WO2007033283A2

WO2007033283A2 - Disposable electrode system for detection of selected nucleic acid sequences

Info

Publication number: WO2007033283A2
Application number: PCT/US2006/035743
Authority: WO
Inventors: Daniel M. Jenkins; Diego Barrettino
Original assignee: University Of Hawaii
Priority date: 2005-09-13
Filing date: 2006-09-13
Publication date: 2007-03-22
Also published as: WO2007033283A3

Abstract

A single stranded DNA probe is synthesized to be complementary to the desired target strand, and is functionalized on one terminus with a thiol group and on the other with a reversibly electrooxidizable group such as ferrocene or thionine. The thiol modification allows the probes to be immobilized in a mixed monolayer on the gold surface of an electrode. Self complementary regions near the ends of the DNA probe cause it to self-hybridize into a hairpin loop structure in the absence of target DNA, which effectively constrains the redox active label near the surface of the electrode such that it can be cyclically oxidized and reduced by application of a cycled potential at the electrode. Hybridization to a complementary strand of DNA or RNA causes the probe to undergo a conformational change in which the redox active label is displaced from the surface, impeding the efficiency of electron tranfer from the electrode and resulting in diminished cyclic redox current. Probes to the users specifications may be synthesized using commercially available solid phase techniques amenable to the automated phosphoramidite method.

Description

Disposable electrode system for detection of selected nucleic acid sequences

This application claims the benefit of U.S. Provisional Application No. 60/717,107, filed September 13, 2005, which is hereby incorporated by reference in its entirety.

SUMMARY OF THE INVENTION

The invention provides disposable electrode systems for detection of selected nucleic acid sequences.

Using a DNA hybridization probe on a disposable electrode directly and selectively detects individual nucleic acid sequences. This technology may be used for applications ranging from rapid diagnostics in the field or in clinical settings to identify diseases and gene based disorders, as well as for making inexpensive platforms for gene microarrays.

The technology is based on a single stranded DNA probe which is synthesized to be complementary to the desired target strand, and which is functionalized on one terminus with a thiol group and on the other with a reversibly electrooxidizable group such as ferrocene or thionine. The thiol modification allows the probes to be immobilized in a mixed monolayer on the gold surface of an electrode. Self complementary regions near the ends of the DNA probe cause it to self-hybridize into a hairpin loop structure in the absence of target DNA, which effectively constrains the redox active label near the surface of the electrode such that it can be cyclically oxidized and reduced by application of a cycled potential at the electrode. Hybridization to a complementary strand of DNA or RNA causes the probe to undergo a conformational change in which the redox active label is displaced from the surface, impeding the efficiency of electron tranfer from the electrode and resulting in diminished cyclic redox current. Probes to the users specifications may be synthesized using commercially available solid phase techniques amenable to the automated phosphoramidite method.

A coherent signal depends on coherent alignment of all probe molecules hybridized to the target molecule. Therefore, immobilization of the probes is achieved in the presence of a spacing alkane-thiol group to form a tight monolayer and prevent the interaction of nucleobases of the probe with the gold surface, which would effectively cause the probes to align randomly on the electrode.

Hybridization to the probes is detected by recording peak redox currents as the potential at the gold electrode vs. a reference electrode is cycled through the redox potential of the given label. For example, in probes using a ferrocene label, oxidation current peaks are observed in the vicinity of +80 mV and reduction current peaks are observed in the vicinity of -50 mV against an Ag/AgCl reference electrode in a 0.1 M chloride electrolyte.

When hybridized to a target complementary DNA strand, peak observed redox currents are diminished.

The stringency or selectivity of the hybridization reaction can be controlled by controlling the reaction conditions- especially the ionic strength and temperature. Under certain circumstances, the ionic strength is subject to additional constraints, for example in the case of ferrocene labels a high concentration of sodium perchlorate is used to prevent decomposition of the oxidized ferrocene ion. Temperature control, however, can be used effectively to control the selectivity and to allow discrimination of a single nucleotide mismatch.

To ensure a high degree of selectivity of the probe for the respective target, on-board temperature control capability can be engineered into the electrode system.

Embodiments of detection systems may be used in different ways.

For standard cyclic voltammetry measurements, the physical system uses three electrodes, including a working gold electrode onto which thiolated probes can be immobilized directly, a reference electrode (e.g. consisting of silver chloride patterned onto silver) to stabilize the potentials at which oxidation and reduction occur, and a chemically inert (e.g. gold, platinum, or graphite) auxiliary electrode to source or sink current to the working electrode. These materials may be directly patterned onto a disposable ceramic substrate using pastes available for thick film screen printing processes, or may be electrodeposited onto metallized surfaces of a microarray chip. For microarray implementations, multiple working electrodes can be electrochemically multiplexed to a single reference and auxiliary electrode. To carry out voltammetric measurements at individual working electrodes, a potentiostatic circuit applies a controlled potential at the working electrode vs. the reference electrode, while supplying requisite redox currents at the working electrode from the auxiliary electrode. The potentiostat circuit cycles the applied potential between two prescribed limits (typically but not limited to less than 500 mV in magnitude relative to the reference electrode) at a prescribed scan rate (typically but not limited to 50 to 100 mV per second). To achieve this end, a number of circuits may be implemented in either a stand-alone configuration or in tandem with a microcontroller to allow software control of the voltammetric conditions. For screen printed implementations of the sensor, the potentiostat circuit would be implemented as part of an interfacing circuit into which the sensor plugs in and which has a user interface. For microchip array implementations of the technology, the potentiostat can be integrated with the array and multiplexed to individual working electrodes.

To provide temperature control for the electrode systems, on-board electrical heating capability is included to apply heat directly to the working electrode where hybridization reactions occur, and a temperature detection system is engineered into the working electrode to allow accurate feedback of the thermal conditions. Electrical heating is implemented by applying current to a resistive element underlying the working electrode. Temperature detection is implemented using a number of representative principles amenable to either screen printing processes or to semiconductor fabrication processes. These include thermistors, resistance temperature detectors, thermocouples, and solid state transducers which record potential changes in p-n junctions as a function of temperature.

In a typical configuration for a screen printed integrated electrode system, a small resistive trace is patterned onto the substrate under the location at which the working electrode is to be deposited, and is then covered with a dielectric material to provide electrical insulation between the heater and the working electrode. A thermocouple is implemented for example by using a thermoj unction of silver and nickel onto which the gold working electrode is deposited. The thermocouple is then intimately in thermal contact with the electrode to provide accurate temperature feedback, to allow control of the current in the underlying resistive heating element. For screen printed configurations, temperature detection using thermocouple principles allows a high degree of precision and repeatability between different electrode systems because the response is a material property and is not subject to imperfections in the geometry of the printing process. A representative calibration of the screen printed thermocouple response as a function of the temperature of the surface of the working electrode above ambient controls, applying heat from the underlying heating element. Using this or a similar calibration, any standard feedback control system is used to effectively control the temperature at the electrode surface.

For microarray embodiments, temperature sensing can be implemented directly using solid state sensors fabricated under the metallized electrode surfaces.

As an additional advantage of temperature control, capability of controlling temperature on individual electrodes can effectively allow the implementation of isothermal DNA/RNA replication techniques to amplify the amount of target DNA present- thereby improving sensitivity and limit of detection, as well as improving the selectivity by incorporating an additional mechanism for recognizing only selected nucleic acid sequences. Representative isothermal amplification techniques currently under investigation for use with an integrated electrode include Nucleic Acid Sequence Based Amplification (NASBA), Loop Mediated Amplification (LAMP), and variations of Rolling Circle Amplification (RCA). These technologies allow for the rapid proliferation of targeted sequences, and have an additional advantage over traditional PCR amplification in that they do not require thermal cycling, and as such may be readily adaptable to simple field detection systems. As yet, no data has been collected on the performance of these amplification mechanisms using the integrated electrode system.

Another advantage of the microarray implementation of this technology is that a very simple electrochemical patterning technology is available to localize different probes to different electrode locations on the array. This allows not only the sensor readout but also the probe patterning to be achieved using nothing more than standard computer interfacing technologies such as USB, and without adding incremental expenses beyond the circuitry already required for sensor readout and electrode multiplexing. These and further and other objects and features of the invention are apparent in the disclosure, which includes the above and ongoing written specification, with the claims and the drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is an illustration of principal of hybridization probe.

Figures 2a and 2b schematically show respectively unpredictable augment and orientation of thiol functionalized oligonucleotides immobilized onto gold without β-mercaptoethanol spacers. After application of β-mercaptoethanol or other alkanethiol spacer molecules, a coherent monolayer is formed.

Figure 3 is representative of a cyclic voltammogram of a typical ferrocene labeled DNA probe in the absence of target DNA.

Figures 4a and 4b schematically show oxidation current scans and standard curves (insets) for probes using different DNA sequences.

Figure 5a shows melting curves for probe 2 in absence of DNA (•), hybridized in 10 nM perfect complement oligonucleotide (°), hybridized in 10 nM of single nucleotide mismatch oligonucleotide^), and hybridized in 10 nM partial stem complement oligonucleotide (x).

Figure 5b shows hypothetical temperature induced transitions in probe conformation for hybridized and hybridized probe molecules.

Figure 6 shows a representative embodiment for layout of working electrodie, reference electrode, and auxiliary electrode on an integrated screen printed disposable sensor.

Figures 7a and 7b respectively show a photograph of active sensor area, and a representation of cross section of active area showing the location of different systems in an example of screen printed electrode system with integral heating element and thermocouple for temperature control.

Figures 8a and 8b respectively show representative calibration of on-board temperature sensor and system diagram of a representative control system for electrode temperature.

Figure 9 is a representative circuit for the potentiostat. Figure 10 shows processing steps for fabrication of microhotplates.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Figure 1 shows a disposable electrode system 10 for detection of selected nucleic acid sequences. DNA hybridization probes 1 on a disposable electrode 3 directly and selectively detects individual nucleic acid sequences 5. Applications range from rapid diagnostics in the field or in clinical settings to identify diseases and gene based disorders, as well as for making inexpensive platforms for gene microarrays.

A single stranded DNA probe 1 is synthesized to be complementary to the desired target strand 5, and is functionalized on one terminus 11 with a thiol group 13 and on the other terminus 21 with a reversibly electrooxidizable group 23 such as ferrocene or thionine. The thiol modification allows the probes 1 to be immobilized in a mixed monolayer on the gold surface 4 of an electrode 3. Self complementary regions 15, 25 near the ends of the DNA probe 1 cause it to self-hybridize into a hairpin loop structure 12 in the absence of target DNA 5, which effectively constrains the redox active label 23 near the surface 4 of the electrode 3 such that it can be cyclically oxidized and reduced by application of a cycled potential at the electrode 3. Hybridization 31 to a complementary strand 5 of DNA or RNA causes the probe 1 to undergo a conformational change 33 to a configuration 32 in which the redox active label 23 is displaced from the surface 4, impeding the efficiency of electron tranfer from the electrode and resulting in diminished 37 cyclic redox current 35. Probes 1 may be synthesized to the users specifications using commercially available solid phase techniques amenable to the automated phosphoramidite method.

Figure 1 is an illustration of principle of hybridization probes. Hybridization 31 of self complementary 15, 25 probe 1 immobilized onto gold electrode 3 through thiol terminal 13 results in a conformational change 33 which displaces electroactive label 23 on probe terminus 21 from electrode surface 4, effectively reducing 37 the cyclic redox current 35.

Figure 2a shows an unpredictable augment 49 and orientation of thiol functionalized oligonucleotide probes 1 immobilized onto gold without ^β-mercaptoethanol spacers 43 as shown in Figure 2b. After application of β-mercaptoethanol or other alkanethiol spacer molecules 43, a coherent monolayer 42 is formed, and immobilized oligonucleotide probes 1 reproducibly align 12, 32 in orientations extending away from the electrode surface 4.

A coherent signal 35 depends on coherent alignment 44 of all probe molecules 1 hybridized 31 to the target molecules 5. Therefore, immobilization of the probes 1 is achieved in the presence of a spacing alkane-thiol group 43 to form a tight monolayer 42 and prevent the interaction of nucleobases of the probes 1 with the gold surface 4, which would effectively cause the probes 1 to align randomly 49 on the electrode 3 as shown in Figure 2a.

Figure 3 shows cyclic voltammogram 50 of a typical ferrocene labeled DNA probe in the absence of target DNA.

Hybridization 3 to the probes 1 is detected by recording peak 51 redox currents 35 as the potential 53 at the gold electrode vs. a reference electrode is cycled through the redox potential of the given label 23. For example, in probes using a ferrocene label 23, oxidation current peaks 55 are observed in the vicinity of +80 mV and reduction current peaks 57 are observed in the vicinity of -50 mV against an Ag/ AgCl reference electrode in a 0.1 M chloride electrolyte.

When hybridized to a target complementary DNA strand, peak observed redox currents are diminished as shown in Figures 4a and 4b.

Figures 4a and 4b show oxidation current scans 70 and standard curves 60 in insets for different probe sequences in probes a and b. The sequence of Probe a is 5' Ferrocene - CCTGCCGACCCGGCCGTTGATCGTCGGTCGCAGG - thiol 3 ' . The sequence of Probe b is 5' Ferocene - CGA CGC CTG CCG ACC CGG CCG TTG ATC GTC GGT CGC AGG CGTCG - thiol 3'. The target sequence is 3 ' GCTGGGCCGGC AACT AGC AGCC AG 5'. Bold nucleotides represent bases complementary to bold nucleobases on Probes a and b.

Current scans 70, in order of diminishing peaks 71, 73, 75, 77 and 72, 74, 76, 78 are for probes incubated in absence of DNA, and incubated for 60 minutes in 100 pM, 10 nM, and 1 μM of the target ssDNA sequence. The dashed lines 61 in insets represent the detection limits for the respective probes, and the shaded regions 63 represent the quantity of bacterial DNA commonly found in the vascular tissue of plants symptomatic of bacterial wilt, assuming one gene copy per CFU. Calibration data for probe 1, 1 = 12.6 - 1.15 log[DNA], R² = 0.985, standard error = 0.45 μA, detection limit = 115 fM; for probe 2, 1 = 12.6 - 1.08 log[DNA], R² = 0.981, standard error = 0.48 μA, detection limit = 330 M.

The stringency or selectivity of the hybridization reaction can be controlled by controlling the reaction conditions, especially the ionic strength and temperature. Under certain circumstances, the ionic strength is subject to additional constraints; for example, in the case of ferrocene labels 23, a high concentration of sodium perchlorate is used to prevent decomposition of the oxidized ferrocene ion. Temperature control, however, can be used effectively to control the selectivity to allow discrimination of a single nucleotide mismatch as shown in Figures 5a and 5b.

Figure 5a shows melting curves 80 for probe b in absence of DNA (•), hybridized in 10 nM perfect complement oligonucleotide (o), hybridized in 10 nM of single nucleotide mismatch oligonucleotide (+), and hybridized in 10 nM partial stem complement oligonucleotide (x).

Figure 5b shows hypothetical temperature induced transitions 81, 83, 85 in probe conformation for unhybridized 12 and hybridized 32 probe molecules. Variations 87 in temperature at which peak current occurs shows that sequences 84, 86 with low homology to the probe 1 can be melted from the probe to restore the stem loop structure at low temperatures.

An example of embodiments of the detection system is shown in Figure 6.

For standard cyclic voltammetry measurements, the physical system 100 uses three electrodes 101, 103, 105, including a working gold electrode 101 onto which thiolated probes 1 can be immobilized directly, a reference electrode 103, e.g. consisting of silver chloride patterned onto silver to stabilize the potentials at which oxidation and reduction occur, and a chemically inert, e.g. gold, platinum, or graphite, and an auxiliary electrode 105 to source or sink current to the working electrode 101. These electrode materials may be directly patterned onto a disposable ceramic substrate 107 using pastes available for thick film screen printing processes, or may be electrodeposited onto metallized surfaces of a microarray chip. For microarray implementations, multiple working electrodes 101 can be electrochemically multiplexed to a single electrode reference 103 and a single auxiliary electrode 105. A representative layout for a screen printed disposable electrode system 100 is shown in Figure 6.

Figure 6 shows a representative embodiment for layout of working electrode 101, reference electrode 103, and auxiliary electrode 105 on an integrated screen printed disposable system sensor 100. A typical characteristic dimension for the diameter of the working electrode 101 on a such a system 100 would be about 1 mm.

Figures 7a and 7b show an example of screen printed electrode system 100 with integral heating element 111 and thermocouple 121 for temperature control, including a photograph of the active sensor area 102 and a representation of cross section of active area 102 showing the location of different system elements.

To provide temperature control for the electrode systems 100, on-board electrical heating 110 is included to apply heat directly to the working electrode 101 where hybridization reactions occur. A temperature detection system 120 is provided under the working electrode 101 to allow accurate feedback of the thermal conditions. Electrical heating 110 is implemented by applying current to a resistive element 111 underlying the working electrode 101. Temperature detection is implemented using a number of representative principles amenable to either screen printing processes or to semiconductor fabrication processes. These include thermistors, resistance temperature detectors, thermocouples, and solid state transducers which record potential changes in p-n junctions as a function of temperature.

In a typical configuration for a screen printed integrated electrode system 100, a small resistive trace 111 is patterned onto the substrate 90 under the location at which the working electrode 101 is to be deposited, and then is covered with a dielectric material 91 to provide electrical insulation between the heater 111 and the working electrode 101. A thermocouple 121 is implemented for example by using a thermoj unction of silver and nickel which is coated with dielectric 93 onto which the gold working electrode 101 is deposited. The thermocouple is then intimately in thermal contact with the electrode 101 to provide accurate temperature feedback, to allow control of the current in the underlying resistive heating element 111. A graphical illustration of this configuration is shown in Figures 7a and 7b. Figure 8a shows a representative calibration of on-board temperature sensor. Figure 8b is a system diagram of a representative control system 140 for controlling electrode 101 temperature.

For screen printed configurations, temperature detection using thermocouple principles allows a high degree of precision and repeatability between different electrode systems because the response is a material property and is not subject to imperfections in the geometry of the printing process. A representative calibration of the screen printed thermocouple response as a function of the temperature of the surface of the working electrode above ambient, applying heat from the underlying heating element, is shown in Figure 8a. Using this or a similar calibration, any standard feedback control system is used to effectively control the temperature 130 at the electrode surface, for example, with the temperature control system 140 shown in Figure 8b.

The resistance of the heating element 111 itself may be used to indicate temperature 130, although some precision from sensor to sensor may be sacrified due to dependence of the resistance on the resistor geometry.

The temperature control system 140 supplies power to the heater 111. The temperature 130 of electrode 101 is sensed and a reverse calibration 143 is applied to comparator 145 which sums the reverse calibration 143 and the set point 147 and applies an error signal 149 to the temperature control system 140.

To carry out voltammetric measurements at individual working electrodes 101, a potentiostatic circuit applies a controlled potential at the working electrode 101 vs. the reference electrode 103, while supplying requisite redox currents at the working electrode 101 from the auxiliary electrode 105. The potentiostat circuit cycles the applied potential between two prescribed limits (typically but not limited to less than 500 mV in magnitude relative to the reference electrode) at a prescribed scan rate (typically but not limited to 50 to 100 mV per second). To achieve this end, a number of circuits may be implemented in either a stand-alone configuration or in tandem with a microcontroller to allow software control of the voltammetric conditions. For screen printed implementations of the sensor, the potentiostat circuit would be implemented as part of an interfacing circuit into which the sensor plugs in and which has a user interface. For microchip array implementations of the technology, the potentiostat can be integrated with the array and multiplexed to individual working electrodes 101. Figure 9 is a representative circuit for the potentiostat 150. The potentiostat 150 controls the voltage difference between a working electrode and a reference electrode 103. Both electrodes are contained in an electrochemical cell.

The potentiostat 150 implements this control by injecting current 151 into the cell through an auxiliary or counter electrode 105. In almost all applications, the potentiostat measure the current flow between the working and counter electrodes.

The multiple potentiostat implementations mainly differ in the type of controller used, for example, proportional controller, PID controller, etc. and in the way that the current flows between the working and counter electrode is measured, for example, transimpedance amplifier, current conveyor, etc.

Controller 160 is a voltage divider with a reference voltage 161 established between resistors R₁ and R₂ connected to the voltage source 163 and ground. Inputs to amplifier 165 are reference voltage 167 and sweep voltage 169. The output of the working electrode 101 is aimplified 167 with the V_SW_EB_P and V REF with resistor R₃ and VOU_T provides the working current IWORKING-

For microarray embodiments, temperature control and sensing can be implemented using microhotplates 170 as shown in Figure 10.

The microhotplate fabrication usually relies on an industrial CMOS (Complimentary Symmetry Metal-Oxide Semiconductor) technology with subsequent post processing steps. Different thin-film layers, which can be used for electrical insulation and passivation, are available in the CMOS-process. They are denoted dielectric membrane and include several silicon oxide layers such as the thermal field-oxide, contact oxide and the intermetal oxide, as well as a silicon nitride layer that serves as passivation. All of these materials exhibit characteristically low thermal conductivity, so that a membrane 183, which consists of only the dielectric layers 184, provides excellent thermal insulation between the bulk silicon chip and a heated area. The heated area usually features a resistive heater (for example, a polysilicon or platinum resistor), a temperature sensor (for example, a PN junction or a polysilicon or platinum resister), and electrodes for patterning the DNA proves.

A typical post-processing step is shown in Figure 10. After a photolithography step 171, 50 nm TiW and, afterward, 100 nm Pt are sputtered 173 onto the wafer 175 through a shadow mask 177 to ensure locally defined metal deposition. The electrodes are then patterned using a lift-off process 179. A potassium hydroxide (KOH) etching process 181 with an electrochemical etch stop technology is used to release the membrane 183 with the silicon island 185 underneath the center part.

Another marketable advantage of the microarray implementation of this technology is that a very simple electrochemical patterning technology is available to localize different probes to different electrode locations on the array. This would allow not only the sensor readout but the probe patterning to be achieved using nothing more than standard computer interfacing technologies such as USB, and without adding incremental expenses beyond the circuitry already required for sensor readout and electrode multiplexing.

While the invention has been described with reference to specific embodiments, modifications and variations of the invention may be constructed without departing from the scope of the invention, which is defined in the following claims.

Claims

We claim:

1. Sensor apparatus, comprising: a disposable heated DNA hybridization probe having a substrate; a heating element on the substrate; heating contacts connected to the heating element; a dielectric coating covering the heating element and the heating contacts; a thermocouple disposed on the first dielectric coating; a working electrode contact disposed on the dielectric coating; a dielectric layer covering the thermocouple and the working electrode contact; a working electrode positioned on the dielectric layer; a reference contact on the substrate; a reference electrode on the substrate in contact with the reference contact; an auxiliary contact on the substrate; an auxiliary electrode on the substrate in contact with the auxiliary contact; a single stranded DNA probe which is synthesized to be complementary to a desired DNA or RNA target strand, the single stranded DNA probe having two termini and being functionalized on a first of the two termini with a thiol group, and being functionalized on a second of the two termini with a reversibly electrooxidizable group and constraining termini of the DNA probe near the working electrode for oxidation and reduction by cycling potential and redox current at the working electrode in the absence of a complementary strand of target DNA or RNA₃ wherein hybridization to a complementary strand of target DNA or RNA and diminishes the redox current and senses presence of the target DNA or RNA.

2. The sensor apparatus of claim 1, further comprising a potentiostatic circuit connected to the reference electrode and the working electrode for supplying a controlled potential at the working electrode in relation to the reference electrode and for supplying the redox currents at the working electrode from the auxiliary electrode.

3. The apparatus of claim 1, wherein the working electrode is gold.

4. The apparatus of claim 1 , wherein hybridization is sensed and detected by recording redox oxidation current peaks and reduction current peaks in cycling working potentials between the working electrode and the reference electrode, and observing changes in the redox oxidation current peaks or the reduction current peaks.

5. The apparatus of claim 1 , wherein temperature in the heater is varied for noting when peak currents occur and for melting DNA or RNA sequences with low homology to the probe from the probe for restoring probe loop structure at low temperatures.

6. Sensor apparatus, comprising: a disposable heated DNA hybridization probe having a substrate; a working electrode conductor disposed on the substrate; a gold working electrode positioned on the substrate and connected to the working conductor; a reference conductor on the substrate; a reference electrode on the substrate in contact with the reference conductor; an auxiliary conductor on the substrate; an auxiliary electrode on the substrate in contact with the auxiliary conductor; single stranded DNA probes which are synthesized to be complementary to sensed DNA or RNA target strands, the single stranded DNA probes first termini functionalized with a constraining group, having self-complementary end regions causing self-hybridizing into hair pin loop structures, having second termini functionalized with redox active labels, constraining the end regions of the DNA probe near a surface of the gold working electrode for oxidation and reduction by cycling potential and redox current at the working electrode in the absence of complementary strands of target DNA or RNA, wherein hybridization to complementary strands of target DNA or RNA causes conformation changes and diminishes the redox current and indicates presence of the target DNA or RNA.

7. The apparatus of claim 6, wherein the end regions are functionalized on the first of the two termini with a thiol group, and functionalized on the second of the two termini with the reversibly electrooxidizable groups.

8. The apparatus of claim 6, wherein hybridization is sensed and detected by recording redox oxidation current peaks and reduction current peaks in cycling working potentials between the working electrode and the reference electrode, and observing changes in the redox oxidation current peaks or reduction current peaks.

9. The apparatus of claim 6, further comprising providing a heating element on the substrate.

10. The apparatus of claim 9, wherein temperature in the heating element is varied for noting when peak currents occur and for melting DNA or RNA sequences with low homology to the probe from the probe for restoring the stein loop structure at low temperatures.

11. A sensing method, comprising: providing a substrate; providing a heating element on the substrate; providing heating conductors on the substrate in contact with the heating element; providing a dielectric film on the heating element; providing a working electrode on the dielectric film; providing a reference electrode on the substrate and partially surrounding the working electrode with the reference electrode; providing an auxiliary electrode on the substrate and partially surrounding the reference electrode with the auxiliary electrode; providing working, reference and auxiliary electrode conductors on the substrate and respectively connecting the conductors to the working, reference and auxiliary electrodes; providing a potential to the heating element conductors and heating the working electrode to a controlled temperature; a single stranded DNA probe which is synthesized to be complementary to a desired DNA or RNA target strand, the single stranded DNA probe having two termini and being functionalized on a first of the two termini with a thiol group, and being functionalized on a second of the two termini with a reversibly electrooxidizable group and constraining the first termini of the DNA probe near the working electrode for oxidation and reduction by cycling potential and redox current at the working electrode in the absence of a complementary strand of target DNA or RNA, wherein hybridization to a complementary strand of target DNA or RNA and diminishes the redox current and senses presence of the target DNA or RNA.

12. The sensor apparatus of claim 11 , further comprising providing a potentiostatic circuit connected to the reference electrode and the working electrode and supplying a controlled potential at the working electrode in relation to the reference electrode and supplying the redox currents at the working electrode from the reference electrode.

13. The method of claim 11 , wherein the working electrode is gold.

14. The method of claim 11 , wherein hybridization is sensed and detected by recording redox oxidation current peaks and reduction current peaks in cycling working potentials between the working electrode and the reference electrode, and observing when redox oxidation current peaks and reduction current peaks.

15. The method of claim 11 , wherein temperature in the heating element is varied for noting when peak currents occur and for melting DNA or RNA sequences with low homology to the probe from the probe for restoring probe loop structure at low temperatures.

16. A sensing method, comprising: providing a substrate; holding a gold working electrode on the substrate; providing a reference electrode on the substrate and partially surrounding the working electrode with the reference electrode; providing an auxiliary electrode on the substrate and partially surrounding the reference electrode with the auxiliary electrode; providing working, reference and auxiliary electrode conductors on the substrate and respectively connecting the conductors to the working, reference and auxiliary electrodes; providing single stranded DNA probes which are synthesized to be complementary to sensed DNA or RNA target strands; providing the single stranded DNA probes with self-complementary end regions causing self- hybridizing into hair pin loop structures and constraining first termini of the DNA probes near the gold working electrode, forming redox active labels with reversibly electrooxidizable groups for oxidation and reduction by cycling potential and redox currents at the working electrode in the absence of complementary strands of target DNA or RNA, wherein hybridization to complementary strands of target DNA or RNA changes conformation of the probes and diminishes the redox current peaks and senses presence of the target DNA or RNA.

17. The method of claim 16, wherein the end regions are functionalized on a first of the two termini with a thiol group, and are functionalized on a second of the two termini with the reversibly electrooxidizable groups.

18. The method of claim 16, wherein hybridization is sensed and detected by recording redox oxidation current peaks and reduction current peaks in cycling working potentials between the working electrode and the reference electrode, and observing changes in redox oxidation current peaks or reduction current peaks.

19. The method of claim 16, further comprising providing a heater on the substrate.

20. The method of claim 19, wherein temperature in the heater is varied for noting when peak currents occur and for melting DNA or RNA sequences with low homology to the probe from the probe for restoring the stein loop structure at low temperatures.