입한 후(이를 pGEM-T Easy-Brazzein라고 함), 상기 브라제인 유전자가 삽입된 pGEM-T Easy 벡터를 대장균 JM109에 형질전환시켰다. 이를 50㎍/㎖ 암피실린(Ampicillin)이 포함된 평판 L-브로쓰(Broth) 배지 상에서 배양하여 형질전환된 대장균을 선별하고, 이를 다시 다시 액체 L-브로쓰 배지에서 배양한 후, 이로부터 브라제인 유전자가 삽입된 pGEM-T Easy 벡터를 다량으로 수득하였다.
<6-4> 재조합 발현벡터 pET26B(+)-Brazzein(Met-)의 제작
상기 <실시예 6-3>에서 클로닝한 pGEM-T Easy-Brazzein 벡터를 제한효소 Nco I과 Xho I (10×K buffer 및 0.1 % BSA 사용)을 사용해 37℃에서 6시간 절단 (digestion)하였다. T7 promoter를 가진 발현 벡터 pET26B(+) 벡터도 상기 조건과 동일한 조건으로 절단하였다. pGEM-T Easy-Brazzein 벡터에서 브라제인 유전자 부분과 절단된 pET26B(+) 벡터를 QIAquick Gel extraction kit (Qiagen, 미국)을 사용하여 정제하였다. 이를 혼합하여 T4 DNA ligase(Takara, 일본)를 사용하여 16℃에서 12시간 반응시킨 후, JM109 감응세포(supercompetent cell)에 형질전환 하였다(도 2 내지 4 참조). 라이게이션 결과 생성된 재조합 발현 벡터를 pET26B(+)-Brazzein이라 명명하였다.
한편, 본 발명의 재조합 브라제인은 전사(transcription)후 번역(translation)과정이 진행됨에 따라 대장균의 세포막간극(periplasm)으로 이동한 뒤 대장균내 시그날 펩티다아제(signal peptidase)에 의하여 재조합 브라제인과 융합된 pelB 신호 서열이 제거된다. 하지만 프라이머내의 제한효소 Nco I 내부의 ATG에 의하여 번역되는 Met은 시그날 펩티다아제에 의해 제거되지 않는다.
따라서 천연물에서 추출한 마이너(minor) 형태의 브라제인과 동일한 형태의 브라제인을 발현시키기 위해서 PCR을 이용한 부위특이적 변이법을 통해 pET26B(+)-Brazzein 벡터에서 pelB 시그날 서열 뒤에 이어지는 제한효소(Nco I) 내부의 “ATG”를 제거하였다(도 2 내지 4 참조). 이를 상세히 설명하면 다음과 같다.
브라제인 유전자 중 제거(deletion)시키고자 하는 염기를 중심으로 하여 양 옆에 브라제인의 염기서열과 동일하게 약 15bp길이로 하여 서열번호 162(CAGCCGGCGATGGCCGACAAATGCAAAAAA) 및 서열번호 163(TTTTTTGCATTTGTCGGCCATCGCCGGCTG)의 프라이머를 합성하였으며, 이들은 각각 제거되는 ATG를 제외하고는 브라제인의 각 단일가닥과 서로 상보적으로 결합할 수 있는 것이다. 상기 pET26B(+)-Brazzein 벡터를 주형으로 하고, 서열번호 162 및 서열번호 163의 프라이머(primer)를 사용하여 QuikChangeTM Site-Directed Mutagenesis Kit(Stratagene, 미국)를 이용하여 제조사의 지침에 따라서 상기 기재한 것과 같이 pET26B(+)-Brazzein 벡터에서 ATG가 제거된 pET26B(+)-Brazzein(Met-)를 얻었다. 즉, pET26B(+)-Brazzein 벡터 10 ng, 각각 최종농도 0.2 mM의 dNTP 혼합물, 각각 125 ng의 서열번호 162 및 서열번호 163의 프라이머, 10× 반응버퍼 5 ㎕, Pfu-Turbo DNA polymerase(2.5 U/㎕, Stratagene, 미국) 1 ㎕를 포함하는 전체 50 ㎕를 반응액으로 PCR을 수행하였다. PCR 반응은 95℃에서 2분간 전변성시킨 다음 98℃ 30초, 55℃ 1분. 68℃ 15분을 15회 반응시키고 68℃에서 10분간 최종반응을 시켰다. 반응이 끝난 후 1.0% agarose 겔 전기영동에 의해 증폭된 생성물을 확인하고 증폭이 이루어진 생성물을 37℃에서 1시간동안 DpnⅠ으로 처리하였다. 그런 후 바로 슈퍼컴페턴트 세포(supercompetent cell)인 대장균 XL1-Blue로 형질전환하였다. 형질전환된 대장균 XL1-Blue는 50 ㎍/㎖의 카나마이신(kanamycin)이 함유된 LB-agar plate에서 12시간 배양하여 선별하고, 선별된 colony를 LB-agar 배지에서 배양하여 대장균으로부터 DNA를 분리하였다. 분리된 DNA에 대해서 각각 염기서열 분석을 통해 ATG가 제거된 변이체로 확인된 벡터를 다시 대장균 BL21(DE3)-Star로 형질 전환하여 대량발현에 이용하였다. 부위특이적 변이법에 의해 생성된 재조합 발현 벡터를 pET26B(+)-Brazzein(Met-)이라 명명하였다.
본 발명의 브라제인 변이체는 종래의 브라제인보다 우수한 열안정성 및 내산성 및 수용성 등의 특성을 가지면서 종래의 브라제인에 비해 최소 2배에서 최대 3.3배 이상의 단맛을 가지고 있으며 브라제인 다중 변이체의 경우 브라제인 변이체와 마찬가지로 브라제인 부타입의 단백질과 동일한 안정성 및 최소 4배에서 최대 20배 이상의 단맛을 가지고 있다. 따라서, 본 발명의 브라제인 변이체는 적은 양으로도 더 많은 양의 설탕(수크로오스)과 같은 다른 감미료를 대체할 수 있어 식품 조성물 등에 감미료로서 다양하게 사용될 수 있다.

Claims (10)

  1. (a) 대장균 pelB신호서열 및 서열번호 100, 서열번호 109, 서열번호 113, 서열번호 114, 서열번호 115, 서열번호 117, 서열번호 142, 서열번호 143, 서열번호 144, 서열번호 145, 서열번호 146, 서열번호 147, 서열번호 148, 서열번호 149, 서열번호 150, 서열번호 151, 서열번호 152, 서열번호 153, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157 및 서열번호 158로 이루어진 군에서 선택된 아미노산 서열을 가지는 브라제인 변이체를 암호화하는 브라제인 변이체 유전자로 형질전환된 대장균을 배양하는 단계;
    (b) 상기 배양된 대장균의 세포막간극의 단백질을 분리하는 단계; 및
    (c) 상기 분리된 세포막간극 단백질을 열처리하는 단계를 포함하는 브라제인 변이체의 제조방법.
  2. 서열번호 100, 서열번호 109, 서열번호 113, 서열번호 114, 서열번호 115, 서열번호 117, 서열번호 142, 서열번호 143, 서열번호 144, 서열번호 145, 서열번호 146, 서열번호 147, 서열번호 148, 서열번호 149, 서열번호 150, 서열번호 151, 서열번호 152, 서열번호 153, 서열번호 154, 서열번호 155, 서열번호 156, 서열번호 157 및 서열번호 158로 이루어진 군에서 선택된 아미노산 서열을 가지는 브라제인 변이체.
  3. 제2항의 브라제인 변이체를 암호화하는 폴리뉴클레오티드.
  4. 제3항에 있어서, 상기 폴리뉴클레오티드는 서열번호 59, 서열번호 68, 서열번호 72, 서열번호 73, 서열번호 74, 서열번호 76, 서열번호 123, 서열번호 124, 서열번호 125, 서열번호 126, 서열번호 127, 서열번호 128, 서열번호 129, 서열번호 130, 서열번호 131, 서열번호 132, 서열번호 133, 서열번호 134, 서열번호 135, 서열번호 138, 서열번호 139, 서열번호 140 및 서열번호 141로 이루어진 군에서 선택된 염기서열을 가지는 폴리뉴클레오티드.
  5. 프로모터 및 이와 작동가능하게 연결된 제3항의 폴리뉴클레오티드를 포함하는 브라제인 변이체 발현용 재조합 발현벡터.
  6. 제5항에 있어서, 재조합 발현벡터는 pET26B(+)-Brazzein(H30R), pET26B(+)-Brazzein(E35D), pET26B(+)-Brazzein(E35D), pET26B(+)- Brazzein(E40D), pET26B(+)-Brazzein(E40K), pET26B(+)-Brazzein(E40R), pET26B(+)-Brazzein(H30R_E35D), pET26B(+)-Brazzein(H30R_E40A), pET26B(+)-Brazzein(H30R_E40D), pET26B(+)-Brazzein(H30R_E40K) 또는 pET26B(+)-Brazzein(H30R_E40R), pET26B(+)-Brazzein(H30R_E35D_E40A), pET26B(+)-Brazzein(H30R_E35D_E40D), pET26B(+)-Brazzein(H30R_E35D_ E40K) pET26B(+)-Brazzein(H30R_E35D_E40R), pET26B(+)-Brazzein (29ins30 Lys_H30R_E35D_E40A), pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40D), pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40K) 및 pET26B(+)-Brazzein(29ins30 Lys_H30R_E35D_E40R)로 이루어진 군에서 선택된 것인 재조합 발현벡터.
  7. 제5항 또는 제6항의 재조합 발현벡터로 형질전환시킨 대장균.
  8. (a) 제7항의 대장균을 배양하는 단계;
    (b) 상기 배양된 대장균의 세포막간극의 단백질을 분리하는 단계; 및
    (c) 상기 분리된 세포막간극 단백질을 열처리하는 단계를 포함하는 브라제인 변이체의 제조방법.
  9. 제2항의 브라제인 변이체를 포함하는 감미료.
  10. 제2항의 브라제인 변이체를 감미료로서 포함하는 식품 조성물.
PCT/KR2009/004855 2009-08-28 2009-08-28 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법 WO2011025077A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US13/392,378 US8592181B2 (en) 2009-08-28 2009-08-28 Brazzein variant having higher sweetness and method for preparing multi-variant
PCT/KR2009/004855 WO2011025077A1 (ko) 2009-08-28 2009-08-28 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법
JP2012526611A JP5625061B2 (ja) 2009-08-28 2009-08-28 高い甘味を有する新規なブラゼイン変異体及び多重変異体の製造方法

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2009/004855 WO2011025077A1 (ko) 2009-08-28 2009-08-28 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법

Publications (1)

Publication Number Publication Date
WO2011025077A1 true WO2011025077A1 (ko) 2011-03-03

Family

ID=43628158

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2009/004855 WO2011025077A1 (ko) 2009-08-28 2009-08-28 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법

Country Status (3)

Country Link
US (1) US8592181B2 (ko)
JP (1) JP5625061B2 (ko)
WO (1) WO2011025077A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014021526A1 (ko) * 2012-07-30 2014-02-06 중앙대학교 산학협력단 단맛이 증가된 신규 브라제인 다중 변이체 및 이의 제조방법
WO2018056746A1 (ko) * 2016-09-23 2018-03-29 주식회사 바이오스위트 항알러지 활성을 갖는 감미 단백질 브라제인 변이체
EP3407733A4 (en) * 2016-01-27 2019-07-03 Magellan Life Sciences Private Limited PROCESS FOR THE EXTRACELLULAR SECRETION OF BRAZZEIN

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11945844B2 (en) * 2018-05-06 2024-04-02 Amai Proteins Ltd. Taste and flavor-modifier proteins
WO2024086530A1 (en) * 2022-10-17 2024-04-25 Oobli, Inc. Chocolate compositions comprising sweet protein

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7153535B2 (en) * 2002-04-08 2006-12-26 Wisconsin Alumni Research Foundation Protein sweetener
KR20090050525A (ko) * 2007-11-16 2009-05-20 중앙대학교 산학협력단 높은 단맛을 가지는 신규한 브라제인 변이체 및 이의 용도
KR20090093470A (ko) * 2008-02-29 2009-09-02 중앙대학교 산학협력단 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중변이체의 제조방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100809100B1 (ko) * 2006-10-04 2008-03-10 중앙대학교 산학협력단 대장균 ｐｅｌＢ 신호서열 및 브라제인 유전자를 포함하는폴리뉴클레오티드 및 이를 이용한 브라제인의 제조방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7153535B2 (en) * 2002-04-08 2006-12-26 Wisconsin Alumni Research Foundation Protein sweetener
KR20090050525A (ko) * 2007-11-16 2009-05-20 중앙대학교 산학협력단 높은 단맛을 가지는 신규한 브라제인 변이체 및 이의 용도
KR20090093470A (ko) * 2008-02-29 2009-09-02 중앙대학교 산학협력단 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중변이체의 제조방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FARIBA M. ASSADI-PORTER ET AL.: "Sweetness Determinant Sites of Brazzein, a Small, Heat- Stable, Sweet-Tasting Protein", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 376, no. 2, 15 April 2000 (2000-04-15), pages 259 - 265 *
QIN ZHAO ET AL.: "Probing the sweet determinants of brazzein: Wild-type brazzein and a tasteless variant, brazzein-ins(Rl8a-Il8b), exhibit different pH-dependent NMR chemical shifts", BIOCHEMICAL AND BIOPHSICAL RESEARCH COMMUNICATIONS, vol. 335, 2005, pages 256 - 263 *
ZHEYUAN JIN ET AL.: "Critical regions for the sweetness ofbrazzein", FEBS LETTERS, vol. 544, 2 May 2003 (2003-05-02), pages 33 - 37 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014021526A1 (ko) * 2012-07-30 2014-02-06 중앙대학교 산학협력단 단맛이 증가된 신규 브라제인 다중 변이체 및 이의 제조방법
US9826773B2 (en) 2012-07-30 2017-11-28 Biosweet Co., Ltd. Brazzen multiple variants of increased sweetness, and production method for same
EP3407733A4 (en) * 2016-01-27 2019-07-03 Magellan Life Sciences Private Limited PROCESS FOR THE EXTRACELLULAR SECRETION OF BRAZZEIN
US11613757B2 (en) 2016-01-27 2023-03-28 Magellan Life Sciences Ltd. Process for extracellular secretion of Brazzein
WO2018056746A1 (ko) * 2016-09-23 2018-03-29 주식회사 바이오스위트 항알러지 활성을 갖는 감미 단백질 브라제인 변이체

Also Published As

Publication number Publication date
US20120220756A1 (en) 2012-08-30
JP2013502920A (ja) 2013-01-31
US8592181B2 (en) 2013-11-26
JP5625061B2 (ja) 2014-11-12

Similar Documents

Publication Publication Date Title
KR100981087B1 (ko) 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중변이체의 제조방법
WO2019117673A2 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2011025077A1 (ko) 높은 단맛을 가지는 신규한 브라제인 변이체 및 다중 변이체의 제조방법
WO2020027362A1 (ko) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
WO2019117671A1 (ko) 5&#39;-이노신산을 생산하는 미생물 및 이를 이용한 5&#39;-이노신산의 생산 방법
WO2019135639A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2023068472A1 (ko) 신규한 당전이효소 및 이의 용도
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2016195157A1 (ko) 안정성이 증가된 인간 섬유아세포 성장인자-2 변이체 및 이의 용도
WO2020196993A1 (ko) 변이형 포스포리보실피로포스페이트 아미도트랜스퍼라아제 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2011025242A2 (ko) 번역 효율 증진용 ｄｎａ 단편 및 이를 포함하는 재조합 벡터
WO2015199386A1 (ko) 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용
WO2011105841A2 (ko) 브라제인 발현용 재조합 발현벡터 및 높은 단맛을 가지는 신규한 브라제인 다중 변이체
WO2019004779A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2020235830A1 (ko) 부반응성이 낮은 리불로스-인산 3-에피머화 효소의 모티프 및 이를 포함하는 효소
WO2019013532A2 (ko) 아세토하이드록시산 신타아제 변이체, 이를 포함하는 미생물 또는 이를 이용하는 l-분지쇄 아미노산 생산 방법
KR100990667B1 (ko) 높은 단맛을 가지는 신규한 브라제인 변이체 및 이의 용도
WO2019031804A9 (ko) 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터
KR101083040B1 (ko) 높은 단맛을 가지는 신규한 브라제인 다중 변이체 및 이의 제조방법
WO2019004780A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2021034101A1 (ko) 신규 인터페론 람다 변이체 및 이의 제조방법
WO2023068722A1 (ko) 리바우디오사이드 d 및 리바우디오사이드 m을 제조하는 방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2023121426A1 (ko) 레바우디오사이드의 생산

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09848780

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 13392378

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2012526611

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09848780

Country of ref document: EP

Kind code of ref document: A1