WO2009017878A2 - High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification - Google Patents

High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification Download PDF

Info

Publication number
WO2009017878A2
WO2009017878A2 PCT/US2008/065286 US2008065286W WO2009017878A2 WO 2009017878 A2 WO2009017878 A2 WO 2009017878A2 US 2008065286 W US2008065286 W US 2008065286W WO 2009017878 A2 WO2009017878 A2 WO 2009017878A2
Authority
WO
WIPO (PCT)
Prior art keywords
probe
signal
target
nucleic acid
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/065286
Other languages
English (en)
French (fr)
Other versions
WO2009017878A3 (en
WO2009017878A9 (en
Inventor
Fang Wei
Bernhard G. Zimmermann
David T. W. Wong
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=40305157&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2009017878(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to US12/601,774 priority Critical patent/US20100248231A1/en
Priority to EP08826854.5A priority patent/EP2158482B1/en
Priority to CN200880101316A priority patent/CN101849185A/zh
Priority to JP2010510514A priority patent/JP5389789B2/ja
Priority to CA2688155A priority patent/CA2688155C/en
Publication of WO2009017878A2 publication Critical patent/WO2009017878A2/en
Publication of WO2009017878A9 publication Critical patent/WO2009017878A9/en
Publication of WO2009017878A3 publication Critical patent/WO2009017878A3/en
Anticipated expiration legal-status Critical
Priority to US13/462,709 priority patent/US20130115594A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/682Signal amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6825Nucleic acid detection involving sensors
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/558Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/30Oligonucleotides characterised by their secondary structure
    • C12Q2525/301Hairpin oligonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/131Nucleic acid detection characterized by the use of physical, structural and functional properties the label being a member of a cognate binding pair, i.e. extends to antibodies, haptens, avidin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10Detection mode being characterised by the assay principle
    • C12Q2565/102Multiple non-interacting labels
    • C12Q2565/1025Multiple non-interacting labels labels being on the same oligonucleotide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10Detection mode being characterised by the assay principle
    • C12Q2565/107Alteration in the property of hybridised versus free label oligonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/50Detection characterised by immobilisation to a surface
    • C12Q2565/501Detection characterised by immobilisation to a surface being an array of oligonucleotides

Definitions

  • the present invention relates to nucleic acid probes and assay methods.
  • One of the requirements for point-of-care detection is to detect a small amount of a target molecule in a mixture. Detection of low number count target needs high sensitivity together with high specificity due to the complexity of any mixture.
  • prior art detection methods require a compromise between specificity and sensitivity.
  • Several techniques are developed to obtain the signal amplification, which helps to increase the sensitivity.
  • the signal intensity relates to the number of target within the detecting region, usually very small comparing to the whole sample volume. Hence either amplifying the amount of target in the whole sample volume or accumulating the target into a small detection region helps to high signal intensity.
  • the first method increases the total number of the target, probe and/or signal, thus brings out a high intensity measurement output.
  • PCR Primed in situ labeling
  • NASBA nucleic acid sequence-based amplification
  • LCR Ligase chain reaction
  • RCA rolling circle amplification
  • Branched DNA (bDNA) and tyramide signal amplification (TSA) result in the signal amplification.
  • bDNA Branched DNA
  • TSA tyramide signal amplification
  • the second method focuses on increasing the local concentration of target instead of creating more copies of the target.
  • nanotechnology can concentrate the few copies of the target within the sample into a detection region by applying nano-particle based techniques. Increase of both the whole amount and the local concentration of target results in high sensitivity. However, it would also produce a higher background level and more false-positive results since both the specific and non-specific signals would be amplified.
  • the present invention generally relates to probes and assay methods.
  • the present invention provides a probe for detecting a target nucleic acid molecule.
  • the probe comprises two parts: a polynucleotide sequence that specifically hybridizes to the sequence of the target nucleic acid molecule, and a ligand for a receptor.
  • the probe has a first three-dimensional structure when no target nucleic acid molecule is bound to the probe and a second three-dimensional structure the target nucleic acid is bound to the probe.
  • the first three-dimensional structure inhibits or prevents the receptor from binding the ligand, whereas the second three-dimensional structure allows the receptor to specifically bind the ligand.
  • the receptor comprises a detectable label, i.e., a moiety that imparts a detectable signal.
  • the detectable signal is amplified, such as by an enzymatic reaction.
  • the first three-dimensional structure sterically hinders the receptor from binding the ligand.
  • the probe is immobilized on a substrate or a solid support.
  • the first-three dimensional structure places the ligand at a position near the substrate such that the receptor is inhibited or prevented from binding the ligand.
  • the receptor is an antibody that specifically binds the ligand.
  • the detectable label is fluorescein, streptavidin, or biotin, and the like.
  • the detection signal from the detectable label may be amplified by way of enzymatic reactions catalyzed by peroxidase, laccase, glucose oxidase, alkaline phosphatease, or urease, and the like.
  • the probe is a hairpin probe or a quadruplex probe.
  • the present invention provides a method for assaying a target nucleic acid molecule in a sample.
  • the method comprises contacting an above-described probe with the sample in the presence of a receptor, and then detecting the presence or absence of a complex between the ligand and the receptor.
  • the probe of this invention comprises a polynucleotide sequence (capable of specifically hybridizing to the sequence of the target nucleic acid molecule) and a ligand (capable of binding to the receptor), and has a first three-dimensional structure when no target nucleic acid molecule is bound to the probe and a second three-dimensional structure the target nucleic acid is bound to the probe.
  • the first three-dimensional structure inhibits or prevents the receptor from binding the ligand, whereas the second three-dimensional structure allows the receptor to specifically bind the ligand.
  • the presence of the complex between the ligand and the receptor indicates the presence of the target nucleic acid molecule in the sample whereas the absence of the complex indicates the absence of the target nucleic acid molecule in the sample.
  • the receptor is a detectable label capable of imparting a detection signal.
  • the detectable signal is amplified.
  • the first three- dimensional structure sterically hinders the receptor from binding the ligand.
  • the probe is immobilized on a substrate.
  • the first-three dimensional structure places the ligand at a position near the substrate such that the receptor is inhibited or prevented from binding the ligand.
  • the receptor is an antibody which specifically binds the ligand.
  • the detectable label is fluorescein, streptavidin or biotin, and the like.
  • the detection signal from the detectable label may be amplified by the use of peroxidase, laccase, glucose oxidase, alkaline phosphatease or urease, and the like in an enzymatic reaction.
  • the probe is a hairpin probe or a quadruplex probe.
  • any receptor unbound to the ligand is removed prior to detecting the complex.
  • the invention provides a method to detect very low concentrations of a biomarker in a "dirty" sample (with high concentrations of contaminants and molecules that interfere with signal detection), such as saliva. It will have applications for situations where high quality sample preparation is not available or too expensive, such as point-of-care, and situations where biomarker concentration is very low compare to contaminants and inferring compounds (interferents). Feasibility data for low concentration detection is presented in an oral cancer mRNA biomarker, IL8.
  • the probes are "ready-to-use," for instance, the probes are pre-anchored on surface and no other treatment during detection is required.
  • the probes are oligonucleotides or aptamers, which are biocompatible.
  • the probes of the present invention may be readily employed in multiplex applications and do not require expensive instruments and complicated data analysis.
  • the read-out signal can be any suitable signal known in the art such as electrochemical signals, fluorescence signals, and the like.
  • the probes of the present invention reduce or eliminate false positive results over the prior art as prior art methods are not selective to the complementary and non- complementary targets, which results in false positive results.
  • the steric hindrance effect to the probe design increases the specificity.
  • the probes of the present invention also reduce or eliminate false negative results over the prior art as prior art methods with high specificity results in signal decrease, which generates false negative results. Specific signal amplification was applied to increase the signal intensity thereby improving the sensitivity.
  • the probes and methods of the present invention may be used for clinical detection for biomarkers in blood, serum, urine and saliva samples, for example, salivary mRNA detection with original saliva and in vivo monitoring of the early stage of a disease.
  • the probes and methods of the present invention may be employed in multiplexed detection, e.g., a microarray comprising a plurality of probes according to the present invention, which are specific for different target nucleic acid molecules.
  • the probes of the present invention may be reused as the switch between different states of probes is reversible, such that the sensor is reusable.
  • the shape and size of the receptor and/or label bound thereto is optimized for the steric hindrance effect, e.g., a large receptor and/or label would be more sensitive to the steric hindrance than a relatively small receptor and/or label.
  • the present invention relates to a probe for a target nucleic acid molecule.
  • the probe comprises a polynucleotide sequence (which specifically hybridizes to the sequence of the target nucleic acid molecule, e.g., IL-8 mRNA or DNA sequence) and a ligand for a receptor.
  • This probe has a first three-dimensional structure in the absence of the target nucleic acid molecule being bound to the probe, and a second three-dimensional structure in the presence of the target nucleic acid being bound to the probe.
  • the first three- dimensional structure inhibits or prevents the receptor from binding the ligand whereas the second three-dimensional structure allows the receptor to specifically bind the ligand.
  • the probe comprises a polynucleotide sequence that is complementary or substantially complementary to the target sequence.
  • substantially complementary refers to a sequence which specifically hybridizes to a sequence under moderate, preferably stringent, hybridization conditions.
  • Figure 1 schematically illustrates an embodiment of the assay method of the present invention.
  • Figure 2 shows the influence of probe structure with hairpin probes according to the present invention.
  • Figure 3 shows the limit of detection for mRNA with linear probes and hairpin probes.
  • FIG 4 schematically illustrates the specific signal amplification in electrochemical detection with hairpin probe.
  • hairpin When no target bound to hairpin probe, hairpin is closed and HRP cannot form an effective complex on the surface, therefore no signal is observed. After hybridized with target, the hairpin open up and the HRP complex is formed. Then TMB keeps regenerating the reduced HRP, which amplifies the current signal.
  • Figure 5 is a graph showing the cross-detection of with two sets salivary RNA applying hairpin probe: IL-8 and S100A8.
  • the RNA target level is 5 nM for IL-8 and 7 nM for S100A8.
  • the blank signal is 6xSSC and 10 mM MgC ⁇ . Mean and standard deviation of experiments performed 4 times are shown.
  • Figure 6 graphically compares detection with IL-8 hairpin probes with different linkers.
  • the hairpin is closed in blank control and open up with RNA sample.
  • the concentration of IL-8 RNA is 50 nM.
  • the blank control is 6xSSC and 10 mM MgC ⁇ . Mean and standard deviation of experiments performed 4 times are shown.
  • the configurations of the hairpin probes with different linker length are shown schematically.
  • Figure 7 graphically compares detection with IL-8 hairpin probes with different stem-loop structure.
  • the hairpin is closed in blank control and open up with RNA sample. Sequences with underlines are complementary to the target RNA. Sequences in italic are the stem parts. Sequences in bold are the loop parts.
  • HPl 10 bp in stem and 41 bp in duplex.
  • HP2 8 bp in stem and 34 bp in duplex.
  • HP3 6 bp in stem and 27 bp in duplex.
  • the concentration of IL-8 RNA is 50 nM.
  • the blank control is 6xSSC and 10 mM MgCl 2 . Mean and standard deviation of experiments performed 4 times are shown.
  • Figure 8 shows salivary RNA detection compared between linear and hairpin probe.
  • IL-8 Linear probes are IL-8 CP and IL-8 DP and hairpin probe is IL-8 HP as listed in Table 2
  • S100A8 Linear probes are S100A8 CP and S100A8 DP and hairpin probe is S100A8 HP as listed in Table 2.
  • Figure 9 shows electrochemical detection of spiked saliva with IVT RNA. Circle: (a) IL8; (b) S100A8.
  • the saliva sample is whole saliva from the same batch of the same person without any treatment.
  • Figure 10 depicts structures of linkages between the labeling molecules and oligonucleotides.
  • FIG. 11 Cross-detection with two sets of IVT RNA applying HP: IL-8 and S100A8.
  • (l)-(4) applied HPs for S100A8 and the targeting RNA were (1) 7 nM S100A8, (2) 500 nM IL-8, (3) 5 nM IL-8, and (4) buffer only, respectively.
  • (5)-(8) used HPs for IL-8, and the targeting RNA were (5) 5 nM IL- 8, (6) 700 nM S100A8, (7) 7 nM S100A8, and (8) buffer only, respectively.
  • FIG. 12 Salivary IL-8 RNA detection by the linear probe (LP) and HP. LPs were IL-8 CP and IL-8 DP, and HP was IL-8 HP as listed in Table 3. Blank control signals were subtracted from the measured signals. Mean and standard deviation of four experiments are shown. The data point of the 4 fM target for LP is not displayed, because its value was below that of the blank control. [0035] Figure 13 Correlation between amperometric signals using HP and concentrations determined by qPCR of IL-8 mRNA for the same set of clinical saliva samples. The R 2 for linear regression was 0.99.
  • target recognition specificallyity
  • signal amplification sensitivity
  • target recognition specificallyity
  • signal amplification sensitivity
  • amplification and recognition are both specific. Only the specific binding of target will cause signal amplification. Non-specific binding of other interferents (contaminants and other molecules in the sample to be assayed) contribute significantly less to the measured signal. Therefore, noise level is suppressed and only the target signal is amplified.
  • target is used interchangeably with “target nucleic acid molecule”.
  • a "target" nucleic acid molecule may be any nucleic acid molecule, the presence and/or amount of which is desired to be known.
  • the sequence of the target nucleic acid molecule is known.
  • the sequence of the target nucleic acid molecule may be a sequence that is suspected of having alterations, i.e. differences, from a reference nucleic acid sequence.
  • the sequence of the target nucleic acid molecule may or may not be known, and the "reference nucleic acid sequence" is a known nucleic acid sequence to which the sequence of the target nucleic acid molecule may be compared.
  • the alteration in the target nucleic acid molecule may be in a single nucleotide base or more than a single nucleotide base.
  • Such an alteration may be a known polymorphic alteration, such as a single nucleotide polymorphism.
  • nucleic acid molecule As used herein, “nucleic acid molecule”, “polynucleotide”, and “oligonucleotide” are used interchangeably to refer DNA and RNA molecules of natural or synthetic origin which may be single-stranded or double-stranded, and represent the sense or antisense strand.
  • the nucleic acid molecules of the present invention may contain known nucleotide analogs or modified backbone residues or linkages, and any substrate that can be incorporated into a polymer by DNA or RNA polymerase.
  • the nucleic acid molecule of the present invention is isolated.
  • isolated refers to a nucleic acid molecule that is isolated from its native environment.
  • An “isolated” nucleic acid molecule may be substantially isolated or purified from the genomic DNA of the species from which the nucleic acid molecule was obtained.
  • An “isolated” polynucleotide may include a nucleic acid molecule that is separated from other DNA segments with which the nucleic acid molecule is normally or natively associated with at the 5' end, 3' end, or both.
  • the nucleic acid molecules of the present invention may be in its native form or synthetically modified.
  • the nucleic acid molecules of the present invention may be single- stranded (coding or antisense) or double -stranded, and may be DNA (genomic, cDNA or synthetic) or RNA molecules.
  • RNA molecules include mRNA molecules, which contain introns and correspond to a DNA molecule in a one-to-one manner, and mRNA molecules, which do not contain introns.
  • the nucleic acid molecules of the present invention may be linked to other nucleic acid molecules, support materials, reporter molecules, quencher molecules, or a combination thereof.
  • nucleic acid molecules include promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA or PCR protocol. In some embodiments of the present invention, nucleic acid sequences comprising a nucleic acid molecule described herein are contemplated.
  • nucleic acid molecules of the present invention may be readily prepared by methods known in the art, for example, directly synthesizing the nucleic acid sequence using methods and equipment known in the art such as automated oligonucleotide synthesizers, PCR technology, recombinant DNA techniques, and the like.
  • the nucleic acid molecules of the present invention may contain a label.
  • a wide variety of labels and conjugation techniques are known by those skilled in the art and may be used in various nucleic acid and amino acid assays employing the nucleic acid molecules of the present invention.
  • a "label” or a “detectable label” is a composition or molecule that produces a signal detectable by methods known in the art including radiography, fluorescence, chemiluminescence, enzymatic activity, absorbance, and the like.
  • Detectable labels include radioisotopes, fluorophores, chromophores, enzymes, dyes, metal ions, ligands such as biotin, avidin, strepavidin and haptens, quantum dots, and the like.
  • a "labeled" nucleic acid molecule comprises a bound label such that the presence of the nucleic acid molecule may be detected by detecting the presence of the label bound to thereto.
  • the label may be bound to the nucleic acid molecule via a covalent bond, such as a chemical bond, or a noncovalent bond, such as ionic, van der Waals, electrostatic, or hydrogen bonds.
  • Methods known in the art for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides may be used and include oligolabeling, nick translation, end-labeling or PCR amplification using a labeled nucleotide, and the like, preferably end-labeling.
  • Suitable labels that may be used include radionucleotides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • nucleic acid probe refers to a nucleic acid molecule that is capable of binding to a target nucleic acid molecule having a sequence that is complementary to the sequence of the nucleic acid probe.
  • a probe may include natural or modified bases known in the art. See e.g. MPEP 2422, 8th ed.
  • the nucleotide bases of the probe may be joined by a linkage other than a phosphodiester bond, so long as the linkage does not interfere with the ability of the nucleic acid molecule to bind a complementary nucleic acid molecule.
  • the probe may bind a target sequence that is less than 100% complementary to the probe sequence and such binding depends upon the stringency of the hybridization conditions.
  • the presence or absence of the probe may be detected to determine the presence or absence of a target sequence or subsequence in a sample.
  • the probe may contain a detectable label.
  • a "ligand” refers to a molecule that binds to another molecule, i.e., a "receptor.”
  • a "receptor” for example, an antigen binding to an antibody, oligonucleotides that hybridize to complimentary oligonucleotides, a hormone or neurotransmitter binding to a receptor, or a substrate or allosteric effector binding to an enzyme and include natural and synthetic biomolecules, such as proteins, polypeptides, peptides, nucleic acid molecules, carbohydrates, sugars, lipids, lipoproteins, small molecules, natural and synthetic organic and inorganic materials, synthetic polymers, and the like.
  • a "receptor” is a molecule that specifically binds a given ligand.
  • binding or “specific interaction” between two molecules means that a given ligand and its receptor bind or interact with each other with specificity sufficient to differentiate from the binding of or interaction with other components or contaminants in a given sample.
  • the phrase "selectively (or specifically) hybridizes to” refers to the binding, duplexing, or hybridizing of a nucleic acid molecule to a particular nucleotide sequence over other nucleotide sequences under stringent hybridization to moderate hybridization conditions.
  • a positive signal is at least about 2 times, preferably about 5 times, more preferably about 10 times the background hybridization.
  • Stringent hybridization conditions are about 5 0 C below the thermal melting temperature (T m ) of the probe to about 10 0 C below T m .
  • Moderate hybridization conditions are about 10 0 C below the thermal melting temperature (T m ) of the probe to about 20 0 C to about 25 0 C below T m .
  • High sensitivity In order to increase the sensitivity, signal amplification based on sandwich detection is applied.
  • the fundamental concept of sandwich amplification is the application of a mediator to form sandwich-like complex, with a purpose of amplifying the signal.
  • a complex forms between reporter labeled probe and mediator before detection.
  • the excess mediator is removed and detection is carried out. See Liao, J.C., et al., Use of electrochemical DNA biosensors for rapid molecular identification ofuropathogens in clinical urine specimens. Journal of Clinical Microbiology, 2006. 44(2): p. 561-570; and Gau, V., et al., Electrochemical molecular analysis without nucleic acid amplification.
  • a steric hindrance -switch structure (such as a stem-loop and aptamer) is introduced to the probe design.
  • the probes of the present invention have at least a two-state structure. When no target is bound, the probe stays in structure I.
  • reporters (alternatively referred to as "ligands") cannot form effective complex with a mediator (alternatively referred to as a "receptor” which specifically binds a given ligand) because of the receptor is sterically hindered, inhibited or prevented from coming into contact with the ligand.
  • the probe After binding with a target, the probe turns into structure II.
  • a reporter forms an effective complex with the mediator which results in a signal amplification.
  • the steric hindrance design is simple and effective, without any additional chemical reaction step that would increase labor and cost.
  • a physical force parameter F a describes the intra-molecular interaction of the probe that constraints conformation. Higher F 3 makes the probe more stable in the structure I state.
  • Another physical force parameter F b describes the inter-molecular interaction between target and probe. Higher F b enables the probe to stabilize in the structure II state. Competition between F a and Fb determines which state the probe stays in. Since Fb comes from the interaction between target and probe, a specific target binding will produce a higher F b than a non-specific target binding. Therefore, the specificity of the detection can be determined by the difference between
  • detection according to the present invention may be a signal-on process.
  • Signal-on process detects an increase of the signal in a low background value
  • signal -off process detects a decrease of the signal a high background value.
  • a measurement at high value has a larger error than that of lower value, so a signal-on process has a more steady background noise level. Furthermore, the dynamic range for the decrease of the signal is limited by the original background value in the signal-off process. Therefore, the signal-on process has a higher limit of detection, less measurement error, as well as more convenient for commercial use because it has less signal processing steps than signal -off process.
  • Probe design The bio-recognition part and constraint-structure (or steric-switch) part of the probe can be designed separately or integrated.
  • Figure 1 illustrates the two methods of probe design.
  • Figure IA a DNA hairpin structure was used as the probe.
  • the loop is the bio-recognition part for the target.
  • the stem is designed for steric-switch part.
  • the probe remains as a closed structure, creating a conformational restriction that prevents the reporter from forming an effective complex with the mediator. Hence the measured signal level is low.
  • the hairpin opens and the reporter is free to from the effective complex with the mediator that amplifies the signal, hence the measure signal level is high.
  • the composition of the probe can form a constraint structure itself without additional part required in the probe design.
  • a G-quadruplex may be used for instance ( Figure IB).
  • Figure 2 shows the effects of different levels of designed steric hindrance.
  • hybridization with specific target forms a DNA duplex that separates the report further away from the electrode surface, and hence a decrease in signal output is measured. Note that in this signal-off process, the decrease of the high background value due to this signal is small and is difficult to detect.
  • the reporter is far away from the surface such that the complex between report and mediator can still form and is effective. Therefore the measured output between no target and existence of target (IL-8) is small, as shown in the left data set labeled "with linker.”
  • the steric hindrance is designed to be greater by removing the linker from the hairpin probe, the reporter is very close to surface when no target is bonded, preventing the formation of an effective mediator-reporter complex and therefore very low background noise is measured.
  • the distance between reporter and surface increases and the complex is allowed to form and effectively amplifies the signal. The change of the signal is dramatic with a large signal to noise ratio. This is a signal -on process and the result is shown on the right data set labeled "no-linker.”
  • the probes exemplified herein are on the surface of a substrate, the detection may be carried out using the probes in solution. Since the key innovation of the probe design is the steric-hindrance, all types of constraints that cause the steric -hindrance could be applied. For instance, the probes may bond to the nanoparticles, magnetic beads, or macromolecules such as proteins.
  • the present invention features a diversity of signal readout types.
  • the read-out signal is not limited to one specific type of signal, such as the electrical output illustrated in the above example, but depends on the amplification process. If the amplification is related to electron transfer process, the signal is preferably current/voltage. If the amplification is related to optical process, the signal is preferably fluorescence/UV/IR and the like. If the amplification is related to delicate molecular structural modification, the signal is preferably fine spectra. Also, the signal can be mechanical as well as magnetic data. One skilled in the art may readily select a suitable detection method based on the given amplification process.
  • the target for detection may be label-free.
  • Label-free detection not only decreases the cost of reagent use, but also makes it possible for real time and high throughput detection. It can be applied to micro-array and automatic in situ detection.
  • Example 1 Monitoring low concentration of mRNA using the hairpin probe design
  • mRNA biomarkers in saliva show that saliva can act as a diagnostic fluid for the oral disease, and possibly for other systematic disease.
  • concentration of specific mRNA biomarker in saliva is below femto mol/L.
  • large excess of non-specific mRNA, rRNA and protein coexist. The key point is how to detect tiny amounts of mRNA or protein in saliva without purification and amplification.
  • Disclosed herein includes an electrochemical array to IL8, an mRNA biomarker for oral cancer.
  • Use of a probe according to the present invention is exemplified.
  • the probe is designed as hairpin structure.
  • the reporter is the detection probe (fluorescein-green).
  • the mediator is the anti-fluorescein-HRP conjugate.
  • the signal amplification is based on HRP redox process.
  • the signal read-out is current.
  • F a is the Gibbs free energy of hairpin probe.
  • Fb is the Gibbs free energy of duplex formed between probe and target.
  • the limit of detection (LOD) of IL8 is about 10 fg/mL (about 1 fmol/L) ( Figure 3).
  • the LOD is only about
  • the dynamic range for hairpin probe detection is from 10 fg/mL to lOO ng/mL.
  • Saliva as a mirror of the body fluid, has been proved to reflect the normal and disease states of the body. See, e.g., I. D. Mandel, J. Am. Dent. Assoc, 124:85-87 (1993); I. D. MandeL J OralPathol. Med., 19: 119-125 (1990); D. T. Wong, J. Am. Dent. Assoc,
  • a major concern of saliva as a diagnostic fluid is that the biomarkers are generally present in lower amounts in saliva than in serum. Due to the low concentration of salivary biomarkers and the complexity of saliva, conventional detection methods cannot meet the clinical diagnostic requirement for high signal-to-noise ratio. [0065] Several techniques are developed to obtain signal amplification, which helps to increase the sensitivity. In most detection methods, the signal intensity relates to the number of targets within the detecting region, usually very small, compared with the whole sample volume. Hence either amplifying the amount of target in the whole sample volume or accumulating the target into a small detection region are applied to ensure high signal intensity. The first method increases the total number of the target, probe and/or signal, thus generates a high intensity measurement output.
  • PCR, primed in situ labeling (PRINS) and nucleic acid sequence-based amplification (NASBA) technology are applied to increase the total amount of targets.
  • PRINS primed in situ labeling
  • NASBA nucleic acid sequence-based amplification
  • LCR Ligase chain reaction
  • RCA rolling circle amplification
  • bDNA Branched DNA
  • TSA tyramide signal amplification
  • the second method focuses on increasing the local concentration of target instead of creating more copies of the target.
  • nanotechnology can concentrate the few copies of the target within the sample into a detection region by applying nano-particle based techniques. See A. N. Shipway and I. Willner, Chem. Commun., pp. 2035-2045 (2001); A. Merkoci, Febs J., 274:310-316 (2007); J. Wang, Anal. Chim. Acta, 500:247-257 (2003); S. G. Penn et al., Curr. Opin. Chem. BwL, 7:609-615 (2003). Increase of both the whole amount and the local concentration of target results in high sensitivity. However, it would also produce a higher background level and more false-positive results since both the specific and non-specific signals would be amplified.
  • Binding to a specific target will cause the conformational change of the probes. Typically, the conformational change will affect the signal level which is distance sensitive, such as FRET, intercalating dye and electrochemistry. See T. J. Huang et al., Nucleic Acids Research, vol. 30 (2002); V.
  • Non-specific targets don't generate signal change and the background level is low.
  • those probes reduce the limit of detection, because a large amount of target is required for a measurable signal, and hence introduce more false-negative results into the detection system..
  • This hairpin probe comprises of a bio-recognition component highly specific to the target, integrated together with a constraint- structure component that activates the signal reporting process. Only after the bio- recognition component verifies the specificity of the target, would the constraint-structure component remove the built-in steric hindrance, permitting signal amplification to occur, which results in high sensitivity. When there is no specific target binding, the steric hindrance inhibits the signal amplification. Therefore, only with the specific target, even if present in a low copy number in a mixture with large amount of interferents, can generate a measurable signal. This method of selective amplification greatly suppresses non-specific bindings and the background level, overcoming the two key hurdles in the implementation of any point-of-care detection system.
  • Blocker BSA in PBS solution contains 10% bovine serum albumin, pH 7 4 Pierce
  • Blocker Casein in PBS solution contains 1% (w/v) casein in PBS, pH 74 Pierce
  • the electrochemical sensor used was a 16-units gold array. See V. Gau et al., Methods, 37:73-83 (2005). Array of electrodes allows multiplexing detection of different samples simultaneously. For each unit, there are three-electrode setup including working electrode (WE), counter electrode (CE) and reference electrode (RE). As advantages of a tiny electrode array, the signal read-out of the 16 electrodes can be obtained simultaneously and only 4 ⁇ L of sample solution is needed for the detection. As exemplified herein, the electrochemical signal is the current generated by the redox process of reporting enzyme - horseradish peroxidase (HRP). After the reaction between HRP and H 2 O 2 , HRP turns into the oxidized state. TMB then keeps regenerating the reduced HRP via 2-electron step which amplifying the current signal.
  • HRP horseradish peroxidase
  • the surface modification of the gold electrochemical sensor contains 3 steps as the following (V. Gau et al., Methods, 37:73-83 (2005); J. J. Gau et al., Biosens. Bioelectron. , 16:745-755 (2001):
  • Probes immobilization The gold electrodes were pre-coated with self-assembled monolayer which is terminated by carboxyl group. The gold surface was activated by 4 ⁇ L 50% EDC and 50% NHS for 10 mins . After that the sensors are rinsed with DI water (18.3 M ⁇ -cm) and dried with ultra pure nitrogen gas. Then 4 ⁇ L of 5mg/mL Ez-Biotin was loaded to the gold surface, followed by DI water rinse and dried with nitrogen gas. After that, 0.5 mg/mL streptavidin in PBS buffer containing 2.5% BSA was incubated on the electrode for 10 mins, finally achieving streptavidin coated electrodes.
  • Targets Hybridization The surface was incubated with the target sample which is prepared in 6xSSC buffer containing 10 mM MgC ⁇ for 60 mins. After the hybridization, the electrodes were rinsed with DI water and dried with nitrogen gas.
  • Signal read-out The current is proportional to the surface concentration of the target. See V. Gau et al., Methods, 37:73-83 (2005). First, 0.5 mU/mL anti-fluorescein-HRP in 0.5% casein blocker solution was bound with the fluorescein labels on HP. After rinsed with DI water and dried with nitrogen gas, TMB/H 2 O 2 substrate was added. Amperometry detection was carried out by applying -200 mV voltage to each electrode unit, followed by parallel signal read-out after 60s equilibrium.
  • the electrochemical signal is the current generated by the redox process of reporting enzyme - horseradish peroxidase (HRP). After the reaction between HRP and H 2 O 2 , HRP turns into the oxidized state. TMB then keeps regenerating the reduced HRP via 2-electron step which amplifying the current signal. First, 0.5 mU/mL anti-fluorescein-HRP in 0.5% casein blocker solution was bound with the fluorescein labels on HP. After rinsed with DI water, TMB/H 2 O 2 was added. Amperometry detection was carried out by applying - 200 mV voltage to each electrode unit, followed by simultaneous signal read-out after 60s equilibrium. The current is proportional to the surface concentration of the target. See V. Gau et al, Methods, 37:73-83 (2005).
  • Oligonucleotides probes and RNA sample preparation
  • Oligonucleotides were ordered from Operon (Alabama, USA). Every hairpin probes are labeled with biotin on one end and biotinTEG on the other. The biotin label can bind streptavidin as an anchor, and fluorescein label is a signal reporter respectively. BiotinTEG provided by Operon has an extra 16-atom spacer connecting biotin and oligo chain. This spacing design confers to the biotin a good accessibility towards the streptavidin.
  • Interleukin 8 is a salivary biomarker for oral cancer.
  • the concentration of IL8 is 2 fM for healthy people and increased to about 16 fM in oral cancer sample. See Y. Li et al., Clin. Cancer Res., 10:8442-8450 (2004).
  • S100A8 SlOO calcium-binding protein A8
  • S100A8 is used as a reference control on each electrochemical sensor.
  • IVT In vitro transcript (IVT) RNA are prepared according to methods known in the art. See H. Ohyama et al., Biotechniques, 29:530-+ (2000). In brief, reverse transcription with T7-oligo-(dT)24 as the primer was performed to synthesize the first strand of c-DNA. The in vitro transcription was carried out with T7 RNA polymerase (Ambion Inc., Austin, TX,
  • RNA sample was aliquot and stored at -20°C before use. For assessment of sensitivity and specificity of saliva, the IVT RNA was spiked into saliva.
  • the oligonucleotide probes are linear. Therefore both the non-specific and specific target, independent of any mediator binding, would increase background and cause false-positive results.
  • the steric hindrance effect was introduced into the hairpin structure. See Figure 4.
  • the hairpin probe is characteristic of its open-or-not two-state structure. When no target is bound, the hairpin probe stays in closed state thus the reporters cannot form effective complex with mediator because of the designed steric hindrance. After binding with a specific target, the probe turns into open state and a reporter forms an effective complex with the mediator, resulting a signal amplification.
  • the steric hindrance design is simple and effective, without any additional chemical reaction step that would increase efforts in carrying out the experiments. Since the signal read-out in this work is only related to the complex formed between reporter and mediator, the target for detection is label-free. Label- free detection not only decreases the types of reagent use, but also makes it possible for real time and high throughput detection. It can be applied to micro-array and automatic in situ detection. [0079]
  • the probes according to the present invention are based on surface steric hindrance which inhibiting the HRP/TMB signal amplification. Therefore, the distance between the surface and reporter would be the major factor to the recognition process. In this setup, hybridization with specific target forms a DNA duplex that separates the report further away from the electrode surface, and hence a decrease in signal output is measured. As the reporter moving from the surface into the solution, the surface restriction could diminished thus the current signal will increase.
  • the detection according to the present invention may be a signal- on process.
  • Signal-on process detects an increase of the signal in a low background value
  • signal -off process detects a decrease of the signal a high background value.
  • a measurement at high value has a larger error than that of lower value, so a signal-on process has a more steady background noise level.
  • the dynamic range for the decrease of the signal is limited by the original background value in the signal -off process. Therefore, the signal-on process has a higher limit of detection, less measurement error, as well as more convenient for commercial use because it has less signal processing steps than signal-off process.
  • the specific signal amplification is accomplished via combination of sandwich-like signal amplification by HRP and TMB/H2O2 and signal selectivity by hairpin probe design.
  • the basic idea of the method of the present invention is the steric hindrance by surface which inhibits the HRP/TMB binding to target-free probe. Therefore, the distance between the surface and reporter would be a major factor to the recognition process. As the reporter moving from the surface into the solution, the surface restriction is diminished thus the current signal will increase. Without steric hindrance, hybridization with specific target forms a DNA duplex that separates the reporters from the electrode surface, and hence a decrease in signal output is measured.
  • the coiled strand would stretch straight under a specific force, such as negative potential. Since the electrochemical detection is carried out under -200 mV, the 9T linker is stretched out at a much longer length instead of having a curved or lay-down structure. See A. M. van Oijen et al., Science, 301: 1235-1238 (2003); U. Rant et al., Bwphys. J., 90:3666-3671 (2006). Although the actual length of the 9T linker is not clear, it should be much longer than 3 nm under negative potential if taking the data from duplex DNA as 9 bp x 0.28 nm/bp. The size of HRP is about 4x6.7x11.8 nm from the crystal data. See G. I. Berglund et al., Nature, 417:463-468 (2002).
  • the measured output between no target and binding of target is small, as shown in the data set labeled "HP L3."
  • the reporter is very close to surface when no target is bonded, preventing the formation of an effective mediator-reporter complex and therefore very low background noise is measured.
  • the distance between reporter and surface increases and the complex is allowed to form and effectively regenerates the signal. The change of the signal is dramatic with a good signal to noise ratio.
  • SNR signal-to-noise ratio
  • hairpin probes of the present invention SNR depends on the open-to-closed ratio of hairpin probe. High SNR can be achieved by the well-closed status when no target bound and the full -open status after hybridization with targets. These closed-or-open states during recognition require high efficiencies for both the intra-molecular and inter-molecular hybridization.
  • the hairpin structure was adjusted by changing the stem length and loop length.
  • 3 hairpin probes with different stem-loop length have been studied (sequences listed in lower part of Figure 7). All 3 probes have the 3-end stem part complementary to the target RNA, together with the loop part. From the results shown in Figure 7, probe with the longest stem and duplex has the lowest signal for blank sample and highest signal for target sample. This result indicates that better closed state when no target and better open state when hybridized with target results in high signal-to-noise ratio. The probe with short stem and duplex doesn't have low background and high signal.
  • Salivary RNA detection with hairpin probes and linear probes spiked and non-spiked samples
  • Figure 8 shows the concentration relationship of the current signal. Both IL-8 and S100A8 exhibits good SNR with hairpin probes, but poor SNR with linear probes. It's interesting that the signal intensity is neither linear to concentration nor linear to the log of concentration.
  • the limit of detection (LOD) of IL8 is about 1 fmol/L.
  • LOD Limit of detection
  • S100A8 is about 1 fmol/L for hairpin probe and 10 pmol/L for the linear probes.
  • RNA samples at different concentrations are spiked into whole saliva. Similar to the purified IVT RNA sample, spiked saliva also has low LOD. This indicates the hairpin probe can differentiate the specific target RNA even with huge number of interferents in saliva. The LOD is about 1 flVI which could meet the requirement of real IL-8 salivary diagnostic.
  • LOD is about 1 flVI which could meet the requirement of real IL-8 salivary diagnostic.
  • RNA detection is combined with lysis to remove other interferents.
  • the high signal-to-noise ratio comes from the combination of a sandwich-like detection and the hairpin probe.
  • sandwich-like detection is the application of a mediator to form a complex, with a purpose of regenerating the HRP which amplify the signal.
  • the target binds to the probe.
  • mediator anti-fluorescein-HRP
  • the excess mediator is removed by washing and TMB/H 2 O 2 substrate is added to regenerate the HRP which amplifying the signal. See V. Gau et al., Methods, 37:73-83 (2005); J. C. Liao et al., J. Clin.
  • the signal level depends on both the amount and the activity of the complex. Because of the strong interaction between the metal electrode and the complex, the surface could serve as a restrictor for the formation of the complex, as well as an inhibitor for the activity of the reporter. This complex which is capable of amplify signal is referred to as the "effective complex.” Only the effective complex generates amplified signal.
  • the hairpin probe is characteristic of its open-or-not two-state structure. When no target is bound, the hairpin probe stays in closed state thus the reporters cannot form effective complex with mediator because of the designed steric hindrance. After bound with a specific target, the probe turns into open state and a reporter forms an effective complex with the mediator, resulting a signal amplification.
  • the steric hindrance design is simple and effective, removing a chemical reaction step from the original two probes design that decreases efforts in carrying out the experiments. Since the signal read-out in this work is only related to the complex formed between reporter and mediator, the target for detection is label-free. Label-free detection not only decreases the types of reagent use, but also makes real time and high throughput detection possible. It can be applied to micro-array and automatic in situ detection.
  • the basic idea of hairpin probe detection is the steric hindrance design which can specifically amplify the signal.
  • the other factor is the electric potential applying to the electrode. Since the oliognucleotides are heavily negative charged, positive potential improves the hybridization and increases the attraction of the electrode to the strand. Negative potential forces the duplex to open and repel the strand from the surface. Oligonucleotide will lay down on electrode under high positive potential, while stretch out into the solution under negative potential. See U. Rant et al., Biophys. J., 90:3666-3671 (2006). When the probes lay down on electrode under positive potential, the surface steric hindrance to the probes in closed and open state would be almost the same, thus there is no differentiation for the complementary target binding. See R G. Sosnowski, P Natl Acad Sa USA, 94: 1119-1123 (1997).
  • the detection of the present invention is a signal-on process. See C. H. Fan et al., P Natl Acad Sa USA, 100:9134-9137 (2003).
  • Signal-on process detects an increase of the signal in a low background value
  • signal-off process detects a decrease of the signal a high background value.
  • a measurement at high value has a larger error than that of lower value, so a signal-on process has a more steady background noise level.
  • the dynamic range for the decrease of the signal is limited by the original background value in the signal-off process. Therefore, the signal-on process has a higher limit of detection, less measurement error, as well as more convenient for commercial use because it has less signal processing steps than signal-off process.
  • Example 2 Electrochemical detection of salivary mRNA employing a hairpin probe (HP)
  • the probe was designed based on the principle that steric hindrance (SH) suppresses unspecific signal and generates a signal-on amplification process for target detection.
  • SH steric hindrance
  • the stem-loop configuration brings the reporter end of the probe into close proximity with the surface and makes it unavailable for binding with the mediator.
  • Target binding opens the hairpin structure of the probe, and the mediator can then bind to the accessible reporter.
  • Horseradish peroxidase was utilized to generate electrochemical signal. This signal- on process is characterized by a low basal signal, a strong positive readout, and a large dynamic range.
  • the SH is controlled via hairpin design and electrical field. By applying electric field control to hairpin probes, the limit of detection of RNA is about 0.4 fM, which is 10,000-fold more sensitive than conventional linear probes. Endogenous IL-8 mRNA is detected with the HP, and good correlation with the qPCR technique is obtained. The resultant process allows a simple setup and by reducing the number of steps it is suited for the point-of-care detection of specific nucleic acid sequences from complex body fluids such as saliva.
  • Saliva is easily accessible in a non-invasive manner, and can be collected with less patient discomfort relative to blood.
  • the levels of interfering material (cells, DNA, RNA, and proteins) and inhibitory substances are lower and less complex in saliva than in blood.
  • This advantage has recently been shown in a thorough study of oral cancer mRNA markers (Li et al. (2004) Clinical Cancer Research, 10, 8442-8450).
  • mRNAs were identified through microarray and validated according to established guidelines (Pepe et al. (2001) Journal of the National Cancer Institute, 93, 1054-1061) by quantitative PCR (qPCR). Detecting salivary mRNA biomarkers adds a new dimension to saliva as a valuable diagnostic fluid. In this study, we aimed to develop a unique methodology for on-site testing of salivary mRNA.
  • Electrochemistry is an excellent candidate for a point-of-care diagnostic method for RNA detection (Hahn et al. (2005) Bioelectrochemistry, 67, 151-154), not only because of its high sensitivity but also because of the simplicity of the instrument (Liao and Cui (2007) Biosensors & Bioelectronics, 23, 218-224; Wei et al. (2005) Journal of the American
  • HP comprises a loop component with a sequence complementary to the target and a stem component labeled with a reporter at one end.
  • SH steric hindrance
  • This built-in SH is removed after the bio-recognition component verifies the target specificity, making the reporter label accessible to the mediator-peroxidase conjugate and generating a current signal. Therefore, only the specific target can generate an amplified current, even if present in low copy numbers and in a complex mixture.
  • the SH effect is controllable in this HP -based electrochemical sensor by optimizing probe design and the surface electrical field.
  • Our selective amplification method suppresses non-specific signal to background levels, overcoming key hurdles in developing point-of-care nucleic acid detection systems for salivary RNA markers and for other general use.
  • Oligonucleotide probes and RNA [0100] HPLC-purified oligonucleotides were custom synthesized (Operon Inc., Alabama, USA). The probe sequence allowed for the formation of a hairpin structure. The loop and half of the hairpin stem (3' end) contained target recognition sequences, and HPs were labeled with biotin or biotin-TEG on the 5' end and with fluorescein on the 3' end (detailed structures are shown in Figure 10). The biotin label bound to streptavidin as an anchor to the chip surface, and the fluorescein label allowed for binding of the signal mediator.
  • biotin link had an extra spacer with mixed polarity based on triethylene glycol containing oxygen atoms connecting the biotin and the oligo chain. Different spacing designs may confer better accessibility of the biotin to the streptavidin, and could serve as an adjustable length linker for the SH effect.
  • Interleukin 8 (IL-8) mRNA (NM_000584)( St John et al. (2004) Archives of Otolaryngology-Head & Neck Surgery, 130, 929-935) has been proposed as a salivary biomarker for oral cancer and was selected for detection.
  • IVT in vitro transcribed IL-8 RNAs were used as a target for standard quantitative measurements. Details of IVT RNA generation are described in the supplementary materials II section. Endogenous mRNAs were detected from clinical samples.
  • a lysis process was carried out by mixing the saliva 1: 1 with AVL viral lysis buffer (QIAGEN, California, USA) for 15 min at room temperature. Details of saliva collection and qPCR measurements are described in the supplementary materials III-IX.
  • RNA targets were selected for the detection.
  • Interleukin 8 (IL-8) mRNA, NM_000584) (St John et al. (2004) Archives of Otolaryngology-Head & Neck Surgery, 130, 929-935) has been proposed as a candidate biomarker for oral cancer.
  • SlOO calcium-binding protein A8 (S100A8) mRNA, NM_002964
  • IVTT In vitro transcribed
  • the IVT RNAs were generated in two steps: first was to generate templates for in vitro transcription using conventional RT- PCR, in which the primers having 20 base core T7 promoter sequence at the 5' end of the forward primers.
  • the forward primer is 5'- CTAATACG ACTCACTATAGGGaaggaaaactgggtgcagag-3'
  • the reversed primer is 5'- attgcatctggcaaccctac-3'.
  • the forward primer is 5'
  • the conventional RT-PCR was conducted with total oral squamous cell carcinoma (OSCC) cell line RNA as template and cDNA was synthesized in 20 ⁇ l of reverse transcription reaction mix with 50 U MuLV reverse transcriptase (Applied Biosystems), 20 U RNAse Inhibitor (Applied Biosystems), 10 mM dNTPs and 5 nmol random hexamers.
  • OSCC total oral squamous cell carcinoma
  • the mix was first incubated at 25°C for 10 min, then reverse transcribed at 42°C for 45 min followed by a final inactivation of RT at 95°C for 5 min and cooling at 4°C for 5 min.
  • One micro litter cDNA was used in a 20 ⁇ l PCR reaction with 400 nM primers.
  • the PCR reaction was carried out by the following protocol: 95°C for 3 min followed by 40 cycle of 95°C for 30s, 60 0 C for 30s, 72°C for 30 s, and final extension at 72°C for 7 min.
  • RT-PCR products were checked on a 2% agarose gel stained with ethidium bromide.
  • the second step was to generate the IVT RNAs.
  • In vitro transcription was performed using T7 MEGAshort transcribe kit (Invitrogen) according to manufacturer's instruction. Briefly, 8 ⁇ l PCR products from the first step was in vitro transcribed at 37° C for 3 hrs and followed by 2 ⁇ l rDNasel (Invitrogen) treatment for additional 20 min. The resultant single strand RNA transcripts were purified with cleaned up (Arcturus, Mountain View, CA). The recombinant RNAs were quantified with Nanodrop spectrometry for quantity and A260/A280 ratio. Resultant RNA were dissolved in RNase-free distilled water (Invitrogen) with baker's yeast tRNA (30 ⁇ g/ml, Roche) as carrier.
  • Un-stimulated whole saliva was collected according to our published protocol (Li, Yang 2004). Briefly, all saliva samples were collected while kept on ice. Upon collection, RNAlater (QIAGEN, Valencia, CA) at room temperature was added into the saliva samples at a 1 : 1 (volume) ratio and mixed by vortexing. RNAlater at 1 : 1 ratio mixed with whole saliva and samples stored at -80 0 C provides prompt and adequate inhibition of salivary RNA degradation. The sample aliquots were stored at -80 0 C for later use.
  • RNA was eluted in 40 ⁇ l of elution buffer, and was treated with rDNase 1 (Ambion, Austin TX) in a solution containing 40 ⁇ l RNA, 4.5 ⁇ l 10x DNase I buffer, 0.5 ⁇ l rDNasel for 30 minutes at 37°C to remove any genomic DNA contamination. After clean up with DNase inactivator, up to 35 ⁇ l total RNA were recovered and frozen at - 80 0 C until use. Primer design
  • Intron-spanning primer pairs with melting temperatures around 60 0 C for IL8 were designed with the primer3 program.
  • OF and OR are primers for RT-PCR and IF and IR were designed for qPCR.
  • IL8 IR IL8 OR CTTGGATACCACAGAGAATGAATTTTT
  • RT and PCR pre-amplification were performed in 20-40 ⁇ l reactions with the Superscript III Platinum One-Step qRT-PCR System (Invitrogen, Carlsbad, CA), primer concentrations were 300 nM for all targets.
  • the reactions were set up utilizing the BioMek 3000 liquid handling platform into 96-well plates on PCR plate cooler and then performed with the following program: 1 min at 60 0 C, 15 min at 50 0 C, 2 min at 95 0 C, and 15 cycles of 15 s at 95 0 C, 30 s at 50 0 C and, 10 s at 60 0 C and 10 s at 72 0 C, with a final extension for 5 min at 72 0 C and cooling to 4 0 C.
  • Probe immobilization The gold electrodes were pre-coated with a self-assembled monolayer of mercaptoundecanoic acid (MUDA), terminated by a carboxyl group (18). The gold surface was activated by a 4 ⁇ L mixture of 50% l-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Biacore Inc., New Jersey, USA) and 50% N- hydroxysuccinimide (NHS) (Biacore) for 10 min. The sensors were rinsed with DI water (18.3 M ⁇ «cm) and dried with nitrogen gas.
  • MUDA mercaptoundecanoic acid
  • amine-PEO2-Biotin labeling reagent (Ez-Biotin) (Pierce Inc., Illinois, USA) was loaded to the gold surface, followed by rinsing and drying.
  • Ethanolamine-HCl (1.0 M, pH 8.5, Biacore) was loaded for inactivation of the un-reacted EDC/NHS activated surface.
  • streptavidin VWR Corp., California, USA
  • PBS pH 7.2, Invitrogen, California, USA
  • Target Hybridization The surface was incubated for 5 min with the target- containing sample prepared in 6x saline-sodium citrate buffer (6x SSC, 0.09 M sodium citrate, with 0.9 M NaCl, pH 7.0, Invitrogen, California, USA) with the addition of 10 mM MgCl 2 (Sigma Corp., Missouri, USA). During hybridization, a cyclic square-wave electric field was applied at 30 cycles of +200 mV for Is and -300 mV for 9s. After hybridization, the electrodes were rinsed with DI water and dried with nitrogen gas. Electrochemical detection
  • the electrochemical readout was performed using an electrochemical workstation according to the manufacturer's instructions. Briefly, anti-fluorescein-HRP (Roche, Indiana, USA) diluted in PBS with 0.5% casein blocking buffer (Blocker Casein in PBS, Pierce, pH 7.4) was added to the fluorescein label on the HP or the detector probes. Then, 3, 3', 5, 5' tetramethylbenzidine low activity (TMB/H 2 O 2 , Neogen Corp., Kentucky, USA) substrate was loaded, and amperometric detection was carried out by applying -200 mV potential vs. gold to each electrode unit, followed by parallel signal read-out after 60 s of equilibration (Gau et al.
  • the electrochemical sensor was a 16-unit gold array. For each unit, there were three electrodes including the working electrode (WE), counter electrode (CE) and reference electrode (RE) (Gau et al. (2005) Methods, 37, 73-83).
  • the reference electrode was determined to be +218 mV vs. SCE by measuring cyclic voltammetric curves of 0.1 mM [Fe(CN) ⁇ ] 3 /4" . All electric potentials described in this report are in reference to the gold reference electrode (+218 mV vs. SCE).
  • the advantages of this small electrode array are that the signal read-out of the 16 electrodes can be obtained simultaneously, and only 4 ⁇ L of sample solution is needed for detection.
  • the electrochemical signal was the current generated by the redox of the HRP reporter enzyme. TMB continually regenerated reduced HRP via a 2-electron step, which amplified the current signal. The current was proportional to the surface concentration of hybridized target (Gau et al. (2005) Methods, 37, 73-83). All experiments were performed at room temperature.
  • FIG. 6 shows the SH effects from different HP designs.
  • TAG-T 9 the fluorescein was far away from the surface even when the hairpin was closed.
  • the mediator complex was formed, and SH effect was very small.
  • Hybridization to the target only increased the distance of the HRP complex from the electrodes. Therefore, the signal decreased upon binding, and recognition resulted in a very weak signal -off process (Fig. 6).
  • Signals with bound target were at similar levels for all four probes, and the blank signal decreased with decreasing linker length.
  • RNA sensor A major concern of the RNA sensor is the SBR.
  • the SBR depended on the ratio of the numbers with an open or closed HP. Background levels were associated with the closed state when no specific target was bound, and signal was generated from the open state after target hybridization. These closed or open states during recognition required high efficiencies for both the intra-molecular and inter-molecular hybridization.
  • Complementary HP sequences included both the whole loop and half of the stem, providing lower free energy after target hybridization. Thus, once target was bound to the loop, even the very long stem could be opened due to its complementary sequence to the target. Since high hybridization efficiency benefits both the sensitivity and specificity, a good SBR was achieved. In contrast, it is difficult to determine the optimized probe sequence with the traditional linear probe (LP) (Liao et al. (2006) Journal of Clinical Microbiology, 44, 561- 570). The long sequence was beneficial to the hybridization efficiency, but generates high background.
  • LP linear probe
  • RNA biomarker sequences can be detected over a wide dynamic range of target concentration.
  • Fig. 12 shows the relationship between the concentration and the current signal in buffer.
  • both probes were designed to be complementary to adjacent stretches of the target sequence.
  • the 'capture probe' was immobilized on the electrode with a 5' end biotin label.
  • the 'detector probe' had a 3' fluorescein label to bind with the anti-fluorescein-HRP.
  • the limit of detection was defined as the concentration with a signal of at least 2 SDV above the background level. According to the criteria, the LOD for HP was about 0.4 fM. For the LPs, the LOD of IL-8 was about 400 pM, which is about 10,000-fold higher than for the HP (Fig. 12).
  • the present inventors developed an effective method for electrochemical detection of mRNA using HP with high sensitivity, high specificity, and a large dynamic range (fM - nM in buffer system and spiked saliva). The inventors also demonstrated that this technique works well for directly detecting endogenous mRNA without the need for PCR amplification.
  • TTC AAA AAC TTC TCC ACA ACC CTC IL-8 HPL3 n TTT TTT TTT GAG GGT TGC TCA GCC CTC BiotinTEG Fluorescein
  • Hairpm probe design was calculated by MFoId free web server (27, 28) f
  • the target recognition sequences are listed in italic font
  • the stem sections of the hairpins are underlined
  • J IL-8 CP is the capture probe with biotin label in dual probes detection
  • IL-8 DP is the detect probe with fluorescein label in dual probes detection Table 4. Oligonucleotide sequences for IL-8 HP with different stem-loop structures.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2008/065286 2007-05-31 2008-05-30 High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification Ceased WO2009017878A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US12/601,774 US20100248231A1 (en) 2007-05-31 2008-05-30 High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification
EP08826854.5A EP2158482B1 (en) 2007-05-31 2008-05-30 High specificity and high sensitivity detection based on steric hindrance&enzyme-related signal amplification
CN200880101316A CN101849185A (zh) 2007-05-31 2008-05-30 基于空间位阻和酶相关信号放大的高特异性和高灵敏度检测
JP2010510514A JP5389789B2 (ja) 2007-05-31 2008-05-30 立体障害および酵素に関連するシグナル増幅に基づく高特異性かつ高感度の検出
CA2688155A CA2688155C (en) 2007-05-31 2008-05-30 High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification
US13/462,709 US20130115594A1 (en) 2007-05-31 2012-05-02 High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US94105707P 2007-05-31 2007-05-31
US60/941,057 2007-05-31

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/462,709 Continuation US20130115594A1 (en) 2007-05-31 2012-05-02 High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification

Publications (3)

Publication Number Publication Date
WO2009017878A2 true WO2009017878A2 (en) 2009-02-05
WO2009017878A9 WO2009017878A9 (en) 2009-03-26
WO2009017878A3 WO2009017878A3 (en) 2009-05-14

Family

ID=40305157

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/065286 Ceased WO2009017878A2 (en) 2007-05-31 2008-05-30 High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification

Country Status (7)

Country Link
US (2) US20100248231A1 (https=)
EP (1) EP2158482B1 (https=)
JP (1) JP5389789B2 (https=)
KR (1) KR20100038330A (https=)
CN (1) CN101849185A (https=)
CA (1) CA2688155C (https=)
WO (1) WO2009017878A2 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2302071A1 (en) * 2009-09-28 2011-03-30 Fujitsu Limited Target-detecting device and method for producing the same
US20140315195A1 (en) * 2011-05-24 2014-10-23 The Regents Of The University Of California Method for exosomal biomarker detection by electric field-induced release and measurement
CN109406596A (zh) * 2018-12-13 2019-03-01 合肥工业大学 一种检测microRNA-21的电化学传感器、其制备方法及应用

Families Citing this family (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8532930B2 (en) 2005-11-26 2013-09-10 Natera, Inc. Method for determining the number of copies of a chromosome in the genome of a target individual using genetic data from genetically related individuals
US11111543B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US10081839B2 (en) 2005-07-29 2018-09-25 Natera, Inc System and method for cleaning noisy genetic data and determining chromosome copy number
US11111544B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US9424392B2 (en) 2005-11-26 2016-08-23 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US10083273B2 (en) 2005-07-29 2018-09-25 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
EP2321642B1 (en) 2008-08-04 2017-01-11 Natera, Inc. Methods for allele calling and ploidy calling
WO2011041485A1 (en) 2009-09-30 2011-04-07 Gene Security Network, Inc. Methods for non-invasive prenatal ploidy calling
WO2011146632A1 (en) 2010-05-18 2011-11-24 Gene Security Network Inc. Methods for non-invasive prenatal ploidy calling
US9677118B2 (en) 2014-04-21 2017-06-13 Natera, Inc. Methods for simultaneous amplification of target loci
US11332785B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11322224B2 (en) 2010-05-18 2022-05-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US20190010543A1 (en) 2010-05-18 2019-01-10 Natera, Inc. Methods for simultaneous amplification of target loci
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US12545960B2 (en) 2010-05-18 2026-02-10 Natera, Inc. Methods for simultaneous amplification of target loci
US11408031B2 (en) 2010-05-18 2022-08-09 Natera, Inc. Methods for non-invasive prenatal paternity testing
US11332793B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for simultaneous amplification of target loci
US12221653B2 (en) 2010-05-18 2025-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US12152275B2 (en) 2010-05-18 2024-11-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11326208B2 (en) 2010-05-18 2022-05-10 Natera, Inc. Methods for nested PCR amplification of cell-free DNA
US10316362B2 (en) 2010-05-18 2019-06-11 Natera, Inc. Methods for simultaneous amplification of target loci
US11339429B2 (en) 2010-05-18 2022-05-24 Natera, Inc. Methods for non-invasive prenatal ploidy calling
CN103608466B (zh) 2010-12-22 2020-09-18 纳特拉公司 非侵入性产前亲子鉴定方法
RU2671980C2 (ru) 2011-02-09 2018-11-08 Натера, Инк. Способы неинвазивного пренатального установления плоидности
US9335292B2 (en) 2011-10-13 2016-05-10 Auburn University Electrochemical proximity assay
ES2678211T3 (es) 2012-03-27 2018-08-09 Ventana Medical Systems, Inc. Conjugados de señalización y procedimientos de uso
WO2013153911A1 (ja) * 2012-04-12 2013-10-17 国立大学法人東京大学 核酸の定量方法、検出プローブ、検出プローブセット、及び核酸の検出方法
US20140100126A1 (en) 2012-08-17 2014-04-10 Natera, Inc. Method for Non-Invasive Prenatal Testing Using Parental Mosaicism Data
US10262755B2 (en) 2014-04-21 2019-04-16 Natera, Inc. Detecting cancer mutations and aneuploidy in chromosomal segments
US10577655B2 (en) 2013-09-27 2020-03-03 Natera, Inc. Cell free DNA diagnostic testing standards
US9499870B2 (en) 2013-09-27 2016-11-22 Natera, Inc. Cell free DNA diagnostic testing standards
CA2945962C (en) 2014-04-21 2023-08-29 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US12492429B2 (en) 2014-04-21 2025-12-09 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US20180173846A1 (en) 2014-06-05 2018-06-21 Natera, Inc. Systems and Methods for Detection of Aneuploidy
US11479812B2 (en) 2015-05-11 2022-10-25 Natera, Inc. Methods and compositions for determining ploidy
DK3133166T4 (da) * 2015-08-21 2023-03-20 42 Life Sciences Gmbh & Co Kg Sammensætning og fremgangsmåde til hybridisering
RU2760913C2 (ru) 2016-04-15 2021-12-01 Натера, Инк. Способы выявления рака легкого
WO2018067517A1 (en) 2016-10-04 2018-04-12 Natera, Inc. Methods for characterizing copy number variation using proximity-litigation sequencing
GB201618485D0 (en) 2016-11-02 2016-12-14 Ucl Business Plc Method of detecting tumour recurrence
US10011870B2 (en) 2016-12-07 2018-07-03 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
WO2018156418A1 (en) 2017-02-21 2018-08-30 Natera, Inc. Compositions, methods, and kits for isolating nucleic acids
WO2018165566A1 (en) 2017-03-09 2018-09-13 Auburn University Differential circuit for background correction in electrochemical measurements
US11505799B2 (en) 2017-07-07 2022-11-22 Innamed, Inc. Aptamers for measuring lipoprotein levels
EP3673079A1 (en) * 2017-09-29 2020-07-01 Boehringer Ingelheim Vetmedica GmbH Sensor apparatus and method for testing a sample
US12084720B2 (en) 2017-12-14 2024-09-10 Natera, Inc. Assessing graft suitability for transplantation
CN108444992B (zh) * 2018-02-09 2020-11-13 河南工业大学 一种黄曲霉毒素定量检测试剂盒及其检测方法
US12398389B2 (en) 2018-02-15 2025-08-26 Natera, Inc. Methods for isolating nucleic acids with size selection
WO2019200326A1 (en) 2018-04-13 2019-10-17 Rarecyte, Inc. Kits for labeling of biomarkers and methods of using the same
US12024738B2 (en) 2018-04-14 2024-07-02 Natera, Inc. Methods for cancer detection and monitoring
US11560565B2 (en) 2018-06-13 2023-01-24 Auburn University Electrochemical detection nanostructure, systems, and uses thereof
US12234509B2 (en) 2018-07-03 2025-02-25 Natera, Inc. Methods for detection of donor-derived cell-free DNA
US12305235B2 (en) 2019-06-06 2025-05-20 Natera, Inc. Methods for detecting immune cell DNA and monitoring immune system
BE1028157B9 (fr) * 2020-04-07 2022-07-11 Vaccim Dispositif et procédé pour déterminer, au départ d'un échantillon préalablement prélevé chez un individu, qu'au moins un anticorps cible a été ou est présent chez ledit individu
CN113466445B (zh) * 2021-06-30 2023-06-30 陕西师范大学 基于杂交链式-酶显色反应检测Hg2+和Ag+的生物传感器及其制备方法和应用
CN115112883B (zh) * 2022-06-29 2025-05-09 深圳市德大科技有限公司 一种miR-Chr8:96检测试剂盒及其检测方法
CN120584195A (zh) * 2023-01-26 2025-09-02 东洋纺株式会社 源自核糖体rna的逆转录的抑制
CN116626120B (zh) * 2023-04-25 2024-12-13 苏州中科苏净生物技术有限公司 一种基于RPA与CRISPR/Cas的电化学核酸检测传感元件及检测方法
CN116660345B (zh) * 2023-04-25 2024-09-06 苏州中科苏净生物技术有限公司 一种基于CRISPR/Cas的电化学核酸检测传感元件及检测方法

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5925517A (en) * 1993-11-12 1999-07-20 The Public Health Research Institute Of The City Of New York, Inc. Detectably labeled dual conformation oligonucleotide probes, assays and kits
US7432048B2 (en) * 1996-11-29 2008-10-07 Third Wave Technologies, Inc. Reactions on a solid surface
US6287765B1 (en) * 1998-05-20 2001-09-11 Molecular Machines, Inc. Methods for detecting and identifying single molecules
US7118860B2 (en) * 1999-10-29 2006-10-10 Stratagene California Methods for detection of a target nucleic acid by capture
AU2002345746A1 (en) * 2001-06-21 2003-01-08 The Regents Of The University Of California Electrochemical detection of mismatch nucleic acids
JP4537053B2 (ja) * 2001-06-25 2010-09-01 ジョージア テック リサーチ コーポレーション 二重共鳴エネルギー転移核酸プローブ
US20030096781A1 (en) * 2001-08-31 2003-05-22 University Of Southern California IL-8 is an autocrine growth factor and a surrogate marker for Kaposi's sarcoma
FR2834521B1 (fr) * 2002-01-10 2004-12-17 Bio Merieux Procede de detection et/ou d'identification de l'espece animale d'origine de la matiere animale contenue dans un echantillon
DE10220935B3 (de) * 2002-05-10 2004-02-05 Siemens Ag Verfahren für die biochemische Analytik von DNA und zugehörige Anordnung
WO2005001129A2 (en) * 2003-06-06 2005-01-06 Applera Corporation Mobility cassettes
WO2007033283A2 (en) * 2005-09-13 2007-03-22 University Of Hawaii Disposable electrode system for detection of selected nucleic acid sequences

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
A. M. VAN OIJEN ET AL., SCIENCE, vol. 301, 2003, pages 1235 - 1238
G. I. BERGLUND ET AL., NATURE, vol. 417, 2002, pages 463 - 468
N. L. ALLINGER, J. AM. CHERRC. SOC., vol. 99, 1977, pages 8127 - 8134
U. RANT ET AL., BIOPHYS. J., vol. 90, 2006, pages 3666 - 3671

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2302071A1 (en) * 2009-09-28 2011-03-30 Fujitsu Limited Target-detecting device and method for producing the same
US20140315195A1 (en) * 2011-05-24 2014-10-23 The Regents Of The University Of California Method for exosomal biomarker detection by electric field-induced release and measurement
US9932635B2 (en) * 2011-05-24 2018-04-03 The Regents Of The University Of California Method for exosomal biomarker detection by electric field-induced release and measurement
CN109406596A (zh) * 2018-12-13 2019-03-01 合肥工业大学 一种检测microRNA-21的电化学传感器、其制备方法及应用
CN109406596B (zh) * 2018-12-13 2021-01-01 合肥工业大学 一种检测microRNA-21的电化学传感器、其制备方法及应用

Also Published As

Publication number Publication date
EP2158482B1 (en) 2017-01-18
WO2009017878A3 (en) 2009-05-14
EP2158482A4 (en) 2010-07-14
US20130115594A1 (en) 2013-05-09
CN101849185A (zh) 2010-09-29
KR20100038330A (ko) 2010-04-14
CA2688155A1 (en) 2009-02-05
EP2158482A2 (en) 2010-03-03
JP2010528618A (ja) 2010-08-26
JP5389789B2 (ja) 2014-01-15
CA2688155C (en) 2020-02-11
US20100248231A1 (en) 2010-09-30
WO2009017878A9 (en) 2009-03-26

Similar Documents

Publication Publication Date Title
CA2688155C (en) High specificity and high sensitivity detection based on steric hindrance & enzyme-related signal amplification
Zhang et al. Sensitive electrochemical biosensor for MicroRNAs based on duplex-specific nuclease-assisted target recycling followed with gold nanoparticles and enzymatic signal amplification
Briones et al. Applications of peptide nucleic acids (PNAs) and locked nucleic acids (LNAs) in biosensor development
EP1784512B1 (en) Electrocatalytic nucleic acid hybridization detection
JP4947355B2 (ja) 増加した感度を持つ核酸検出方法
Fojta et al. Multiply osmium-labeled reporter probes for electrochemical DNA hybridization assays: detection of trinucleotide repeats
Feng et al. QCM detection of DNA targets with single-base mutation based on DNA ligase reaction and biocatalyzed deposition amplification
US20100240030A1 (en) new method for qualitative and quantitative detection of short nucleic acid sequences of about 8-50 nucleotides in length
Li et al. Ultrasensitive electrochemical biosensor for specific detection of DNA based on molecular beacon mediated circular strand displacement polymerization and hyperbranched rolling circle amplification
Laschi et al. Enzyme-amplified electrochemical hybridization assay based on PNA, LNA and DNA probe-modified micro-magnetic beads
Shi et al. Cascaded strand displacement for non-enzymatic target recycling amplification and label-free electronic detection of microRNA from tumor cells
CN103717752B (zh) 核酸分析法
Park et al. QCM sensing of miR-21 by formation of microRNA–DNA hybrid duplexes and intercalation on surface-functionalized pyrene
US11156582B2 (en) Systems for detecting and quantifying nucleic acids
WO2022204427A1 (en) Crispr-mediated cleavage of oligonucleotide-detectable marker conjugates for detection of target analytes
Xu et al. Microfabricated disposable DNA sensors based on enzymatic amplification electrochemical detection
Wang et al. A Sandwich‐Type Electrochemical Biosensor for Detection of BCR/ABL Fusion Gene Using Locked Nucleic Acids on Gold Electrode
Sun et al. Electrochemical DNA biosensor based on proximity-dependent DNA ligation assays with DNAzyme amplification of hairpin substrate signal
WO2006132022A1 (ja) メチルシトシンの簡便検出法
US20040096859A1 (en) Method for detecting and/or quantifying an analyte
Zhang et al. miRNA Electrochemical Detection
Pöhlmann et al. Electrochemical Detection of RNA
Abe et al. Aptamer sensors combined with enzymes for highly sensitive detection

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880101316.2

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08826854

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2688155

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2010510514

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2008826854

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 4365/KOLNP/2009

Country of ref document: IN

Ref document number: 2008826854

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20097027652

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12601774

Country of ref document: US