WO2010125480A1 - Pneumococcal vaccine and uses thereof - Google Patents
Pneumococcal vaccine and uses thereof Download PDFInfo
- Publication number
- WO2010125480A1 WO2010125480A1 PCT/IB2010/051150 IB2010051150W WO2010125480A1 WO 2010125480 A1 WO2010125480 A1 WO 2010125480A1 IB 2010051150 W IB2010051150 W IB 2010051150W WO 2010125480 A1 WO2010125480 A1 WO 2010125480A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pneumococcal vaccine
- conjugated
- saccharide
- serotypes
- anyone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
- A61K39/092—Streptococcus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/385—Haptens or antigens, bound to carriers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/08—Bronchodilators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
- A61P25/32—Alcohol-abuse
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6037—Bacterial toxins, e.g. diphteria toxoid [DT], tetanus toxoid [TT]
Definitions
- the present invention relates to new pneumococcal vaccines.
- the invention also relates to vaccination of subjects, in particular immunocompromised subjects, against pneumoccocal infections using said novel pneumococcal vaccines.
- Pneumococcal diseases are a major public health problem all over the world. Infections caused by pneumococci are a major cause of morbidity and mortality all over the world. Pneumonia, febrile bacteraemia and meningitis are the most common manifestations of invasive pneumococcal disease, whereas bacterial spread within the respiratory tract may result in middle-ear infection, sinusitis or recurrent bronchitis. Compared with invasive disease, the non-invasive manifestations are usually less severe, but considerably more common. In spite of the importance of pneumococcal disease, there is a scarcity of information on disease burden, particularly from developing countries. This is partly due to the inherent problem of obtaining an etiological diagnosis in cases of pneumonia.
- pneumococcal pneumonia is the most common community-acquired bacterial pneumonia, estimated to affect approximately 100 per 100 000 adults each year.
- the corresponding figures for febrile bacteraemia and meningitis are 15-19 per 100 000 and 1-2 per 100 000, respectively. The risk for one or more of these manifestations is much higher in infants and elderly people, as well as immune compromised persons of any age.
- pneumococcal disease Even in economically developed regions, invasive pneumococcal disease carries high mortality; for adults with pneumococcal pneumonia the mortality rate averages 10%- 20%, whilst it may exceed 50% in the high-risk groups. Pneumonia is by far the most common cause of pneumococcal death worldwide.
- the etiological agent of pneumococcal diseases Streptococcus pneumoniae (the pneumococcus) a Gram-positive encapsulated coccus, surrounded by a polysaccharide capsule. Differences in the composition of this capsule permit serological differentiation between about 90 capsular types, some of which are frequently associated with pneumococcal disease, others rarely.
- Invasive pneumococcal infections include pneumonia, meningitis and febrile bacteremia; among the common non-invasive manifestations are otitis media, sinusitis and bronchitis.
- Pneumococcal resistance to essential antimicrobials such as penicillins, cephalosporins and macrolides is a serious and rapidly increasing problem worldwide.
- Conditions associated with increased risk of serious pneumococcal disease include age extremes (infants, elderly) and being immunocompromised for any reason, including but not limited to: HIV infection, other chronic viral infections, sickle-cell anaemia, diabetes, cancer and cancer therapy, smoking, chronic organ failures, organ transplant and immune suppressive therapy.
- age extremes infants, elderly
- immunocompromised for any reason, including but not limited to: HIV infection, other chronic viral infections, sickle-cell anaemia, diabetes, cancer and cancer therapy, smoking, chronic organ failures, organ transplant and immune suppressive therapy.
- the recent development of widespread microbial resistance to essential antibiotics and the increasing number of immunocompromised persons underline the urgent need for more efficient pneumococcal vaccines.
- Some of the shortcomings of current vaccination include: need for several boosts to achieve protection, delay in rise of protective antibodies, prevalence of vaccine non-responders (this is particularly a problem for immune-compromised individuals), cost of antigen and vaccine production which is a very significant limitation in the development of new conjugated pneumococcal vaccines, poorly protective antibodies with low affinity, falling antibody titres over time.
- An object of the new pneumococcal vaccine of the invention is to overcome at least patiatly some of thses shortcomings. In particular with a view to vaccinate immunocompromised subjects against pneumoccocal infections.
- the present invention is directed towards new pneumococcal vaccines wherein said vaccine comprises one or more pneumoccal polysaccharide antigens conjugated to a carrier protein as antigen and an agonist for Toll-like receptor 9 (TLR9) as adjuvant.
- said vaccine comprises one or more pneumoccal polysaccharide antigens conjugated to a carrier protein as antigen and an agonist for Toll-like receptor 9 (TLR9) as adjuvant.
- TLR9 Toll-like receptor 9
- the present invention is directed towards the use of a pneumococcal vaccine comprising one or more pneumoccal polysaccharide antigens conjugated to a carrier protein as antigen and a TLR-9 agonist as adjuvant to vaccinate immunocompromised subjects.
- a pneumococcal vaccine comprising one or more pneumoccal polysaccharide antigens conjugated to a carrier protein as antigen and a TLR-9 agonist as adjuvant to vaccinate immunocompromised subjects.
- the invention is directed towards any of the pneumococcal vaccine disclosed herein for use in the vaccination of immunocompromised subjects, preferably any of the immunocompromised subjects disclosed herein.
- the present invention is directed towards the use of any of the pneumococcal vaccines disclosed herein to vaccinate immunocompromised subjects, preferably any of the immunocompromised subjects disclosed herein.
- the present invention is directed towards any of the vaccines disclosed herein for the prevention or treatment of diseases caused by S. pneumoniae infection, preferably in an immunocompromised subject.
- the present invention is directed towards a method of immunizing a subject, preferably any of the immunocompromised subjects disclosed herein, against diseases caused by S. pneumoniae infection comprising administering to said subject an immunoprotective dose of any of the vaccines disclosed herein.
- the present invention is directed towards the use of any of the vaccines disclosed herein, for the manufacture of a medicament for the prevention or treatment of diseases caused by S. pneumoniae infection, preferably in an immunocompromised subject.
- the present invention is directed towards any of the pneumococcal vaccines disclosed herein and at least one TLR-9 agonist disclosed herein. In a further aspect, the present invention is directed towards any of the pneumococcal vaccines disclosed herein and at least one TLR-9 agonist disclosed herein for use in the vaccination of any of the immunocompromised subjects disclosed herein.
- TLR-9 agonist Toll-like receptor 9 agonist
- a TLR-9 agonist for use in the present invention is a CpG Oligonucleotide.
- a CpG oligonucleotide as used herein refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and accordingly these terms are used interchangeably unless otherwise indicated.
- Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs that are unmethylated cytosine-guanine dinucleotides, optionally within certain preferred base contexts. The methylation status of the CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide.
- An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide which contains a 5' unmethylated cytosine linked by a phosphate bond to a 3' guanine, and which activates the immune system through binding to Toll-like receptor 9 (TLR-9).
- TLR-9 Toll-like receptor 9
- the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system through TLR9 but not as strongly as if the CpG motif(s) was/were unmethylated.
- CpG CpG immunostimulatory oligonucleotides may comprise one or more palindromes that in turn may encompass the CpG dinucleotide.
- CpG oligonucleotides have been described in a number of issued patents, published patent applications, and other publications, including U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371 ; 6,239,116; and 6,339,068.
- CpG immunostimulatory oligonucleotides Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as A, B, C and P class, and are described in greater detail below Methods of the invention embrace the use of these different classes of CpG immunostimulatory oligonucleotides. Any of the classes may be subjugated to an E modification which enhances its potency.
- An E modification may be a halogen substitution for the 5' terminal nucleotide; examples of such substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
- An E modification can also include an ethyl- uridine substituation for the 5' terminal nucleotide.
- the "A class" CpG immunostimulatory oligonucleotides are characterized functionally by the ability to induce high levels of interferon-alpha (IFN- ⁇ ) from plasmacytoid dendritic cells (pDC) and inducing NK cell activation while having minimal effects on B cell activation. Structurally, this class typically has stabilized poly-G sequences at 5' and 3' ends. It also has a palindromic phosphodiester CpG dinucleotide-containing sequence of at least 6 nucleotides, for example but not necessarily, it contains one of the following hexamer palindromes: GACGTC, AGCGCT, or AACGTT described by Yamamoto and colleagues. Yamamoto S et al. J.
- the "A class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5' GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1)
- A-Class oligonucleotides include: 5' G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO: 2) ; wherein * refers to a phosphorothioat ⁇ bond and _ refers to a phosphodiester bond.
- the "B class" CpG immunostimulatory oligonucleotides are characterized functionally by the ability to activate B cells and pDC except are relatively weak in inducing IFN- ⁇ and NK cell activation. Structurally, this class typically may be fully stabilized with phosphorothioate linkages, but it may also have one or more phosphodiester linkages, preferably between the cytosine and guanine of the CpG motif(s), in which case the molecule is referred to as semi-soft..
- the TLR-9 agonist for use in the present invention is a B class CpG oligonucleotide represented by at least the formula: 5' XiX 2 CGX 3 X 4 3 ' , wherein X1 , X2, X3, and X4 are nucleotides.
- X 2 is adenine, guanine, or thymine.
- X 3 is cytosine, adenine, or thymine.
- the TLR-9 agonist for use in the present invention is a B class CpG oligonucleotide represented by at least the formula:
- N 1 X 1 X 2 CGX 3 X 4 N 2 3' wherein X 1 , X 2 , X 3 , and X 4 are nucleotides and N is any nucleotide and N 1 and N 2 are nucleic acid sequences composed of from about 0-25 N's each.
- X 1 X 2 is a dinucleotide selected from the group consisting of GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT and TpG; and X 3 X 4 is a dinucleotide selected from the group consisting of TpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA and CpA.
- X 1 X 2 is GpA or GpT and X3X4 is TpT.
- X 1 or X 2 or both are purines and X 3 or X 4 or both are pyrimidines or X 1 X 2 is GpA and X 3 or X 4 or both are pyrimidines.
- X 1 X 2 is a dinucleotide selected from the group consisting of TpA, ApA, ApC, ApG and GpG.
- X 3 X 4 is a dinucleotide selected from the group consisting of TpT, TpA, TpG, ApA, ApG, GpA and CpA.
- X 1 X 2 in another embodiment, is a dinucleotide selected from the group consisting of TpT, TpG, ApT, GpC, CpC, CpT, TpC, GpT and CpG;
- X 3 is a nucleotide selected from the group consisting of A and T, and
- X 4 is a nucleotide, but when X 1 X 2 is TpC, GpT or CpG, X 3 X 4 is not TpC, ApT or ApC
- the CpG oligonucleotide has the sequence 5' TCN 1 TX 1 X 2 CGX 3 X 4 3'.
- the CpG oligonucleotides of the invention include X 1 X 2 selected from the group consisting of GpT, GpG, GpA and ApA and X3X4 selected from the group consisting of TpT, CpT and TpC.
- the B class CpG oligonucleotide sequences of the invention are those broadly described above as well as disclosed in published PCT Patent Applications PCT/US95/01570 and PCT/US97/19791 , and in USPs 6,194,388, 6,207,646, 6,214,806, 6,218,371 , 6,239,116 and 6,339,068. Exemplary sequences include but are not limited to those disclosed in these latter applications and patents.
- the "B class" CpG oligonucleotide of the invention has the following nucleic acid sequence 1 5' TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO: 3), or 5' TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO: 4), or 5' TCGTCGTTTTGTCGTTTTGTCGTT 3' (SEQ ID NO. 5), or 5' TCGTCGTTTCGTCGTTTTGTCGTT 3' (SEQ ID NO: 6), or 5' TCGTCGTTTTGTCGTTTTTCGA 3' (SEQ ID NO: 7).
- all of the linkages may be all phosphorothioate bonds.
- one or more of the linkages may be phosphodiester, preferably between the "C” and the "G” of the CpG motif making a semi-soft CpG oligonucleotide.
- an ethyl-uridine or a halogen may substitute for the 5' T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
- B-Class oligonucleotides include: 5' T*C*G*T*C*G*T*TT*T*T*C*G*G*T*G*C*T*T*T 3' (SEQ ID NO: 8), or 5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T 3' (SEQ ID NO: 9), or
- CpG immunostimulatory oligonucleotides is characterized functionally by the ability to activate B cells and NK cells and induce IFN- ⁇ . Structurally, this class typically includes a region with one or more B class-type immunostimulatory CpG motifs, and a GC -rich palindrome or near-palindrome region that allows the molecules to form secondary (e.g., stem-loop) or tertiary (e.g., dimer) type structures.
- Some of these oligonucleotides have both a traditional "stimulatory" CpG sequence and a "GC-rich” or "B-cell neutralizing” motif.
- combination motif oligonucleotides have immune stimulating effects that fall somewhere between the effects associated with traditional B class CpG oligonucleotides (i.e , strong induction of B cell activation and dendritic cell (DC) activation), and the effects associated with A class CpG ODN (i.e., strong induction of IFN- ⁇ and NK cell activation but relatively poor induction of B cell and DC activation).
- B class CpG oligonucleotides i.e , strong induction of B cell activation and dendritic cell (DC) activation
- a class CpG ODN i.e., strong induction of IFN- ⁇ and NK cell activation but relatively poor induction of B cell and DC activation.
- the C class of combination motif immune stimulatory oligonucleotides may have either completely stabilized, (e.g., all phosphorothioate), chimeric (phosphodiester central region), or semi-soft (e.g., phosphodiester within CpG motif) backbones. This class has been described in U.S. patent application US 10/224,523 filed on August 19, 2002.
- One stimulatory domain or motif of the C class CpG oligonucleotide is defined by the formula: 5' X 1 DCGHX 2 3'.
- D is a nucleotide other than C.
- C is cytosine.
- G is guanine.
- H is a nucleotide other than G.
- X 1 and X 2 are any nucleic acid sequence 0 to 10 nucleotides long.
- X 1 may include a CG, in which case there is preferably a T immediately preceding this CG.
- DCG is TCG.
- X 1 is preferably from 0 to 6 nucleotides in length.
- X 2 does not contain any poly G or poly A motifs.
- the immunostimulatory oligonucleotide has a poly-T sequence at the 5' end or at the 3' end.
- poly- A or poly-T shall refer to a stretch of four or more consecutive A's or T's respectively, e.g., 5' AAAA 3' or 5' TTTT 3'.
- poly-G end shall refer to a stretch of four or more consecutive G's, e.g., 5' GGGG 3', occurring at the 5' end or the 3' end of a nucleic acid.
- poly-G oligonucleotide shall refer to an oligonucleotide having the formula 5' X 1 X 2 GGGXaXj 3' wherein X 1 , X 2 , X 3 , and X 4 are nucleotides and preferably at least one of X 3 and X 4 is a G.
- Some preferred designs for the B cell stimulatory domain under this formula comprise TTTTTCG, TCG, TTCG, TTTCG, TTTTCG, TCGT, TTCGT, TTTCGT, TCGTCGT.
- the second motif of the C class CpG oligonucleotide is referred to as either P or N and is positioned immediately 5' to X 1 or immediately 3' to X 2 .
- N is a B cell neutralizing sequence that begins with a CGG trinucleotide and is at least 10 nucleotides long.
- a B cell neutralizing motif includes at least one CpG sequence in which the CG is preceded by a C or followed by a G (Krieg AM et al. (1998) Proc Natl Acad Sd USA 95:12631-12636) or is a CG containing DNA sequence in which the C of the CG is methylated.
- Neutralizing motifs or sequences have some degree of immunostimulatory capability when present in an otherwise non- stimulatory motif, but when present in the context of other immunostimulatory motifs serve to reduce the immunostimulatory potential of the other motifs.
- P is a GC-rich palindrome containing sequence at least 10 nucleotides long.
- GC-rich palindrome shall refer to a palindrome having a base composition of at least two-thirds G's and Cs. In some embodiments the GC- ri ch domain is preferably 3' to the "B cell stimulatory domain". In the case of a 10- base long GC-rich palindrome, the palindrome thus contains at least 8 G's and Cs.
- the palindrome In the case of a 12-base long GC-rich palindrome, the palindrome also contains at least 8 G's and Cs. In the case of a 14-mer GC-rich palindrome, at least ten bases of the palindrome are G's and Cs. In some embodiments the GC-rich palindrome is made up exclusively of G's and Cs.
- the GC-rich palindrome has a base composition of at least 81 % G's and Cs. In the case of such a 10-base long GC-rich palindrome, the palindrome thus is made exclusively of G's and Cs. In the case of such a 12-base long GC-rich palindrome, it is preferred that at least ten bases (83 %) of the palindrome are G's and Cs. In some preferred embodiments, a 12-base long GC-rich palindrome is made exclusively of G's and Cs. In the case of a 14-mer GC-rich palindrome, at least twelve bases (86 %) of the palindrome are G's and Cs.
- a 14-base long GC-rich palindrome is made exclusively of G's and Cs.
- the Cs of a GC-rich palindrome can be unmethylated or they can be methylated.
- this domain has at least 3 Cs and Gs, more preferably 4 of each, and most preferably 5 or more of each.
- the number of Cs and Gs in this domain need not be identical. It is preferred that the Cs and Gs are arranged so that they are able to form a self-complementary duplex, or palindrome, such as CCGCGCGG.
- the self-complementarity is at least partially preserved as for example in the motifs CGACGTTCGTCG or CGGCGCCGTGCCG.
- the non-complementary base pairs be TG.
- the GC-rich palindrome includes at least one CGG trimer, at least one CCG trimer, or at least one CGCG tetramer.
- the GC-rich palindrome is not CCCCCCGGGGGG or GGGGGGCCCCCC, CCCCCGGGGG or GGGGGCCCCC. At least one of the G's of the GC rich region may be substituted with an inosine (I). In some embodiments, P includes more than one I.
- the immunostimulatory oligonucleotide has one of the following formulas 5' NX 1 DCGHX 2 3', 5' X iDCGHX 2 N 3', 5 1 PX 1 DCGHX 2 3', 5' X 1 DCGHX 2 P 3', 5' X 1 DCGHX 2 PX 3 3', 5' X 1 DCGHPX 3 3', 5' DCGHX 2 PX 3 3', 5' TCGHX 2 PX3 3', 5' DCGHPX 3 3' or 5'DCGHP 3'.
- the invention provides other immune stimulatory oligonucleotides defined by a formula 5' N 1 PyGN 2 P 3'.
- N 1 is any sequence 1 to 6 nucleotides long Py is a pyrimidine.
- G is guanine
- N 2 is any sequence 0 to 30 nucleotides long.
- P is a GC- rich palindrome containing a sequence at least 10 nucleotides long.
- N 1 and N 2 may contain more than 50% pyrimidines, and more preferably more than 50% T.
- N 1 may include a CG, in which case there is preferably a T immediately preceding this CG.
- NI PyG is TCG, and most preferably a TCGN 2 , where N 2 is not G.
- N 1 PyGN 2 P may include one or more inosine (I) nucleotides. Either the C or the G in N 1 may be replaced by inosine, but the CpI is preferred to the IpG. For inosine substitutions such as IpG, the optimal activity may be achieved with the use of a "semi-soft" or chimeric backbone, where the linkage between the IG or the Cl is phosphodiester. N1 may include at least one Cl, TCI, IG or TIG motif.
- N 1 PyGN 2 is a sequence selected from the group consisting of TTTTTCG, TCG,
- TTCG TTCG
- TTTCG TTTTCG
- TCGT TTCGT
- TTTCGT TTTCGT
- the "C class" CpG oligonucleotides of the invention has the following nucleic acid sequence:
- all of the linkages may be all phosphorothioate bonds.
- one or more of the linkages may be phosphodiester, preferably between the "C” and the "G” of the CpG motif making a semi-soft CpG oligonucleotide.
- C-Class oligonucleotides include:
- P-Class CpG immunostimulatory oligonucleotides have been described in WO2007/095316 and are characterized by the fact that they contain duplex forming regions such as, for example, perfect or imperfect palindromes at or near both the 5' and 3' ends, giving them the potential to form higher ordered structures such as concatamers.
- P-Class oligonucleotides have the ability in some instances to induce much high levels of IFN- ⁇ secretion than the C-Class.
- the P-Class oligonucleotides have the ability to spontaneously self -assemble into concatamers either in vitro and/or in vivo.
- the TLR-9 agonist for use in the present invention is a P class CpG oligonucleotide containing a 5' TLR activation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected to a 3' palindromic region of at least 8 nucleotides in length either directly or through a spacer, wherein the oligonucleotide includes at least one YpR dinucleotide.
- said oligoonucleotide is not T * C_G * T * C_G * A * C_G * T * T * C_G * G * C * G * C_G * C * G * C * C * G (SEQ ID NO: 27).
- the a P class CpG oligonucleotide includes at least one unmethylated CpG dinucleotide.
- the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT In yet another embodiment the TLR activation domain is within the 5' palindromic region.
- the TLR activation domain is immediately 5' to the 5' palindromic region.
- the 5' palindromic region is at least 8 nucleotides in length.
- the 3' palindromic region is at least 10 nucleotides in length.
- the 5' palindromic region is at least 10 nucleotides in length.
- the 3' palindromic region includes an unmethylated CpG dinucleotide In another embodiment the 3' palindromic region includes two unmethylated CpG dinucleotides. In another embodiment the 5' palindromic region includes an unmethylated CpG dinucleotide.
- the 5' palindromic region includes two unmethylated CpG dinucleotides.
- the 5' and 3' palindromic regions have a duplex stability value of at least 25.
- the 5' and 3' palindromic regions have a duplex stability value of at least 30.
- the 5' and 3' palindromic regions have a duplex stability value of at least 35.
- the 5' and 3' palindromic regions have a duplex stability value of at least 40.
- the 5' and 3' palindromic regions have a duplex stability value of at least 45.
- the 5' and 3' palindromic regions have a duplex stability value of at least 50.
- the 5' and 3' palindromic regions have a duplex stability value of at least 55. In another embodiment the 5' and 3' palindromic regions have a duplex stability value of at least 60. In another embodiment the 5' and 3' palindromic regions have a duplex stability value of at least 65. In one embodiment the two palindromic regions are connected directly. In another embodiment the two palindromic regions are connected via a 3 '-3' linkage. In another embodiment the two palindromic regions overlap by one nucleotide. In yet another embodiment the two palindromic regions overlap by two nucleotides. In another embodiment the two palindromic regions do not overlap. In another embodiment the two palindromic regions are connected by a spacer.
- the spacer is a nucleic acid having a length of 1-50 nucleotides. In another embodiment the spacer is a nucleic acid having a length of 1 nucleotide. In another embodiment the spacer is a non-nucleotide spacer. In one embodiment the non-nucleotide spacer is a D-spacer. In another embodiment the non-nucleotide spacer is a linker.
- the oligonucleotide has the formula 5' XP 1 SP 2 T 3', wherein X is the TLR activation domain, P 1 is a palindrome, S is a spacer, P 2 is a palindrome, and T is a 3' tail of 0-100 nucleotides in length.
- X is TCG, TTCG, or TTTCG.
- T is 5-50 nucleotides in length.
- T is 5-10 nucleotides in length.
- S is a nucleic acid having a length of 1-50 nucleotides.
- S is a nucleic acid having a length of 1 nucleotide.
- S is a non-nucleotide spacer.
- the non-nucleotide spacer is a D- spacer.
- the non-nucleotide spacer is a linker.
- the oligonucleotide is not an antisense oligonucleotide or a ribozyme.
- P 1 is A and T rich.
- P 1 includes at least 4 Ts.
- P 2 is a perfect palindrome.
- P2 is G-C rich
- P 2 is CGGCGCX 1 GCGCCG, where X 1 is T or nothing.
- the oligonucleotide includes at least one phosphorothioate linkage. In another embodiment all internucleotide linkages of the oligonucleotide are phosphorothioate linkages. In another embodiment the oligonucleotide includes at least one phosphodiester-like linkage. In another embodiment the phosphodiester-like linkage is a phosphodiester linkage. In another embodiment a lipophilic group is conjugated to the oligonucleotide. In one embodiment the lipophilic group is cholesterol.
- the TLR-9 agonist for use in the present invention is a P class CpG oligonucleotide with a 5' TLR activation domain and at least two complementarity-containing regions, a 5' and a 3' complementarity-containing region, each complementarity-containing region being at least 8 nucleotides in length and connected to one another either directly or through a spacer, wherein the oligonucleotide includes at least one pyrimidine-purine (YpR) dinucleotide, and wherein at least one of the complementarity-containing regions is not a perfect palindrome.
- the oligonucleotide includes at least one unmethylated CpG dinucleotide.
- the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT.
- the TLR activation domain is within the 5' complementarity-containing region.
- the TLR activation domain is immediately 5' to the 5' complementarity- containing region.
- the 3' complementarity-containing region is at least 10 nucleotides in length.
- the 5' complementarity-containing region is at least 10 nucleotides in length.
- the 3' complementarity- containing region includes an unmethylated CpG dinucleotide.
- the 3' complementarity-containing region includes two unmethylated CpG dinucleotides.
- the 5' complementarity-containing region includes an unmethylated CpG dinucleotide.
- the 5' complementarity-containing region includes two unmethylated CpG dinucleotides.
- the complementarity-containing regions include at least one nucleotide analog.
- the complementarity-containing regions form an intramolecular duplex.
- the intramolecular duplex includes at least one non- Watson Crick base pair.
- the non- Watson Crick base pair is G-T, G-A, G-G, or C-A.
- the complementarity-containing regions form intermolecular duplexes.
- at least one of the intermolecular duplexes includes at least one non- Watson Crick base pair.
- the non- Watson Crick base pair is G-T, G- A, G-G, or C-A.
- the complementarity-containing regions contain a mismatch.
- the complementarity-containing regions contain two mismatches.
- the complementarity-containing regions contain an intervening nucleotide.
- the complementarity-containing regions contain two intervening nucleotides.
- the 5' and 3' complementarity-containing regions have a duplex stability value of at least 25.
- the 5' and 3' complementarity- containing regions have a duplex stability value of at least 30. In another embodiment the 5' and 3' complementarity-containing regions have a duplex stability value of at least 35. In another embodiment the complementarity-containing regions have a duplex stability value of at least 40. In another embodiment the complementarity-containing regions have a duplex stability value of at least 45. In another embodiment the complementarity-containing regions have a duplex stability value of at least 50. In another embodiment the complementarity- containing regions have a duplex stability value of at least 55. In another embodiment the complementarity-containing regions have a duplex stability value of at least 60. In another embodiment the complementarity-containing regions have a duplex stability value of at least 65.
- the two complementarity-containing regions are connected directly. In another embodiment the two palindromic regions are connected via a 3 '-3' linkage. In yet another embodiment the two complementarity-containing regions overlap by one nucleotide. In another embodiment the two complementarity-containing regions overlap by two nucleotides. In another embodiment the two complementarity-containing regions do not overlap. In another embodiment the two complementarity- containing regions are connected by a spacer. In another embodiment the spacer is a nucleic acid having a length of 1 -50 nucleotides. In another embodiment the spacer is a nucleic acid having a length of 1 nucleotide. In one embodiment the spacer is a non-nucleotide spacer.
- non- nucleotide spacer is a D-spacer. In yet another embodiment the non- nucleotide spacer is a linker.
- the P -class oligonucleotide has the formula 5' XNSPT 3', wherein X is the TLR activation domain, N is a non-perfect palindrome, P is a palindrome, S is a spacer, and T is a 3' tail of 0- 100 nucleotides in length.
- X is TCG, TTCG, or TTTCG.
- T is 5-50 nucleotides in length. In another embodiment T is 5-10 nucleotides in length.
- S is a nucleic acid having a length of 1-50 nucleotides. In another embodiment S is a nucleic acid having a length of 1 nucleotide. In another embodiment S is a non-nucleotide spacer. In another embodiment the non-nucleotide spacer is a D-spacer. In another embodiment the non-nucleotide spacer is a linker. In another embodiment the oligonucleotide is not an antisense oligonucleotide or a ribozyme In another embodiment N is A and T rich. In another embodiment N is includes at least 4 Ts. In another embodiment P is a perfect palindrome. In another embodiment P is G-C rich.
- P is CGGCGCX I GCGCCG, wherein X 1 is T or nothing.
- the oligonucleotide includes at least one phosphorothioate linkage. In another embodiment all interaucleotide linkages of the oligonucleotide are phosphorothioate linkages. In another embodiment the oligonucleotide includes at least one phosphodiester-like linkage. In another embodiment the phosphodiester-like linkage is a phosphodiester linkage. In another embodiment a lipophilic group is conjugated to the oligonucleotide. In one embodiment the lipophilic group is cholesterol.
- the "P class" CpG oligonucleotides of the invention has the following nucleic acid sequence: 5' TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).
- all of the linkages may be all phosphorothioate bonds.
- one or more of the linkages may be phosphodiester, preferably between the "C" and the "G" of the CpG motif making a semi-soft CpG oligonucleotide.
- an ethyl-uridine or a halogen may substitute for the 5' T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
- P-Class oligonucleotides include.
- all the internucleotide linkage of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides, as described in the PCT application WO2007/026190).
- CpG oligonucleotides of the invention are rendered resistant to degradation (e.g., are stabilized).
- a "stabilized oligonucleotide" refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Nucleic acid stabilization can be accomplished via backbone modifications.
- Oligonucleotides having phosphorothioate linkages provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases.
- the immunostimulatory oligonucleotides may have a chimeric backbone, which have combinations of phosphodiester and phosphorothioate linkages.
- a chimeric backbone refers to a partially stabilized backbone, wherein at least one internucleotide linkage is phosphodiester or phosphodiester-like, and wherein at least one other internucleotide linkage is a stabilized internucleotide linkage, wherein the at least one phosphodiester or phosphodiester-like linkage and the at least one stabilized linkage are different.
- the phosphodiester linkage is preferentially located within the CpG motif such molecules are called "semi-soft" as described in the PCT application WO2007/026190.
- modified oligonucleotides include combinations of phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, and/or p-ethoxy linkages. Since boranophosphonate linkages have been reported to be stabilized relative to phosphodiester linkages, for purposes of the chimeric nature of the backbone, boranophosphonate linkages can be classified either as phosphodiester-like or as stabilized, depending on the context. For example, a chimeric backbone according to the instant invention could, in some embodiments, includes at least one phosphodiester (phosphodiester or phosphodiester-like) linkage and at least one boranophosphonate (stabilized) linkage.
- a chimeric backbone according to the instant invention could include boranophosphonate (phosphodiester or phosphodiester-like) and phosphorothioate (stabilized) linkages.
- a "stabilized internucleotide linkage” shall mean an internucleotide linkage that is relatively resistant to in vivo degradation (e.g., via an exo- or endo-nuclease), compared to a phosphodiester internucleotide linkage.
- Preferred stabilized internucleotide linkages include, without limitation, phosphorothioate, phosphorodithioate, methylphosphonate, and methylphosphorothioate.
- Other stabilized internucleotide linkages include, without limitation, peptide, alkyl, dephospho, and others as described above.
- Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
- Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described.
- oligonucleotides of the invention can also include other modifications. These include nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
- the size of the CpG oligonucleotide (i.e , the number of nucleotide residues along the length of the oligonucleotide) also may contribute to the stimulatory activity of the oligonucleotide.
- CpG oligonucleotide of the invention preferably have a minimum length of 6 nucleotide residues.
- Oligonucleotides of any size greater than 6 nucleotides are capable of inducing an immune response if sufficient immunostimulatory motifs are present, because larger oligonucleotides are degraded inside cells
- the CpG oligonucleotides are 6 to 100 nucleotides long, preferentially 8 to 30 nucleotides long.
- nucleic acids and oligonucleotides of the invention are not plasmids or expression vectors.
- the CpG oligonucleotide disclosed herein comprise substitutions or modifications, such as in the bases and/or sugars as described at paragraph 134 to 147 of WO2007/026190.
- the CpG oligonucleotide of the present invention is chemically modified.
- Examples of chemical modifications are known to the skilled person and are described, for example in Uhlmann E. et al. (1990), Chem. Rev. 90:543, S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, ST. et al.
- An oligonucleotide according to the invention may have one or more modifications, wherein each modification is located at a particular phosphodiester internucleoside bridge and/or at a particular ⁇ - D-ribose unit and/or at a particular natural nucleoside base position in comparison to an oligonucleotide of the same sequence which is composed of natural DNA or RNA.
- CpG-containing nucleic acids might be simply mixed with immunogenic carriers according to methods known to those skilled in the art (see, e.g. WO03/024480).
- any of the vaccine disclosed herein comprises from 2 ⁇ g to 100mg of CpG oligonucleotide, preferably from 0.1 mg to 50 mg CpG oligonucleotide, preferably from 0.2mg to 10 mg CpG oligonucleotide, preferably from 0.3 mg to 5 mg CpG oligonucleotide, preferably from 0.3 mg to 5 mg CpG oligonucleotide, even preferably from 0.5 to 2 mg CpG oligonucleotide, even preferably from 0.75 to 1.5 mg CpG oligonucleotide.
- any of the vaccine disclosed herein comprises approximately 1 mg CpG oligonucleotide.
- Pneumococcal vaccine of the present invention will typically comprise conjugated capsular saccharide antigens, wherein the saccharides are derived from at least seven serotypes of S. pneumoniae.
- the number of S. pneumoniae capsular saccharides can range from 7 different serotypes (or "v", valences) to 23 different serotypes (23v). In one embodiment there are 7, 8 , 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22 or 23 different serotypes. In an embodiment there are 10 or 11 different serotypes. In an embodiment there are 7 or 13 different serotypes.
- the capsular saccharide antigens are conjugated to a carrier protein as described here below.
- the vaccine may comprise conjugated S. pneumoniae saccharides and unconjugated S. pneumoniae saccharides.
- the total number of saccharide serotypes is less than or equal to 23.
- the vaccine may comprise 7 conjugated serotypes and 16 unconjugated saccharides.
- the vaccine may comprise 13 conjugated serotypes and 10 unconjugated saccharides.
- the vaccine may comprise 8, 9, 10, 11
- the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F.
- the vaccine of the invention comprises in addition to point 1 above, conjugated S. pneumoniae saccharides from serotype 1.
- the vaccine of the invention comprises in addition to point 1 or 2 above, conjugated S. pneumoniae saccharides from serotype 5.
- the vaccine of the invention comprises in addition to point 1 , 2 or 3 above, conjugated S. pneumoniae saccharides from serotype 7F. 5. In another embodiment the vaccine of the invention comprises in addition to point 1 , 2, 3 or 4 above, conjugated S. pneumoniae saccharides from serotype 3.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4 or 5 above, conjugated S. pneumoniae saccharides from serotype 6A.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5 or 6 above, conjugated S. pneumoniae saccharides from serotype 19A.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6 or 7 above, conjugated S. pneumoniae saccharides from serotype 22F.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7 or 8 above, conjugated S. pneumoniae saccharides from serotype 15. 10. In another embodiment the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8 or 9 above, conjugated S. pneumoniae saccharides from serotype 8. 11. In another embodiment the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 above, conjugated S. pneumoniae saccharides from serotype 12F.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 above, conjugated S. pneumoniae saccharides from serotype 2. 13. In another embodiment the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 11 or 12 above, conjugated S. pneumoniae saccharides from serotype 9N.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 11 , 12 or 13 above, conjugated S pneumoniae saccharides from serotype 10A
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 11 , 12, 13 or 14 above, conjugated S. pneumoniae saccharides from serotype 11 A.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 11 , 12, 13, 14, or 15 above, conjugated S. pneumoniae saccharides from serotype 11 A.
- the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 11 , 12, 13, 14, 15 or 16 above, conjugated S. pneumoniae saccharides from serotype 17F. 18. In another embodiment the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 11 , 12, 13, 14, 15, 16 or 17 above, conjugated S. pneumoniae saccharides from serotype 20. 19. In another embodiment the vaccine of the invention comprises in addition to point 1 , 2, 3, 4, 5, 6, 7, 8, 9, 11 , 12, 13, 14, 15, 16, 17 or 18 above, conjugated S. pneumoniae saccharides from serotype 33F.
- the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F.
- the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and. 23F
- the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, 18C, 19F and. 23F.
- the vaccine of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1 , 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F.
- the capsular saccharide antigens are conjugated to a carrier protein independently selected from the group consisting of TT, DT, CRM197, fragment C of TT, PhtD, PhtDE fusions (particularly those described in WO 01/98334 and WO 03/54007), detoxified pneumolysin and protein D.
- a carrier protein independently selected from the group consisting of TT, DT, CRM197, fragment C of TT, PhtD, PhtDE fusions (particularly those described in WO 01/98334 and WO 03/54007), detoxified pneumolysin and protein D.
- the capsular saccharide antigens are conjugated to a carrier proteins which is selected in the group consisting of: DT (Diphtheria toxin), TT (tetanus toxid) or fragment C of TT, CRM 197 (a nontoxic but antigenically identical variant of diphtheria toxin) other DT point mutants, such as CRM176, CRM228, CRM 45 (Uchida et al J. Biol. Chem.
- meningitidis serogroup B - EP0372501 PorB (from N. meningitidis), PorB (from N. meningitidis), PD (Haemophilus influenzae protein D - see, e.g., EP 0 594 610 B), or immunologically functional equivalents thereof, synthetic peptides (EP0378881 , EP0427347), heat shock proteins (WO 93/17712, WO 94/03208), pertussis proteins (WO 98/58668, EP0471 177), cytokines, lymphokines, growth factors or hormones (WO 91/01146), artificial proteins comprising multiple human CD4+ T cell epitopes from various pathogen derived antigens (Falugi et al (2001 ) Eur J Immunol 31 ; 3816-3824) such as N19 protein (Baraldoi et al (2004) Infect lmmun 72; 4884-7) pneumococcal surface protein PspA (WO 02/09
- the capsular saccharide antigens are conjugated to DT (Diphtheria toxoid). In another embodiment, the capsular saccharide antigens are conjugated to TT (tetanus toxid).
- the capsular saccharide antigens are conjugated to fragment C of TT.
- the capsular saccharide antigens are conjugated to PD (Haemophilus influenzae protein D - see, e g., EP 0 594 610 B).
- the capsular saccharide antigens of the invention are conjugated to CRM197 protein.
- the CRM197 protein is a nontoxic form of diphtheria toxin but is immunologically indistinguishable from the diphtheria toxin.
- CRM197 is produced by C. diphtheriae infected by the nontoxigenic phage ⁇ 197 tox- created by nitrosoguanidine mutagenesis of the toxigenic corynephage beta (Uchida, T. et al. 1971 , Nature New Biology 233:8-11).
- the CRM197 protein has the same molecular weight as the diphtheria toxin but differs therefrom by a single base change (guanine to adenine) in the structural gene.
- CRM197 protein is a safe and effective T-cell dependent carrier for saccharides. Further details about CMR197 and production thereof can be found e.g. in US 5,614,382.
- the saccharides could be conjugated to the same molecule of the protein carrier (carrier molecules having 2 more different saccharides conjugated to it) [see for instance WO 04/083251].
- the saccharides may each be individually conjugated to different molecules of the protein carrier (each molecule of protein carrier only having one type of saccharide conjugated to it).
- the capsular saccharides are said to be individually conjugated to the carrier protein.
- the capsular saccharide antigens of the present invention are from different S. pneumoniae serotypes and are conjugated to one or more carrier protiein.
- the vaccine of the invention comprises 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22 or 23 different serotypes capsular saccharide conjugates in which CRM 197 is the carrier protein
- the vaccine of the invention comprises 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22 or 23 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
- saccharide from serotype 1 , 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 1OA, 1 1 A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F or 33F is conjugated to protein D.
- saccharide from serotype 1 , 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 1 OA, 1 1A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F or 33F is conjugated to CRM197.
- saccharides from at least serotypes 1 , 3 and 4; 1 , 3 and 5; 1 , 3 and 6A; 1 , 3 and 6B; 1 , 3 and 7F; 1 , 3 and 9V; 1 , 3 and 14; 3, 4 and 7F; 3, 4 and 5; 3, 4 and 7F; 3, 4 and 9V; 3, 4 and 14; 4, 5 and 7F; 4, 5 and 9V; 4, 5, and 14; 5, 7F and 9V; 5, 7F and 14; 7F, 9V and 14; 1 , 3, 4 and 5; 3, 4, 5 and 7F; 4, 5, 7F and 9V; 4, 5, 7F and 14; 4, 5, 9V and 14; 4, 7F, 9V and 14; 5, 7F, 9V and 14; or 4, 5, 7F, 9V and 14 are conjugated to CRM197.
- saccharides from at least serotypes 1 , 3 and 4, 1 , 3 and 5, 1 , 3 and 6A; 1 , 3 and 6B; 1 , 3 and 7F; 1 , 3 and 9V; 1 , 3 and 14; 3, 4 and 7F; 3, 4 and 5; 3, 4 and 7F; 3, 4 and 9V; 3, 4 and 14; 4, 5 and 7F; 4, 5 and 9V; 4, 5, and 14; 5, 7F and 9V; 5, 7F and 14; 7F, 9V and 14; 1 , 3, 4 and 5; 3, 4, 5 and 7F; 4, 5, 7F and 9V; 4, 5, 7F and 14; 4, 5, 9V and 14; 4, 7F, 9V and 14; 5, 7F, 9V and 14; or 4, 5, 7F, 9V and 14 are conjugated to protein D.
- the vaccine of the invention comprises 7 different serotypes capsular saccharide conjugates in which CRM 197 is the carrier protein.
- the vaccine of the invention comprises 7 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
- the vaccine of the invention comprises 10 different serotypes capsular saccharide conjugates in which CRM 197 is the carrier protein. In an embodiment the vaccine of the invention comprises 10 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
- the vaccine of the invention comprises 11 different serotypes capsular saccharide conjugates in which CRM197 is the carrier protein. In an embodiment the vaccine of the invention comprises 11 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
- the vaccine of the invention comprises 13 different serotypes capsular saccharide conjugates in which CRM 197 is the carrier protein
- the vaccine of the invention comprises 13 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
- the vaccine of the invention comprises 23 different serotypes capsular saccharide conjugates in which CRM 197 is the carrier protein.
- the vaccine of the invention comprises 23 different serotypes capsular saccharide conjugates in which protein D is the carrier protein.
- the vaccine of the invention comprises saccharide from serotypes 4, 6B, 9V, 14, 18C,
- the vaccine of the invention comprises saccharide from serotypes 4, 6B, 9V, 14, 18C,
- the vaccine of the invention comprises saccharide from serotypes 1 , 3, 4, 5, 6A, 6B,
- the vaccine of the invention comprises saccharide from serotypes 1 , 3, 4, 5, 6A, 6B,
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, 18C, 19F and. 23F conjugated to protein D.
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V,
- the vaccine of the invention comprises saccharide from serotypes 1 , 3, 4, 5, 6B, 7F,
- the vaccine of the invention comprises saccharide from serotypes 1 , 3, 4, 5, 6B, 7F,
- the vaccine of the invention comprises saccharide from serotype 1 , 2, 3, 4, 5, 6B, 7F,
- the vaccine of the invention comprises saccharide from serotypes 1 , 2, 3, 4, 5, 6B, 7F, 8, 9N. 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F conjugated to CRM 197.
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, and 23F conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT).
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 7F, 9V, 19F and 23F conjugated to tetanus toxoid (TT) and saccharide from serotypes 3, 14 18C and 6B conjugated to diphtheria toxoid (DT).
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT).
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 7F, 9V, 19F and 23F individually conjugated to tetanus toxoid (TT) and saccharide from serotypes 3, 14 18C and 6B conjugated to diphtheria toxoid (DT).
- saccharide throughout this specification may indicate polysaccharide or oligosaccharide and includes both.
- Capsular polysaccharides of Streptococcus pneumoniae comprise repeating oligosaccharide units which may contain up to 8 sugar residues.
- oligosaccharide units for the key Streptococcus pneumoniae serotypes see JONES, Christopher. Vaccines based on the cell surface carbohydrates of pathogenic bacteria. An. Acad. Bras Cienc, June 2005, vol.77, no.2, p.293-324 Table Il ISSN 0001- 3765.
- Capsular saccharide antigens of the invention are prepared by standard techniques known to those skilled in the art. Typically polysaccharides conjugates are prepared by separate processes and formulated into a single dosage formulation. For example, in one embodiment, each pneumococcal polysaccharide serotype is grown in a soy-based medium. The individual polysaccharides are then purified through centrifugation, precipitation, ultra-filtration, and column chromatography. The purified polysaccharides are chemically activated to make the saccharides capable of reacting with the carrier protein. Once activated, each capsular polysaccharide is separately conjugated to a carrier protein to form a glycoconjugate. In one embodiment, each capsular polysaccharide is conjugated to the same carrier protein.
- the conjugation is effected by reductive amination.
- the chemical activation of the polysaccharides and subsequent conjugation to the carrier protein are achieved by conventional means. See, for example, U.S. Pat. Nos. 4,673,574 and 4,902,506.
- the polysaccharide-protein conjugates are purified (enriched with respect to the amount of polysaccharide-protein conjugate) by a variety of techniques. These techniques include concentration/diafiltration operations, precipitation/elution, column chromatography, and depth filtration. See for examples US2007/0184072 or WO2008/079653.
- the individual glycoconjugates are purified, they are compounded to formulate the vaccine of the present invention.
- Formulation of the immunogenic composition of the present invention can be accomplished using art-recognized methods.
- the individual pneumococcal conjugates can be formulated with a physiologically acceptable vehicle to prepare the composition. Examples of such vehicles include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and dextrose solutions.
- each dose comprises 0.1 to 1000 ⁇ g of each saccharide or saccharide - protein conjugate, preferably 2 to 100 ⁇ g, most preferably 4 to 40 ⁇ g. In an embodiment, each dose comprises between 0.1 and 20 ⁇ g , 1 and 10 ⁇ g or 1 and 5 ⁇ g of saccharide.
- the vaccine of the invention contains each S. pneumoniae capsular saccharide at a dose of between 0.1-20 ⁇ g, 0.5-10 ⁇ g; 0.5-5 ⁇ g or 1- 5 ⁇ g of saccharide.
- capsular saccharides may be present at different dosages, for example some capsular saccharides may be present at a dose of around or exactly 2 ⁇ g or some capsular saccharides may be present at a dose of around or exactly 4 ⁇ g.
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g.
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g.
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM 197 wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM 197 wherein each S. pneumoniae capsular saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM 197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g.
- the vaccine disclosed herein contain from 5 to 500 ⁇ g, preferably 10 to 200 ⁇ g, even more preferably, 20 to 100 ⁇ g of CRM197 carrier protein In an embodiment of the present invention, the vaccine disclosed herein contain 20 to 50 ⁇ g, preferably 20 to 40 ⁇ g, even more preferably 25 to 30 ⁇ g, even more preferably approximately 28 or 29 ⁇ g of CRM 197 carrier protein. In an embodiment of the present invention, the vaccine disclosed herein contain 40 to 100 ⁇ g, preferably 40 to 80 ⁇ g, even more preferably 50 to 60 ⁇ g, even more preferably approximately 57 or 58 ⁇ g of CRM 197 carrier protein. In a particular embodiment of the present invention, the vaccine disclosed herein contain sodium chloride and / or sodium succinate buffer as excipients.
- the pneumococcal vaccine to be used herein is the 7-valent conjugated pneumococcal vaccine (Prevenar) or the 13-valent conjugated pneumococcal vaccine disclosed in US2007/0184072 - Prevenar 13).
- 7-valent Prevenar contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and. 23F individually conjugated to CRM197.
- 13-valent Prevenar contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197.
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S pneumoniae capsular saccharide is at a dose of 1 ⁇ g except for 4, 18C and 19F which is at a dose of 3 ⁇ g.
- said vaccine contains from 5 to 500 ⁇ g, preferably 7 to 100 ⁇ g of protein D carrier protein, from 2 to 200 ⁇ g, preferably 4 to 50 ⁇ g of tetanus toxoid (TT) carrier protein and from 1 to 100 ⁇ g, preferably 2 to 25 ⁇ g of diphtheria toxoid (DT) carrier protein.
- said vaccine contains from 9 to 16 ⁇ g of protein D carrier protein, from 5 to 10 ⁇ g tetanus toxoid (TT) carrier protein and from 3 to 6 ⁇ g diphtheria toxoid (DT) carrier protein.
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 4, 18C and 19F which is at a dose of 6 ⁇ g.
- said vaccine contains from 10 to 1000 ⁇ g, preferably 14 to 200 ⁇ g of protein D carrier protein, from 4 to 400 ⁇ g, preferably 8 to 100 ⁇ g of tetanus toxoid (TT) carrier protein and from 2 to 200 ⁇ g, preferably 4 to 50 ⁇ g of diphtheria toxoid (DT) carrier protein.
- said vaccine contains from 18 to 32 ⁇ g of protein D carrier protein, from 10 to 20 ⁇ g tetanus toxoid (TT) carrier protein and from 6 to 12 ⁇ g diphtheria toxoid (DT) carrier protein.
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae capsular saccharide is at a dose of 3 ⁇ g except for 4, 18C and 19F which is at a dose of 9 ⁇ g.
- said vaccine contains from 15 to 1500 ⁇ g, preferably 21 to 300 ⁇ g of protein D carrier protein, from 6 to 600 ⁇ g, preferably 12 to 150 ⁇ g of tetanus toxoid (TT) carrier protein and from 3 to 300 ⁇ g, preferably 6 to 75 ⁇ g of diphtheria toxoid (DT) carrier protein.
- said vaccine contains from 27 to 48 ⁇ g of protein D carrier protein, from 15 to 30 ⁇ g tetanus toxoid (TT) carrier protein and from 9 to 18 ⁇ g diphtheria toxoid (DT) carrier protein.
- the vaccine of the invention comprises saccharide from serotypes 1 , 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to protein D, saccharide from serotype 18C conjugated to tetanus toxoid (TT) and saccharide from serotype 19F conjugated to diphtheria toxoid (DT) wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 4, 18C and 19F which is at a dose of 12 ⁇ g.
- TT tetanus toxoid
- DT diphtheria toxoid
- said vaccine contains from 20 to 2000 ⁇ g, preferably 28 to 400 ⁇ g of protein D carrier protein, from 8 to 800 ⁇ g, preferably 16 to 200 ⁇ g of tetanus toxoid (TT) carrier protein and from 4 to 400 ⁇ g, preferably 8 to 100 ⁇ g of diphtheria toxoid (DT) carrier protein.
- said vaccine contains from 36 to 64 ⁇ g of protein D carrier protein, from 20 to 40 ⁇ g tetanus toxoid (TT) carrier protein and from 12 to 24 ⁇ g diphtheria toxoid (DT) carrier protein.
- the vaccine disclosed herein contain sodium chloride buffer as excipients.
- the pneumococcal vaccine to be used herein is the 10-valent conjugated pneumococcal vaccine sold uder the commercial name SynflorixTM.
- the pneumococcal vaccines as disclosed herein comprise at least one, two or three adjuvant in addition to the at least one TLR-9 agonist adjuvant disclosed herein.
- adjuvant refers to a compound or mixture that enhances the immune response to an antigen. Antigens may act primarily as a delivery system, primarily as an immune modulator or have strong features of both. Suitable adjuvants include those suitable for use in mammals, including humans
- alum e.g., aluminum phosphate, aluminum sulfate or aluminum hydroxide
- calcium phosphate e.g., calcium phosphate
- liposomes e.g., calcium phosphate, liposomes
- oil-in-water emulsions such as MF59 (4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v sorbitan trioleate (Span 85)
- water-in-oil emulsions such as Montanide
- PLG poly(D,L-lactide-co-glycolide)
- Suitable immune modulatory type adjuvants that can be used in humans include, but are not limited to saponins extracts from the bark of the Aquilla tree (QS21 , Quil A), TLR4 agonists such as MPL (Monophosphoryl Lipid A), 3DMPL (3-O-deacylated MPL) or GLA-AQ, LT/CT mutants, , cytokines such as the various interleukins (e.g., IL-2, IL-12) or GM-CSF, and the like.
- saponins extracts from the bark of the Aquilla tree QS21 , Quil A
- TLR4 agonists such as MPL (Monophosphoryl Lipid A), 3DMPL (3-O-deacylated MPL) or GLA-AQ
- LT/CT mutants e.g., IL-2, IL-12
- cytokines such as the various interleukins (e.g., IL-2, IL-12) or GM-C
- ISCOMS see, e.g., Sj ⁇ lander et al. (1998) J. Leukocyte Biol. 64:713; WO90/03184, WO96/11711 , WO 00/48630, WO98/36772, WO00/41720, WO06/134423 and WO07/026190
- GLA-EM which is a combination of a TLR4 agonist and an oil-in-water emulsion.
- CFA Complete Freund's Adjuvant
- IFA Freund's Incomplete Adjuvant
- Emulsigen N-acetyl-muramyl-L-threonyl-
- D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor- MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3- hydroxyphosphoryloxy)-ethylamin ⁇ (CGP 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion.
- MPL+TDM+CWS cell wall skeleton
- exemplary adjuvants to enhance effectiveness of the pneumococcal vaccines as disclosed herein include, but are not limited to: (1 ) oil-in-water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components), such as for example (a) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121 , and thr-MDP either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (b) RIBITM adjuvant system (RAS), (Ribi Immunochem, Hamilton, MT) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components such as monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (DETOXTM);
- cytokines such as interleukins (e.g. IL-1 , IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (WO99/44636), etc.), interferons (e.g.
- MPL monophosphoryl lipid A
- 3dMPL 3-O-deacylated MPL
- EP-A-0835318, EP-A-0735898, EP-A-0761231 ); (7) a polyoxyethylene ether or a polyoxyethylene ester (see e.g. WO99/52549); (8) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (WO01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol (WO01/21152); (9) a saponin and an immunostimulatory oligonucleotide (e.g.
- a CpG oligonucleotide (WO00/62800); (10) an immunostimulant and a particle of metal salt (see e.g. WO00/23105); (11 ) a saponin and an oil-in-water emulsion e.g. WO99/11241 ; (12) a saponin (e.g. QS21) + 3dMPL + IM2 (optionally + a sterol) e.g. WO98/57659; (13) other substances that act as immunostimulating agents to enhance the efficacy of the composition.
- a saponin e.g. QS21
- 3dMPL + IM2 optionally + a sterol
- Muramyl peptides include N-acetyl-muramyl-L-threonyl-D- isoglutamine (thr-MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L- alanyl-D-isoglutarninyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc.
- thr-MDP N-acetyl-muramyl-L-threonyl-D- isoglutamine
- nor-MDP N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine
- the pneumococcal vaccines as disclosed herein comprise alum, aluminium hydroxide, aluminum phosphate, or aluminum sulphate as additional adjuvant to the at least one TLR-9 agonist adjuvant disclosed herein.
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g, further comprising 0.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S.
- pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g, further comprising 1 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g, further comprising 1.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the vaccine contains saccharide from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g, further comprising 2 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM 197 wherein each S. pneumoniae capsular saccharide is at a dose of 2 ⁇ g except for 6B which is at a dose of 4 ⁇ g further comprising 0.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 4 ⁇ g except for 6B which is at a dose of 8 ⁇ g further comprising 1 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM 197 wherein each S. pneumoniae capsu lar saccharide is at a dose of 6 ⁇ g except for 6B which is at a dose of 12 ⁇ g further comprising 1.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the vaccine contains saccharide from serotypes 1 , 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to CRM197 wherein each S. pneumoniae capsular saccharide is at a dose of 8 ⁇ g except for 6B which is at a dose of 16 ⁇ g further comprising 1.5 mg aluminum phosphate, and optionally sodium chloride and sodium succinate buffer as excipients.
- the pneumococcal vaccine is the 7-valent conjugated pneumococcal vaccine (Prevenar) or the 13-valent conjugated pneumococcal vaccine as disclosed in US2007/0184072 (13vPnC).
- the subject to be vaccinated with the vaccines of the present invention is an immunocompromised subject.
- said immunocomprimised subject is a mammal, such as a cat, sheep, pig, horse, bovine, dog or a human.
- said subject is a human.
- An immunocompromised individual is generally defined as a person who exhibits an attenuated or reduced ability to mount a normal humoral or cellular defense to challenge by infectious agents.
- the immunocompromised subject to be vaccinated with the pneumococcal vaccine suffers from a disease or condition that impairs the immune system and results in an antibody response that is insufficient to protect against or treat pneumococcal disease.
- said disease is a primary immunodeficiency disorder.
- said primary immunodeficiency disorder is selected from the group consisting of: combined T- and B-cell immunodeficiencies, antibody deficiencies, well-defined syndromes, immune dysregulation diseases, phagocyte disorders, innate immunity deficiencies, autoinflammatory disorders, and complement deficiencies.
- said combined T- and B-cell immunodeficiency is selected from the group consisting of: yc deficiency, JAK3 deficiency, interleukin 7 receptor chain ⁇ deficiency, CD45 deficiency or CD3 ⁇ /CD3 ⁇ deficiency, RAG 1/2 deficiency, DCLRE1C deficiency, adenosine deaminase (ADA) deficiency, reticular dysgenesis, Omenn syndrome, DNA ligase type IV deficiency, CD40 ligand deficiency, CD40 deficiency, Purine nucleoside phosphorylase (PNP) deficiency, MHC class Il deficiency, CD3 ⁇ deficiency, CD8 deficiency, ZAP-70 deficiency, TAP-1/2 deficiency and Winged helix deficiency.
- PNP Purine nucleoside phosphorylase
- said antibody deficiencies is selected from the group consisting of: X-linked agammaglobulinemia, btk deficiency, Bruton's agammaglobulinemia, ⁇ -Heavy chain deficiency, I 5 deficiency, Ig ⁇ deficiency, BLNK deficiency, thymoma with immunodeficiency, common variable immunodeficiency (CVID), ICOS deficiency, CD19 deficiency, TACI (TNFRSF13B) deficiency, BAFF receptor deficiency, AID deficiency, UNG deficiency, heavy chain deletions, kappa chain deficiency, isolated IgG subclass deficiency, IgA with IgG subsclass deficiency, selective immunoglobulin A deficiency, specific antibody deficiency to specific antigens with normal B cell and normal Ig concentrations, transient hypogammaglobulinemia of infancy (THI
- said well-defined syndrome is selected from the group consisting of: Wiskott-Aldrich syndrome, ataxia telangiectasia, ataxia-like syndrome, Nijmegen breakage syndrome, Bloom syndrome, DiGeorge syndrome (when associated with thymic defects), cartilage-hair hypoplasia, Schimke syndrome , Hermansky-Pudlak syndrome type 2, Hyper-lgE syndrome, Chronic mucocutaneous candidiasis,
- said immune dysregulation disease is selected from the group consisting of: Chediak- Higashi syndrome, Griscelli syndrome type 2, perforin deficiency, MUNC13D deficiency, syntaxin 11 deficiency, X-linked lymphoproliferative syndrome, autoimmune lymphoproliferative syndrome: such as type 1a (CD95 defects), type 1 b (Fas ligand defects), type 2a (CASP10 defects), type 2b (CASP8 defects), APECED (autoimmune polyendocrinopathy with candidia
- said innate immunity deficiency is selected from the group consisting of: Hypohidrotic ectodermal dysplasia, NEMO deficiency, IKBA deficiency, IRAK-4 deficiency, WHIM syndrome (warts, hypogammaglobulinaemia, infections, myleokathexis) and Epidermodysplasia verruciformis.
- said autoinflammatory disorder is selected from the group consisting of: Familial Mediterranean fever, TNF receptor associated periodic syndrome (TRAPS), Hyper-lgD syndrome (HIDS), CIAS1 -related diseases, Muckle-Wells syndrome, Familial cold autoinflammatory syndrome, Neonatal onset multisystem inflammatory disease, PAPA syndrome (pyogenic sterile arthritis, pyoderma gangrenosum, acne) and Blau syndrome.
- TRAPS TNF receptor associated periodic syndrome
- HIDS Hyper-lgD syndrome
- CIAS1 -related diseases CIAS1 -related diseases
- Muckle-Wells syndrome Familial cold autoinflammatory syndrome
- Neonatal onset multisystem inflammatory disease Neonatal onset multisystem inflammatory disease
- PAPA syndrome pyogenic sterile arthritis, pyoderma gangrenosum, acne
- Blau syndrome Blau syndrome
- said complement deficiency is selected from the group consisting of: C1q deficiency (lupus-like syndrome, rheumatoid disease, infections), C1 r deficiency (idem), C4 deficiency (idem), C2 deficiency (lupus-like syndrome, vasculitis, polymyositis, pyogenic infections), C3 deficiency (recurrent pyogenic infections), C5 deficiency (Neisserial infections, SLE), C6 deficiency (idem), C7 deficiency (idem, vasculitis), C8a and C8b deficiency (idem), C9 deficiency (Neisserial infections), C1 -inhibitor deficiency (hereditary angioedema), Factor I deficiency (pyogenic infections), Factor H deficiency (haemolytic-uraemic syndrome, membranoproliferative glomerulonephritis),
- the immunocompromised subject to be vaccinated suffers from a disease that affects the immune system wherein said disease is an acquired immunodeficiency disorder.
- Acquired immunodeficiency can be caused by several factors including bacterial or viral infections (such as HIV), cancers (such as leukaemia or myeloma), other chronic disorder but also aging, malnutrition, or various (such as glucocorticoids, chemotherapydrug treatments
- the immunocompromised subject to be vaccinated suffers from a disease selected from the groups consisting of: HIV-infection, acquired immunodeficiency syndrome (AIDS), cancer, chronic heart or lung disorders, congestive heart failure, diabetes mellitus, chronic liver disease, alcoholism, cirrhosis, spinal fluid leaks, cardiomyopathy, chronic bronchitis, emphysema, Chronic obstructive pulmonary disease (COPD), spleen dysfunction (such as sickle cell disease), lack of spleen function (asplenia), blood malignancy, leukemia, multiple myeloma, Hodgkin's disease, lymphoma, kidney failure, nephrotic syndrome and asthma.
- AIDS acquired immunodeficiency syndrome
- the immunocompromised subject to be vaccinated suffers from a disease selected from the groups consisting of: spleen dysfunction (such as sickle cell disease), lack of spleen function (asplenia), leukemia, multiple myeloma, Hodgkin's disease and lymphoma.
- spleen dysfunction such as sickle cell disease
- asplenia lack of spleen function
- leukemia multiple myeloma
- Hodgkin's disease lymphoma.
- the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS).
- HIV-infection or acquired immunodeficiency syndrome (AIDS) HIV-infection or acquired immunodeficiency syndrome
- the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS), and is under therapy, said therapy consisting of taking at least one antiretroviral drug selected from the group consisting of a non-nucleosied reverse transcriptase inhibitor, a protease inhibitor and a nucleoside analog reverse transcriptase inihibitor (e.g abacavir).
- said therapy consists of taking at least three drugs belonging to at least two classes of antiretroviral drugs selected from the group consisting of non-nucleoside reverse transcriptase inhibitor, protease inhibitor and nucleoside analog reverse transcriptase inihibitor (e.g. abacavir).
- said therapy consists of taking at least two nucleoside analogue reverse transcriptase inhibitors plus either a protease inhibitor or a non-nucleoside reverse transcriptase inhibitor.
- the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS) and is under highly active antiretroviral therapy (HAART).
- said HAART consists of a 3 drug regimen which includes a non-nucleoside reverse transcriptase inhibitor, a protease inhibitor and/or a nucleoside analog reverse transcriptase inihibitor (e.g. abacavir) or a 2 drug regimen which includes a combination of a non-nucleoside reverse transcriptase inhibitor and a protease inhibitor.
- the immunocompromised subject to be vaccinated suffers from HIV-infection or acquired immunodeficiency syndrome (AIDS) and is not under highly active antiretroviral therapy (HAART), or is not under antiretroviral therapy, or said subject has never been exposed to antiretroviral drugs.
- HIV-infection or acquired immunodeficiency syndrome AIDS
- HAART highly active antiretroviral therapy
- the immunocompromised subject to be vaccinated is a non-viremic HIV infected patient. In another embodiment, the immunocompromised subject to be vaccinated is a viremic HIV infected patient.
- the immunocompromised subject to be vaccinated suffers from tuberculosis or sexually transmitted diseases, e. g., syphilis or hepatitis.
- the immunocompromised subject to be vaccinated suffers from malnutrition. In an embodiment of the present invention, the immunocompromised subject to be vaccinated suffers from aging. In a particular embodiment of the present invention, the immunocompromised subject to be vaccinated is a human adult 55 years of age or older, more preferably a human adult 65 years of age or older. In an embodiment, the immunocompromised subject to be vaccinated is a human adult 70 years of age or older, 75 years of age or older or 80 years of age or older.
- the immunocompromised subject to be vaccinated is taking a drug or treatment that lowers the body's resistance to infection.
- the immunocompromised subject to be vaccinated is taking a drug selected from the group consisting of chemotherapy (e.g. cancer drugs), disease-modifying antirheumatic drugs, immunosuppressive drugs after organ transplants and glucocorticoids.
- the immunocompromised subject to be vaccinated is taking an oral immunosuppressant drug selected from the group consisting of: tacrolimus (Prograf), mycophenolate mofetil (CellCept), sirolimus (Rapamune), prednisone, cyclosoporine (Neoral, Sandimmune, Gengraf) and azathioprine (Imuran).
- an oral immunosuppressant drug selected from the group consisting of: tacrolimus (Prograf), mycophenolate mofetil (CellCept), sirolimus (Rapamune), prednisone, cyclosoporine (Neoral, Sandimmune, Gengraf) and azathioprine (Imuran).
- the immunocompromised subject is taking at least two or three of said oral immunosuppressant drugs.
- the immunocompromised subject to be vaccinated is taking an immunosuppressant drug selected from the group consisting of: Everolimus, Mycophenolic acid, Corticosteroids (such as Prednisolone or Hydrocortisone), Monoclonal anti-IL-2R ⁇ receptor antibodies (such as Basiliximab or Daclizumab), Anti-thymocyte globulin (ATG) and Anti-lymphocyte globulin (ALG).
- the immunocompromised subject is taking at least two or three of said immunosuppressant drugs.
- the immunocompromised subject to be vaccinated has undergone organ transplant, or bone marrow transplant or cochlear implantation.
- the immunocompromised subject to be vaccinated has undergone radiation therapy.
- the immunocompromised subject to be vaccinated is a smoker.
- the immunocompromised subject to be vaccinated suffers from asthma and is treated with oral corticosteroid therapy.
- the immunocompromised subject to be vaccinated is an Alaskan native or an American Indian.
- the immunocompromised subject to be vaccinated has a white blood cell count (leukocyte count) below 5 x 10 9 cells per liter, or below 4 x 10 9 cells per liter, or below 3 x 10 9 cells per liter, or below 2 x 10 9 cells per liter, or below 1 x 10 9 cells per liter, or below 0.5 x 10 9 cells per liter, or below 0.3 x 10 9 cells per liter, or below 0.1 x 10 9 cells per liter.
- White blood cell count (leukocyte count) The number of white blood cells (WBCs) in the blood.
- the WBC is usually measured as part of the CBC (complete blood count).
- White blood cells are the infection- fighting cells in the blood and are distinct from the red (oxygen-carrying) blood cells known as erythrocytes.
- red blood cells known as erythrocytes.
- white blood cells There are different types of white blood cells, including neutrophils (polymorphonuclear leukocytes; PMNs), band cells (slightly immature neutrophils), T-type lymphocytes (T cells), B-type lymphocytes (B cells), monocytes, eosinophils, and basophils. All the types of white blood cells are reflected in the white blood cell count.
- the normal range for the white blood cell count is usually between 4,300 and 10,800 cells per cubic millimeter of blood. This can also be referred to as the leukocyte count and can be expressed in international units as 4.3 - 10 8 x 10 9 cells per liter.
- the immunocompromised subject to be vaccinated suffers from neutropenia.
- the immunocompromised subject to be vaccinated has a neutrophil count below 2 x 10 9 cells per liter, or below 1 x 10 9 cells per liter, or below 0.5 x 10 9 cells per liter, or below 0.1 x 10 9 cells per liter, or below 0.05 x 10 9 cells per liter.
- a low white blood cell count or "neutropenia" is a condition characterized by abnormally low levels of neutrophils in the circulating blood. Neutrophils are a specific kind of white blood cell that help prevent and fight infections. The most common reason that cancer patients experience neutropenia is as a side effect of chemotherapy. Chemotherapy-induced neutropenia increases a patient's risk of infection and disrupts cancer treatment.
- neutrophils are a major component of antibacterial defense mechanisms. As the neutrophil count falls below 1.0, 0.5, and 0.1 x 10 9 /L, the frequency of life-threatening infection rises steeply from 10% to 19% and 28%, respectively.
- the immunocompromised subject to be vaccinated has a CD4+ cell count below 500/mm3, or CD4+ cell count below 300/mm3, or CD4+ cell count below 200/mm3, CD4+ cell count below 100/mm3, CD4+ cell count below 75/mm3, or CD4+ cell count below 50/mm3.
- CD4 cell tests are normally reported as the number of cells in mm3 Normal CD4 counts are between 500 and 1600, and CD8 counts are between 375 and 1100. CD4 counts drop dramatically in people with HIV.
- any of the immunocompromised subject disclosed herein is a human male or a human female.
- a prime dose is given at day 0 and one or more boosts are given at intervals that range from about 2 to about 24 weeks, preferably with a dosing interval of 4-8 weeks. In an embodiment, a prime dose is given at day 0 and a boost is given about 3 months later.
- the vaccine of the invention may reduce the number of vaccinations required to achieve seroprotection, accelerate seroconversion, possibly permitting post- exposure vaccination, reduce the proportion of non-responders, reduce the amount of antigen required, increase antibody avidity and protective activity and/or lead to a more sustained antibody levels.
- AEs Adverse events
- SAEs Serious adverse events
- Laboratory tests hematology, clinical chemistry i.e. viral load (HIV RNA) and CD4-count
- Physical examination hematology, clinical chemistry i.e. viral load (HIV RNA) and CD4-count.
- CPG 7909 is a B-Class CpG ODN of sequence ⁇ '-TCGTCGTTTTGTCGTTTTGTCGTT-S' (SEQ ID NO: 5) and has been synthesized with a wholly phosphorothioate backbone.
- TEST DRUG DOSAGE 1 mg CpG 7909 (100 ⁇ l) mixed with each pneumococcal vaccination.
- CONTROLS 100 ⁇ l of a neutral PBS buffer (identical in colour and viscocity to the test drug) with each pneumococcal vaccine.
- ROUTE OF ADMINISTRATION Intramuscular injection.
- BLINDING Double-blinded study.
- ENROLMENT Randomization;
- Eligible patients have been randomized in a ratio of 1 :1 to receive pneumococcal vaccination with or without CpG 7909.
- Vaccines were kept in their original container according to manufacturer's description and mixed with the adjuvant (CpG 7909 or Placebo) immediately before immunization. Immunization has been done in the left or right upper deltoid muscle at the preference of the subject.
- a withdrawal from the investigational product is any subject who does not receive the complete treatment, i.e. when no further planned dose is administered from the date of withdrawal.
- a subject withdrawal from the investigational product may not necessarily be withdrawn from the study as further study procedures or follow-up may be performed (safety or immunogenicity) if planned in the protocol.
- PARTICIPANT EXCLUSION CRITERIA 1) Pregnancy as determined by a positive urine beta-hCG (if female).
- Reliable methods of birth control include: pharmacologic contraceptives including oral, parenteral, and transcutaneous delivery; condoms with spermicide; diaphragm with spermicide; surgical sterilization; vaginal ring; intrauterine device; abstinence; and post-menopause (if female). 3) Currently breast-feeding (if female).
- Viral load > 50 copies/mL if on HAART (defined as at least three antiretrovirals including either a protease inhibitor or a NNRTI, i.e. combivir 300/150 mg x2 + stocrin 600 mg x1 for a minimum of 6 months) 6) Previous enrollment in this study.
- Consenting participants that pass the inclusion/exclusion criteria have been enrolled in the study. Blood samples for baseline parameter measurements have been drawn before proceeding to immunization. At randomization, participants has been allocated 1 :1 one of two study regimens:
- Control group 1 Two doses of 7-valent conjugate pneumococcal vaccination (Prevenar®, Wyeth) + 100 ⁇ l of placebo (day 0), two doses of 7-valent conjugate pneumococcal vaccination (Prevenar®, Wyeth) + 100 ⁇ l of placebo (day 90) and one dose of 23-valent polysaccharide vaccine (Pneumo Novum®, Sanofi Pasteur MSD) + 100 ⁇ l of placebo (day 270).
- VACCINES AND TEST DRUG/PLACEBO INJECTIONS All subjects were dosed at 0, 90 and 270 days. All immunizations were done in the deltoid muscle of the right or left arm (according to the participants preference).
- the study was powered to detect differences between the experimental group and the control group in Pneumococcal vaccine high responders defined as 2-fold increase and IgG levels >1 ⁇ g/mL to at least 5 of 7 pneumococcal serotypes (by quantitative IgG measurements).
- the study was not powered to detect differences in the incidence of pneumonia or confirmed pneumococcal disease invasive/non-invasive. This would require a substantial number of participants and a longer follow-up period.
- the most widely used measurement of immune response to pneumococcal vaccination is quantitative detection of serotype specific anticapsular antibodies. Recent data indicate that the specificity of this method can be improved by incorporation a 22F absorption step; thereby removing crossreacting antibodies of low avidity.
- Measuring the quantitative amount of serotype specific anticapsular antibodies does not give any information the functionality of the antibodies. This can be measured by a flow-cyto metric opsonophagocytic assay and gives indirect information on the antibodies ability to opsonize and facilitate killing of invading pneumococci. Qualitative analysis was done using a flowcytometric opsonophagocytic assay which measures functional (opsonophagocytic) activity (OPA) of the serotype specific antibodies. In short: Eight twofold dilutions are made in OPA buffer from 10 ⁇ l of test serum.
- a 20- ⁇ l aliquot of either multiplex bacteria or multiplex bead suspension containing 1x10 5 of each of the target pneumococcal serotype or pneumococcal polysaccharide-conjugated beads is added to each well, and the plate is incubated for one hour at 37°C with horizontal shaking (200 rpm). Following this, 20 ⁇ l of sterile serum from 3- to 4-week-old baby rabbit serum (Pel-Freez, Brown Deer, Wis.) is added to each well except for HL60 cell control wells, which receives 20 ⁇ l of OPA buffer.
- An AE is any untoward medical occurrence in a clinical investigation subject, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product.
- An AE can therefore be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom or disease (new or exacerbated) temporally associated with the use of a medicinal product.
- an AE has been graded according to the Common Toxicity Criteria, version 2.0.
- An adverse event occurring during a clinical trial is any undesirable experience associated with the use of a medical product in a participant.
- the event is serious and will be reported to the regulatory authority when the participant outcome is:
- Pneumococcal vaccine high responders defined as 2-fold increase and IgG levels >1 ⁇ g/mL to at least 5 of 7 pneumococcal serotypes (by quantitative IgG measurements)
- Serotype-specific antibody response defined as 2-fold increase and IgG levels >1 ⁇ g/mL
- Serotype-specific antibody response defined as change in IgG levels At six months after 2nd vaccination with Prevenar.
- Serotype-specific antibody response defined as 2-fold increase and IgG levels >1 ⁇ g/mL
- Pneumococcal vaccine high responders defined as 2-fold increase and IgG levels >1 ⁇ g/mL to at least 5 of 7 pneumococcal serotypes (by quantitative IgG measurements)
- Serotype-specific antibody response defined as 2-fold increase and IgG levels >1 ⁇ g/mL
- Serotype-specific antibody response defined as change in IgG levels • Geometric Mean Antibody Concentrations With the Standard Enzyme Immunoassay for serotypes 1 , 4, 7F, 9V, 14, 18C and 19F PHARYNGEAL COLONIZATION At six months after 2nd vaccination with Prevenar.
- Poisson regression model adjusted by age, CD4 cell count at baseline and HAART (on HAART vs. no HAART) at baseline is planned.
- Sample size is calculated for the primary endpoint (prevalence ratios of high responders at six months after 2nd vaccination with Prevenar, comparing the two vaccination scheme groups). Setting the probabilities of Type I and Type Il error to:
- Primary endpoint proportion of vaccine highresponders (defined as 2-fold increase and IgG levels >1 ⁇ g/mL to at least 5 of 7 pneumococcal serotypes).
- N is the number of participants needed in each group.
- Example 2 1 Immunoqenicity and safety of TLR9-adjuvanted pneumococcal vaccines in HIV-infected adults. Results of the randomized, double-blind, placebo-controlled trial The clinical trial described in example 1 was conducted.
- Results As shown in table 1 , 96 participants were included. In each group of 48 participants, 38 were on ART.
- Figures 2 and 3 show the difference in relative IgG response for two PCV serotypes (9v and 14) between the CPG and placebo group.
- Figures 4 and 5 show the relative IgG response for two non-PCV serotypes (1 and 7f) in the CPG and placebo group (as expected no increase in IgG was observed in relation to PCV immunization). Following PPV immunization, both groups (+/- CpG) show significant responses. However, CpG did not increase the antibody response to non-PCV serotypes (1 and 7f) after PPV immunization.
- TLR9-aqonist adjuvant induces cellular memory in response to pneumococcal conjugate vaccine in HIV-infected adults.
- PBMC Periferal blood mononuclear cells
- the Frozen PBMCs were thawed and tested for viability and transferred to 96-well flat-bottomed tissue culture plates. The cells were incubated overnight at 37°C, and stimulated the following day with purified pneumococcal polysaccharide (serotype (ST) 6B and 14). After 48 hours incubation, the supernatants were harvested and cytokine concentrations measured by Luminex. The relative response was calculated as the ratio between cytokine concentrations post- and pre-immunization, taking pre-existing immunity to
- Streptococcus pneumoniae into account, as well as eliminating bias from innate recognition.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Pulmonology (AREA)
- Oncology (AREA)
- Cardiology (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Heart & Thoracic Surgery (AREA)
- Addiction (AREA)
- Obesity (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Endocrinology (AREA)
- Urology & Nephrology (AREA)
- Tropical Medicine & Parasitology (AREA)
- AIDS & HIV (AREA)
- Emergency Medicine (AREA)
- Hospice & Palliative Care (AREA)
- Gastroenterology & Hepatology (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10712546.0A EP2424562B1 (en) | 2009-04-30 | 2010-03-17 | Pneumococcal vaccine and uses thereof |
| AU2010243285A AU2010243285B2 (en) | 2009-04-30 | 2010-03-17 | Pneumococcal vaccine and uses thereof |
| BRPI1014494A BRPI1014494A2 (pt) | 2009-04-30 | 2010-03-17 | vacina pneumocócica e usos da mesma |
| RU2011143398/15A RU2536248C2 (ru) | 2009-04-30 | 2010-03-17 | Пневмококковая вакцина и ее применения |
| KR1020117028547A KR101450958B1 (ko) | 2009-04-30 | 2010-03-17 | 폐렴구균 백신 및 그의 용도 |
| ES10712546.0T ES2552153T3 (es) | 2009-04-30 | 2010-03-17 | Vacuna neumocócica y usos de la misma |
| DK10712546.0T DK2424562T3 (en) | 2009-04-30 | 2010-03-17 | Pneumococcal vaccine and uses thereof |
| CA2757620A CA2757620C (en) | 2009-04-30 | 2010-03-17 | Pneumococcal vaccine and uses thereof |
| MX2011011505A MX340830B (es) | 2009-04-30 | 2010-03-17 | Vacuna neumococica y usos de la misma. |
| US13/266,846 US20120052088A1 (en) | 2009-04-30 | 2010-03-17 | Pneumococcal vaccine and uses thereof |
| CN2010800190716A CN102413838A (zh) | 2009-04-30 | 2010-03-17 | 肺炎球菌疫苗及其用途 |
| IL215389A IL215389A (en) | 2009-04-30 | 2011-09-26 | Pneumococcal vaccine and its uses |
| US14/049,842 US9205143B2 (en) | 2009-04-30 | 2013-10-09 | Pneumococcal vaccine and uses thereof |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17406809P | 2009-04-30 | 2009-04-30 | |
| US61/174,068 | 2009-04-30 | ||
| US23831309P | 2009-08-31 | 2009-08-31 | |
| US61/238,313 | 2009-08-31 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/266,846 A-371-Of-International US20120052088A1 (en) | 2009-04-30 | 2010-03-17 | Pneumococcal vaccine and uses thereof |
| US14/049,842 Division US9205143B2 (en) | 2009-04-30 | 2013-10-09 | Pneumococcal vaccine and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010125480A1 true WO2010125480A1 (en) | 2010-11-04 |
Family
ID=42561160
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2010/051150 Ceased WO2010125480A1 (en) | 2009-04-30 | 2010-03-17 | Pneumococcal vaccine and uses thereof |
Country Status (14)
| Country | Link |
|---|---|
| US (2) | US20120052088A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2424562B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP5823670B2 (cg-RX-API-DMAC7.html) |
| KR (1) | KR101450958B1 (cg-RX-API-DMAC7.html) |
| CN (1) | CN102413838A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2010243285B2 (cg-RX-API-DMAC7.html) |
| BR (1) | BRPI1014494A2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2757620C (cg-RX-API-DMAC7.html) |
| DK (1) | DK2424562T3 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2552153T3 (cg-RX-API-DMAC7.html) |
| IL (1) | IL215389A (cg-RX-API-DMAC7.html) |
| MX (1) | MX340830B (cg-RX-API-DMAC7.html) |
| RU (1) | RU2536248C2 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2010125480A1 (cg-RX-API-DMAC7.html) |
Cited By (53)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100143400A1 (en) * | 2008-12-09 | 2010-06-10 | Pfizer Inc. | Immunostimulatory Oligonucleotides |
| WO2012089800A1 (en) * | 2010-12-30 | 2012-07-05 | Intervet International B.V. | Immunostimulatory oligodeoxynucleotides |
| WO2012160183A1 (en) * | 2011-05-26 | 2012-11-29 | Intervet International B.V. | Immunostimulatory oligodeoxynucleotides |
| US20140105927A1 (en) * | 2012-10-17 | 2014-04-17 | Glaxosmithkline Biologicals S.A. | Immunogenic composition |
| WO2015110940A2 (en) | 2014-01-21 | 2015-07-30 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| WO2015110941A2 (en) | 2014-01-21 | 2015-07-30 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2015110942A2 (en) | 2014-01-21 | 2015-07-30 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| WO2016113644A1 (en) | 2015-01-15 | 2016-07-21 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| EP2865392B1 (en) | 2012-06-20 | 2016-11-16 | SK Chemicals Co., Ltd. | Polyvalent pneumococcal polysaccharide-protein conjugate composition |
| WO2017013548A1 (en) | 2015-07-21 | 2017-01-26 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| WO2017085586A1 (en) | 2015-11-20 | 2017-05-26 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US9981029B2 (en) | 2012-12-11 | 2018-05-29 | Sk Chemical Co., Ltd. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| WO2018134693A1 (en) | 2017-01-20 | 2018-07-26 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| WO2020039359A2 (en) | 2018-08-24 | 2020-02-27 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2020121159A1 (en) | 2018-12-12 | 2020-06-18 | Pfizer Inc. | Immunogenic multiple hetero-antigen polysaccharide-protein conjugates and uses thereof |
| WO2020208502A1 (en) | 2019-04-10 | 2020-10-15 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| WO2021084429A1 (en) | 2019-11-01 | 2021-05-06 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| US11065329B2 (en) | 2012-10-19 | 2021-07-20 | The Council Of The Queensland Institute Of Medical Research | Human herpesvirus immunotherapy |
| WO2021165928A2 (en) | 2020-02-23 | 2021-08-26 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| US11123417B2 (en) | 2018-02-05 | 2021-09-21 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US11147864B2 (en) | 2018-02-05 | 2021-10-19 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US11160855B2 (en) | 2014-01-21 | 2021-11-02 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US11224652B2 (en) | 2016-08-05 | 2022-01-18 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US11241489B2 (en) | 2016-08-05 | 2022-02-08 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| WO2022090893A2 (en) | 2020-10-27 | 2022-05-05 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2022097010A1 (en) | 2020-11-04 | 2022-05-12 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| WO2022137078A1 (en) | 2020-12-23 | 2022-06-30 | Pfizer Inc. | E. coli fimh mutants and uses thereof |
| WO2022234405A1 (en) | 2021-05-03 | 2022-11-10 | Pfizer Inc. | Vaccination against bacterial and betacoronavirus infections |
| WO2022234416A1 (en) | 2021-05-03 | 2022-11-10 | Pfizer Inc. | Vaccination against pneumoccocal and covid-19 infections |
| WO2022249107A2 (en) | 2021-05-28 | 2022-12-01 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2022249106A2 (en) | 2021-05-28 | 2022-12-01 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2023135515A1 (en) | 2022-01-13 | 2023-07-20 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US11759510B2 (en) | 2017-09-07 | 2023-09-19 | Merck, Sharp & Dohme LLC | Pneumococcal polysaccharides and their use in immunogenic polysaccharide-carrier protein conjugates |
| WO2023218322A1 (en) | 2022-05-11 | 2023-11-16 | Pfizer Inc. | Process for producing of vaccine formulations with preservatives |
| US11951162B2 (en) | 2018-04-18 | 2024-04-09 | Sk Bioscience Co., Ltd. | Streptococcus pneumoniae capsular polysaccharides and immunogenic conjugate thereof |
| WO2024084397A1 (en) | 2022-10-19 | 2024-04-25 | Pfizer Inc. | Vaccination against pneumoccocal and covid-19 infections |
| WO2024110827A1 (en) | 2022-11-21 | 2024-05-30 | Pfizer Inc. | Methods for preparing conjugated capsular saccharide antigens and uses thereof |
| WO2024110839A2 (en) | 2022-11-22 | 2024-05-30 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024116096A1 (en) | 2022-12-01 | 2024-06-06 | Pfizer Inc. | Pneumococcal conjugate vaccine formulations |
| WO2024127215A2 (en) | 2022-12-13 | 2024-06-20 | Pfizer Inc. | Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile |
| WO2024166008A1 (en) | 2023-02-10 | 2024-08-15 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024201324A2 (en) | 2023-03-30 | 2024-10-03 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024214016A1 (en) | 2023-04-14 | 2024-10-17 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024224266A1 (en) | 2023-04-24 | 2024-10-31 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US12138302B2 (en) | 2020-10-27 | 2024-11-12 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2025057078A1 (en) | 2023-09-14 | 2025-03-20 | Pfizer Inc. | Adjuvanted immunogenic compositions comprising conjugated pneumococcal capsular saccharide antigens and uses thereof |
| WO2025133971A1 (en) | 2023-12-23 | 2025-06-26 | Pfizer Inc. | Improved methods for producing bacterial capsular saccharide glycoconjugates |
| WO2025163460A2 (en) | 2024-01-30 | 2025-08-07 | Pfizer Inc. | Vaccines against respiratory diseases |
| WO2025186705A2 (en) | 2024-03-06 | 2025-09-12 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2025191415A1 (en) | 2024-03-11 | 2025-09-18 | Pfizer Inc. | Immunogenic compositions comprising conjugated escherichia coli saccharides and uses thereof |
| WO2025219904A1 (en) | 2024-04-19 | 2025-10-23 | Pfizer Inc. | Improved methods for producing glycoconjugates by reductive amination in aprotic solvent |
| WO2025238502A1 (en) | 2024-05-14 | 2025-11-20 | Pfizer Inc. | Aluminum adjuvant nanoparticles, methods of manufacture, and uses thereof |
| WO2025257712A1 (en) | 2024-06-12 | 2025-12-18 | Pfizer Inc. | Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile |
Families Citing this family (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2268289A4 (en) * | 2008-04-01 | 2014-07-02 | Innate Therapeutics Ltd | ANTI-INFECTIVES AND USES THEREOF |
| WO2012117377A1 (en) * | 2011-03-02 | 2012-09-07 | Novartis Ag | Combination vaccines with lower doses of antigen and/or adjuvant |
| WO2013063277A1 (en) | 2011-10-25 | 2013-05-02 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| JP6375289B2 (ja) | 2012-04-05 | 2018-08-15 | マサチューセッツ インスティテュート オブ テクノロジー | 免疫刺激組成物およびその使用方法 |
| US20140193451A1 (en) * | 2012-10-17 | 2014-07-10 | Glaxosmithkline Biologicals Sa | Immunogenic composition |
| KR20140075201A (ko) * | 2012-12-11 | 2014-06-19 | 에스케이케미칼주식회사 | 다가 폐렴구균 다당류-단백질 접합체 조성물 |
| JP6502262B2 (ja) | 2012-12-20 | 2019-04-17 | ファイザー・インク | 糖複合化方法 |
| US9717649B2 (en) | 2013-04-24 | 2017-08-01 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9707155B2 (en) | 2013-04-24 | 2017-07-18 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9839579B2 (en) | 2013-04-24 | 2017-12-12 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9700485B2 (en) | 2013-04-24 | 2017-07-11 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9707153B2 (en) * | 2013-04-24 | 2017-07-18 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9700486B2 (en) | 2013-04-24 | 2017-07-11 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9717648B2 (en) | 2013-04-24 | 2017-08-01 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9713572B2 (en) | 2013-04-24 | 2017-07-25 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9603775B2 (en) | 2013-04-24 | 2017-03-28 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9849066B2 (en) | 2013-04-24 | 2017-12-26 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US9707154B2 (en) | 2013-04-24 | 2017-07-18 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US20150086592A1 (en) | 2013-09-25 | 2015-03-26 | Sequoia Sciences, Inc | Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections |
| US9149521B2 (en) | 2013-09-25 | 2015-10-06 | Sequoia Sciences, Inc. | Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections |
| US9504743B2 (en) | 2013-09-25 | 2016-11-29 | Sequoia Sciences, Inc | Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections |
| US9149522B2 (en) | 2013-09-25 | 2015-10-06 | Sequoia Sciences, Inc. | Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections |
| US9107906B1 (en) | 2014-10-28 | 2015-08-18 | Adma Biologics, Inc. | Compositions and methods for the treatment of immunodeficiency |
| EP3325015B1 (en) * | 2015-07-20 | 2021-05-12 | Zoetis Services LLC | Liposomal adjuvant compositions |
| JP6630440B2 (ja) * | 2015-12-17 | 2020-01-15 | マックス プランク ゲゼルシャフト ツゥアー フェデルゥン デル ヴィッセンシャフテン エー フォー | ストレプトコッカス ニューモニアエ(Streptococcus pneumoniae)血清型2に対する合成ワクチン |
| US10300145B2 (en) | 2016-07-15 | 2019-05-28 | Massachusetts Institute Of Technology | Synthetic nanoparticles for delivery of immunomodulatory compounds |
| US10259865B2 (en) | 2017-03-15 | 2019-04-16 | Adma Biologics, Inc. | Anti-pneumococcal hyperimmune globulin for the treatment and prevention of pneumococcal infection |
| WO2018227177A1 (en) | 2017-06-10 | 2018-12-13 | Inventprise, Llc | Multivalent conjugate vaccines with bivalent or multivalent conjugate polysaccharides that provide improved immunogenicity and avidity |
| US10729763B2 (en) | 2017-06-10 | 2020-08-04 | Inventprise, Llc | Mixtures of polysaccharide-protein pegylated compounds |
| JP2020524710A (ja) | 2017-06-23 | 2020-08-20 | パソヴァックス エルエルシー | 免疫応答の抗原特異的リダイレクターとしてのキメラウイルス様粒子およびその使用 |
| US10702596B2 (en) * | 2017-07-05 | 2020-07-07 | Inventprise, Llc | Polysaccharide purification for vaccine production using lytic enzymes, tangential flow filtration, and multimode chromatography |
| AU2019414934A1 (en) | 2018-12-27 | 2021-06-24 | Verimmune Llc | Conjugated virus-like particles and uses thereof as anti-tumor immune redirectors |
| CN109771640A (zh) * | 2019-02-28 | 2019-05-21 | 北京智飞绿竹生物制药有限公司 | 多价肺炎球菌结合疫苗 |
| WO2020191305A2 (en) | 2019-03-20 | 2020-09-24 | Massachusetts Institute Of Technology | Uses of amphiphiles in immune cell therapy and compositions therefor |
| WO2022035816A1 (en) | 2020-08-10 | 2022-02-17 | Inventprise, Llc | Multivalent pneumococcal glycoconjugate vaccines containing emerging serotype 24f |
| CA3195963A1 (en) | 2020-10-19 | 2022-04-28 | Joshua Weiyuan WANG | Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer |
| WO2025117535A1 (en) * | 2023-11-29 | 2025-06-05 | Zola Therapeutics Inc. | Synthetic immunostimulatory nucleic acids for immunotherapy of cancer and other diseases |
Citations (59)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0092574A1 (en) | 1981-10-23 | 1983-11-02 | Molecular Biosystems Inc | OLIGONUCLEOTIDE THERAPEUTIC AGENT AND METHODS OF MAKING SAME. |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4673574A (en) | 1981-08-31 | 1987-06-16 | Anderson Porter W | Immunogenic conjugates |
| US4709017A (en) | 1985-06-07 | 1987-11-24 | President And Fellows Of Harvard College | Modified toxic vaccines |
| GB2220221A (en) | 1988-07-02 | 1990-01-04 | Bkl Extrusions Ltd | Glazing bead |
| US4902506A (en) | 1983-07-05 | 1990-02-20 | The University Of Rochester | Immunogenic conjugates |
| WO1990003184A1 (en) | 1988-09-30 | 1990-04-05 | Bror Morein | Matrix with immunomodulating activity |
| EP0372501A2 (de) | 1988-12-07 | 1990-06-13 | BEHRINGWERKE Aktiengesellschaft | Synthetische Antigene, Verfahren zu ihrer Herstellung und ihre Verwendung |
| EP0378881A1 (en) | 1989-01-17 | 1990-07-25 | ENIRICERCHE S.p.A. | Synthetic peptides and their use as universal carriers for the preparation of immunogenic conjugates suitable for the development of synthetic vaccines |
| US4950740A (en) | 1987-03-17 | 1990-08-21 | Cetus Corporation | Recombinant diphtheria vaccines |
| WO1991001146A1 (en) | 1989-07-14 | 1991-02-07 | Praxis Biologics, Inc. | Cytokine and hormone carriers for conjugate vaccines |
| EP0427347A1 (en) | 1989-11-10 | 1991-05-15 | ENIRICERCHE S.p.A. | Synthetic peptides useful as universal carriers for the preparation of immunogenic conjugates and their use in the development of synthetic vaccines |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| EP0471177A2 (en) | 1990-08-13 | 1992-02-19 | American Cyanamid Company | Filamentous hemagglutinin of bordetella pertussis as a carrier molecule for conjugate vaccines |
| WO1993017712A2 (en) | 1992-03-06 | 1993-09-16 | Biocine Spa | Conjugates formed from heat shock proteins and oligo- or polysaccharides |
| WO1994003208A1 (en) | 1992-07-30 | 1994-02-17 | Yeda Research And Development Company Ltd. | Conjugates of poorly immunogenic antigens and synthetic peptide carriers and vaccines comprising them |
| EP0689454A1 (en) | 1993-03-23 | 1996-01-03 | Smithkline Beecham Biolog | VACCINE COMPOSITIONS CONTAINING 3-O DESACETYL MONOPHOSPHORYLIC LIPID |
| WO1996011711A1 (en) | 1994-10-12 | 1996-04-25 | Iscotec Ab | Saponin preparations and use thereof in iscoms |
| EP0735898A1 (en) | 1993-12-23 | 1996-10-09 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | Vaccines |
| EP0761231A1 (en) | 1992-06-25 | 1997-03-12 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | Vaccine composition containing adjuvants |
| US5614382A (en) | 1993-03-05 | 1997-03-25 | American Cyanamid Company | Plasmid for production of CRM protein and diphtheria toxin |
| EP0835318A2 (en) | 1995-06-29 | 1998-04-15 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | Vaccines against hepatitis c |
| WO1998036772A1 (en) | 1997-02-19 | 1998-08-27 | Csl Limited | Chelating immunostimulating complexes |
| EP0594610B1 (en) | 1990-05-31 | 1998-09-02 | Arne Forsgren | PROTEIN D - AN IgD-BINDING PROTEIN OF HAEMOPHILUS INFLUENZAE |
| US5843711A (en) | 1992-05-06 | 1998-12-01 | The Regents Of The University Of California | Diphtheria toxin receptor-binding region |
| WO1998057659A1 (en) | 1997-06-14 | 1998-12-23 | Smithkline Beecham Biologicals S.A. | Adjuvant compositions for vaccines |
| WO1998058668A2 (en) | 1997-06-20 | 1998-12-30 | Microbiological Research Authority | Bordetella pertussis antigens as carriers in vaccinating conjugates and oral vaccines comprising bordetella pertussis fimbriae |
| WO1999011241A1 (en) | 1997-09-05 | 1999-03-11 | Smithkline Beecham Biologicals S.A. | Oil in water emulsions containing saponins |
| US5917017A (en) | 1994-06-08 | 1999-06-29 | President And Fellows Of Harvard College | Diphtheria toxin vaccines bearing a mutated R domain |
| WO1999044636A2 (en) | 1998-03-05 | 1999-09-10 | The Medical College Of Ohio | Il-12 enhancement of immune responses to t-independent antigens |
| WO1999052549A1 (en) | 1998-04-09 | 1999-10-21 | Smithkline Beecham Biologicals S.A. | Adjuvant compositions |
| WO2000037105A2 (en) | 1998-12-21 | 2000-06-29 | Medimmune, Inc. | Streptococcus pneumoniae proteins and immunogenic fragments for vaccines |
| WO2000039299A2 (en) | 1998-12-23 | 2000-07-06 | Shire Biochem Inc. | Streptococcus antigens |
| WO2000041720A1 (en) | 1999-01-08 | 2000-07-20 | Csl Limited | Improved saponin adjuvant compositions and methods relating thereto |
| WO2000048630A1 (en) | 1999-02-17 | 2000-08-24 | Csl Limited | Immunogenic complexes and methods relating thereto |
| WO2000061761A2 (en) | 1999-04-09 | 2000-10-19 | Techlab, Inc. | Recombinant clostridium toxin a protein carrier for polysaccharide conjugate vaccines |
| US6194388B1 (en) | 1994-07-15 | 2001-02-27 | The University Of Iowa Research Foundation | Immunomodulatory oligonucleotides |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO2001021207A2 (en) | 1999-09-24 | 2001-03-29 | Smithkline Beecham Biologicals S.A. | Use of combination of polyoxyethylene sorbitan ester and octoxynol as adjuvant and its use in vaccines |
| WO2001022990A2 (en) | 1999-09-27 | 2001-04-05 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
| US6214806B1 (en) | 1997-02-28 | 2001-04-10 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders |
| US6218371B1 (en) | 1998-04-03 | 2001-04-17 | University Of Iowa Research Foundation | Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines |
| US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO2001072337A1 (en) | 2000-03-27 | 2001-10-04 | Microbiological Research Authority | Proteins for use as carriers in conjugate vaccines |
| WO2001098334A2 (en) | 2000-06-20 | 2001-12-27 | Shire Biochem Inc. | Streptococcus antigens |
| US6339068B1 (en) | 1997-05-20 | 2002-01-15 | University Of Iowa Research Foundation | Vectors and methods for immunization or therapeutic protocols |
| US6455673B1 (en) | 1994-06-08 | 2002-09-24 | President And Fellows Of Harvard College | Multi-mutant diphtheria toxin vaccines |
| WO2002091998A2 (en) | 2001-05-11 | 2002-11-21 | Aventis Pasteur, Inc. | Novel meningitis conjugate vaccine |
| WO2003024480A2 (en) | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles |
| WO2003054007A2 (en) | 2001-12-20 | 2003-07-03 | Shire Biochem Inc. | Streptococcus antigens |
| WO2004081515A2 (en) | 2003-03-13 | 2004-09-23 | Glaxosmithkline Biologicals S.A. | Purification process for bacterial cytolysin |
| WO2004083251A2 (en) | 2003-03-17 | 2004-09-30 | Wyeth Holdings Corporation | Mutant cholera holotoxin as an adjuvant and an antigen carrier protein |
| WO2006134423A2 (en) | 2004-07-18 | 2006-12-21 | Coley Pharmaceutical Group, Ltd. | Methods and compositions for inducing innate immune responses |
| WO2007026190A2 (en) | 2004-07-18 | 2007-03-08 | Csl Limited | Immuno stimulating complex and oligonucleotide formulations for inducing enhanced interferon-gamma responses |
| US20070184072A1 (en) | 2005-04-08 | 2007-08-09 | Wyeth | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| WO2007095316A2 (en) | 2006-02-15 | 2007-08-23 | Coley Pharmaceutical Gmbh | Compositions and methods for oligonucleotide formulations |
| WO2009000826A1 (en) | 2007-06-26 | 2008-12-31 | Glaxosmithkline Biologicals S.A. | Vaccine comprising streptococcus pneumoniae capsular polysaccharide conjugates |
| US9501570B2 (en) | 2014-07-14 | 2016-11-22 | Verizon Patent And Licensing Inc. | Dynamic routing system |
| US9719791B2 (en) | 2014-12-10 | 2017-08-01 | Mapquest, Inc. | Computerized systems and methods for providing travel information and/or content to users |
Family Cites Families (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9727262D0 (en) * | 1997-12-24 | 1998-02-25 | Smithkline Beecham Biolog | Vaccine |
| US7128918B1 (en) | 1998-12-23 | 2006-10-31 | Id Biomedical Corporation | Streptococcus antigens |
| US7074415B2 (en) | 2000-06-20 | 2006-07-11 | Id Biomedical Corporation | Streptococcus antigens |
| ATE411054T1 (de) | 2001-08-17 | 2008-10-15 | Coley Pharm Gmbh | Kombinations-motif-immunstimulierende oligonukleotide mit verbesserter wirkung |
| WO2004098491A2 (en) * | 2002-11-01 | 2004-11-18 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | METHOD OF PREVENTING INFECTIONS FROM BIOTERRORISM AGENTS WITH IMMUNOSTIMULATORY CpG OLIGONUCLEOTIDES |
| GB0410220D0 (en) * | 2004-05-07 | 2004-06-09 | Kirkham Lea Ann | Mutant pneumolysin proteins |
| US7709001B2 (en) | 2005-04-08 | 2010-05-04 | Wyeth Llc | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| CN101155833B (zh) | 2005-04-08 | 2011-04-20 | 惠氏公司 | 通过pH操作将污染物与肺炎链球菌多糖分离 |
| US7955605B2 (en) | 2005-04-08 | 2011-06-07 | Wyeth Llc | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| EP3311836A1 (en) * | 2005-04-08 | 2018-04-25 | Wyeth LLC | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| PE20110072A1 (es) * | 2005-06-27 | 2011-02-04 | Glaxosmithkline Biolog Sa | Composicion inmunogenica |
| JP5135220B2 (ja) * | 2005-09-01 | 2013-02-06 | ノバルティス ヴァクシンズ アンド ダイアグノスティクス ゲーエムベーハー アンド カンパニー カーゲー | 血清群c髄膜炎菌を含む複数ワクチン接種 |
| KR101515078B1 (ko) | 2005-12-22 | 2015-04-24 | 글락소스미스클라인 바이오로지칼즈 에스.에이. | 백신 |
| TW200806315A (en) | 2006-04-26 | 2008-02-01 | Wyeth Corp | Novel formulations which stabilize and inhibit precipitation of immunogenic compositions |
| US8808707B1 (en) * | 2006-05-08 | 2014-08-19 | Wyeth Llc | Pneumococcal dosing regimen |
| DK2074221T3 (da) | 2006-10-10 | 2010-09-06 | Wyeth Llc | Forbedrede fremgangsmåder til separation af streptococcus pneumoniae type 3 polysakkarider |
| RU2009134478A (ru) | 2007-03-14 | 2011-04-20 | Вайет (Us) | Автоматизированные колориметрические системы анализа полисахаридов |
| CN101663327B (zh) | 2007-03-23 | 2014-05-07 | 惠氏公司 | 产生肺炎链球菌(streptococcus pneumoniae)荚膜多糖的缩短的纯化方法 |
| US8241844B2 (en) * | 2008-10-03 | 2012-08-14 | Ralph Clark, legal representative | Methods and compositions for modulating an immune response with immunogenic oligonucleotides |
| ES2749952T3 (es) | 2008-12-18 | 2020-03-24 | Wyeth Llc | Procedimiento de control del peso molecular de polisacáridos de Streptococcus pneumoniae usando carbono |
| BRPI0922981A8 (pt) | 2008-12-18 | 2019-11-26 | Wyeth Llc | método para o controle do peso molecular polissacarídeo para o sorotipo 19a de streptococcus pneumoniae |
-
2010
- 2010-03-17 US US13/266,846 patent/US20120052088A1/en not_active Abandoned
- 2010-03-17 EP EP10712546.0A patent/EP2424562B1/en active Active
- 2010-03-17 BR BRPI1014494A patent/BRPI1014494A2/pt not_active Application Discontinuation
- 2010-03-17 ES ES10712546.0T patent/ES2552153T3/es active Active
- 2010-03-17 KR KR1020117028547A patent/KR101450958B1/ko not_active Expired - Fee Related
- 2010-03-17 WO PCT/IB2010/051150 patent/WO2010125480A1/en not_active Ceased
- 2010-03-17 CN CN2010800190716A patent/CN102413838A/zh active Pending
- 2010-03-17 RU RU2011143398/15A patent/RU2536248C2/ru active
- 2010-03-17 MX MX2011011505A patent/MX340830B/es active IP Right Grant
- 2010-03-17 AU AU2010243285A patent/AU2010243285B2/en not_active Ceased
- 2010-03-17 DK DK10712546.0T patent/DK2424562T3/en active
- 2010-03-17 CA CA2757620A patent/CA2757620C/en active Active
- 2010-03-23 JP JP2010066884A patent/JP5823670B2/ja active Active
-
2011
- 2011-09-26 IL IL215389A patent/IL215389A/en active IP Right Grant
-
2013
- 2013-10-09 US US14/049,842 patent/US9205143B2/en active Active
Patent Citations (60)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4673574A (en) | 1981-08-31 | 1987-06-16 | Anderson Porter W | Immunogenic conjugates |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| EP0092574A1 (en) | 1981-10-23 | 1983-11-02 | Molecular Biosystems Inc | OLIGONUCLEOTIDE THERAPEUTIC AGENT AND METHODS OF MAKING SAME. |
| US4902506A (en) | 1983-07-05 | 1990-02-20 | The University Of Rochester | Immunogenic conjugates |
| US4709017A (en) | 1985-06-07 | 1987-11-24 | President And Fellows Of Harvard College | Modified toxic vaccines |
| US4950740A (en) | 1987-03-17 | 1990-08-21 | Cetus Corporation | Recombinant diphtheria vaccines |
| GB2220221A (en) | 1988-07-02 | 1990-01-04 | Bkl Extrusions Ltd | Glazing bead |
| WO1990003184A1 (en) | 1988-09-30 | 1990-04-05 | Bror Morein | Matrix with immunomodulating activity |
| EP0372501A2 (de) | 1988-12-07 | 1990-06-13 | BEHRINGWERKE Aktiengesellschaft | Synthetische Antigene, Verfahren zu ihrer Herstellung und ihre Verwendung |
| EP0378881A1 (en) | 1989-01-17 | 1990-07-25 | ENIRICERCHE S.p.A. | Synthetic peptides and their use as universal carriers for the preparation of immunogenic conjugates suitable for the development of synthetic vaccines |
| WO1991001146A1 (en) | 1989-07-14 | 1991-02-07 | Praxis Biologics, Inc. | Cytokine and hormone carriers for conjugate vaccines |
| EP0427347A1 (en) | 1989-11-10 | 1991-05-15 | ENIRICERCHE S.p.A. | Synthetic peptides useful as universal carriers for the preparation of immunogenic conjugates and their use in the development of synthetic vaccines |
| EP0594610B1 (en) | 1990-05-31 | 1998-09-02 | Arne Forsgren | PROTEIN D - AN IgD-BINDING PROTEIN OF HAEMOPHILUS INFLUENZAE |
| EP0471177A2 (en) | 1990-08-13 | 1992-02-19 | American Cyanamid Company | Filamentous hemagglutinin of bordetella pertussis as a carrier molecule for conjugate vaccines |
| WO1993017712A2 (en) | 1992-03-06 | 1993-09-16 | Biocine Spa | Conjugates formed from heat shock proteins and oligo- or polysaccharides |
| US5843711A (en) | 1992-05-06 | 1998-12-01 | The Regents Of The University Of California | Diphtheria toxin receptor-binding region |
| EP0761231A1 (en) | 1992-06-25 | 1997-03-12 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | Vaccine composition containing adjuvants |
| WO1994003208A1 (en) | 1992-07-30 | 1994-02-17 | Yeda Research And Development Company Ltd. | Conjugates of poorly immunogenic antigens and synthetic peptide carriers and vaccines comprising them |
| US5614382A (en) | 1993-03-05 | 1997-03-25 | American Cyanamid Company | Plasmid for production of CRM protein and diphtheria toxin |
| EP0689454A1 (en) | 1993-03-23 | 1996-01-03 | Smithkline Beecham Biolog | VACCINE COMPOSITIONS CONTAINING 3-O DESACETYL MONOPHOSPHORYLIC LIPID |
| EP0735898A1 (en) | 1993-12-23 | 1996-10-09 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | Vaccines |
| US6455673B1 (en) | 1994-06-08 | 2002-09-24 | President And Fellows Of Harvard College | Multi-mutant diphtheria toxin vaccines |
| US5917017A (en) | 1994-06-08 | 1999-06-29 | President And Fellows Of Harvard College | Diphtheria toxin vaccines bearing a mutated R domain |
| US6194388B1 (en) | 1994-07-15 | 2001-02-27 | The University Of Iowa Research Foundation | Immunomodulatory oligonucleotides |
| US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO1996011711A1 (en) | 1994-10-12 | 1996-04-25 | Iscotec Ab | Saponin preparations and use thereof in iscoms |
| EP0835318A2 (en) | 1995-06-29 | 1998-04-15 | SMITHKLINE BEECHAM BIOLOGICALS s.a. | Vaccines against hepatitis c |
| WO1998036772A1 (en) | 1997-02-19 | 1998-08-27 | Csl Limited | Chelating immunostimulating complexes |
| US6214806B1 (en) | 1997-02-28 | 2001-04-10 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders |
| US6339068B1 (en) | 1997-05-20 | 2002-01-15 | University Of Iowa Research Foundation | Vectors and methods for immunization or therapeutic protocols |
| WO1998057659A1 (en) | 1997-06-14 | 1998-12-23 | Smithkline Beecham Biologicals S.A. | Adjuvant compositions for vaccines |
| WO1998058668A2 (en) | 1997-06-20 | 1998-12-30 | Microbiological Research Authority | Bordetella pertussis antigens as carriers in vaccinating conjugates and oral vaccines comprising bordetella pertussis fimbriae |
| WO1999011241A1 (en) | 1997-09-05 | 1999-03-11 | Smithkline Beecham Biologicals S.A. | Oil in water emulsions containing saponins |
| WO1999044636A2 (en) | 1998-03-05 | 1999-09-10 | The Medical College Of Ohio | Il-12 enhancement of immune responses to t-independent antigens |
| US6218371B1 (en) | 1998-04-03 | 2001-04-17 | University Of Iowa Research Foundation | Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines |
| WO1999052549A1 (en) | 1998-04-09 | 1999-10-21 | Smithkline Beecham Biologicals S.A. | Adjuvant compositions |
| WO2000037105A2 (en) | 1998-12-21 | 2000-06-29 | Medimmune, Inc. | Streptococcus pneumoniae proteins and immunogenic fragments for vaccines |
| WO2000039299A2 (en) | 1998-12-23 | 2000-07-06 | Shire Biochem Inc. | Streptococcus antigens |
| WO2000041720A1 (en) | 1999-01-08 | 2000-07-20 | Csl Limited | Improved saponin adjuvant compositions and methods relating thereto |
| WO2000048630A1 (en) | 1999-02-17 | 2000-08-24 | Csl Limited | Immunogenic complexes and methods relating thereto |
| WO2000061761A2 (en) | 1999-04-09 | 2000-10-19 | Techlab, Inc. | Recombinant clostridium toxin a protein carrier for polysaccharide conjugate vaccines |
| WO2001021207A2 (en) | 1999-09-24 | 2001-03-29 | Smithkline Beecham Biologicals S.A. | Use of combination of polyoxyethylene sorbitan ester and octoxynol as adjuvant and its use in vaccines |
| WO2001022990A2 (en) | 1999-09-27 | 2001-04-05 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
| WO2001072337A1 (en) | 2000-03-27 | 2001-10-04 | Microbiological Research Authority | Proteins for use as carriers in conjugate vaccines |
| WO2001098334A2 (en) | 2000-06-20 | 2001-12-27 | Shire Biochem Inc. | Streptococcus antigens |
| WO2002091998A2 (en) | 2001-05-11 | 2002-11-21 | Aventis Pasteur, Inc. | Novel meningitis conjugate vaccine |
| WO2003024480A2 (en) | 2001-09-14 | 2003-03-27 | Cytos Biotechnology Ag | In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles |
| WO2003054007A2 (en) | 2001-12-20 | 2003-07-03 | Shire Biochem Inc. | Streptococcus antigens |
| WO2004081515A2 (en) | 2003-03-13 | 2004-09-23 | Glaxosmithkline Biologicals S.A. | Purification process for bacterial cytolysin |
| WO2004083251A2 (en) | 2003-03-17 | 2004-09-30 | Wyeth Holdings Corporation | Mutant cholera holotoxin as an adjuvant and an antigen carrier protein |
| WO2006134423A2 (en) | 2004-07-18 | 2006-12-21 | Coley Pharmaceutical Group, Ltd. | Methods and compositions for inducing innate immune responses |
| WO2007026190A2 (en) | 2004-07-18 | 2007-03-08 | Csl Limited | Immuno stimulating complex and oligonucleotide formulations for inducing enhanced interferon-gamma responses |
| US20070184072A1 (en) | 2005-04-08 | 2007-08-09 | Wyeth | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| WO2007095316A2 (en) | 2006-02-15 | 2007-08-23 | Coley Pharmaceutical Gmbh | Compositions and methods for oligonucleotide formulations |
| WO2008079653A1 (en) | 2006-12-22 | 2008-07-03 | Wyeth | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| WO2009000826A1 (en) | 2007-06-26 | 2008-12-31 | Glaxosmithkline Biologicals S.A. | Vaccine comprising streptococcus pneumoniae capsular polysaccharide conjugates |
| US9501570B2 (en) | 2014-07-14 | 2016-11-22 | Verizon Patent And Licensing Inc. | Dynamic routing system |
| US9719791B2 (en) | 2014-12-10 | 2017-08-01 | Mapquest, Inc. | Computerized systems and methods for providing travel information and/or content to users |
Non-Patent Citations (26)
| Title |
|---|
| "CpG 7909: PF 3512676, PF-3512676.", DRUGS IN R&D 2006 LNKD- PUBMED:16922592, vol. 7, no. 5, 2006, pages 312 - 316, XP009078751, ISSN: 1174-5886 * |
| ANGEL JONATHAN B ET AL: "CpG increases vaccine antigen-specific cell-mediated immunity when administered with hepatitis B vaccine in HIV infection", JOURNAL OF IMMUNE BASED THERAPIES AND VACCINES, BIOMED CENTRAL LTD., LONDON, GB LNKD- DOI:10.1186/1476-8518-6-4, vol. 6, no. 1, 12 August 2008 (2008-08-12), pages 4, XP021043811, ISSN: 1476-8518 * |
| BALLAS ZK ET AL., J IMMUNOL, vol. 157, 1996, pages 1840 - 5 |
| BARALDOI ET AL., INFECT IMMUN, vol. 72, 2004, pages 4884 - 7 |
| CENTERS FOR DISEASE CONTROL AND PREVENTION (CDC). ADVISORY COMMITTEE ON IMMUNIZATION PRACTICES: "Pneumococcal vaccination for cochlear implant candidates and recipients: updated recommendations of the Advisory Committee on Immunization Practices.", 8 August 2003, MMWR. MORBIDITY AND MORTALITY WEEKLY REPORT 8 AUG 2003 LNKD- PUBMED:12908457, VOL. 52, NR. 31, PAGE(S) 739 - 740, ISSN: 1545-861X, XP002597881 * |
| COOPER C L ET AL: "CPG 7909 adjuvant plus hepatitis B virus vaccination in HIV-infected adults achieves long-term seroprotection for up to 5 years.", 15 April 2008, CLINICAL INFECTIOUS DISEASES : AN OFFICIAL PUBLICATION OF THE INFECTIOUS DISEASES SOCIETY OF AMERICA 15 APR 2008 LNKD- PUBMED:18444872, VOL. 46, NR. 8, PAGE(S) 1310 - 1314, ISSN: 1537-6591, XP002597878 * |
| CORDONNIER CATHERINE ET AL: "Randomized study of early versus late immunization with pneumococcal conjugate vaccine after allogeneic stem cell transplantation.", CLINICAL INFECTIOUS DISEASES : AN OFFICIAL PUBLICATION OF THE INFECTIOUS DISEASES SOCIETY OF AMERICA 15 MAY 2009 LNKD- PUBMED:19368505, vol. 48, no. 10, 14 April 2009 (2009-04-14), pages 1392 - 1401, XP002597880, ISSN: 1537-6591 * |
| CROOKE, S.T. ET AL., ANNU. REV. PHARMACOL. TOXICOL., vol. 36, 1996, pages 107 - 129 |
| FALUGI ET AL., EUR J IMMUNOL, vol. 31, 2001, pages 3816 - 3824 |
| FEIKIN DANIEL R ET AL: "Specificity of the antibody response to the pneumococcal polysaccharide and conjugate vaccines in human immunodeficiency virus-infected adults.", CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY JAN 2004 LNKD- PUBMED:14715560, vol. 11, no. 1, January 2004 (2004-01-01), pages 137 - 141, XP002597879, ISSN: 1071-412X * |
| GOODCHILD J, BIOCONJUGATE CHEM, vol. 1, 1990, pages 165 |
| GUPTA KAVERI ET AL: "A review of the role of CpG oligodeoxynucleotides as toll-like receptor 9 agonists in prophylactic and therapeutic vaccine development in infectious diseases", DRUGS IN R & D, ADIS INTERNATIONAL, AUCKLAND, NZ, vol. 9, no. 3, 1 January 2008 (2008-01-01), pages 137 - 145, XP009137826, ISSN: 1174-5886 * |
| HUNZIKER J. ET AL., MOD. SYNTH. METHODS, vol. 7, 1995, pages 331 - 417 |
| JONES; CHRISTOPHER: "Vaccines based on the cell surface carbohydrates of pathogenic bacteria", AN. ACAD. BRAS. CIENC, vol. 77, no. 2, June 2005 (2005-06-01), pages 293 - 324 |
| KRIEG AM ET AL., NATURE, vol. 374, 1995, pages 546 - 9 |
| KRIEG AM ET AL., PROC NATL ACAD SD USA, vol. 95, 1998, pages 12631 - 12636 |
| KROON F P ET AL: "Enhanced antibody response to pneumococcal polysaccharide vaccine after prior immunization with conjugate pneumococcal vaccine in HIV-infected adults", VACCINE, ELSEVIER LTD, GB LNKD- DOI:10.1016/S0264-410X(00)00232-2, vol. 19, no. 7-8, 22 November 2000 (2000-11-22), pages 886 - 894, XP004225408, ISSN: 0264-410X * |
| KUO ET AL., INFECT TMMUN, vol. 63, 1995, pages 2706 - 13 |
| SJÖLANDER ET AL., J. LEUKOCYTE BIOL., vol. 64, 1998, pages 713 |
| SOGAARD OLE S ET AL: "Improving the immunogenicity of pneumococcal conjugate vaccine in HIV-infected adults with a toll-like receptor 9 agonist adjuvant: a randomized, controlled trial", CLINICAL INFECTIOUS DISEASES, THE UNIVERSITY OF CHICAGO PRESS, CHICAGO, IL, US, vol. 51, no. 1, 1 July 2010 (2010-07-01), pages 42 - 50, XP009137803, ISSN: 1058-4838 * |
| UCHIDA ET AL., J. BIOL. CHEM., vol. 218, 1973, pages 3838 - 3844 |
| UCHIDA, T. ET AL., NATURE NEW BIOLOGY, vol. 233, 1971, pages 8 - 11 |
| UHLMANN E ET AL., CHEM REV, vol. 90, 1990, pages 544 |
| UHLMANN E. ET AL.: "Chem. Rev.", vol. 90, 1990, HUMANA PRESS, pages: 543 |
| YAMAMOTO S ET AL., J IMMUNOL, vol. 148, 1992, pages 4072 - 6 |
| YAMAMOTO S ET AL., J. IMMUNOL, vol. 148, 1992, pages 4072 - 6 |
Cited By (100)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8552165B2 (en) * | 2008-12-09 | 2013-10-08 | Heather Davis | Immunostimulatory oligonucleotides |
| US9453059B2 (en) | 2008-12-09 | 2016-09-27 | Coley Pharmaceutical Group, Inc. | Immunostimulatory oligonucleotides |
| US20100143400A1 (en) * | 2008-12-09 | 2010-06-10 | Pfizer Inc. | Immunostimulatory Oligonucleotides |
| US9364531B2 (en) | 2010-12-30 | 2016-06-14 | Intervet Inc. | Immunostimulatory oligodeoxynucleotides |
| WO2012089800A1 (en) * | 2010-12-30 | 2012-07-05 | Intervet International B.V. | Immunostimulatory oligodeoxynucleotides |
| EP2471926A3 (en) * | 2010-12-30 | 2012-07-11 | Intervet International BV | Immunostimulatory oligodeoxynucleotides |
| CN103270159A (zh) * | 2010-12-30 | 2013-08-28 | 英特维特国际股份有限公司 | 免疫刺激性寡脱氧核苷酸 |
| RU2615457C2 (ru) * | 2010-12-30 | 2017-04-04 | Интервет Интернэшнл Б.В. | Иммуностимулирующие олигодезоксинуклеотиды |
| CN103270159B (zh) * | 2010-12-30 | 2016-10-26 | 英特维特国际股份有限公司 | 免疫刺激性寡脱氧核苷酸 |
| WO2012160183A1 (en) * | 2011-05-26 | 2012-11-29 | Intervet International B.V. | Immunostimulatory oligodeoxynucleotides |
| US9359602B2 (en) | 2011-05-26 | 2016-06-07 | Intervet Inc. | Immunostimulatory oligodeoxynucleotides |
| US10058607B2 (en) | 2012-06-20 | 2018-08-28 | Sk Chemicals Co., Ltd. | Polyvalent pneumococcal polysaccharide-protein conjugate composition |
| EP2865392B2 (en) † | 2012-06-20 | 2020-02-12 | SK Bioscience Co., Ltd. | Polyvalent pneumococcal polysaccharide-protein conjugate composition |
| US10034949B2 (en) | 2012-06-20 | 2018-07-31 | Sk Chemicals Co., Ltd. | Polyvalent pneumococcal polysaccharide-protein conjugate composition |
| EP2865392B1 (en) | 2012-06-20 | 2016-11-16 | SK Chemicals Co., Ltd. | Polyvalent pneumococcal polysaccharide-protein conjugate composition |
| US20140105927A1 (en) * | 2012-10-17 | 2014-04-17 | Glaxosmithkline Biologicals S.A. | Immunogenic composition |
| US11896665B2 (en) | 2012-10-19 | 2024-02-13 | The Council Of The Queensland Institute Of Medical Research | Human herpesvirus immunotherapy |
| US11065329B2 (en) | 2012-10-19 | 2021-07-20 | The Council Of The Queensland Institute Of Medical Research | Human herpesvirus immunotherapy |
| US9981029B2 (en) | 2012-12-11 | 2018-05-29 | Sk Chemical Co., Ltd. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| WO2015110942A2 (en) | 2014-01-21 | 2015-07-30 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| EP3616716A2 (en) | 2014-01-21 | 2020-03-04 | Pfizer Inc | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| EP3957321A2 (en) | 2014-01-21 | 2022-02-23 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| EP4286000A2 (en) | 2014-01-21 | 2023-12-06 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| US9492559B2 (en) | 2014-01-21 | 2016-11-15 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2015110940A2 (en) | 2014-01-21 | 2015-07-30 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| US10105431B2 (en) | 2014-01-21 | 2018-10-23 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| US11426456B2 (en) | 2014-01-21 | 2022-08-30 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| WO2015110941A2 (en) | 2014-01-21 | 2015-07-30 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| EP3583947A1 (en) | 2014-01-21 | 2019-12-25 | Pfizer Inc | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| EP3607966A1 (en) | 2014-01-21 | 2020-02-12 | Pfizer Inc | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US10918708B2 (en) | 2014-01-21 | 2021-02-16 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| US11872274B2 (en) | 2014-01-21 | 2024-01-16 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US11160855B2 (en) | 2014-01-21 | 2021-11-02 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| US12343389B2 (en) | 2014-01-21 | 2025-07-01 | Pfizer Inc. | Streptococcus pneumoniae capsular polysaccharides and conjugates thereof |
| US10653764B2 (en) | 2015-01-15 | 2020-05-19 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US20200237890A1 (en) * | 2015-01-15 | 2020-07-30 | Pfizer Inc. | Immunogenic Compositions for Use in Pneumococcal Vaccines |
| US11135279B2 (en) | 2015-01-15 | 2021-10-05 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| WO2016113644A1 (en) | 2015-01-15 | 2016-07-21 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US10124050B2 (en) | 2015-07-21 | 2018-11-13 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| AU2016295566B2 (en) * | 2015-07-21 | 2019-06-20 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| TWI756893B (zh) * | 2015-07-21 | 2022-03-01 | 美商輝瑞股份有限公司 | 包含經共軛之莢膜糖抗原的致免疫性組成物、包含該致免疫性組成物之套組及彼等之用途 |
| US11020469B2 (en) | 2015-07-21 | 2021-06-01 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| KR102800419B1 (ko) * | 2015-07-21 | 2025-04-25 | 화이자 인코포레이티드 | 접합된 캡슐형 사카라이드 항원을 포함하는 면역원성 조성물, 그를 포함하는 키트 및 그의 용도 |
| WO2017013548A1 (en) | 2015-07-21 | 2017-01-26 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| EP4649956A2 (en) | 2015-07-21 | 2025-11-19 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| KR102225282B1 (ko) * | 2015-07-21 | 2021-03-10 | 화이자 인코포레이티드 | 접합된 캡슐형 사카라이드 항원을 포함하는 면역원성 조성물, 그를 포함하는 키트 및 그의 용도 |
| EP4649956A3 (en) * | 2015-07-21 | 2026-03-11 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| KR20180030175A (ko) * | 2015-07-21 | 2018-03-21 | 화이자 인코포레이티드 | 접합된 캡슐형 사카라이드 항원을 포함하는 면역원성 조성물, 그를 포함하는 키트 및 그의 용도 |
| AU2019208271B2 (en) * | 2015-07-21 | 2021-11-18 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| KR20230058726A (ko) * | 2015-07-21 | 2023-05-03 | 화이자 인코포레이티드 | 접합된 캡슐형 사카라이드 항원을 포함하는 면역원성 조성물, 그를 포함하는 키트 및 그의 용도 |
| WO2017085586A1 (en) | 2015-11-20 | 2017-05-26 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US10786561B2 (en) | 2015-11-20 | 2020-09-29 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US20240238400A1 (en) * | 2015-11-20 | 2024-07-18 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US11224652B2 (en) | 2016-08-05 | 2022-01-18 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US11241489B2 (en) | 2016-08-05 | 2022-02-08 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US12318438B2 (en) | 2017-01-20 | 2025-06-03 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US11413344B2 (en) | 2017-01-20 | 2022-08-16 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| WO2018134693A1 (en) | 2017-01-20 | 2018-07-26 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| US11759511B2 (en) | 2017-09-07 | 2023-09-19 | Merck Sharp & Dohme Llc | Pneumococcal polysaccharides and their use in immunogenic polysaccharide-carrier protein conjugates |
| US11759510B2 (en) | 2017-09-07 | 2023-09-19 | Merck, Sharp & Dohme LLC | Pneumococcal polysaccharides and their use in immunogenic polysaccharide-carrier protein conjugates |
| US11911452B2 (en) | 2018-02-05 | 2024-02-27 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US12605435B2 (en) | 2018-02-05 | 2026-04-21 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US11147864B2 (en) | 2018-02-05 | 2021-10-19 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US11123417B2 (en) | 2018-02-05 | 2021-09-21 | Sanofi Pasteur Inc. | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| US12440548B2 (en) | 2018-04-18 | 2025-10-14 | Sk Bioscience Co., Ltd. | Streptococcus pneumoniae capsular polysaccharides and immunogenic conjugate thereof |
| US11951162B2 (en) | 2018-04-18 | 2024-04-09 | Sk Bioscience Co., Ltd. | Streptococcus pneumoniae capsular polysaccharides and immunogenic conjugate thereof |
| US12128095B2 (en) | 2018-08-24 | 2024-10-29 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2020039359A2 (en) | 2018-08-24 | 2020-02-27 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2020121159A1 (en) | 2018-12-12 | 2020-06-18 | Pfizer Inc. | Immunogenic multiple hetero-antigen polysaccharide-protein conjugates and uses thereof |
| WO2020208502A1 (en) | 2019-04-10 | 2020-10-15 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens, kits comprising the same and uses thereof |
| WO2021084429A1 (en) | 2019-11-01 | 2021-05-06 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2021165928A2 (en) | 2020-02-23 | 2021-08-26 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2022090893A2 (en) | 2020-10-27 | 2022-05-05 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| US12138302B2 (en) | 2020-10-27 | 2024-11-12 | Pfizer Inc. | Escherichia coli compositions and methods thereof |
| WO2022097010A1 (en) | 2020-11-04 | 2022-05-12 | Pfizer Inc. | Immunogenic compositions for use in pneumococcal vaccines |
| WO2022137078A1 (en) | 2020-12-23 | 2022-06-30 | Pfizer Inc. | E. coli fimh mutants and uses thereof |
| US12357681B2 (en) | 2020-12-23 | 2025-07-15 | Pfizer Inc. | E. coli FimH mutants and uses thereof |
| WO2022234405A1 (en) | 2021-05-03 | 2022-11-10 | Pfizer Inc. | Vaccination against bacterial and betacoronavirus infections |
| WO2022234416A1 (en) | 2021-05-03 | 2022-11-10 | Pfizer Inc. | Vaccination against pneumoccocal and covid-19 infections |
| WO2022249106A2 (en) | 2021-05-28 | 2022-12-01 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2022249107A2 (en) | 2021-05-28 | 2022-12-01 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2023135515A1 (en) | 2022-01-13 | 2023-07-20 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2023218322A1 (en) | 2022-05-11 | 2023-11-16 | Pfizer Inc. | Process for producing of vaccine formulations with preservatives |
| WO2024084397A1 (en) | 2022-10-19 | 2024-04-25 | Pfizer Inc. | Vaccination against pneumoccocal and covid-19 infections |
| WO2024110827A1 (en) | 2022-11-21 | 2024-05-30 | Pfizer Inc. | Methods for preparing conjugated capsular saccharide antigens and uses thereof |
| WO2024110839A2 (en) | 2022-11-22 | 2024-05-30 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024116096A1 (en) | 2022-12-01 | 2024-06-06 | Pfizer Inc. | Pneumococcal conjugate vaccine formulations |
| WO2024127215A2 (en) | 2022-12-13 | 2024-06-20 | Pfizer Inc. | Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile |
| WO2024166008A1 (en) | 2023-02-10 | 2024-08-15 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024201324A2 (en) | 2023-03-30 | 2024-10-03 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024214016A1 (en) | 2023-04-14 | 2024-10-17 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2024224266A1 (en) | 2023-04-24 | 2024-10-31 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2025057078A1 (en) | 2023-09-14 | 2025-03-20 | Pfizer Inc. | Adjuvanted immunogenic compositions comprising conjugated pneumococcal capsular saccharide antigens and uses thereof |
| WO2025133971A1 (en) | 2023-12-23 | 2025-06-26 | Pfizer Inc. | Improved methods for producing bacterial capsular saccharide glycoconjugates |
| WO2025163460A2 (en) | 2024-01-30 | 2025-08-07 | Pfizer Inc. | Vaccines against respiratory diseases |
| WO2025186705A2 (en) | 2024-03-06 | 2025-09-12 | Pfizer Inc. | Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof |
| WO2025191415A1 (en) | 2024-03-11 | 2025-09-18 | Pfizer Inc. | Immunogenic compositions comprising conjugated escherichia coli saccharides and uses thereof |
| WO2025219904A1 (en) | 2024-04-19 | 2025-10-23 | Pfizer Inc. | Improved methods for producing glycoconjugates by reductive amination in aprotic solvent |
| WO2025238502A1 (en) | 2024-05-14 | 2025-11-20 | Pfizer Inc. | Aluminum adjuvant nanoparticles, methods of manufacture, and uses thereof |
| WO2025257712A1 (en) | 2024-06-12 | 2025-12-18 | Pfizer Inc. | Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile |
Also Published As
| Publication number | Publication date |
|---|---|
| MX340830B (es) | 2016-07-26 |
| KR20120005537A (ko) | 2012-01-16 |
| BRPI1014494A2 (pt) | 2016-08-02 |
| US9205143B2 (en) | 2015-12-08 |
| US20120052088A1 (en) | 2012-03-01 |
| RU2011143398A (ru) | 2013-06-10 |
| DK2424562T3 (en) | 2015-12-07 |
| ES2552153T3 (es) | 2015-11-26 |
| JP2010260849A (ja) | 2010-11-18 |
| EP2424562A1 (en) | 2012-03-07 |
| IL215389A (en) | 2016-06-30 |
| AU2010243285B2 (en) | 2013-06-06 |
| JP5823670B2 (ja) | 2015-11-25 |
| MX2011011505A (es) | 2011-11-18 |
| KR101450958B1 (ko) | 2014-10-15 |
| CA2757620C (en) | 2016-04-26 |
| IL215389A0 (en) | 2011-12-29 |
| AU2010243285A1 (en) | 2011-10-27 |
| EP2424562B1 (en) | 2015-10-07 |
| RU2536248C2 (ru) | 2014-12-20 |
| US20140099337A1 (en) | 2014-04-10 |
| CN102413838A (zh) | 2012-04-11 |
| CA2757620A1 (en) | 2010-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2757620C (en) | Pneumococcal vaccine and uses thereof | |
| JP7033175B2 (ja) | 肺炎球菌ワクチンにおいて用いるための免疫原性組成物 | |
| JP6884145B2 (ja) | 肺炎連鎖球菌ワクチンにおいて用いるための免疫原性組成物 | |
| KR101538535B1 (ko) | 15가 폐렴구균성 폴리사카라이드-단백질 접합체 백신 조성물 | |
| KR102459629B1 (ko) | 폐렴구균 백신에 사용하기 위한 면역원성 조성물 | |
| TWI857300B (zh) | 包含結合之莢膜醣抗原的免疫原組合物及其用途 | |
| JP2022512345A (ja) | 免疫原性多重ヘテロ抗原多糖-タンパク質コンジュゲートおよびその使用 | |
| TW202306969A (zh) | 包含結合之莢膜醣抗原的免疫原組合物及其用途 | |
| WO2025133971A1 (en) | Improved methods for producing bacterial capsular saccharide glycoconjugates | |
| HK1169024A (en) | Pneumococcal vaccine and uses thereof | |
| JP7804631B2 (ja) | コンジュゲートさせた莢膜糖抗原を含む免疫原性組成物およびその使用 | |
| KR20240087549A (ko) | 접합된 피막 사카라이드 항원을 포함하는 면역원성 조성물 및 그의 용도 | |
| KR20240086722A (ko) | 접합된 피막 사카라이드 항원을 포함하는 면역원성 조성물 및 그의 용도 | |
| CN117729933A (zh) | 包含缀合的荚膜糖抗原的免疫原性组合物及其用途 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080019071.6 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10712546 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010712546 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2757620 Country of ref document: CA Ref document number: 7543/DELNP/2011 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2010243285 Country of ref document: AU Date of ref document: 20100317 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13266846 Country of ref document: US Ref document number: MX/A/2011/011505 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20117028547 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2011143398 Country of ref document: RU Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI1014494 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: PI1014494 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: PI1014494 Country of ref document: BR Kind code of ref document: A2 Effective date: 20111020 |