Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/66—Phosphorus compounds
  • A61K31/664—Amides of phosphorus acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
  • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
  • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
  • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
  • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/10—Antimycotics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
  • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
  • A61P31/18—Antivirals for RNA viruses for HIV
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/20—Antivirals for DNA viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/20—Antivirals for DNA viruses
  • A61P31/22—Antivirals for DNA viruses for herpes viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P33/00—Antiparasitic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P33/00—Antiparasitic agents
  • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
  • A61P33/06—Antimalarials
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/04—Immunostimulants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/521—Chemokines
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/70503—Immunoglobulin superfamily
  • C07K14/70532—B7 molecules, e.g. CD80, CD86
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
  • C07K14/7158—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for chemokines
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/62—DNA sequences coding for fusion proteins
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
  • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
  • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

• compositions and methods for modulating T cell activation in. particular to compositions and methods for enhancing T cell activation in tumor microenvironments and in tissues involved in immune cell activation.
• MHC (signal 1)
• B7-CD28 B7-1 (CD80) and B7-2 (CD86) each can engage the stimulatory CD28 receptor and the inhibitory CTLA-4 (CD 152) receptor.
• CD28 ligation increases antigen-specific proliferation of T cells, enhances production of cytokines, stimulates differentiation and effector function, and promotes survival of T cells (Lenshow, et al, Annu. Rev. Immunol, 14:233- 258 (1996); Chambers and Allison, Curr. Opin. Immunol, 9:396-404 (1997); and Rathmell and Thompson, Annu. Rev. Immunol, 17:781-828 (1999)).
• signaling through CTLA-4 is thought to deliver a negative signal that inhibits T cell proliferation, IL-2 production, and cell cycle progression (Krammel and Allison, J Exp.
• B7-H1 Long, et at, Nature Med, 5:1365-1369 (1999); and Freeman, et al., J Exp. Med, 192:1-9 (2000)
• B7-DC also Tseng, et al., J Exp.
• B7- Hl also known as PD-Ll
• B7-DC also known as PD-L2
• B7-H2 is a ligand for ICOS
• B7-H3 and B7-H4 remain orphan ligands at this time(Dong. et al., Immunol. Res., 28:39-48 (2003)).
• Certain molecules such as those of the B7 family can enhance effector immune responses to tumor/tumor antigens. Exogenous delivery of costimulatory molecules that enhance T cell response in vivo is therefore thought to be a practical way to augment the immune response to tumors. However, reaching an effective level of costimulatory molecules in vivo may require a large amount of recombinant protein. Systemic delivery of costimulatory molecules in vivo can also result in non-specific immune activation that can be harmful to the host.
• T cell costimulatory compositions that enhance T cell responses and are targeted to tumors or tumor- associated neovasculature and methods for their use. It is another object of the invention to provide costimulatory compositions that enhance T cell responses and can concentrate inside tumors in vivo and augment the function of tumor-infiltrating T cells.
• compositions are provided that are targeted to tumors or tumor- associated neovasculature and enhance the function of tumor-infiltrating T cells.
• the compositions include fusion proteins that contain a T cell binding domain, a tumor/tumor-associated neovasculature targeting domain and optionally a linker domain.
• the linker is preferably a peptide/polypeptide.
• the T cell binding domain is a costimulatory molecule or a variant and/or fragment thereof that binds to and activates a receptor on T cells, resulting in enhanced T cell responses.
• Representatives of such receptor agonists include members of the B7 family, including, but not limited to, B7-1, B7-2, and B7-H5.
• UseM fragments of said costimulatory molecules include soluble fragments, including the extracellular domain, or fragments thereof, including the IgV and/or IgC domains.
• Agonistic single polypeptide antibodies or fragments thereof that bind to and activate costimulatory receptors and lead to enhanced T cell responses are also useful T cell activating domains.
• the tumor/tumor-associated neovasculature targeting domain is a domain that binds to an antigen, receptor or ligand that is specific for tumors or tumor-associated neovasculature, or is overexpressed in tumors or tumor- associated neovasculature as compared to normal tissue.
• Suitable antigens that can be targeted include, but are not limited to, tumor-specific and tumor- associated antigens and antigens overexpressed on tumor-associated neovasculature including, but not limited to, V ⁇ GF/KDR, Tie2, vascular cell adhesion molecule (VCAM), endoglin and Ot 5 ⁇ 3 integrin/vitronectin.
• Suitable tumor/tumor-associated neovasculature targeting domains include, but are not limited to, ligands, receptors, single polypeptide antibodies and immunoglobulin Fc domains.
• the peptide/polypeptide linker domain can be any flexible peptide or polypeptide at least 2 amino acids in length that separates the T cell binding domain and the tumor/tumor-associated neovasculalure targeting domain and provides increased rotational freedom between these two domains.
• Suitable polypeptides include the hinge region of immunoglobulins alone, or in combination with either immunoglobulin Fc regions or the C H I or C L regions.
• the fusion proteins can also contain dimerization or multimerization domains that can either be separate domains or can be contained within the T cell binding domain, the tumor/tumor-associated neovasculature targeting domain or the peptide/polypeptide linker domain.
• Preferred dimerization domains contain at least one cysteine that is capable of forming an intermolecular disulfide bond. Other suitable dimerization/multimerization domains are provided.
• the fusion proteins can be dimerized or multimerized to form homodimers, heterodimers, homomultimers or heteromultimers. Dimerization or multimerizalion can occur either through dimerization/multimerization domains, or can be the result of chemical crosslinking. Dimerization/multimerization partners can be arranged either in parallel or antiparallel orientations.
• Isolated nucleic acids molecules encoding the disclosed fusion proteins, vectors and host cells, and pharmaceutical and immunogenic compositions containing the fusion proteins are also provided. Immunogenic compositions contain antigens, a source of fusion proteins and, optionally, additional adjuvants.
• compositions include the induction of tumor immunity.
• the tumor or tumor-associated neovasculature binding domains function to effectively target the fusion proteins to the tumor microenvironment, where they can specifically enhance the activity of tumor-infiltrating T cells through their T cell binding domains.
• the ability of the compositions to concentrate in tumors reduces the amount of costimulatory molecule that is necessary to administer in vivo to achieve an effective amount, and thereby reduces the risk of non-specific activation of the immune system.
• Fusion proteins can be administered as monomers, dimers or multiniers. In one embodiment, fusion proteins are administered as dimers or multimers that have increased valency for T cell and/or tumor/tumor-associated neovasculature binding determinants.
• Figure 1 is a diagram of an exemplary dosing regimen for the P815 tumor model.
• Figures 2A-C is a line graphs of tumor volumes plotted as a function of time and treatment: A) vehicle control, B) mouse IgG control, and C) murine B7-DC-Ig.
• Figures 3 A and B are line graphs of tumor growth (mm 3 ) versus days post tumor inoculation in mice given 100 mg/kg cyclophosphamide (CTX or Cytoxan®) alonce ( Figure 3A) and mice given the combination of CTX and dimeric murine B7-DC-Ig ( Figure 3B).
• CTX or Cytoxan® Cytoxan®
• FIG. 3C is a line graph of average average tumor volume versus days post tumor implanation in mice given 100 mg/kg CTX (-•-) or the combination of CTX and dimeric murine B7-DC-Ig (- ⁇ -).
• Figure 4 shows the results of experiments wherein the combination of
• CTX and dimeric murine B7-DC-Ig eradicated established CT26 tumors (colon carcinoma) in mice and protected against re-challenge with CT26.
• Mice that were treated with CTX and B7-DC-Ig and found to be free of tumor growth on day 44 following tumor inoculation were rechallenged with tumors. The mice were later rechallenged again on on Day 70. None of the mice displayed tumor growth by day 100.
• FIG. 5 shows CTX and B7-DC-Ig treatment resulted in generation of tumor specific memory CTL.
• Mice eradicated established CT26 subcutenous tumors post CTX and B7-DC-Ig treatment were re-challenged with CT26 cells. Seven days later, splenocytes were isolated and pulsed with either ovalbumin, an irrelevant peptide, or AHl, a CT26 specific peptide. Cells were stained with anti-CD8 antibody first followed by intracellular staining with anti-IFN ⁇ antibody prior to FACS analysis.
• FIGS 6 A and B show the results of experiments wherein Balb/C mice at age of 9 to 11 weeks of age were implanted with I X lO 5 CT26 cells subcutaneously.
• mice were injected with 100 mg/kg of CTX, IP.
• mice were treated with 100 ug of B7- DC-Ig.
• Two na ⁇ ve mice and 4 mice from other groups were removed from the study on Day 11 (2 days post CTX) and Day 16 (7 days post CTX) for T cell analysis.
• Figure 6A shows on Day 11, 2 days post CTX injection, Treg in the spleen of the mice with CTX treatment was significantly lower than the one in the mice with tumor implantation and injected with vehicle.
• Figure 6B shows that on Day 16, 7 days post CTX and 6 days post B7-DC-Ig treatment, B7- DC-Ig significantly lowered the CD4+ T cells expressing high PD-I . This was observed in both the B7-DC-Ig treated and CTX + B7-DC-Ig treated mice. Mice implanted with tumor cells intended to have more PD-1+/CD4+ T cells in the draining LN compared with na ⁇ ve mice.
• Figure 7 is a line graph of survival (%) versus days post tumor implantation in mice administered with the combination of CTX and B7-DC- Ig (-A-), CTX alone (dashed line), or B7-DC- ⁇ g alone (solid line).
• SP-I cells were isolated from mouse lungs that were metastasized from TRAMP prostate tumor cell injection.
• B10.D2 mice were first injected with 3xlO 5 SP- 1 cells via tail vein injection. On Day 5, 12 and 19, mice were injected with 50 mg/kg of CTX where was indicated. On Day 6, 13 and 20, mice were administered with 5 mg/kg of B7-DC-Ig were it was indicated.
• NT refers to "not treated”.
• Figure 8 is line graph of overall survival (%) versus days post tumor implantation in Balb/C mice at age of 11-13 weeks given isolated hepatic metastases using a hemispleen injection technique.
• the spleens of anesthetized mice were divided into two halves and the halves were clipped.
• CT26 cells (1E05) were injected into one hemispleen, and after 30 seconds, that hemispleen was resected and the splenic draining vein was clipped.
• mice received 1 injection of CTX at 50 mg/kg, IP.
• mice Twenty four hours later, on Day 11, mice were treated with recombinant Listeria carrying AHl peptide, an immunodominant epitope of CT26, at 0.1 x LD50 (1 xlO7 CFU), then on Day 14 and 17. Mice were also treated with B7-DC-Ig on Day 11 and then on Day 18. Mouse overall survival was monitored.
• isolated is meant to describe a compound of interest (e.g., either a polynucleotide or a polypeptide) that is in an environment different from that in which the compound naturally occurs e.g. separated from its natural milieu such as by concentrating a peptide to a concentration at which it is not found in nature. "Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
• polypeptide refers to a chain of amino acids of any length, regardless of modification (e.g., phosphorylation or glycosylation).
• costimulatory polypeptide or “costimulatory molecule” is a polypeptide that, upon interaction with a cell-surface molecule on T cells, modulates the activity of the T cell. Costimulatory signaling can inhibit T cell function or enhance T cell function depending on which T cell receptor is activated or blocked.
• amino acid sequence alteration can be, for example, a substitution, a deletion, or an insertion of one or more amino acids.
• a "vector” is a repHcon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment.
• the vectors described herein can be expression vectors.
• an "expression vector” is a vector that includes one or more expression control sequences
• an "expression control sequence” is a DNA sequence that controls and regulates the transcription and/or translation of another DNA sequence.
• Operaably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual or intended function. Thus, two different polypeptides operably linked together retain their respective biological functions while physically linked together.
• valency refers to the number of binding sites available per molecule.
• the term "host cell” refers to prokaryotic and eukaryotic cells into which a recombinant expression vector can be introduced.
• transformed and transfected encompass the introduction of a nucleic acid (e.g. a vector) into a cell by a number of techniques known in the art.
• antibody is meant to include both intact molecules as well as fragments thereof that include the antigen-binding site. These include Fab and F(ab') 2 fragments which lack the Fc fragment of an intact antibody.
• the terms "individual”, “host”, “subject”, and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, humans, rodents such as mice and rats, and other laboratory animals. II. Fusion proteins
• compositions disclosed herein are fusion proteins that contain a costimulatory polypeptide domain and a domain that is an antigen-binding domain that targets the fusion protein to tumor cells, tumor cell-associated neovasculature, or to tissues involved in T cell activation.
• the costimulatory polypeptide can either bind to a T cell receptor and enhance a T cell response
• the fusion proteins also optionally contain a peptide or polypeptide linker domain that separates the costimulatory polypeptide domain from the antigen-binding domain.
• Fusion proteins disclosed herein are of formula I:
• N represents the N-terminus of the fusion protein
• C represents the C-terminus of the fusion protein
• Rf is a costimulatory polypeptide domain or a antigen-binding targeting domain
• R 2 is a peptide/polypeptide linker domain
• R 3 is a costimulatory polypeptide domain or a antigen- binding targeting domain
• R 3 is a costimulatory polypeptide domain when "Ri” is a antigen-binding targeting domain
• R 3 " is a antigen-binding targeting domain when "Rj” is a costimulatory polypeptide domain.
• the fusion proteins additionally contain a domain that functions to dimerize or multimerize two or more fusion proteins.
• the domain that functions to dimerize or multimerize the fusion proteins can either be a separate domain, or alternatively can be contained within one of one of the other domains (costimulatory polypeptide domain, antigen- binding targeting domain, or peptide/polypeptide linker domain) of the fusion protein.
• the fusion proteins can be dimerized or multimerized. Dimerization or multimerization can occur between or among two or more fusion proteins through dimerization or multimerization domains. Alternatively, dimerization or multimerization of fusion proteins can occur by chemical crosslinking. The dimers or multimers that are formed can be homodimeric/homomultimeric or heterodimeric/heteromultimeric.
• the modular nature of the fusion proteins and their ability to dimerize or multimerize in different combinations provides a wealth of options for targeting molecules that function to costimulate T cells to the tumor cell microenvironment or to immune regulatory tissues.
• the fusion proteins disclosed herein include costimulatory polypeptides of the B7 family, or biologically active fragments and/or variants thereof.
• Representative co-stimulatory polypeptides include, but are not limited to B7-1, B7-2, and B7-H5. These costimulatory polypeptides can activate T cell function.
• the extracellular domain or a biologically active fragment thereof is used as a T cell costimulatory polypeptide.
• B7-DC binds to PD-I, a distant member of the CD28 receptor family that is inducibly expressed on activated T cells, B cells, natural killer (NK) cells, monocytes, DC 5 and macrophages (Keir, et al Curr. Opin. Immunol. 19:309-314 (2007)).
• PD-I-/- mice provide direct evidence for PD-I being a negative regulator of immune responses in vivo.
• mice on the C57BL/6 background slowly develop a lupus-like glomerulonephritis and progressive arthritis (Nishimura, et al., Immunity, 11 :141—151 (1999)).
• B7-DC acts as a costimulatory polypeptide that can activate T cell function.
• the B7 costirnulalory polypeptide may be of any species of origin.
• the costimulatory polypeptide is from a mammalian species.
• the costimulatory polypeptide is of murine or human or non-human primate origin.
• Useful human B7 costimulatory polypeptides have at least about 80, 85, 90, 95 or 100% sequence identity to the B7-DC polypeptide encoded by the nucleic acid having GenBank Accession Number NM_025239; the B7-1 polypeptide encoded by the nucleic acid having GenBank Accession Number
• B7-H5 is also disclosed in PCT Publication No. WO 2006/012232. 1. Fragments of B7 costimulatory polypeptides
• the B7 polypeptides disclosed herein can be full-length polypeptides, or can be a fragment of a full length B7 polypeptide.
• a fragment of B7 polypeptides refers to any subset of the polypeptide that is a shorter polypeptide of the full length protein.
• the fragments retain the ability to co-stimulate T cells.
• Fragments of B7 costimulatory molecules may be useful to reduce the size of the fusion protein in order to facilitate the simultaneous association of the costimulatory molecule with a costimulatory receptor on T cells in concert with CD3/T cell receptor engagement during formation of immune synapses.
• Useful fragments are those that retain the ability to bind to their natural ligands.
• a costimulatory polypeptide that is a fragment of full-length costimulatory polypeptide typically has at least 20 percent, 30 percent, 40 percent, 50 percent, 60 percent, 70 percent, 80 percent, 90 percent, 95 percent, 98 percent, 99 percent, 100 percent, or even more than 100 percent of the ability to bind its natural Hgand(s) as compared to the full-length costiniulatory polypeptide.
• a B7 polypeptide that is a fragment of a full- length B 7 polypeptide typically has at least 20 percent, 30 percent, 40 percent, 50 percent, 60 percent, 70 percent, 80 percent, 90 percent, 95 percent, 98 percent, 99 percent, 100 percent, or even more than 100 percent of the costiniulatory activity of the full-length B7 polypeptide.
• B7 costimulatory polypeptides include soluble fragments. Soluble B7 costimulatory polypeptide fragments are fragments of B7 costimulatory polypeptides that may be shed, secreted or otherwise extracted from the producing cells.
• Soluble fragments of B7 costimulatory polypeptides include some or all of the extracellular domain of the B7 costimulatory polypeptide, and lack some or all of the intracellular and/or transmembrane domains.
• B7 costimulatory polypeptide fragments include the entire extracellular domain of the B7 costimulatory B7 costimulatory polypeptide.
• the soluble fragments of B7 costimulatory polypeptides include fragments of the extracellular domain that retain B7 costimulatory biological activity.
• the extracellular domain can include 1, 2, 3, 4, or 5 amino acids from the transmembrane domain.
• the extracellular domain can have 1, 2, 3, 4, or 5 amino acids removed from the C-terminus, N-terminus, or both.
• the B7 costimulatory polypeptides or fragments thereof are expressed from nucleic acids that include sequences that encode a signal sequence.
• the signal sequence is generally cleaved from the immature polypeptide to produce the mature polypeptide lacking the signal sequence.
• the signal sequence of B 7 costimulatory polypeptides can be replaced by the signal sequence of another polypeptide using standard molecule biology techniques to affect the expression levels, secretion, solubility, or other property of the polypeptide.
• the signal sequence that is used to replace the B7 costimulatory polypeptide signal sequence can be any known in the art.
• Murine B7-DC polypeptides can have at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to:
• Human B7-DC polypeptides can have at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to:
• RPVTTTKREV NSAI 254 (SEQ ID NO:4).
• Non-human primate (Cynomolgus) B7-DC polypeptides can have at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to:
• SEQ ID NOs: 1, 3 and 5 each contain a signal peptide.
• Murine B7-1 polypeptides can have at least 80%, 85%, 90% s 95%, 99% or 100% sequence identity to:
• Human B7-1 polypeptides can have at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to:
• SEQ ID NO: 10 each contain a signal peptide.
• Murine B7-2 polypeptides can have at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: MDPRCTMGLA ILI FVTVLLI SDAVSVETQA YFNGTAYLPC PFTKAQNISL SELWFWQDQ 60
• Human B7-2 polypeptides can have at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to:
• MGLSNILFVM AFLLSGAAPL KIQAYFNETA DLPCQFANSQ NQSLSELVVF WQDQENLVLN 60 EVYLGKEKFD SVHSKYMGRT SFDSDSWTLR LHNLQIKDKG LYQCIIHHKK PTGMIRIHQM 120
• SEQ ID NOs: 11 and 13 each contain a signal peptide.
• B7-H5 Murine B7-H5 polypeptides can have at least 80%, 85%, 90%, 95%,
• GRYLLSDPST PLSPPGPGDV FFPSLDPVPD SPNSEAI 277 (SEQ ID NO: 16).
• Human B7-H5 can have at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to:
• MGVPTALEAG SWRWG ⁇ LLFA LPLAASLGPV AAFKVATPYS LYVCPEGQHV TLTCRLLGPV 60 DKGHDVTFYK TWYRSSRGEV QTCSERRPIR NLTFQDLHLH HGGHQAAHTS HDLAQRHGLB 120
• PVPDSPNFBV I 311 SEQ IDNO:17
• SEQ ID NOs: 15 and 17 each contain a signal peptide.
• the disclosed fusion proteins include the extracellular domain of the murine B7-DC, B7-1, B7-2 or B7-H5, proteins shown in SEQ ID NOs: 1, 2, 7, 8, 11, 12, 15 or 16, as shown below.
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atgctgctcc tgctgccgat actgaacctg agcttacaac ttcatcctgt agcagcttta 60 ttcaccgtga cagcccctaa agaagtgtac accgtagacg tcggcagcag tgtgagcotg 120 gagtgcgatt ttgaccgcag agaatgcact gaactggaag ggataagagc cagtttgcag 180 aaggtagaaa atgatacgtc tctgcaaagt gaaagagcca ccctgctgga ggagcagctg 240 c
• SEQ ID NO:21 provides the murine amino acid sequence of SEQ ID NO:20 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of murine B7-DC.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: ttcaccgtga cagccctaa agaagtgtac accgtagacg tcggcagcag tgtgagcctg 60 gagtgcgatt ttgaccgcag agaatgcact gaactggaag ggataagagc cagtttgcag 120 aaggtagaaa atgatacgtc tctgcaaagt gaaagagcca ccctgctgga ggagcagctg 180 ccctgggaa aggctttgtt ccacatccct agtg
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atggcttgca attgtcagtt gatgcaggat acaccactcc tcaagtttcc atgtccaagg 60 ctcattcttc tctttgtgct gct ctttcacaag tgtcttcaga tgttgatga 120 caactgtcca agtcagtgaa agataggta ttgctgcttt gccttt gccgttacaa ctctctcat ISO gaagatgagt ctgaagaccg aatctactgg caaaaacatg acaaagtggt gctgtctcat
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• SEQ ID NO:26 provides the murine amino acid sequence of SEQ ID NO:25 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of murine B7-1.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: gttgatgaac aactgtccaa gtcagtgaaa gataaggtat tgctgcottg ccgttacaac 60 tctcotcatg aagatgagtc tgaagaccga atctactggc aaaaacatga caaagtggtg 120 ctgtctgtca ttgctgggaa actaaaagtg tggcccgagt ataagaaccg gactttatat X80 gacaacacta cctactctct tatcatcctg ggcttg
• the costiniulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atggacccca gatgcaccat gggcttggca atccttatct ttgtgacagt cttgctgatc 60 tcagatgctg tttccgtgga gacgcaagct tatttcaatg ggactgoata tctgcgtgc 120 ccatttacaa aggctcaaa cataagcctg agtgagctgg tagtattttg gcaggaccag 180 caaaagttgg tctgtacgacgacgacgacactatttg ggcacagaga aacttgatag tgtgaatgcc 240
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• I ILQQTLTEL SVIANFSEPE IKLAQNVTGH SGINLTCTSK QGHPKPKKMY FLITNSTNEY 180 GDNMQISQDK VTELFSISNS LSLSFPDGVW HMTWCVLET ESMKISSKPL NFTQEFPSPQ 240
• SEQ ID NO: 31 provides the murine amino acid sequence of SEQ ID NO:30 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of murine B7-2.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: aatgggactg catatctgcc gtgcccattt acaaaggctc aaaacataag cctgagtgag 60 ctggtagtat tttggcagga ccagcaaaag ttggttctgt acgagcacta tttgggcaca 120 gagaaacttg atagtgtgaa tgccaagtac ctgggccgca cgagcttttga caggaacaac 180 tggactctac gacttcacaa tgttcagatc
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• NGTAYLPCPF TKAQNISLSE LVVFWQDQQK LVLYEHYLGT EKtDSVNAKY LGRTSFDRNW 60 WTLRLHNVQI KDMGSYDCFI QKKPPTGSII LQQTLT 96
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atgggtgtcc ccgcggtccc agaggccagc agcccgct ggggaaccct gctccttgct 60 attttcctgg ctgcatc ⁇ ag aggtctggta gcagccttca aggtcaccac tccatattct 120 ctctatgtgt gtcccgaggg acagaatgcc accctcacct gcaggattct gggcccgtg 180 tccaaagggc acgatgtgac catctscaag acgtggtacc tcagctcacg aggcgg
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: MGVPAVPEAS SPRWGTLLLA IFLAASRGLV AAFKVTTPYS LYVCPEGQNA TLTCRILGPV 60
• SEQ ID NO:35 The signal sequence will be removed in the mature protein. Additionally, it will be appreciated that signal peptides from other organisms can be used to enhance the secretion of the fusion protein from a host during manufacture.
• SEQ ID NO:36 provides the murine amino acid sequence of SEQ ID NO:35 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of murine B7-H5.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: ttcaaggtca ccactccata ttctctctat gtgtgtcccg agggacagaa tgccaccctc 60 acctgcagga ttctgggccc cgtgtccaaa gggcacgatg tgaccatcta caagacgtgg 120 tacctcagct cacgaggcga ggtccagatg tgcaaagaac accggcccat acgcaacttc 180 acattgcagc accttcagca ccacggaagc
• the T cell receptor binding domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• the disclosed fusion proteins include the extracellular domain of the human B7-DC, B7-1, B7-2 or B7-H5, proteins shown in SEQ ID NOs:3, 4, 9, 10, 13, 14, 15 or 16, as shown below.
• B7-DC human B7-DC
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atgatctttc ttctcttgat gctgtctttg gaattgcaac ttcaccaaat cgcggccctc 60 tttactgtga ccgtgccaaa agaactgtat atcattgagc acgggtccaa tgtgaccctc 120 gaatgtaact ttgacaccgg cagccacgtt aacctggggg ccatcactgc cagcttgcaa 180 aaagttgaaaacgacacttc acctcaccgg gagagggcaa ccctcttgga ggagcaactg 240 ccattgggga a
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: MIFLLLMLSL ELQLHQIAAL FTVTVPKELY I IEHGSHVTL ECNFDTGSHV NLGAITASLQ 60
• SEQ ID NO:40 provides the human amino acid sequence of SEQ ID NO:40 without the signal sequence: LFTVTVPKEL YIIEHGSNVT LECHFDTGSH VNLGAITASL QKV ⁇ NDTSPH RERATLLEEQ 60 LPLGKASFHI PQVQVRDEGQ YQCIIIYGVA WDYKYLTLKV KASYRKINTH ILKVPETDEV 120 ELTCQATGYP LAEVSWPNVS VPANTSHSRT PEGLYQVTSV LRLKPPPGRN FSCVFWNTHV 180
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of human B7-DC.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: tttactgtga ccgtgccaaa agaactgtat atcattgagc acgggtccaa tgtgaccctc 60 gaatgtaact ttgacaccgg cagccacgtt aacctggggg ccatcactgc cagcttgcaa 120 aaagttgaaaacgacacttc acctcaccgg gagagggcaa ccctcttgga ggagcaactg 180 ccattgggga aggcctcttt caggt
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atgggccaca cacggaggca gggaacatca ccatccaagt gtccatacct caatttcttt 60 cagctcttgg tgctggctgg tctttctcac ttctgttcag gtgttatoca cgtgacoaag 120 gaagtgaaag aagtggcaac gctgtcctgt ggtcacaatg tttctgtga agagctggca 180 caaactcgca tctactggca aaaggagaag aaatggtgc tggggac 240 atgaatata
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• SEQ ID NO:46 provides the murine amino acid sequence of SEQ ID NO:45 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of human B7-1.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: gttatccacg tgaccaagga agtgaaagaa gtggcaacgc tgtcctgtgg tcacaatgtt 60 tctgttgaag agctggcaca aactcgcatc tactggcaaa aggagaagaa aatggtgctg 120 actatgatgt ctggggacat gaatatatgg cccgagtaca agaaccggac catctttgat 180 atcactaata acctctccat tgtgatcctg gcgcc catcttgactgacc
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: VIHVTKEVKE VATLSCGHNV SVEELAQTRI YWQKEKKMVL TMMSGDMNIW PEYKHRTIFD 60 ITNNLSIVIL ALRPSDEGTY ECVVLKYEKD AFKREHLAEV T 101
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atgggactga gtaacattct ctttgtgatg gcctt ⁇ ctgc tctctggtgc tgctcctctg 60 aagattcaag cttatttcaa tgagactgca gacctgccat gccaatttgc aaactctcaa 120 aaccaaagcc tgagtgagct agtagtattt tggcaggacc aggaaaactt ggttctgaat 180 gaggtatact taggcaaaga gaaatttgac agtgttcatt ccaagtatat gggccgcaca 240 ag
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• MGLSKILFVM AFLLSGAAPL KIQAYFNETA DLPCQFANSQ NQSLSELVVF WQDQENLVLN 60 EVYLGKEKFD SVHSKYMGRT SFDSDSWTLR LHKLQIKDKG LYQCIIHHKK PTGMIRIHQM 120
• SEQ ID NO:51 provides the murine amino acid sequence of SEQ ID NO:50 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of human B7-2.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: ccatgccaat ttgcaaactc tcaaaaccaa agcctgagtg agctagtagt atttggcag 60 gaccaggaaa acttggttct gaatgaggta tacttaggca aagagaaatt tgacagtgtt 120 cattccaagt atatgggccg cacaagttttt gattcggaca gttggaccct gagacttcac 180 aatcttcaga tcaaggacaa gggcttgtat caatgtatca tccatcaa aagcccacacaa a
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atgggcgtcc ccacggccct ggaggccggc agctggcgct ggggatccct gctcttcgct 60 ⁇ tcttcctgg ctgcgtccct aggtccggtg gcagccttca aggtcgccac gccgtattcc 120 ctgtatgtct gtcccgaggg gcagaacgtc accctcacct gcaggctctt gggccctgtg 180 gacaaagggc acgatgtgac cttctacaag acgtggggggggc
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• SEQ ID NO:56 provides the murine amino acid sequence of SEQ ID NO:55 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of human B7-H5.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: ttca ⁇ ggtcg ccacgccgta ttccctgtat gtctgtcccg aggggcagaa cgtcaccctc 60 acctgcaggc tcttgggccc tgtggacaaa gggcacgatg tgaccttcta caagacgtgg 120 taccgcagct cgaggggcga ggtgcagacc tgctcagagc gccggcccat ccgcaacctc 180 acgttccagg accttcacct gcaccatgga gg
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: FKVATPYSLY VCPEGQNVTL TCRLLGPVDK GHDVTFYKTW YRSSRGEVQT CSERRPIRNL 60 TFQDLHLHHG GHQAANTSHD LAQRHGLESA SDHHGNFSIT MRNLTLLDSG LYCCLWEIR 120 HHHSEHRVHG 130
• the disclosed fusion proteins include the extracellular domain of the non-human primate (Cynomolgus) B7-DC, proteins shown in SEQ ID NOs: 5 or 6, as shown below.
• the costimulatory polypeptide domain of the fusion protein can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: atgatcttcc tcctgctaat gttgagcctg gaattgcagc ttcaccagat agcagcttta 60 ttcagtga cagtccctaa ggaactgtac ataatagagc atggcagcaa tgtgaccctg 120 gaatgcaact ttgacactgg aagtcatgtg aaccttggag caataacagc cagtttgcaa 180 aaggtggaaa atgatacatc cccacaccgt gaaagagcca ctttgctgga ggagcagctg 240 cccctaggga agg
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• SEQ ID NO:61 provides the non-human primate amino acid sequence of SEQ ID NO:60 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of non-human primate B7-DC.
• the costimulatory polypeptide domain can be encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to: ttcacagtga cagtccctaa ggaactgtac ataatagagc atggcagcaa tgtgaccctg 60 gaatgcaact ttgacactgg aagtcatgtg aaccttggag caataacagc cagtttgcaa 120 aaggtggaaa atgatacatc cccacaccgt gaaagagcca ctttgctgga ggagcagctg 180 ccctaggga
• the costimulatory polypeptide domain of the fusion protein can have at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to:
• B7-DC, B7-1, B7-2 and B7-H5 extracellular domains can contain one or more amino acids from the signal peptide or the putative transmembrane domain of B7-DC, B7-1, B 7-2 or B 7- H5.
• the number of amino acids of the signal peptide that are cleaved can vary depending on the expression system and the host.
• fragments of B7-DC, B7-1, B7-2 or B7-H5 extracellular domain missing one or more amino acids from the C-terminus or the N- terminus that retain the ability to bind to their natural receptors can be used as a fusion partner for the disclosed fusion proteins.
• Exemplary suitable fragments of murine B7-DC that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of murine B7-DC include, but are not limited to, the following:
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO:1, or may be any signal peptide known in the art.
• Exemplary suitable fragments of human B7-DC that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of human B7-DC include, but are not limited to, the following:
• SEQ ID NO:3 optionally with one to five amino acids of a signal peptide attached to the N-terminal end.
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO:3, or may be any signal peptide known in the art.
• Exemplary suitable fragments of non-human primate B7-DC that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of non-human primate B7-DC include, but are not limited to, the following:
• SEQ ID NO:5 optionally with one to five amino acids of a signal peptide attached to the N-terminal end.
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO:5, or may be any signal peptide known in the art.
• Exemplary suitable fragments of murine B7-1 that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of murine B 7-1 include, but are not limited to, lhe following:
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO:7, or may be any signal peptide known in the art.
• Exemplary suitable fragments of human B7-1 that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of human B7-1 include, but are not limited to, the following:
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO: 9, or may be any signal peptide known in the art.
• Exemplary suitable fragments of murine B7-2 that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of murine B7-2 include, but are not limited to, the following:
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO: 11 , or may be any signal peptide known in the art.
• Exemplary suitable fragments of human B 7-2 that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of human B7-2 include, but are not limited to, the following:
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO: 13, or may be any signal peptide known in the art.
• Exemplary suitable fragments of murine B7-H5 that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of murine B7-H5 include, but are not limited to, the following:
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO: 15, optionally with one to five amino acids of a signal peptide attached to the N-terminal end.
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO:
• Exemplary suitable fragments of human B7-H5 that can be used as a costimulatory polypeptide domain include, but are not limited to, the following:
• Additional suitable fragments of human B7-H5 include, but are not limited to, the following:
• the signal peptide may be any disclosed herein, including the signal peptide contained within SEQ ID NO: 17, or may be any signal peptide known in the art.
• Variant B7 costimulatory polypeptides Variants of costimulatory molecules can also be used.
• the variant B7 costimulatory polypeptide has the same activity, substantially the same activity, or different activity as a reference B7 costimulatory polypeptide, for example a non-mutated B7-DC polypeptide. Substantially the same activity means it retains the ability to costimulate T cells.
• Exemplary variant B7 co-stimulatory polypeptides include, but are not limited to B7-1, B7-2, B7-H5 or B7-DC polypeptides that are mutated to contain a deletion, substitution, insertion, or rearrangement of one or more amino acids.
• a variant B7 costimulatory polypeptide can have any combination of amino acid substitutions, deletions or insertions.
• isolated B 7 variant polypeptides have an integer number of amino acid alterations such that their amino acid sequence shares at least 60, 70, 80, 85, 90, 95, 97, 98, 99, 99.5 or 100% identity with an amino acid sequence of a wild type B7 co- stimulatory polypeptide.
• B7 variant polypeptides have an amino acid sequence sharing at least 60, 7O 5 80, 85, 90, 95, 97, 98, 99, 99.5 or 100% identity with the amino acid sequence of a wild type murine or wild type human B7 polypeptide (GenBank Accession Number NM_025239, NM_005191, U04343, orNP_071436).
• Percent sequence identity can be calculated using computer programs or direct sequence comparison.
• Preferred computer program methods to determine identity between two sequences include, but are not limited to, the GCG program package, FASTA, BLASTP, and TBLASTN (see, e.g., D. W. Mount, 2001, Bio ⁇ nformatics: Sequence and Genome Analysis, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
• the BLASTP and TBLASTN programs are publicly available from NCBI and other sources.
• the well-known Smith Waterman algorithm may also be used to determine identity.
• Exemplary parameters for amino acid sequence comparison include the following: 1) algorithm from Needleman and Wunsch (J MoI. Biol,
• Amino acid substitutions in B7 costimulatory polypeptides may be "conservative” or “non-conservative".
• “conservative” amino acid substitutions are substitutions wherein the substituted amino acid has similar structural or chemical properties
• “non-conservative” amino acid substitutions are those in which the charge, hydrophobicity, or bulk of the substituted amino acid is significantly altered.
• Non-conservative substitutions will differ more significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
• conservative amino acid substitutions include those in which the substitution is within one of the five following groups: 1) small aliphatic, nonpolar or slightly polar residues (Ala, Ser, Thr, Pro, GIy); 2) polar, negatively charged residues and their amides (Asp, Asn, GIu, GIn); polar, positively charged residues (His, Arg, Lys); large aliphatic, nonpolar residues (Met, Leu, lie, VaI, Cy s); and large aromatic resides (Phe, Tyr, Trp).
• non-conservative amino acid substitutions are those where 1) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; 2) a cysteine or proline is substituted for (or by) any other residue; 3) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or 4) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) a residue that does not have a side chain, e.g., glycine.
• a hydrophilic residue e.g., seryl or threon
• B7 family molecules are expressed at the cell surface with a membrane proximal constant IgC domain and a membrane distal IgV domain. Receptors for these ligands share a common extracellular IgV-like domain. Interactions of receptor-ligand pairs are mediated predominantly through residues in the IgV domains of the ligands and receptors.
• IgV domains are described as having two sheets that each contain a layer of ⁇ -strands. These ⁇ -strands are referred to as A', B, C f C, C", D, E, F and G.
• the B7 variant polypeptides contain amino acid alterations (i.e., substitutions, deletions or insertions) within one or more of these ⁇ -strands in any possible combination.
• B7 variants contain one or more amino acid alterations (i.e., substitutions, deletions or insertions) within the A', C, C ⁇ C", D 5 E, F or G ⁇ -strands.
• B7 variants contain one or more amino acid alterations in the G ⁇ -strand.
• a variant B7-DC co-stimulatory polypeptide is one that is mutated so that it retains its ability to enhance T cell activity, but shows reduced PD-I binding activity.
• a variant B7-DC polypeptide can contain, without limitation, substitutions, deletions or insertions at position 33 of the A' ⁇ -strand, positions 39 or 41 of the B ⁇ -strand, positions 56 or 58 of the C ⁇ -strand, positions 65 or 67 of the C * ⁇ -strand, positions 71 or 72 of the C" ⁇ -strand, position 84 of the D ⁇ -strand, position 88 of the E ⁇ -strand, positions 101, 103 or 105 of the F ⁇ -strand, or positions 110, 111, 113 or 116 of the G ⁇ -strand.
• amino acid positions are relative to the full length amino acid sequences of murine and human B 7- DC provided by SEQ ID NO: 1 and SEQ ID NO:3, respectively. It will be appreciated that fragments of murine and human B7-DC polypeptides may contain substitutions, deletions or insertions at corresponding amino acid positions.
• variant B7-DC polypeptides contain a substitution at position 33 (e.g., a serine substitution for aspartic acid at position 33), a substitution at position 39 (e.g., a tyrosine substitution for serine at position 39), a substitution at position 41 (e.g., a serine substitution for glutamic acid at position 41), a substitution at position 56 (e.g., a serine substitution for arginine at position 56), a substitution at position 58 (e.g., a tyrosine substitution for serine at position 58), a substitution at position 65 (e.g., a serine substitution for aspartic acid at position 65), a substitution at position 67 (e.g., a tyrosine substitution for serine at position 67), a substitution at position 71 (e.g., a serine substitution for glutamic acid at position 71), a substitution at position 72 (e.g., a serine substitution for arginine at position
• substitutions at the recited amino acid positions can be made using any amino acid or amino acid analog.
• the substitutions at the recited positions can be made with any of the naturally-occurring amino acids (e.g., alanine, aspartic acid, asparagine, arginine, cysteine, glycine, glutamic acid, glutamine, histidine, leucine, valine, isoleucine, lysine, methionine, proline, threonine, serine, phenylalanine, tryptophan, or tyrosine).
• the naturally-occurring amino acids e.g., alanine, aspartic acid, asparagine, arginine, cysteine, glycine, glutamic acid, glutamine, histidine, leucine, valine, isoleucine, lysine, methionine, proline, threonine, serine, phenylalanine, tryptophan, or
• the costimulatory polypeptide domain of the fusion protein includes the extracellular domain of human B7-DC with a K113S substitution provided by SEQ ID NO.64, or a fragment thereof: MI FLLLMLSL ELQLHQIAAL FTVTVPKELY IIEHGSNVTL BCNFDTGSHV NLGAITASLQ 60
• SEQ ID NO:65 provides the human amino acid sequence of SEQ ID NO:64 without the signal sequence:
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of human B7-DC with a Kl 13S substitution provided by SEQ ID NO: 66, or a fragment thereof:
• the costimulatory polypeptide domain of the fusion protein includes the extracellular domain of human B7-DC with a Dl I lS substitution provided by SEQ ID NO:67, or a fragment thereof: MIFLLLMLSL ELQLHQIAAL FTVTVPKELY IIEHGSNVTL ECNFDTGSHV NLGAITASLQ 60
• SEQ ID NO.67 provides the human amino acid sequence of SEQ ID NO:67 without the signal sequence: LFTVTVPKEL YIIEHGStgVT LECNFDTGSH VNLGAITASL QKVENDTSPH RERATLLEEQ 60
• the costimulatory polypeptide domain of the fusion protein includes the IgV domain of human B7-DC with a Dl 1 IS substitution provided by SEQ ID NO: 69, or a fragment thereof:
• nucleic acids encoding the disclosed fusion polypeptides may be optimized for expression in the expression host of choice. Codons may be substituted with alternative codons encoding the same amino acid to account for differences in codon usage between the mammal from which the nucleic acid sequence is derived and the expression host. In this manner, the nucleic acids may be synthesized using expression host-preferred codons. c. Properties of variant B 7 costimulatory polypeptides
• the disclosed B7 costimulatory polypeptides and variants and fragments thereof are capable of activating T cells.
• the T cell response that results from the interaction typically is greater than the response in the absence of the costimulatory polypeptide.
• the response of the T cell in the absence of the costimulatory polypeptide can be no response or can be a response significantly lower than in the presence of the costimulatory polypeptide.
• Exemplary variants of costimulatory polypeptides are those that have an insertion, deletion, or substitution of one or more amino acids that reduces or prevents the co- stimulatory molecule from participating in signal transduction pathways that transmit inhibitory signals in T cells.
• Methods for measuring the binding affinity between two molecules are well known in the art
• Methods for measuring the binding affinity of B7 variant polypeptides to receptors include, but are not limited to, fluorescence activated cell sorting (FACS) 5 surface plasmon resonance, fluorescence anisotropy, affinity chromatography and affinity selection-mass spectrometry.
• Methods for measuring costimulation of T cells are well known in the art and include measurements of T cell proliferation and secretion of cytokines, including, but not limited to, 11-2, IL-4, IL-5, IL-6, IL-IO, IL- 13, and IFN- ⁇ .
• Proliferation of T cells can be measured by a number of methods including, but not limited to, cell counting, measuring DNA synthesis by uptake of labeled nucleotides (such as [ 3 H] TdR and BrdU) and measuring metabolic activity with tetrazolium salts. Methods for measuring the secretion of cytokines include, but are not limited to, ELISA.
• Antigen-binding targeting domain The fusion proteins also contain antigen-binding targeting domains. In some embodiments, the targeting domains bind to antigens, ligands or receptors that are specific to tumor cells or tumor-associated neovasculature, or are upregulated in tumor cells or tumor-associated neovasculature compared to normal tissue.
• the targeting domains bind to antigens, ligands or receptors that are specific to immune tissue involved in the regulation of T cell activation in response to infectious disease causing agents.
• Tumor/tumor-associated vasculature targeting domains a. Antigens, ⁇ igands and receptors to target i. Tumor-specific and tumor-associated antigens
• the fusion proteins contain a domain that specifically binds to an antigen that is expressed by tumor cells. The antigen expressed by the tumor may be specific to the tumor, or may be expressed at a higher level on the tumor cells as compared to non-tumor cells.
• Tumor-associated antigens may include, for example, cellular oncogene-encoded products or aberrantly expressed proto-oncogene-encoded products (e.g., products encoded by the neu, ras, trk, and kit genes), or mutated forms of growth factor receptor or receptor-like cell surface molecules (e.g., surface receptor encoded by the c-erb B gene).
• tumor-associated antigens include molecules that may be directly involved in transformation events, or molecules that may not be directly involved in oncogenic transformation events but are expressed by tumor cells (e.g., carcinoembryonic antigen, CA- 125, melonoma associated antigens, etc.) (see, e.g., U.S. Pat. No. 6,699,475; Jager, et al., Int. J. Cancer, 106:817-20 (2003); Kennedy, et al., Int. Rev. Immunol, 22:141-72 (2003); Scanlan, et al. Cancer Immun., 4:1 (2004)).
• tumor cells e.g., carcinoembryonic antigen, CA- 125, melonoma associated antigens, etc.
• Genes that encode cellular tumor associated antigens include cellular oncogenes and proto-oncogenes that are aberrantly expressed.
• cellular oncogenes encode products that are directly relevant to the transformation of the cell, and because of this, these antigens are particularly preferred targets for immunotherapy.
• An example is the tumorigenic neu gene that encodes a cell surface molecule involved in oncogenic transformation.
• Other examples include the ras, kit, and trk genes.
• the products of proto-oncogenes may be aberrantly expressed (e.g., overexpressed), and this aberrant expression can be related to cellular transformation.
• the product encoded by proto-oncogenes can be targeted.
• Some oncogenes encode growth factor receptor molecules or growth factor receptor-like molecules that are expressed on the tumor cell surface.
• An example is the cell surface receptor encoded by the c-erbB gene.
• Other tumor-associated antigens may or may not be directly involved in malignant transformation. These antigens, however, are expressed by certain tumor cells and may therefore provide effective targets.
• Some examples are carcinoembryonic antigen (CEA), CA 125 (associated with ovarian carcinoma), and melanoma specific antigens.
• tumor associated antigens are detectable in samples of readily obtained biological fluids such as serum or mucosal secretions.
• One such marker is CAl 25, a carcinoma associated antigen that is also shed into the bloodstream, where it is detectable in serum (e.g., Bast, et al., N. Eng. J. Med., 309:883 (1983); Lloyd, et al., Int. J. Cane, 71 :842 (1997).
• CAl 25 levels in serum and other biological fluids have been measured along with levels of other markers, for example, carcinoembryonic antigen (CEA), squamous cell carcinoma antigen (SCC), tissue polypeptide specific antigen (TPS), sialyl TN mucin (STN), and placental alkaline phosphatase (PLAP) 5 in efforts to provide diagnostic and/or prognostic profiles of ovarian and other carcinomas (e.g., Sarandakou, et at, Acta Oncol, 36:755 (1997); Sarandakou, et al., Eur. J. Gynaecol.
• CEA carcinoembryonic antigen
• SCC squamous cell carcinoma antigen
• TPS tissue polypeptide specific antigen
• STN sialyl TN mucin
• PLAP placental alkaline phosphatase
• Elevated serum CAl 25 may also accompany neuroblastoma (e.g., Hirokawa, et al., Surg. Today, 28:349 (1998), while elevated CEA and SCC, among others, may accompany colorectal cancer (Gebauer, et al., Anticancer Res., 17(4B):2939 (1997)).
• the tumor associated antigen, raesothelin, defined by reactivity with monoclonal antibody K-I, is present on a majority of squamous cell carcinomas including epithelial ovarian, cervical, and esophageal tumors, and on mesotheliomas (Chang, et al., Cancer Res., 52:181 (1992); Chang, et al., Int. J. Cancer, 50:373 (1992); Chang, et al., Int. J Cancer, 51 :548 (1992); Chang, et al., Proc. Natl. Acad. ScI USA, 93:136 (1996); Chowdhury, et al, Proc. Natl. Acad.
• mesothelin is detectable only as a cell-associated tumor marker and has not been found in soluble form in serum from ovarian cancer patients, or in medium conditioned by OVCAR-3 cells (Chang, et al., Int. J. Cancer, 50:373 (1992)).
• Structurally related human mesothelin polypeptides also include tumor-associated antigen polypeptides such as the distinct mesothelin related antigen (MRA) polypeptide, which is detectable as a naturally occurring soluble antigen in biological fluids from patients having malignancies (see WO 00/50900).
• MRA mesothelin related antigen
• a tumor antigen may include a cell surface molecule.
• Tumor antigens of known structure and having a known or described function include the following cell surface receptors: HERl (GenBank Accession No. U48722), HER2 (Yoshino, et al., J Immunol., 152:2393 (1994); Disis, et al., Cane. Res., 54:16 (1994); GenBank Ace. Nos. X03363 and Ml 7730), HER3 (GenBank Ace. Nos. U29339 and M34309), HER4 (Plowman, et al, Nature, 366:473 (1993); GenBank Ace. Nos.
• GenBank Ace. Nos. X01060 and Ml 1507 Estrin receptor
• estrogen receptor GenBank Ace. Nos. M38651, X03635, X99101, U47678 and M 12674
• progesterone receptor GenBank Ace. Nos. X51730, X69068 and Ml 5716
• FSH- R follicle stimulating hormone receptor
• retinoic acid receptor GenBank Ace. Nos.
• any of the CTA class of receptors including in particular HOM- MEL-40 antigen encoded by the SSX2 gene (GenBank Ace. Nos. X86175, U90842, U90841 and X86174), carcinoembryonic antigen (CEA, Gold and Freedman, J Exp. Med., 121 :439 (1985); GenBank Ace. Nos. M59710, M59255 and M29540), and PyLT (GenBank Ace. Nos.
• tumor associated antigens include prostate surface antigen
• Tumor antigens of interest include antigens regarded in the art as
• CT antigens that are immunogenic in subjects having a malignant condition
• Scanlan, et al., Cancer Immun., 4:1 (2004) CT antigens include at least 19 different families of antigens that contain one or more members and that are capable of inducing an immune response, including but not limited to MAGEA (CTl); BAGE (CT2); MAGEB (CT3); GAGE (CT4); SSX (CT5); NY-ESO-I (CT6); MAGEC (CT7); SYCPl (C8); SPANXBl (CTl 1.2); NA88 (CT18); CTAGE (CT21); SPA17 (CT22); OY- TES-I (CT23); CAGE (CT26); HOM-TES-85 (CT28); HCA661 (CT30); NY-SAR-35 (CT38); FATE (CT43); and TPTE (CT44).
• MAGEA CTl
• BAGE CT2
• MAGEB CT3
• GAGE CT4
• SSX CT5
• Additional tumor antigens that can be targeted include, but not limited to, alpha- actinin-4, Bcr-Abl fusion protein, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ET V6- AMLl fusion protein, LDLR- fucosy transferase AS fusion protein, HLA-A2, HLA-AI l 5 hsp70-2, KIAAO205, Mart2 s Mum- 1 5 2, and 3, neo-PAP, myosin class I, OS-9, pml- RAR ⁇ fusion protein, PTPRK, K-ras, N-ras, Triosephosphate isomeras, Bage-1, Gage 3,4,5,6,7, GnTV, Herv-K-mel, Lü-1, Mage- Al,2,3,4,6 9 10,12, Mage-C2,
• tumor-associated and tumor-specific antigens are known to those of skill in the art and are suitable for targeting by the disclosed fusion proteins.
• Antigens associated with tumor neovasculature Protein therapeutics can be ineffective in treating tumors because they are inefficient at tumor penetration. Tumor-associated neovasculature provides a readily accessible route through which protein therapeutics can access the tumor.
• the fusion proteins contain a domain that specifically binds to an antigen that is expressed by neovasculature associated with a tumor. The antigen may be specific to tumor neovasculature or may be expressed at a higher level in tumor neovasculature when compared to normal vasculature.
• antigens that are over-expressed by tumor- associated neovasculature as compared to normal vasculature include, but are not limited to, VEGF/KDR, Tie2, vascular cell adhesion molecule (VCAM), endoglin and ⁇ 5 ⁇ 3 integrin/vitronectin.
• Other antigens that are over- expressed by tumor-associated neovasculature as compared to normal vasculature are known to those of skill in the art and are suitable for targeting by the disclosed fusion proteins.
• the fusion proteins contain a domain that specifically binds to a chemokine or a chemokine receptor.
• Chemokines are soluble, small molecular weight (8-14 kDa) proteins that bind to their cognate G-protein coupled receptors (GPCRs) to elicit a cellular response, usually directional migration or chemotaxis.
• GPCRs G-protein coupled receptors
• Tumor cells secrete and respond to chemokines, which facilitate growth that is achieved by increased endothelial cell recruitment and angiogenesis, subversion of immunological surveillance and maneuvering of the tumoral leukocyte profile to skew it such that the chemokine release enables the tumor growth and metastasis to distant sites.
• chemokines are vital for tumor progression.
• CXC conserved two N-terminal cysteine residues of the chemokines
• CXC chemokines are classified into four groups namely CXC, CC, CX3C and C chemokines.
• the CXC chemokines can be further classified into ELR+ and ELR- chemokines based on the presence or absence of the motif 'glu-leu-arg (ELR motif)' preceding the CXC sequence.
• ELR motif glu-leu-arg
• the CC chemokines act on several subsets of dendritic cells, lymphocytes, macrophages, eosinophils, natural killer cells but do not stimulate neutrophils as they lack CC chemokine receptors except murine neutrophils. There are approximately 50 chemokines and only 20 chemokine receptors, thus there is considerable redundancy in this system of HgandVreceptor interaction. Chemokines elaborated from the tumor and the stromal cells bind to the chemokine receptors present on the tumor and the stromal cells. The autocrine loop of the tumor cells and the paracrine stimulatory loop between the tumor and the stromal cells facilitate the progression of the tumor.
• CXCR2, CXCR4, CCR2 and CCR7 play major roles in tumorigenesis and metastasis.
• CXCR2 plays a vital role in angiogenesis and CCR2 plays a role in the recruitment of macrophages into the tumor microenvironment.
• CCR7 is involved in metastasis of the tumor cells into the sentinel lymph nodes as the lymph nodes have the ligand for CCR7, CCL21.
• CXCR4 is mainly involved in the metastatic spread of a wide variety of tumors.
• tumor or tumor-associated neovasculature targeting domains are ligands that bind to cell surface antigens or receptors that are specifically expressed on tumor cells or tumor-associated neovasculature or are overexpressed on tumor cells or tumor-associated neovasculature as compared to normal tissue. Tumors also secrete a large number of ligands into the tumor microenvironment that affect tumor growth and development. Receptors that bind to ligands secreted by tumors, including, but not limited to growth factors, cytokines and chemokines., including the chemokines provided above, are suitable for use in the disclosed fusion proteins.
• Ligands secreted by tumors can be targeted using soluble fragments of receptors that bind to the secreted ligands.
• Soluble receptor fragments are fragments polypeptides that may be shed, secreted or otherwise extracted from the producing cells and include the entire extracellular domain, or fragments thereof.
• tumor or tumor-associated neovasculature targeting domains are single polypeptide antibodies that bind to cell surface antigens or receptors that are specifically expressed on tumor cells or tumor- associated neovasculature or are overexpressed on tumor cells or tumor- associated neovasculature as compared to normal tissue.
• Single domain antibodies are described above with respect to coinhibitory receptor antagonist domains.
• Fc domains Fc domains
• tumor or tumor-associated neovasculature targeting domains are Fc domains of immunoglobulin heavy chains that bind to Fc receptors expressed on tumor cells or on tumor-associated neovasculature.
• the Fc region as used herein includes the polypeptides containing the constant region of an antibody excluding the first constant region immunoglobulin domain.
• Fc refers to the last two constant region immunoglobulin domains of IgA, IgD 9 and IgG 5 and the last three constant region immunoglobulin domains of IgE and IgM.
• the Fc domain is derived from a human or murine immunoglobulin.
• the Fc domain is derived from human IgGl or murine IgG2a including the CH2 and C H 3 regions.
• the hinge, CH2 and C H 3 regions of a human immunoglobulin C ⁇ l chain are encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: gagcctaagt catgtgacaa gacccatacg tgcccaccct gtcccgctcc agaactgctg 60 gggggaccta gcgttttcttt gttcccccca aagcccaagg acaccctcat gatctcacgg 120 actcccgaag taacatgcgt agtagtcgac gtgagccacg aggatcctga agtgaagttt 180 aat
• the hinge, C H 2 and CH3 regions of a human immunoglobulin C ⁇ l chain encoded by SEQ ID NO:70 has the following amino acid sequence:
• the hinge, C H 2 and C H 3 regions of a murine immunoglobulin C ⁇ 2a chain are encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: gagccaagag gtcctacgat caagccctgc ccgccttgta aatgcccagc tccaaatttg 60 ctgggtggac cgtcagtcttt tatcttcccg ccaaagataaggacgtctt gatgattagt 120 ctgagcccca tcgtgacatg cgttgtggtg gatgtttcag aggatgaccc cgacgtgcaa 180 atcagttggt tcgttaacaa cgtggaggtg cataccgctc aaacccaga
• the hinge, CH2 and CH3 regions of a murine immunoglobulin C ⁇ 2a chain encoded by SEQ ID NO:72 has the following amino acid sequence: EPRGPTIKPC PPCKCPAPNL LGGPSVFIFP PKIKDVLMIS LSPIVTCVW DVSEDDPDVQ 60
• the Fc domain may contain one or more amino acid insertions, deletions or substitutions that enhance binding to specific Fc receptors that specifically expressed on tumors or tumor-associated neovasculature or are overexpressed on tumors or tumor-associated neovasculature relative to normal tissue.
• Suitable amino acid substitutions include conservative and non-conservative substitutions, as described above.
• rituximab a chimeric mouse/human IgGl monoclonal antibody against CD20
• rituximab a chimeric mouse/human IgGl monoclonal antibody against CD20
• Waldenstrom's macroglobulinemia correlated with the individual's expression of allelic variants of Fc ⁇ receptors with distinct intrinsic affinities for the Fc domain of human IgGl .
• patients with high affinity alleles of the low affinity activating Fc receptor CDl 6 A (Fc ⁇ RJIIA) showed higher response rates and, in the cases of non-Hodgkin's lymphoma, improved progression-free survival.
• the Fc domain may contain one or more amino acid insertions, deletions or substitutions that reduce binding to the low affinity inhibitory Fc receptor CD32B (Fc ⁇ RIIB) and retain wild-type levels of binding to or enhance binding to the low affinity activating Fc receptor CD16A (Fc ⁇ RIIIA).
• the Fc domain contains amino acid insertions, deletions or substitutions that enhance binding to CD 16 A.
• a large number of substitutions in the Fc domain of human IgGl that increase binding to CD16A and reduce binding to CD32B are known in the art and are described in Stavenhagen, et al., Cancer Res,, 57(18):8882-90 (2007).
• Exemplary variants of human IgGl Fc domains with reduced binding to CD32B and/or increased binding to CD16A contain F243L, R929P, Y300L, V305I or P296L substitutions. These amino acid substitutions may be present in a human IgGl Fc domain in any combination.
• the human IgGl Fc domain variant contains a F243L, R929P and Y300L substitution.
• the human IgGl Fc domain variant contains a F243L, R929P, Y300L, V3O5I and P296L substitution. d.
• tumor or tumor-associated neovasculature targeting domains are polypeptides that provide a signal for the posttranslational addition of a glycosylphosphatidylinositol (GPI) anchor.
• GPI anchors are glycolipid structures that are added posttranslationally to the C-terminus of many eukaryotic proteins. This modification anchors the attached protein in the outer leaflet of cell membranes.
• GPI anchors can be used to attach T cell receptor binding domains to the surface of cells for presentation to T cells.
• the GPI anchor domain is C- terminal to the T cell receptor binding domain.
• the GPI anchor domain is a polypeptide that signals for the posttranslational addition addition of a GPI anchor when the polypeptide is expressed in a eukaryotic system.
• Anchor addition is determined by the GPI anchor signal sequence, which consists of a set of small amino acids at the site of anchor addition (the ⁇ site) followed by a hydrophilic spacer and ending in a hydrophobic stretch (Low, FASEBJ., 3:1600-1608 (1989)).
• the glycan core can be variously modified with side chains, such as a phosphoethanolamine group, mannose, galactose, sialic acid, or other sugars.
• side chains such as a phosphoethanolamine group, mannose, galactose, sialic acid, or other sugars.
• the most common side chain attached to the first mannose residue is another mannose.
• Complex side chains, such as the JV-acetylgalactosamine- containing polysaccharides attached to the third mannose of the glycan core are found in mammalian anchor structures.
• the core glucosamine is rarely modified.
• the lipid anchor of the phosphoinositol ring is a diacylglycerol, an alkylacylglycerol, or a ceramide.
• the lipid species vary in length, ranging from 14 to 28 carbons, and can be either saturated or unsaturated.
• Many GPI anchors also contain an additional fatty acid, such as palmitic acid, on the 2-hydroxyl of the inositol ring. This extra fatty acid renders the GPI anchor resistant to cleavage by PI-PLC.
• GPI anchor attachment can be achieved by expression of a fusion protein containing a GPI anchor domain in a eukaryotic system capable of carrying out GPI posttranslational modifications.
• GPI anchor domains can be used as the tumor or tumor vasculature targeting domain, or can be additionally added to fusion proteins already containing separate tumor or tumor vasculature targeting domains.
• GPI anchor moieties are added directly to isolated T cell receptor binding domains through an in vitro enzymatic or chemical process.
• GPI anchors can be added to polypeptides without the requirement for a GPI anchor domain.
• GPI anchor moieties can be added to fusion proteins described herein having a T cell receptor binding domain and a tumor or tumor vasculature targeting domain.
• GPI anchors can be added directly to T cell receptor binding domain polypeptides without the requirement for fusion partners encoding tumor or tumor vasculature targeting domains.
• Fusion proteins disclosed herein optionally contain a peptide or polypeptide linker domain that separates the costimulatory polypeptide domain from the antigen-binding targeting domain.
• the linker domain contains the hinge region of an immunoglobulin.
• the hinge region is derived from a human immunoglobulin. Suitable human immunoglobulins that the hinge can be derived from include IgG 5 IgD and IgA. In a preferred embodiment, the hinge region is derived from human IgG.
• the linker domain contains a hinge region of an immunoglobulin as described above, and further includes one or more additional immunoglobulin domains.
• the additional domain includes the Fc domain of an immunoglobulin.
• the Fc region as used herein includes the polypeptides containing the constant region of an antibody excluding the first constant region immunoglobulin domain.
• Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, and the last three constant region immunoglobulin domains of IgE and IgM.
• the Fc domain is derived from a human immunoglobulin.
• the Fc domain is derived from human IgG including the CH2 and CH3 regions.
• the linker domain contains a hinge region of an immunoglobulin and either the CHI domain of an immunoglobulin heavy chain or the C L domain of an immunoglobulin light chain.
• the CHI or C L domain is derived from a human immunoglobulin.
• the C L domain may be derived from either a K light chain or a ⁇ light chain.
• the CHI or C L domain is derived from human IgG.
• Amino acid sequences of immunoglobulin hinge regions and other domains are well known in the art.
• peptide/polypeptide linker domains include naturally occurring or non-naturally occurring peptides or polypeptides.
• Peptide linker sequences are at least 2 amino acids in length.
• the peptide or polypeptide domains are flexible peptides or polypeptides.
• a "flexible linker” herein refers to a peptide or polypeptide containing two or more amino acid residues joined by peptide bond(s) that provides increased rotational freedom for two polypeptides linked thereby than the two linked polypeptides would have in the absence of the flexible linker. Such rotational freedom allows two or more antigen binding sites joined by the flexible linker to each access target antigen(s) more efficiently.
• Exemplary flexible peptides/polypeptides include, but are not limited to, the amino acid sequences Gly-Ser, Gly-Ser-Gly-Ser (SEQ ID NO:74), Ala-Ser, Gly-Gly- Gly-Ser (SEQ ID NO:75), (Gly 4 -Ser) 3 (SEQ ID NO:76), (Gly 4 -Ser) 4 (SEQ ID NO:77), and (Gly 4 -Ser) 4 (SEQ ID NO:78). Additional flexible peptide/polypeptide sequences are well known in the art.
• the fusion proteins disclosed herein optionally contain a dimerization or multimerization domain that functions to dimer ⁇ ze or multimerize two or more fusion proteins.
• the domain that functions to dimerize or multimerize the fusion proteins can either be a separate domain, or alternatively can be contained within one of the other domains (T cell costimulatory/coinhibitory receptor binding domain, tumor/tumor neovasculature antigen-binding domain, or peptide/polypeptide linker domain) of the fusion protein. 1.
• Dimerization domains A "dimerization domain" is formed by the association of at least two amino acid residues or of at least two peptides or polypeptides (which may have the same, or different, amino acid sequences). The peptides or polypeptides may interact with each other through covalent and/or non- covalent association ⁇ ).
• Preferred dimerization domains contain at least one cysteine that is capable of forming an intermolecular disulfide bond with a cysteine on the partner fusion protein.
• the dimerization domain can contain one or more cysteine residues such that disulfide bond(s) can form between the partner fusion proteins.
• dimerization domains contain one, two or three to about ten cysteine residues.
• the dimerization domain is the hinge region of an immunoglobulin. In this particular embodiment, the dimerization domain is contained within the linker peptide/polypeptide of the fusion protein.
• Additional exemplary dimerization domain can be any known in the art and include, but not limited to, coiled coils, acid patches, zinc fingers, calcium hands, a C H I-C L pair, an "interface" with an engineered “knob” and/or “protruberance” as described in U.S. Pat. No. 5,821,333, leucine zippers (e.g., from jun and/or fos) (U.S. Pat. No.
• SH2 src homology 2
• SH3 src Homology 3
• PTB phosphotyrosine binding
• NGF nerve growth factor
• NT-3 neurotro ⁇ hin-3
• IL-8 interleukin-8
• VEGF vascular endothelial growth factor
• VEGF-C 5 VEGF-D vascular endothelial growth factor
• PDGF PDGF members
• BDNF brain-derived neurotrophic factor
• polypeptide pairs can be identified by methods known in the art, including yeast two hybrid screens. Yeast two hybrid screens are described in U.S. Pat. Nos. 5,283,173 and 6,562,576, both of which are herein incorporated by reference in their entireties. Affinities between a pair of interacting domains can be determined using methods known in the art, including as described in Katahira, et al., J Biol. Chem., 277, 9242-9246 (2002)).
• a library of peptide sequences can be screened for heterodimerization, for example, using the methods described in WO 01/00814.
• Useful methods for protein-protein interactions are also described in U.S. Pat. No. 6,790,624.
• a “multimerization domain” is a domain that causes three or more peptides or polypeptides to interact with each other through covalent and/or non-covalent association(s).
• Suitable multimerization domains include, but are not limited to, coiled-coil domains.
• a coiled-coil is a peptide sequence with a contiguous pattern of mainly hydrophobic residues spaced 3 and 4 residues apart, usually in a sequence of seven amino acids (heptad repeat) or eleven amino acids (undecad repeat), which assembles (folds) to form a multimeric bundle of helices.
• Coiled-coils with sequences including some irregular distribution of the 3 and 4 residues spacing are also contemplated.
• Hydrophobic residues are in particular the hydrophobic amino acids VaI, lie, Leu, Met, Tyr, Phe and Trp. Mainly hydrophobic means that at least 50% of the residues must be selected from the mentioned hydrophobic amino acids.
• the coiled coil domain may be derived from laminin.
• the heterotrimeric coiled coil protein laminin plays an important role in the formation of basement membranes.
• the multifunctional oligomeric structure is required for laminin function.
• Coiled coil domains may also be derived from the thrombospondins in which three (TSP-I and TSP-2) or five (TSP-3, TSP-4 and TSP-5) chains are connected, or from COMP (COMPcc) (Guo, et at, EMBOJ., 1998, 17: 5265-5272) which folds into a parallel five-stranded coiled coil (Malashkevich ,et al., Science, 274: 761-765 (1996)).
• B7-DC A representative murine B7-DC fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atgctgctcc tgctgccgat actgaacctg agcttacaac ttcatcctgt agcagcttta 60 ttcaccgtga cagcccctaa agaagtgtac accgtagacg tcggcagcag tgtgagcctg 120 gagtgcgatt ttgaccgcag agaatgcact gaactggaag ggataagagc cagtttgcag 180 aaggtag
• the murine B7-DC fusion protein encoded by SEQ ID NO:79 has the following amino acid sequence: MLLLLPILNL SLQLKPVAAL FTVTAPKEVY TVDVGSSVSL ECDFDRRECT ELEGIRASLQ 60
• amino acid sequence of the murine B7-DC fusion protein of SEQ ID NO:80 without the signal sequence is:
• KELTSAIIDP LSRMEPKVPR TWEPRGPTIK PCPPCKCPAP NLLGGPSVFI FPPKIKDVLM 240 ISLSPIVTCV VVDVSEDDPD VQISWFVNNV EVHTAQTQTH REDYNSTLRV VSALPIQHQD 300
• a representative human B7-DC fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atgatctttc ttctcttgat gctgtctttg gaattgcaac ttcaccaaat cgcggccctc 60 tttactgtga ccgtgccaaa agaactgtat atcattgagc acgggtccaa tgtgaccctc 120 gaatgtaact ttgacaccgg cagccacgtt aacctggggg ccatcactgc cagcttgcaa 180 aaagttgaaaacgacacttc acctcaccgg gagagggcaa ccctcttgga ggagcaactg 240 ccattgggga a
• the human B7-DC fusion protein encoded by SEQ ID NO: 82 has the following amino acid sequence: MIFLLLMLSL ELQLHQIA ⁇ L FTVTVPKELY IIEHGSNVTL ECNFDTGSHV NLGAITASLQ 60
• amino acid sequence of the human B7-DC fusion protein of SEQ ID NO:83 without the signal sequence is:
• a representative non-human primate (Cynomolgus) B7-DC fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: B7-1
• a representative murine B7-1 fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atggcttgca attgtcagtt gatgcaggat acaccactcc tcaagtttcc atgtccaagg 60 ctcattcttc tctttgtgct gctgattcgt cttcacaag tgtcttcaga tgttgatga 120 caactgtcca agtcagtgaa agataggta ttgctgcttt gccttt gccgttacaa ctctctcat 180 gaagatgagt ctgaagaccg aatctactgg caaaaacatg acaaagtggt gctgtgtc 240 attg
• the murine B7-1 fusion protein encoded by SEQ ID NO:88 has the following amino acid sequence:
• VQKKERGTYE VKHLALVKLS IK ⁇ DFSTPNI TESGNPSADT KRITCFASGG FPKPRFSWLE 180 NGRELPGINT TISQDPESEL YTISSQLDFN TTRNHTIKCL IKYGDAHVSE DFTWEKPPED 240
• amino acid sequence of the murine B7-1 fusion protein of SEQ ID NO:89 without the signal sequence is:
• TCMVTDFKPE DIYVEWTNNG KTELNYKNTE PVLDSDGSYF MYSKLRVEKK NWVERNSYSC 420 SVVHBGLHNH HTTKSFSRTP GK 442 (SEQ ID NO:90).
• a representative human B 7-1 fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atgggccaca cacggaggca gggaacatca ccatccaagt gtccatacct caatttcttt 60 cagctcttgg tgctggctgg tctttctcac ttctgttcag gtgttatcca cgtgaccaag 120 gaagtgasag aagtggcaac gctgtcctgt ggtcacaatg tttctgtga agagctggca 180 caaactcgca tctactggca aaaggagaag aaaatggtgc tggggac 240 atgaatatat ggcccgagta caaga
• the human B7-1 fusion protein encoded by SEQ ID NO:91 has the following amino acid sequence:
• VKFNWYVDGV EVHKAKTKPR EEQYNSTYRV VSVLTVLHQD WLNGKEYKCK VSNKALPAPI 360
• TTPPVLDSDG SFFLYSKLTV DKSRWQQGNV FSCSVMHEAL HNHYTQKSLS LSPGK 475 (SEQ ID NO:92)
• amino acid sequence of the human B7-1 fusion protein of SEQ ID NO:92 without the signal sequence is:
• a representative murine B7-2 fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atggacccca gatgcaccat gggcttggca atccttatct ttgtgacagt cttgctgatc 60 tcagatgctg tttccgtgga gacgcaagct tatttcaatg ggactgcata tctgccgtgc 120 ccatttacaa aggctcaaa cataagcctg agtgagctgg tagtattttg gcaggaccag ISO caaaagttgg tctgtacgacgacactatttg ggcacagaga aacttgatag tgtgaatgcc 240 aagtacctgg gccg
• the murine B7-2 fusion protein encoded by SEQ ID NO: 84 has the following amino acid sequence:
• amino acid sequence of the murine B7-2 fusion protein of SEQ ID NO:95 without the signal sequence is: VSVETQAYFN GTAYLPCPFT KAQNISLSEL WFWQDQQKL VLYEHYLGTE KLDSVNAKYL 60
• a representative human B 7-2 fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atgggactga gtaacattct ctttgtgatg gccttcctgc tctctggtgc tgctcctg 60 aagattcaag cttatttcaa tgagactgca gacctgccat gccaatttgc aaactctcaa 120 aaccaaagcc tgagtgagct agtagtattt tggcaggaco aggaaaactt ggttctgaat 180 gaggtatact taggcaaaga gaaatttgac agtgttcatt ccaagtatat gggccgcaca 240 agtttgatt cgg
• the human B7-2 fusion protein encoded by SEQ ID NO:97 has the following amino acid sequence:
• MGLSNILFVM AFLLSGAAPL KIQAYFMETA DLPCQFARSQ NQSLSELVVF WQDQENLVLN 60 EVYLGKEKFD SVHSKYMGRT SFDSDSWTLR LHNLQIKDKG LYQCIIHHKK PTGMIRIHQM 120
• amino acid sequence of the human B 7-2 fusion protein of SEQ ID NO: 98 without the signal sequence is:
• VDKSRWQQGN VFSCSVMHEA LHNHYTQKSL SLSPGK 456
• a representative murine B7-H5 fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atgggtgtcc ccgcggtccc agaggccagc agcccgct ggggaaccct gctccttgct 60 attttcctgg ctgcatccag aggtctggta gcagccttca aggt ⁇ accac tccatattct 120 ctctatgtgt gtcccgaggg acagaatgcc accctcacct gcaggattct gggcccgtg 180 tccaaagggc acgatgtgac catctacaag acgtggtacc tcagctcacgaggtc 240 ca
• the murine B7-H5 fusion protein encoded by SEQ ID NO: 100 has the following amino acid sequence:
• MGVPAVPEAS SPRWGTLLLA IFLAASRGLV AAFKVTTFYS LYVCPEGQNA TLTCRILGPV 60 SKGHDVTIYK THYLSSRGEV QMCKEHRPIR NFTLQHLQHH GSHLKANASH DQPQKHGLEL 120
• NKDLPAPIER TISKPKGSVR APQVYVLPPP EEEMTKKQVT LTCMVTDFMP EDIYVEWTNN 360 GKTELNYKNT EPVLDSDGSY FMYSKLRVEK KNWVERNSYS CSWHEGLHN HHTTKSFSRT 420
• the amino acid sequence of the murine B7-H5 fusion protein of SEQ ID NO: 101 without the signal sequence is: FKVTTPYSLY VCPEGQNATL TCRILGPVSK GHDVTIYKTW YLSSRGEVQM CKEHRPIRNF 60
• a representative human B7-H5 fusion protein is encoded by a nucleic acid having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to: atgggcgtcc ccacggccct ggaggccggc agctggcgct ggggatccct gctcttcgct 60 ctcttcctgg ctgcgtccct aggtccggtg gcagccttca aggtcgccac gccgtattcc 120 ctgtatgtct gtcccgaggg gcagaacgtc accctcacct gcaggctcttt gggccctgtg 180 gacaaagggc acgatgtgac cttctacaag acgtggtacc gcagctct
• the human B7-H5 fusion protein encoded by SEQ ID NO: 103 has the following amino acid sequence:
• amino acid sequence of the human B7-H5 fusion protein of SEQ ID NO: 104 without the signal sequence is:
• the fusion proteins disclosed herein can be dimerized or multimerized. Dimerization or multimerization can occur between or among two or more fusion proteins through dimerization or multimerization domains, including those described above. Alternatively, dimerization or multimerization of fusion proteins can occur by chemical crossHnking. Fusion protein dimers can be homodimers or heterodimers. Fusion protein multimers can be homomultimers or heteromultimers.
• Fusion protein dimers as disclosed herein are of formula II:
• fusion proteins of the dimer provided by formula II are defined as being in a parallel orientation and the fusion proteins of the dimer provided by formula III are defined as being in an antiparallel orientation.
• Parallel and antiparallel dimers are also referred to as cis and trans dimers, respectively.
• N" and “C” represent the N- and C-termini of the fusion protein, respectively.
• the fusion protein constituents "Ri”, “R 2 " and “R 3 " are as defined above with respect to formula I.
• R 4 is a costimulatory polypeptide domain or a antigen- binding targeting domain
• R 5 is a peptide/polypeptide linker domain
• R 6 is a costimulatory polypeptide domain or a antigen-binding targeting domain
• R 6 is a costimulatory polypeptidedomain when "R 4 " is a antigen-binding targeting domain
• R 6 is a antigen-binding targeting domain when "R 4 " is a costimulatory polypeptide domain.
• heterodimers may contain domain orientations that meet these conditions (i.e., for a dimer according to formula II, "R 1 " and “R 4 " are both costimulatory polypeptide domains, “R 2 " and “R 5 “ are both peptide/polypeptide liker domains and “R 3 " and “R 6 " are both antigen-binding targeting domains), however the species of one or more of these domains is not identical.
• R 3 " and “R 6 " may both be antigen-binding targeting domains, they may each target a distinct antigen.
• R 3 and R 6 may both be antigen- binding targeting domains that target the same antigen, but may be distinct classes of binding domains (i.e., "R 3 " is a natural ligand for a receptor and "R 6 " is a single chain variable fragment (scFv) that binds to the same receptor).
• R 3 is a natural ligand for a receptor
• R 6 is a single chain variable fragment (scFv) that binds to the same receptor).
• Dimers of fusion proteins that contain either a CHI or C L region of an immunoglobulin as part of the polypeptide linker domain preferably form heterodimers wherein one fusion protein of the dimer contains a CHI region and the other fusion protein of the dimer contains a C L region.
• Fusion proteins can also be used to form multimers.
• multimers may be parallel multimers, in which all fusion proteins of the multimer are aligned in the same orientation with respect to their N- and C- termini.
• Multimers may be antiparallel multimers, in which the fusion proteins of the multimer are alternatively aligned in opposite orientations with respect to their N- and C-termini.
• Multimers (parallel or antiparallel) can be either homomul timers or heteromultimers.
• the disclosed fusion proteins may be modified by chemical moieties that may be present in polypeptides in a normal cellular environment, for example, phosphorylation, methylalion, amidation, sulfation, acylation, glycosylation, sumoylation and ubiquitylation. Fusion proteins may also be modified with a label capable of providing a detectable signal, either directly or indirectly, including, but not limited to, radioisotopes and fluorescent compounds.
• the fusion proteins disclosed herein may also be modified by chemical moieties that are not normally added to polypeptides in a cellular environment. Such modifications may be introduced into the molecule by reacting targeted amino acid residues of the polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues. Another modification is cyclization of the protein.
• Examples of chemical derivatives of the polypeptides include lysinyl and amino terminal residues derivatized with succinic or other carboxylic acid anhydrides. Derivatization with a cyclic carboxylic anhydride has the effect of reversing the charge of the lysinyl residues.
• Other suitable reagents for derivatizing amino-containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; t?-methylisourea; 2,4 pentanedione; and transaminase-catalyzed reaction with glyoxylate.
• aspartyl and glutamyl residues can be converted to asparaginyl and glutaminyl residues by reaction with ammonia.
• Fusion proteins may also include one or more D-amino acids that are substituted for one or more L-amino acids.
• Isolated nucleic acid sequences encoding the fusion proteins disclosed herein are also provided.
• An isolated nucleic acid can be, for example, a DNA molecule, provided one of the nucleic acid sequences normally found immediately flanking that DNA molecule in a naturally- occurring genome is removed or absent.
• an isolated nucleic acid includes, without limitation, a DNA molecule that exists as a separate molecule independent of other sequences (e.g., a chemically synthesized nucleic acid, or a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease treatment), as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, lentivirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote.
• a virus e.g., a retrovirus, lentivirus, adenovirus, or herpes virus
• an isolated nucleic acid can include an engineered nucleic acid such as a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid.
• an engineered nucleic acid such as a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid.
• Nucleic acids encoding fusion polypeptides may be optimized for expression in the expression host of choice. Codons may be substituted with alternative codons encoding the same amino acid to account for differences in codon usage between the mammal from which the nucleic acid sequence is derived and the expression host. In this manner, the nucleic acids may be synthesized using expression host-preferred codons.
• Nucleic acids can be DNA, RNA, or nucleic acid analogs. Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone. Such modification can improve, for example, stability,, hybridization, or solubility of the nucleic acid. Modifications at the base moiety can include deoxyuridine for deoxythymidine, and 5-methyl-2'- deoxycytidine or 5-bromo ⁇ 2'-deoxycytidine for deoxycytidine. Modifications of the sugar moiety can include modification of the T hydroxyl of the ribose sugar to form 2'-O-methyl or 2'-O-allyl sugars.
• the deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids, in which each base moiety is linked to a six merabered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained. See, for example, Summerton and Weller (1997) Antisense Nucleic Acid Drug Dev. 7:187-195; and Hyrup et al (1996) Bioorgan. Med Chem. 4:5-23.
• the deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoroamidite, or an alkyl phosphotriester backbone.
• Nucleic acids encoding polypeptides disclosed herein can be administered to subjects in need thereof. Nucleic delivery involves introduction of "foreign" nucleic acids into a cell and ultimately, into a live animal. Compositions and methods for delivering nucleic acids to a subject are known in the art (see Understanding Gene Therapy, Lemoine, N.R., ed., BIOS Scientific Publishers, Oxford, 2008).
• One approach includes nucleic acid transfer into primary cells in culture followed by autologous transplantation of the ex vivo transformed cells into the host, either systemically or into a particular organ or tissue.
• vectors containing nucleic acids encoding fusion proteins are transfected into cells that are administered to a subject in need thereof.
• Ex vivo methods can include, for example, the steps of harvesting cells from a subject, culturing the cells, transducing them with an expression vector, and maintaining the cells under conditions suitable for expression of the encoded polypeptides. These methods are known in the art of molecular biology.
• the transduction step can be accomplished by any standard means used for ex vivo gene therapy, including, for example, calcium, phosphate, Kpofection, electroporat ⁇ on, viral infection, and biolistic gene transfer. Alternatively, liposomes or polymeric microparticles can be used. Cells that have been successfully transduced then can be selected, for example, for expression of the coding sequence or of a drag resistance gene. The cells then can be lethally irradiated (if desired) and injected or implanted into the subject. In vivo nucleic acid therapy can be accomplished by direct transfer of a functionally active DNA into mammalian somatic tissue or organ in vivo.
• nucleic acids encoding polypeptides disclosed herein can be administered directly to lymphoid tissues or tumors.
• victim lymphoid tissue specific targeting can be achieved using lymphoid tissue-specific transcriptional regulatory elements (TREs) such as a B lymphocyte-, T lymphocyte-, or dendritic cell-specific TRE. Lymphoid tissue specific TREs are known in the art.
• TREs lymphoid tissue-specific transcriptional regulatory elements
• Nucleic acids may also be administered in vivo by viral means. Nucleic acid molecules encoding fusion proteins may be packaged into retrovirus vectors using packaging cell lines that produce replication- defective retroviruses, as is well-known in the art. Other virus vectors may also be used, including recombinant adenoviruses and vaccinia virus, which can be rendered non-replicating. In addition to naked DNA or RNA, or viral vectors, engineered bacteria may be used as vectors. Nucleic acids may also be delivered by other carriers, including liposomes, polymeric micro- and nanoparticles and poly cations such as asialoglycoprotein/poly Iy sine .
• Nucleic acids such as those described above, can be inserted into vectors for expression in cells.
• a "vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment.
• Vectors can be expression vectors.
• An "expression vector” is a vector that includes one or more expression control sequences, and an “expression control sequence” is a DNA sequence that controls and regulates the transcription and/or translation of another DNA sequence.
• Nucleic acids in vectors can be operably linked to one or more expression control sequences.
• "operably linked” means incorporated into a genetic construct so that expression control sequences effectively control expression of a coding sequence of interest.
• expression control sequences include promoters, enhancers, and transcription terminating regions.
• a promoter is an expression control sequence composed of a region of a DNA molecule, typically within 100 nucleotides upstream of the point at which transcription starts (generally near the initiation site for RNA polymerase II). To bring a coding sequence under the control of a promoter, it is necessary to position the translation initiation site of the translational reading frame of the polypeptide between one and about fifty nucleotides downstream of the promoter.
• Enhancers provide expression specificity in terms of time, location, and level. Unlike promoters, enhancers can function when located at various distances from the transcription site.
• An enhancer also can be located downstream from the transcription initiation site.
• a coding sequence is "operably linked" and “under the control” of expression control sequences in a cell when RNA polymerase is able to transcribe the coding sequence into mRNA, which then can be translated into the protein encoded by the coding sequence.
• Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses, tobacco mosaic virus, herpes viruses, cytomegalo virus, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses.
• plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses, tobacco mosaic virus, herpes viruses, cytomegalo virus, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses.
• Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen Life Technologies (Carlsbad, CA).
• Vectors containing mucleic acids to be expressed can be transferred into host cells.
• the term "host cell” is intended to include prokaryotic and eukaryotic cells into which a recombinant expression vector can be introduced.
• transformed and “transfected” encompass the introduction of a nucleic acid molecule (e.g., a vector) into a cell by one of a number of techniques. Although not limited to a particular technique, a number of these techniques are well established within the art.
• Prokaryotic cells can be transformed with nucleic acids by, for example, electroporation or calcium chloride mediated transformation.
• Nucleic acids can be transfected into mammalian cells by techniques including, for example, calcium phosphate co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, or microinjection.
• Host cells e.g., a prokaryotic cell or a eukaryotic cell such as a CHO cell
• a host cell e.g., an antigen presenting cell
• a host cell e.g., an antigen presenting cell
• Vaccines require strong T cell response to eliminate cancer cells and infected cells.
• the fusion proteins described herein can be administered as a component of a vaccine to provide a costimulatory signal to T cells.
• Vaccines disclosed herein include antigens, a source of fusion proteins, and optionally, adjuvants.
• Antigens can be any substance that evokes an immunological response in a subject.
• Representative antigens include peptides, proteins, polysaccharides, saccharides, lipids, nucleic acids, or combinations thereof.
• the antigen can be derived from a tumor or from a transformed cell such as a cancer or leukemic cell and can be a whole cell or immunogenic component thereof, e.g., cell wall components or molecular components thereof. Suitable antigens are known in the art and are available from commercial sources.
• the antigens may be purified or partially purified polypeptides derived from tumors or other sources.
• the antigens can be recombinant polypeptides produced by expressing DNA encoding the polypeptide antigen in a heterologous expression system.
• the antigens can be DNA encoding all or part of an antigenic protein.
• the DNA may be in the form of vector DNA such as plasmid DNA.
• Antigens may be provided as single antigens or may be provided in combination. Antigens may also be provided as complex mixtures of polypeptides or nucleic acids.
• Fusion proteins Any of the fusion proteins disclosed herein are suitable for use in the immunogenic compositions.
• Sources of fusion proteins include any fusion protein or nucleic acid encoding any fusion protein disclosed herein, or host cells containing vectors that express any of the fusion proteins disclosed herein.
• the fusion proteins may be monomeric, homodimeric, heterodimeric, homomultimeric or heteromultimeric.
• the vaccines described herein may include adjuvants.
• the adjuvant can be, but is not limited to, one or more of the following: oil emulsions (e.g., Freund's adjuvant); saponin formulations; virosomes and viral-like particles; bacterial and microbial derivatives; immuno stimulatory oligonucleotides; ADP-ribosylating toxins and detoxified derivatives; alum; BCG; mineral-containing compositions (e.g., mineral salts, such as aluminium salts and calcium salts, hydroxides, phosphates, sulfates, etc.); bioadhesives and/or mucoadhesives; microparticles; liposomes; polyoxyethylene ether and polyoxyethylene ester formulations; polyphosphazene; muramyl peptides; imidazoquinolone compounds; and surface active substances (e.g.
• Additional adjuvants may also include immunomodulators such as cytokines, interleukins (e.g., IL-I, IL-2, IL-4, IL-5, ⁇ L-6, IL-7, IL- 12, etc.), interferons (e.g., interferon-.gamrna.), macrophage colony stimulating factor, and tumor necrosis factor.
• immunomodulators such as cytokines, interleukins (e.g., IL-I, IL-2, IL-4, IL-5, ⁇ L-6, IL-7, IL- 12, etc.), interferons (e.g., interferon-.gamrna.), macrophage colony stimulating factor, and tumor necrosis factor.
• costimulatory molecules including other polypeptides of the B7 family, may be co-administered.
• proteinaceous adjuvants may be provided as the full-length polypeptide or an active fragment thereof, or in the form of DNA, such as plasm
• compositions including fusion polypeptides disclosed herein are provided.
• Pharmaceutical compositions containing peptides or polypeptides may be for administration by parenteral (intramuscular, intraperitoneal, intravenous (IV) or subcutaneous injection), transdermal (either passively or using iontophoresis or electroporation), or transmucosal (nasal, vaginal, rectal, or sublingual) routes of administration or using bioerodible inserts and can be formulated in dosage forms appropriate for each route of administration.
• the compositions disclosed herein are administered to a subject in a therapeutically effective amount.
• the term "effective amount” or “therapeutically effective amount” means a dosage sufficient to treat, inhibit, or alleviate one or more symptoms of the disorder being treated or to otherwise provide a desired pharmacologic and/or physiologic effect. The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, etc.), the disease, and the treatment being effected.
• Therapeutically effective amounts of the fusion proteins disclosed herein cause an immune response against a tumor or an infectious agent to be activated or sustained.
• Therapeutically effective amounts of the fusion proteins disclosed herein also costimulate the subject's T cells..
• compositions disclosed herein and nucleic acids encoding the same as further studies are conducted, information will emerge regarding appropriate dosage levels for treatment of various conditions in various patients, and the ordinary skilled worker, considering the therapeutic context, age, and general health of the recipient, will be able to ascertain proper dosing.
• the selected dosage depends upon the desired therapeutic effect, on the route of administration, and on the duration of the treatment desired. Generally dosage levels of 0.001 to 10 mg/kg of body weight daily are administered to mammals. Generally, for intravenous injection or infusion, dosage may be lower.
• compositions disclosed herein are administered in an aqueous solution, by parenteral injection.
• the formulation may also be in the form of a suspension or emulsion.
• pharmaceutical compositions are provided including effective amounts of a peptide or polypeptide, and optionally include pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers.
• compositions include diluents sterile water, buffered saline of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic strength; and optionally, additives such as detergents and solubilizing agents (e.g., TWEEN 20, TWEEN 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), and preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol).
• buffered saline of various buffer content e.g., Tris-HCl, acetate, phosphate
• pH and ionic strength e.g., Tris-HCl, acetate, phosphate
• additives e.g., Tris-HCl, acetate, phosphate
• additives e.g., TWEEN 20, TWEEN 80, Poly
• non-aqueous solvents or vehicles examples include propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and com oil, gelatin, and injectable organic esters such as ethyl oleate.
• the formulations may be lyophilized and redissolved/resuspended immediately before use.
• the formulation may be sterilized by, for example, filtration through a bacteria retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions.
• Topical administration does not work well for most peptide formulations, although it can be effective especially if applied to the lungs, nasal, oral (sublingual, buccal), vaginal, or rectal mucosa.
• Compositions can be delivered to the lungs while inhaling and traverse across the lung epithelial lining to the blood stream when delivered either as an aerosol or spray dried particles having an aerodynamic diameter of less than about 5 microns.
• a wide range of mechanical devices designed for pulmonary delivery of therapeutic products can be used, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
• Some specific examples of commercially available devices are the Ultravent nebulizer (Mallinckrodt Inc., St.
• Nektar, Alkermes and Mannkind all have inhalable insulin powder preparations approved or in clinical trials where the technology could be applied to the formulations described herein.
• Formulations for administration to the mucosa will typically be spray dried drug particles, which may be incorporated into a tablet, gel, capsule, suspension or emulsion. Standard pharmaceutical excipients are available from any formulator. Oral formulations may be in the form of chewing gum, gel strips, tablets or lozenges.
• Transdermal formulations may also be prepared. These will typically be ointments, lotions, sprays, or patches, all of which can be prepared using standard technology. Transdermal formulations will require the inclusion of penetration enhancers.
• Controlled delivery polymeric matrices Fusion proteins disclosed herein may also be administered in controlled release formulations.
• Controlled release polymeric devices can be made for long term release systemically following implantation of a polymeric device (rod, cylinder, film, disk) or injection (microparticles).
• the matrix can be in the form of microparticles such as microspheres, where peptides are dispersed within a solid polymeric matrix or microcapsules, where the core is of a different material than the polymeric shell, and the peptide is dispersed or suspended in the core, which may be liquid or solid in nature.
• microparticles, microspheres, and microcapsules are used interchangeably.
• the polymer may be cast as a thin slab or film, ranging from nanometers to four centimeters, a powder produced by grinding or other standard techniques, or even a gel such as a hydrogel.
• Either non-biodegradable or biodegradable matrices can be used for delivery of fusion polypeptides or nucleic acids encoding the fusion polypeptides, although biodegradable matrices are preferred.
• These may be natural or synthetic polymers, although synthetic polymers are preferred due to the better characterization of degradation and release profiles.
• the polymer is selected based on the period over which release is desired. In some cases linear release may be most useful, although in others a pulse release or "bulk release" may provide more effective results.
• the polymer may be in the form of a hydrogel (typically in absorbing up to about 90% by weight of water), and can optionally be crosslinked with multivalent ions or polymers.
• the matrices can be formed by solvent evaporation, spray drying, solvent extraction and other methods known to those skilled in the art.
• Bioerodible microspheres can be prepared using any of the methods developed for making microspheres for drug delivery, for example, as described by Mathiowitz and Langer, J Controlled Release, 5:13-22 (1987); Mathiowitz, et al, Reactive Polymers, 6:275-283 (1987); and Mathiowitz, et ⁇ ., J. Appl. Polymer Set, 35:755-774 (1988).
• the devices can be formulated for local release to treat the area of implantation or injection - which will typically deliver a dosage that is much less than the dosage for treatment of an entire body - or systemic delivery. These can be implanted or injected subcutaneously, into the muscle, fat, or swallowed. VI. Methods of manufacture
• Isolated fusion proteins can be obtained by, for example, chemical synthesis or by recombinant production in a host cell.
• a nucleic acid containing a nucleotide sequence encoding the fusion protein can be used to transform, transduce, or transfect a bacterial or eukaryotic host cell (e.g., an insect, yeast, or mammalian cell).
• nucleic acid constructs include a regulatory sequence operably linked to a nucleotide sequence encoding the fusion protein.
• Regulatory sequences also referred to herein as expression control sequences typically do not encode a gene product, but instead affect the expression of the nucleic acid sequences to which they are operably linked.
• Useful prokaryotic and eukaryotic systems for expressing and producing polypeptides are well know in the art include, for example, Escherichia coli strains such as BL-21 , and cultured mammalian cells such as CHO cells.
• viral-based expression systems can be utilized to express fusion proteins.
• Viral based expression systems are well known in the art and include, but are not limited to, baculoviral, SV40, retroviral, or vaccinia based viral vectors.
• Mammalian cell lines that stably express variant fusion proteins can be produced using expression vectors with appropriate control elements and a selectable marker.
• the eukaryotic expression vectors pCR3.1 (Invitrogen Life Technologies) and p91023(B) (see Wong et at (1985) Science 228 : 810-815) are suitable for expression of variant costimulatory polypeptides in, for example, Chinese hamster ovary (CHO) cells, COS-I cells, human embryonic kidney 293 cells, NIH3T3 cells, BHK21 cells, MDCK cells, and human vascular endothelial cells (HUVEC).
• CHO Chinese hamster ovary
• COS-I cells human embryonic kidney 293 cells
• NIH3T3 cells NIH3T3 cells
• BHK21 cells BHK21 cells
• MDCK cells human vascular endothelial cells
• transfected cells can be cultured such that the polypeptide of interest is expressed, and the polypeptide can be recovered from, for example, the cell culture supernatant or from lysed cells.
• a fusion protein can be produced by (a) Hgating amplified sequences into a mammalian expression vector such as pcDN A3 (Invitrogen Life Technologies), and (b) transcribing and translating in vitro using wheat germ extract or rabbit reticulocyte lysate. Fusion proteins can be isolated using, for example, chromatographic methods such as DEAE ion exchange, gel filtration, and hydroxylapatite chromatography. For example, a costimulatory polypeptide in a cell culture supernatant or a cytoplasmic extract can be isolated using a protein G column. In some embodiments, fusion proteins can be engineered to contain an additional domain containing amino acid sequence that allows the polypeptides to be captured onto an affinity matrix.
• a tag such as c-rayc, hemagglutinin, polyhistidine, or FlagTM (Kodak) can be used to aid polypeptide purification.
• tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus.
• Other fusions that can be useful include enzymes that aid in the detection of the polypeptide, such as alkaline phosphatase.
• Immunoaffinity chromatography also can be used to purify costimulatory polypeptides. Fusion proteins can additionally be engineered to contain a secretory signal (if there is not a secretory signal already present) that causes the fusion protein to be secreted by the cells in which it is produced. The secreted fusion proteins can then conveniently be isolated from the cell media.
• Isolated nucleic acid molecules can be produced by standard techniques, including, without limitation, common molecular cloning and chemical nucleic acid synthesis techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain an isolated nucleic acid encoding a variant costimulatory polypeptide. PCR is a technique in which target nucleic acids are enzymatically amplified. Typically, sequence information from the ends of the region of interest or beyond can be employed to design oligonucleotide primers that are identical in sequence to opposite strands of the template to be amplified.
• PCR polymerase chain reaction
• PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA.
• Primers typically are 14 to 40 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length.
• General PCR techniques are described, for example in PCR Primer: A Laboratory Manual, ed. by Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995.
• reverse transcriptase can be used to synthesize a complementary DNA (cDNA) strand.
• Ligase chain reaction, strand displacement amplification, self-sustained sequence replication or nucleic acid sequence- based amplification also can be used to obtain isolated nucleic acids. See, for example, Lewis (1992) Genetic Engineering News 12:1 ; Guatelli et al. (1990) Proc. Natl Acad ScL USA 87:1874-1878; and Weiss (1991) Science 254:1292-1293.
• Isolated nucleic acids can be chemically synthesized, either as a single nucleic acid molecule or as a series of oligonucleotides (e.g., using phosphoramidite technology for automated DNA synthesis in the 3' to 5' direction).
• oligonucleotides e.g., >100 nucleotides
• one or more pairs of long oligonucleotides can be synthesized that contain the desired sequence, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex is formed when the oligonucleotide pair is annealed.
• DNA polymerase can be used to extend the oligonucleotides, resulting in a single, double-stranded nucleic acid molecule per oligonucleotide pair, which then can be ligated into a vector.
• Isolated nucleic acids can also obtained by mutagenesis.
• Fusion protein-encoding nucleic acids can be mutated using standard techniques, including oligonucleotide-directed mutagenesis and/or site-directed mutagenesis through PCR. See, Short Protocols in Molecular Biology. Chapter 8, Green Publishing Associates and John Wiley & Sons, edited by Ausubel et al, 1992. Examples of amino acid positions that can be modified include those described herein. VII. Methods of use
• the fusion proteins disclosed herein, nucleic acids encoding the fusion proteins, or cells expressing the fusion proteins can be used to activate T cells (i.e., increase antigen-specific proliferation of T cells, enhance cytokine production by T cells, stimulate differentiation and effector functions of T cells and/or promote T cell survival).
• Methods for using fusion proteins to activate T cell responses are disclosed herein.
• the methods include contacting a T cell with any of the molecules disclosed herein.
• Fusion proteins are a preferred example.
• the fusion protein or fusion protein dimer or multimer can be any of those described herein, including any of the disclosed amino acid alterations, polypeptide fragments, and combinations thereof.
• variant costimulatory polypeptides used in the fusion proteins can have reduced or increased binding to coinhibitory receptors (i.e. PD-I) relative to wild type costimulatrory polypeptides, yet retain the ability to costimulate T cells.
• Preferred variant costimulatory polypeptides have a enhanced ability to stimulate signaling through and activating receptor compared to a non- variant costimulatory polypeptide.
• the contacting can be in vitro, ex vivo, or in vivo (e.g., in a mammal such as a mouse, rat, rabbit, dog, cow, pig, non-human primate, or a human).
• fusion proteins are administered to contact T cells in vivo.
• the contacting can occur before, during, or after activation of the T cell.
• contacting of the T cell with fusion protein can be at substantially the same time as activation.
• Activation can be, for example, by exposing the T cell to an antibody that binds to the T cell receptor (TCR) or one of the polypeptides of the CD3 complex that is physically associated with the TCR.
• TCR T cell receptor
• a T cell can be exposed to either an alloantigen (e.g., a MHC alloantigen) on, for example, an APC [e.g., an interdigitating dendritic cell (referred to herein as a dendritic cell), a macrophage, a monocyte, or a B cell] or an antigenic peptide produced by processing of a protein antigen by any of the above APC and presented to the T cell by MHC molecules on the surface of the APC.
• the T cell can be a CD4 + T cell or a CD8 + T cell.
• the fusion proteins can be bound to the floor of a relevant culture vessel, e.g. a well of a plastic microtiter plate.
• a relevant culture vessel e.g. a well of a plastic microtiter plate.
• fusion proteins disclosed herein can be added to in vitro assays (e.g., T cell proliferation assays) designed to test for immunity to an antigen of interest in a subject from which the T cells were obtained. Addition of fusion proteins to such assays would be expected to result in a more potent, and therefore more readily detectable, in vitro response.
• fusion proteins disclosed herein or nucleic acids encoding them can be used: (a) as a positive control in an assay to test for costimulatory activity in other molecules; or (b) in screening assays for compounds useful in inhibiting T costimulation (e.g., compounds potentially useful for treating autoimmune diseases or organ graft rejection).
• T costimulation e.g., compounds potentially useful for treating autoimmune diseases or organ graft rejection.
• the fusion proteins provided herein are generally useful in vivo and ex vivo as immune response-stimulating therapeutics.
• the fusion proteins are particularly useful in vivo for the induction of tumor immunity and immunity to agents that cause infectious diseases.
• the fusion proteins disclosed herein contain a domain that binds to an antigen, ligand, or receptor on tumors or tumor- associated neovasculature in the local tumor environment.
• the tumor or tumor-associated neovasculature binding domain functions to effectively target the fusion proteins to the local tumor microenv ⁇ ronment, where they can specifically enhance the activity of tumor-infiltrating effector T cells.
• the fusion proteins disclosed herein contain a domain that binds to an antigen, ligand or receptor on cells in tissues involved in regulating immune cell activation in response to infectious disease causing agents. Targeting the fusion proteins to tissues involved in immune cell activation allows for efficient activation of T cells and can cause local activation of T cell, resulting in long term immunity.
• Non-specific activation of the immune system refers to activation of T cells or other immune cells that do not specifically recognize antigens expressed by a tumor or an infectious disease causing agent to be treated or are not involved directly or indirectly in the anti-tumor or anti-infection response.
• Non-specific activation of the immune response can lead to the development of inflammatory disorders and autoimmunity.
• Fusion proteins can be administered as monomers or as dimers or multimers. Dimers and multimers can be homodimers/homomultimers or heterodimers/heteromultimers as described above. In a preferred embodiment, fusion proteins are administered as dimers or multimers. Administration of fusion proteins as dimers or multimers increases the valency of the fusion proteins. The increase in valency can result in an increase in the avidity of the fusion protein for its target antigen(s), receptor(s) or ligand(s) on the tumor, tumor-associated neovasculature, or tissue involved in immune cell activation, and thereby increase its retention in the tumor microenvironment or in the immune-regulating tissue. Increasing the valency of the fusion proteins can also increase their ability to cross-link costimulatory receptors on T cells. 1. Induction of tumor immunity
• TIL tumor-infiltrating, antigen specific cytotoxic T lymphocytes
• compositions increase or augment the functional immune response against a tumor relative to a control by costimulating T cells or by inhibiting or reducing inhibitory signals to T cells in a subject.
• compositions are formulated to increase the number or functional activity of tumor-infiltrating, antigen specific cytotoxic T lymphocytes (TILs) in a subject in need thereof.
• TILs tumor-infiltrating, antigen specific cytotoxic T lymphocytes
• One embodiment provides a method for increasing the activation of tumor-infiltrating leukocytes in a subject by administering to the subject an effective amount of a fusion protein disclosed herein or a nucleic acid encoding the same to activate the subject's T cells and/or to inhibit or reduce coinhibition of the subject's T cells.
• Another embodiment provides a method for increasing the population of tumor-infiltrating leukocytes in a subject by administering to the subject an effective amount of a fusion protein disclosed herein or a nucleic acid encoding the same to costimulate the subject's T cells and/or to inhibit or reduce coinhibition of the subject's T cells.
• Another embodiment provides a method for stimulating or augmenting an effective anti-tumor T cell response by administering to the subject an effective amount of a fusion protein disclosed herein or a nucleic acid encoding the same to activate the subject's T cells and/or to inhibit or block inhibition of the subject's T cells.
• Malignant tumors which may be treated are classified herein according to the embryonic origin of the tissue from which the tumor is derived.
• Carcinomas are tumors arising from endodermal or ectodermal tissues such as skin or the epithelial lining of internal organs and glands.
• Sarcomas which arise less frequently, are derived from mesodermal connective tissues such as bone, fat, and cartilage.
• the leukemias and lymphomas are malignant tumors of hematopoietic cells of the bone marrow. Leukemias proliferate as single cells, whereas lymphomas tend to grow as tumor masses. Malignant tumors may show up at numerous organs or tissues of the body to establish a cancer.
• the types of cancer that can be treated in with the provided compositions and methods include, but are not limited to, the following: bladder, brain, breast, cervical, colo-rectal, esophageal, kidney, liver, lung, nasopharangeal, pancreatic, prostate, skin, stomach and uterine.
• Administration is not limited to the treatment of an existing tumor or infectious disease but can also be used to prevent or lower the risk of developing such diseases in an individual, i.e., for prophylactic use.
• Potential candidates for prophylactic vaccination include individuals with a high risk of developing cancer, i.e., with a personal or familial history of certain types of cancer.
• fusion proteins in vaccines
• the fusion proteins disclosed herein, and/or nucleic acids encoding the same may be administered alone or in combination with any other suitable treatment.
• fusion proteins, and/or nucleic acids encoding the same may be administered in conjunction with, or as a component of, a vaccine composition. Suitable components of vaccine compositions are described above.
• Fusion protein compositions described herein can be administered prior to, concurrently with, or after the administration of a vaccine. In one embodiment the fusion protein composition is administered at the same time as administration of a vaccine.
• the fusion proteins described herein may be administered in conjunction with prophylactic vaccines, which confer resistance in a subject to development of certain types of tumors, or in conjunction with therapeutic vaccines, which can be used to initiate or enhance a subject's immune response to a pre-existing antigen, such as a tumor antigen in a subject already having cancer.
• a prophylactic or therapeutic immune response may vary according to the disease, according to principles well known in the art.
• an immune response against cancer may completely treat the cancer or infectious disease, may alleviate symptoms, or may be one facet in an overall therapeutic intervention against the cancer or infectious disease.
• the disclosed fusion protein compositions can be administered alone or in combination with one or more additional therapeutic agents.
• the stimulation of an immune response against a cancer may be coupled with surgical, chemotherapeutic, radiologic, hormonal and other immunologic approaches in order to affect treatment.
• the disclosed fusion proteins can be administered with an antibody or antigen binding fragment thereof specific for growth factor receptors or tumor specific antigens.
• Representative growth factors receptors include, but are not limited to, epidermal growth factor receptor (EGFR; HERl ); c-erbB2 (HER2); c-erbB3 (HER3); c-erbB4 (HER4); insulin receptor; insulin-like growth factor receptor 1 (IGF-IR); insulin-like growth factor receptor 2/Mannose-6-phosphate receptor (IGF-II R/M-6-P receptor); insulin receptor related kinase (IRRK); platelet-derived growth factor receptor (PDGFR); colony-stimulating factor- 1 receptor (CSF-IR) (c-Fms); steel receptor (c-Kit); Flk2/Flt3; fibroblast growth factor receptor 1 (Flg/Cekl); fibroblast growth factor receptor 2 (Bek/Cek3/K-Sam); Fibroblast growth factor receptor 3; Fibroblast growth factor e
• Additional therapeutic agents include conventional cancer therapeutics such as chemotherapeutic agents, cytokines, chemokines, and radiation therapy.
• chemotherapeutic agents such as chemotherapeutic agents, cytokines, chemokines, and radiation therapy.
• the majority of chemolherapeutic drugs can be divided into: alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents. All of these drugs affect cell division or DNA synthesis and function in some way.
• Additional therapeutics include monoclonal antibodies and the tyrosine kinase inhibitors e.g. imatinib mesylate (GLEEVEC® or GLIVEC®), which directly targets a molecular abnormality in certain types of cancer (chronic myelogenous leukemia, gastrointestinal stromal tumors).
• chemotherapeutic agents include, but are not limited to cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, vincristine, vinblastine, vinorelbine, vindesine, taxol and derivatives thereof, irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, epipodophyllotoxins, trastuzumab (HERCEPTIN®), cetuximab, and rituximab (RITUXAN® or MABTHERA®), bevacizumab (AVASTIN®), and combinations thereof.
• P815 mastocytoma cells were derived from DBA/2 mice after methylcholanthrene (MCA) treatment. Injection of 5 x 10 4 cells SC can result in mortality approximately 35 days post tumor inoculation.
• mice (6 - 10 weeks of age, females) were first challenged with 5 x 10 4 live P815 cells injected SC in the flank. Six days later, the mice were treated with murine B7-DC-Ig via IP injection.
• the dosing regimen shown in Figure 1, was 100 ⁇ g of murine B7-DC-Ig per injection (approximately 5 mg/kg), 2 times per week, up to 6 doses.
• Control groups were treated with vehicle only or with murine IgG. Tumor size was measured with digital calipers every 2 TM 3 days.
• mice were euthanized and defined as dead when their tumor size reached or exceeded 1000 mm 3 , according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the American Red Cross (ARC; the site of Amplimmune's vivarium). Surviving tumor free mice were re-challenged with P815 tumor cells on Day 52.
• IACUC Institutional Animal Care and Use Committee
• mice treated with vehicle or control mouse IgG required euthanasia by Day 38 because their tumor volumes reached the IACUC limit.
• Figures 2A-C show tumor eradication in mice using murine B7-DC- Ig.
• the tumor-free mice were then re-challenged with 5 * 1O 4 PSl 5 cells administered to the flank opposite the primary inoculation site on Day 52.
• the mice remained tumor free through 74 days after the primary inoculation, while all na ⁇ ve mice challenged with P 815 cells developed tumors. This suggests that mice inoculated with P815 cells and treated with murine B7- DC-Ig developed long-term immunity against P815 mastocytoma.
• Example 2 Combination of cyclophosphamide and B7-DC-Ig can eradicate established tumors.
• Balb/C mice at age of 9 to 11 weeks were implanted subcutaneously with 1.0 x 105 CT26 colorectal tumor cells.
• mice received 100 mg/kg of cyclophosphamide.
• B7-DC-Ig treatment started 1 day later, on day 11. Mice were treated with 100 ug of B7-DC-Ig, 2 doses per week, for 4 weeks and total 8 doses.
• Combination of cyclophosphamide and B7-DC-Ig can eradicate established tumors and protect against tumor re-challenge.
• Combination of cyclophosphamide and B7-DC-Ig can generate tumor specific, memory cytotoxic T lymphocytes
• mice eradiated established CT26 colorectal tumors from the above described experiment were rechallenged with 2.5x105 CT26 cells on Day 44. Seven days later, mouse spleens were isolated. Mouse splenocytes were pulsed with 5 or 50 ug/mL of ovalbumin (OVA) or AHl peptides for 6 hours in the presence of a Golgi blocker (BD BioScience). Memory T effector cells were analyzed by assessing CD8+/IFND+ T cells. Results in Figure 5 show that there were significant amount of CT26 specific T effector cells in the CT26 tumor-eradicated mice.
• OVA ovalbumin
• AHl peptides AHl peptides
• Example 5 Combination of cyclophosphamide and B7-DC-Ig Regimen Leads to Reduction of Tregs in the Tumor Microenvironment
• Figure 6 shows the results of experiments wherein Balb/C mice at age of 9 to 11 weeks of age were implanted with 1 X 105 CT26 cells subcutaneously. On Day 9, mice were injected with 100 rng/kg of CTX, IP. Twenty four hours later, on Day 10, mice were treated with 100 ug of B7-DC-Ig. There were 5 groups: na ⁇ ve mice that did not receive any tumor cells, vehicle injected, CTX alone, CTX + B7-DC-Ig or B7-DC-Ig alone.
• mice and 4 mice from other groups were removed from the study on Day 11 (2 days post CTX) and Day 16 (7 days post CTX) for T cell analysis.
• Left panel shows on Day 11, 2 days post CTX injection, Treg in the spleen of the mice with CTX treatment was significantly lower than the one in the mice with tumor implantation and injected with vehicle.
• Right panel shows that on Day 16, 7 days post CTX and 6 days post B7-DC-Ig treatment, B7-DC-Ig significantly lowered the CD4+ T cells expressing high PD-I . This was observed in both the B7-DC-Ig treated and CTX + B7-DC-Ig treated mice. Mice implanted with tumor cells intended to have more PD-1+/CD4+ T cells in the draining LN compared with na ⁇ ve mice.
• Example 6 Combination of cyclophosphamide and B7-DC-Ig can promote mouse survival in a metastatic prostate lung tumor model
• B10.D2 mice at age of 9 to 11 weeks were injected intravenously with 3.0 x 105 SP-I mouse prostate tumor cells, which were isolated from lung metastasis post parent TRAMP prostate tumor cell injection.
• the CTX mice received 3 doses of CTX, 50 mg/kg, on Day 5, 12 and 19.
• the B7-DC-Ig treated mice received 3 doses of B7-DC-Ig, 5 mg/kg, on Day 6, 13 and 20.
• Combination of Listeria cancer vaccine and B7-DC-Ig can enhance mouse survival post CT26 liver implantation
• mice at age of 11-13 weeks were implanted with CT26 cells using a hemispleen injection technique (Yoshimura K et al., 2007, Cancer Research).
• mice received 1 injection of CTX at 50 mg/kg, IP.
• mice were treated with recombinant Listeria carrying AHl peptide, an immunodominant epitope of CT26, at 0.1 LD 50 (1x107 CFU), then on Day 14 and 17.
• Mice were also treated with B7-DC-Ig on Day 11 and then on Day 18.
• Figire 8 shows mice without any treatment or treated with CTX and Listeria cancer vaccine all died before Dady 45. There were 60% of the mice received triple combination, CTX + Listeria cancer vaccine and B7-DC-Ig survived.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Immunology (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Zoology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Virology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Gastroenterology & Hepatology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Oncology (AREA)
• Toxicology (AREA)
• Communicable Diseases (AREA)
• Epidemiology (AREA)
• Biomedical Technology (AREA)
• Cell Biology (AREA)
• Biotechnology (AREA)
• Microbiology (AREA)
• General Engineering & Computer Science (AREA)
• Tropical Medicine & Parasitology (AREA)
• Wood Science & Technology (AREA)
• Mycology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Endocrinology (AREA)
• AIDS & HIV (AREA)

Priority Applications (3)

Applications Claiming Priority (12)

Publications (2)

Family

ID=41349286

Family Applications (3)

Family Applications Before (1)

Family Applications After (1)

Country Status (13)

Cited By (726)