WO2006058620A2 - Verfahren zur herstellung von carboxy-terminal amidierten peptiden - Google Patents

Verfahren zur herstellung von carboxy-terminal amidierten peptiden Download PDF

Info

Publication number
WO2006058620A2
WO2006058620A2 PCT/EP2005/012365 EP2005012365W WO2006058620A2 WO 2006058620 A2 WO2006058620 A2 WO 2006058620A2 EP 2005012365 W EP2005012365 W EP 2005012365W WO 2006058620 A2 WO2006058620 A2 WO 2006058620A2
Authority
WO
WIPO (PCT)
Prior art keywords
expression
nucleic acid
acid molecule
peptides
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2005/012365
Other languages
English (en)
French (fr)
Other versions
WO2006058620A3 (de
Inventor
Paul Habermann
Heinrich Decker
Claus Lattemann
Oliver Maneg
Christophe Salagnad
Frank Zocher
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi Aventis Deutschland GmbH
Original Assignee
Sanofi Aventis Deutschland GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to DE502005007161T priority Critical patent/DE502005007161D1/de
Priority to HK08101877.8A priority patent/HK1111426B/xx
Priority to CA2589951A priority patent/CA2589951C/en
Priority to EP05850211A priority patent/EP1819729B8/de
Priority to BRPI0518759-1A priority patent/BRPI0518759A2/pt
Priority to US11/720,006 priority patent/US7939293B2/en
Priority to CN2005800412833A priority patent/CN101068833B/zh
Priority to KR1020077012501A priority patent/KR101299417B1/ko
Priority to DK05850211T priority patent/DK1819729T3/da
Priority to PL05850211T priority patent/PL1819729T3/pl
Priority to MX2007005840A priority patent/MX2007005840A/es
Priority to AT05850211T priority patent/ATE429445T1/de
Application filed by Sanofi Aventis Deutschland GmbH filed Critical Sanofi Aventis Deutschland GmbH
Priority to JP2007543728A priority patent/JP4857279B2/ja
Priority to AU2005312165A priority patent/AU2005312165B2/en
Publication of WO2006058620A2 publication Critical patent/WO2006058620A2/de
Publication of WO2006058620A3 publication Critical patent/WO2006058620A3/de
Priority to IL183467A priority patent/IL183467A0/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/605—Glucagons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/57563—Vasoactive intestinal peptide [VIP]; Related peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to the preparation of carboxy-terminal (C-terminal) amidated peptides, with C-terminal amidated lysine, in particular with the biological activity of GLP-1, their chemical or biotechnological precursors and intermediates, processes for their preparation and their Uses for the production of pharmaceutical products.
  • Patent Application US2004 / 0106547 A1 describes exendin-derived peptides which, due to their hypoglycemic effect, are useful in the treatment of diabetes or other metabolic disorders, e.g. can lead to obesity, as possible drugs play an important role. Due to their physiological mechanism of action, it is currently believed, in particular, that diabetic late effects are less pronounced or greatly delayed.
  • the peptides described in US2004 / 0106547A1 are found to be particularly effective due to the introduction of one or more C-terminal lysine residues, of which the terminal C-terminal is amidated.
  • Called manufacturing process One relates to a biotechnological process in which, after intracellular expression in yeasts, the isolation of the target protein from the cell disruption occurs.
  • peptides which are C-terminally amidated are formed by microorganisms only in traces, so that biotechnological production, as proposed by US2004 / 0106547A1, can only be carried out with great effort or cost-intensive.
  • the application describes the full chemical synthesis of the respective peptides. In this case, a modified Merryfield synthesis is proposed, which is still very expensive and associated with high costs. The reasons for this are, inter alia, that the amino acids used for the synthesis must first be prepared and purified in order to subsequently be chemically determined
  • Enzymes have long been known which are capable of amidating peptides C-terminally. These enzymes are named (Eipper et al., Mol. Endocrinol. 1987 Nov; 1 (11): 1987) Peptidylglycine alpha-amidating enzyme (PAM).
  • PAM Peptidylglycine alpha-amidating enzyme
  • the preparation and purification of such PAM enzymes is familiar to the person skilled in the art and described in detail: Such enzyme preparations are also commercially available in many cases (eg K. Ohsuye et al., Cytotechnology 31, 1999: 85-94, US Pat. No. 4,709,834, US Pat. No. 5,778,934, US Pat. No. 6,250,067, US Pat. No. 6,319,685 , JP0177184).
  • exendin derivatives having a C-terminal sequence of basic amino acids in particular an oligo- or poly-lysine sequence, which furthermore carry a C-terminal glycine residue, are surprisingly recognized by PAM as substrate.
  • amidated peptides are surprisingly made possible, in particular of such amidated peptides as are described in US2004 / 0106547A1, wherein the desired product can be prepared from its C-terminal glycine-extended precursor peptide / protein by means of a single enzymatic step.
  • biologically active peptides which contain one or more basic amino acids, preferably lysine, histidine and / or arginine residues, in particular lysine residues with a C-terminal lysine residues, wherein the last C-terminal lysine residue C -terminally amidated.
  • the peptides produced by the method of the invention have the biological activity of GLP-1, exendin-4, or their biologically active analogs or derivatives.
  • Said Compound No. 2 has the sequence (Seq ID No. 1): NH 2 -HGEGTFTSDL SKQMEEEAVR LFIEWLKNGG PSSGAPPSKK KKKK-NH 2
  • the present invention therefore relates to peptides of the general formula I.
  • AS means one or more genetically encodable amino acid; n is 5-2000, preferably 10-1000, especially 15-500, most preferably 20-400;
  • X is one or more basic amino acid or its derivatives, preferably lysine, histidine and / or arginine, in particular lysine;
  • m is 1-15, preferably 3-10, especially 6-8;
  • Y is one or more charge-neutral amino acid, preferably glycine; p is 1-10, preferably 1-5, especially 1; where n, m and p are integers and (AS) n and / or (AS) nXm are preferably a biologically active peptide or protein.
  • SEQ ID No. 2 NH 2 -HGEGTFTSDL SKQMEEEAVR LFIEWLKNGG PSSGAPPSKK KKKKG (SEQ ID No. 2) and their biologically active derivatives having a homology of at least 60%, preferably 80%, in particular 90%.
  • Nucleic acid molecules coding for a peptide according to the invention preferably DNA, cDNA or RNA molecules
  • the expression cassettes containing nucleic acid molecules according to the invention b) the expression cassettes containing nucleic acid molecules according to the invention
  • vectors containing the nucleic acid molecules of the invention or expression cassettes preferably expression vectors, in particular expression vectors for expression in yeast and / or bacterial cells
  • host cells containing the nucleic acid molecules of the invention, expression cassettes, or vectors, preferably bacterial or
  • Yeast cells optionally additionally co-expressing the enzyme PAM; e) In vitro expression systems that allow the translation of RNA molecules into protein.
  • AS n-Xm-NH 2 (Formula II), wherein AS represents one or more genetically encodable amino acids; n is 5-2000, preferably 10-1000, especially 15-500, most preferably 20-400; and
  • (AS) n and / or (AS) n-Xm is a biologically active peptide or protein, X is one or more basic amino acid or its derivatives, preferably
  • Lysine histidine and / or arginine, especially lysine; m is 1-15, preferably 3-10, especially 6-8; and n and m are integers, and wherein a) the host cells according to the invention are cultured in a suitable nutrient medium, b) the peptides according to the invention are expressed, c) optionally the peptides according to the invention from a suitable nutrient medium, b) the peptides according to the invention are expressed, c) optionally the peptides according to the invention from a suitable
  • the process according to the invention for the preparation of C-terminally amidated peptides preferably serves for the preparation of compounds according to SEQ ID No. 1.
  • the desired peptide / protein sequence is translated into the corresponding DNA sequence, which is coupled to a host-specific promoter sequence.
  • the target peptide can be expressed in such a way that it is formed by the cells remaining intracellularly, directly or indirectly, as a fusion protein.
  • the fusion protein can either be reacted directly with PAM before it is chemically or enzymatically processed to the desired target protein or, in reverse order, first cleaved into the fusion moieties before undergoing amidation by reaction with PAM.
  • the fusion partners must be connected to each other via a bridge member such that the splitting of the partners allows the N-terminus of the target peptide extended by Lys-X m -Gly to be correctly determined according to the Processing is present.
  • a bridge member For the design of the bridge member, there are a variety of ways. If one chooses, for example, the amino acid methionine, then a chemical cleavage with cyanogen halide is possible. If, for example, a pentapeptide of the sequence DDDDK is selected as the bridge member, cleavage with enterokinase is possible.
  • the cleavage can take place via factor Xa.
  • appropriate design can be for proteins whose N terminus start with histidine, using genes nose ® as processing enzyme.
  • enterokinase is described below.
  • the medium either in the form of a fusion protein or directly in native form.
  • genetically modified cells in particular of microorganisms, preferably bacteria or yeasts. If bacterial cells are selected as the expression system, it is also possible to disperse directly into the periplasm or into the culture medium the target protein or a corresponding fusion protein which comprises the target protein.
  • the following host / vector systems are mentioned as examples: bacteria of the type E. coli, S. camosus, Salmonella, Bacillus subtilis or Pseudomonas, and yeasts of the type K. lactis, P. pastoris, Schizosaccharomyces pombe and S. cerevisiae.
  • bacteria of the type E. coli, S. camosus, Salmonella, Bacillus subtilis or Pseudomonas and yeasts of the type K. lactis, P. pastoris, Schizosaccharomyces pombe and S. cerevisiae.
  • yeasts of the type K. lactis, P. pastoris, Schizosaccharomyces pombe and S. cerevisiae.
  • the use of systems based on E. coli K12 or E. coli B is described by way of example below.
  • these systems exemplified offer a variety of possible variations, for example, the choice of suitable promoters or other regulatory nucleic acid
  • An alternative to 'in vitro' amidation using PAM is obtained by coexpressing the enzyme with the precursor protein to be amidated in one and the same host cell. This is achieved by introducing a gene sequence coding for a PAM activity into the host cell under the control of a host-specific regulatory sequence.
  • This expression sequence can either be stably incorporated into the respective chromosomal DNA sequence, or be present on a second plasmid parallel to the expression plasmid for the target protein, or integrated as a second expression cassette on the same vector, or even in a polycistronic expression batch in phase with the Gene sequence encoding the target protein encoded under control of the same promoter sequence.
  • the present invention thus comprises biotechnological processes for the preparation of peptides of the formula I or derivatives thereof which have at least 60%, preferably at least 80%, in particular at least 90% homology to the formula I.
  • the methods of the invention are characterized in that recombinant organisms are produced which synthesize a peptide precursor, which is then in the presence of an enzyme directly or by linking with one or more basic amino acid or derivatives thereof in series, preferably lysine, histidine and / or arginine Residues in series, in particular lysine, wherein the
  • Sequence is C-terminal amidated, can be converted into a peptide corresponding to the formula I.
  • Other subjects of the invention are also the uses of the compounds of the general formula I according to the invention or of the C-terminally amidated peptides of the general formula II which have been prepared by the process according to the invention, in particular the compounds according to SEQ ID No. 1 or 2, for the preparation of a pharmaceutical product or a pharmaceutical formulation, preferably for the treatment of carbohydrate metabolism disorders, particularly preferably for the treatment of diabetes mellitus.
  • the synthesis of the gene sequence was carried out by means of PCR technology.
  • the following 5 primers were prepared by means of chemical DNA synthesis.
  • This synthesis was carried out by means of the Expedite Tm DNA synthesis system.
  • primer zp5u has the sequence (Seq ID No 4): 5'-TTTTTTAAGC TTGCACGGTG AAG -3 '
  • primer zp3a has the sequence (Seq ID No 5): ⁇ ' -CTTCCATCTG TTTGGACAGG TCGGAGGTGA AGGTACCTTC ACCGTGCAAG CTTAAAAAA-3 '
  • Seq ID No 5 covers the range 1-59 of the opposite strand ('antisense')
  • primer zp3b has the sequence (Seq ID No 6):
  • Seq ID No 6 covers the range 40-108 of the opposite strand (antisense 1 ).
  • primer zp3c has the sequence (Seq ID No 7):
  • primer zp3d has the sequence (Seq ID No 8):
  • Seq ID No 8 covers the range 144-197 of the opposite strand ('antisense').
  • reaction 1 the primers zp3a and zp5u were used per 100ng.
  • the PCR cycle number was 5.
  • 1/40 of the reaction was reacted with 100ng each of the primers zp ⁇ u and zp3b in 10 cycles.
  • reaction 3 1/40 of the product of reaction 2 was reacted with 100ng of the primers zp ⁇ u and zp3c in a further 10 cycles.
  • the desired DNA fragment whose length was gel electrophoretically controlled was synthesized.
  • the desired DNA fragment was purified and reacted with the restriction enzymes EcoR1 and then with Hind3 according to the manufacturer (New England Biolabs).
  • DNA of the plasmid pUC19 (New England Biolabs) was reacted with the enzymes EcoR1 and Hind3.
  • the fragments of the cleavage mixtures were separated on a 1, 2% agarose gel and then the residual vector fragment from pUC19 and the desired product from reaction 4 were isolated.
  • the purified fragments were ligated together at 16 ° C. overnight in a T4 ligase reaction.
  • competent E. coli cells (Stratagene, strain E. coli XL10 Gold) were transformed with the ligation mixture and plated out on agar plates containing 25 mg / l ampicillin. Plasmid DNA was isolated from the individual clones and characterized by DNA sequence analysis.
  • the plasmid DNA of the desired fragment was named pSCHPUCZPIO. It served as starting material for the preparation of expression vectors for the synthesis of the precursor peptides according to the invention in E. coli K12 cells.
  • Example 2 Construction of expression vectors containing the precursor peptide AVE 1 - encoding GIy - 44
  • primer Zpjtiiohisf with a BamH1 site (Seq ID No 9): 5'-TTTTTTGGAT CCGGTGATGA CGATGACAAG CACGGTGAAG GTACCTTC-3 '
  • Primer ZP_thiohisrev with an EcoR1 site (Seq ID No 10): 5'-TTTTTTGAAT TCGTCGACCA GGTGC -3 '
  • the primers Zp_thiohisf and ZP_thiohisrev were used under standard conditions.
  • a PCR fragment was generated which, after cleavage with the enzymes BamH1 and EcoR1, is inserted directly into the pTHIOHisA vector, which has been opened correspondingly with BamH1 and EcoR1, in a T4 ligase reaction. Competent E.
  • coli BL21 cells were transformed with the ligation mixture and plated on selective agar containing 25 mg / l ampicillin. From some clones, the plasmid DNA was re-isolated and analyzed by PCR followed by DNA sequence analysis. The desired positive clones, called pTHIOHisAZP10-Gly, were assayed for expression of the fusion protein in a manner analogous to Example 14 of US5496924. Due to the positive expression analysis, a clone was selected and fermented to produce larger amounts of material. The resulting fusion protein comprises thioredoxin linked to AVE i- 44 -Gly via an enterokinase recognition sequence (Seq ID No 12).
  • Seq ID no. 11 GGAAACAGAATTC ATGGCGCCGA CCTCTTCTTC TACCAAAAAG CTCAACTGC AACTGGAACA CCTGCTGCTG GACCTGCAGA TGATCCTGAA CGGTATCAAC AACTACAAAA ACCCGAAACT GACGCGTATC GACGATGACG ATAAACACGG TGAAGGTACC TTCACCTCCG ACCTGTCCAA ACAGATGGAA GAAGAAGCTG TTCGTCTGTT CATCGAATGG CTGAAAAACG GTGGTCCGTC CTCCGGTGCT CCGCCTTCGA AAAAGAAGAA AAAGAAAGGT TGATAATAGC ATGCACGTGC GGCCGCAAGC TTAAAAAA Seq ID no. 12
  • the production of the coding gene sequence was carried out by means of PCR technology.
  • the following primers were synthesized:
  • the sequence of the primer covers the enterokinase recognition site and the beginning of the AVE 1 -44-Gly coding sequence.
  • Primer psw3_zpcolrev (SEQ ID NO 14): 5 '- GTGTTTATCG TCATCGTCGA TACGCGTCAG TTTCGG -3'
  • the sequence corresponds to the synthetic Interleukin2 sequence, which according to Table I of US5496924 covers the amino acids 34 -38 and 2/3 of the codon for the amino acid methionine.
  • the remainder of the primer sequence overlaps with primer psw3_zpcolf.
  • the primer hybridizes upstream with the EcoRI site contained in plasmid pK50 ( Figure 33 of US5496924).
  • Two PCRs were performed in parallel. One was on DNA of the plasmid pK50 with the primer pair and pBprimefi psw3_zpcolrev at 5O 0 C and the other Reaction with the primer pair psw3_zpcolf and psw3_zp10colrev performed at 54 0 C on DNA of the plasmid pTHIOHisAZP10-Gly.
  • the PCR yields were purified after gel electrophoretic separation, mixed each one aliquot in the ratio 1: 1 and then reacted in a third PCR with the primer pair pBprimefi and psw3_zp10colrev.
  • PCR yield was reacted with the enzymes EcoR1 and Hind3 and inserted into the plasmid pK50 opened in parallel with these enzymes in a T4-L.igase reaction.
  • Competent E. coli BL21 cells are transformed with the ligation mixture and plated on selective agar containing 25 mg / l ampicillin. From some clones, plasmid DNA was re-isolated and analyzed by PCR followed by DNA sequence analysis. Positive clones were named pBZP100 and checked for expression of the fusion protein.
  • the expression products were mass spectrometrically and analyzed by SDS-PAGE and the N-terminus determined by protein sequence analysis. A suitable clone for fermenting larger amounts of material was selected.
  • Example 3 Fermentation of the strains constructed in Example 2
  • E. coli BL21 cells, transformed with different for target peptide derivatives (- fusion protein) encoding plasmid vectors were in mineral salt medium or complex medium (see Example 1) at 30 0 C or 37 ° C and a pH value of 7, 0 cultivated in a fermenter.
  • the pH was adjusted with a NH 4 + solution (26% in water).
  • the aeration of the culture was ensured by a control strategy which kept the dissolved oxygen in the culture broth constant at 30%.
  • a glucose solution (60% w / v) was fed (8 g / L / h to 26 g / L / h).
  • AVEi -44 -Gly (fusion protein) in E. coli BL21 / pBZP100 was performed as follows: 100 ⁇ l_ cell suspension were taken from a stored at -80 0 C for continuous culture of E. coli BL21 cells and incubated in 0.5 L of preculture medium at 37 ° C, shaking for 10 16th The main culture in the fermenter was inoculated to an inoculation density of 0.01 to 0.05 OD ⁇ oo with the appropriate amount of preculture.
  • Pre-culture medium 5 g / L Bacto tryptone 10 g / L yeast extract 5 g / L NaCl
  • mineral salt medium (minimal medium) based on glucose as carbon source (Jeffrey H. Miller: Experiments in Molecular Genetics, ColD Spring Harbor Laboratory (1972)).
  • the supernatant was pressure-filtered (Sartorius 0.22 ⁇ m filter, type 111) and applied to a chromatography column (Source S, Amersham Biosciences) previously equilibrated with buffer (50 mM Tris / HCl pH 7.3; 1 mM EDTA). After sample application, a wash step was performed with equilibration buffer (2 column volumes), followed by another wash with 10% high salt buffer (50 mM Tris / HCl pH 7.3, 1 M NaCl, 1 mM EDTA). The fractionation was carried out by applying a salt gradient using high salt buffer over 5 column volumes.
  • the fusion protein content of the individual fractions was tested by SDS gel electrophoresis (NuPage ® Novex 12% gel system, Invitrogen). Fusion protein-containing fractions were pooled and concentrated between 5 and 10-fold (Millipore ultrafiltration cell, 10 kDa cut-off membrane). The concentrate was used after buffer exchange in enterokinase buffer (50 mM Tris / HCl pH 7.4, 50 mM NaCl, 2 mM CaCl 2 ) directly for the protease cleavage reaction, or additionally purified before the cleavage reaction via gel filtration (Superdex 75, Amersham Biosciences).
  • enterokinase buffer 50 mM Tris / HCl pH 7.4, 50 mM NaCl, 2 mM CaCl 2
  • the cleavage of the fusion proteins was carried out by enterokinase (Invitrogen) in enterokinase buffer (20 mM Tris / HCl, 50 mM NaCl, 2 mM CaCl 2 pH 7.4) according to the manufacturer.
  • the concentrate was further purified by gel filtration chromatography (Superdex 75, Amersham Biosciences) A pre-equilibrated column (50 mM Tris / HCl pH 7.4, 200 mM NaCl) was loaded with concentrated fusion protein solution up to 5% of the column volume equilibration buffer. the fusion protein content of the individual fractions was again on SDS-gel electrophoresis ((NuPage ® Novex 12% gel system, Invitrogen TM.
  • Example 6 Separation of the cleavage products from the enterokinase cleavage reaction
  • the cleavage products were separated from each other by ion exchange chromatography (Source 3OS, Amersham Biosciences). The ionic strength of the solution was brought to about 10 mS / cm by adding sodium chloride. After loading the protein solution onto the previously equilibrated column (20 mM Tris / HCl, pH 7.4, adjusted to a conductivity of about 10 mS / cm with NaCl), unbound material with buffer (20 mM Tris / HCl, pH 7.4; NaCI adjusted to a conductivity of about 10 mS / cm) washed out. The elution of the AveI 44 -Gly peptide was done by applying a gradient over 10 column volumes to 500 mM NaCl.
  • the identification AVEi -44 -containing fractions or precursors to AVEi -44 was performed by SDS-gel electrophoresis, HPLC and mass spectrometry. The appropriate fractions were pooled and lyophilized after removal of organic solvent. Finally, the isolated AVE 1-44 gene was completely sequenced via Edman to secure the amino acid sequence.
  • the reaction was carried out with the aid of the enzyme PAM (Peptidiylglycine-amidating enzymes Wako Pure Chemicals Ind., Ltd. (Order No. 161-16971)) according to the reaction conditions of the manufacturer.
  • PAM Peptidiylglycine-amidating enzymes Wako Pure Chemicals Ind., Ltd. (Order No. 161-16971)
  • the solution was preincubated at 37 ° C for 1 h and then the protein solution AVEi -44 Gly (Tris / HCl pH 7.0, 80 ⁇ g / ml final concentration) was added. The reaction mixture was then further incubated at 37 ° C. The course of the reaction is monitored by sampling at different times. At maximum reaction, the reaction was stopped by addition of a 50 mM EDTA solution.
  • reaction mixture was then separated by ion exchange chromatography (Shodex Co., column type IEC CM-825 (8 ⁇ 75 mm)). The following gradient was applied to this column:
  • the column was operated at room temperature at a flow rate of 2 ml / min or 1 ml / min.
  • the eluted fractions (detection at 280 nm) were collected and the mass of the respective peptide was determined by MALDI-MS.
  • the mass spectrometric analyzes were carried out with a BRUKER Reflex IV device. The samples were used directly for the MALDI-MS analysis, or diluted to a concentration of about 50 pmol / ⁇ L with 50% TAaq ([1 +1] 0.1% TFA + 50% acetonitrile).
  • the expected mass for the AVEi -44 - NH 2 was confirmed.
  • the product obtained can be supplied for further pharmaceutical use.
  • compositions can be further prepared by adding suitable pharmaceutical formulation adjuvants to the biologically active peptide or peptide derivative in a manner known to those skilled in the art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Endocrinology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Diabetes (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Vascular Medicine (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Emergency Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Die vorliegende Erfindung betrifft die Herstellung von Carboxy-terminal (C-terminal) amidierten Peptiden, mit C-terminal amidiertem Lysin, insbesondere mit der biologischen Aktivität von GLP-1, deren chemische bzw. biotechnologische Vorstufen und Zwischenprodukte, Verfahren zu deren Herstellung sowie deren Verwendungen zur Herstellung pharmazeutischer Produkte.

Description

Verfahren zur Herstellung von Carboxy-terminal amidierten Peptiden
Die vorliegende Erfindung betrifft die Herstellung von Carboxy-terminal (C-terminal) amidierten Peptiden, mit C-terminal amidiertem Lysin, insbesondere mit der biologischen Aktivität von GLP-1 , deren chemische bzw. biotechnologische Vorstufen und Zwischenprodukte, Verfahren zu deren Herstellung sowie deren Verwendungen zur Herstellung pharmazeutischer Produkte.
Die Zahl der an Diabetes oder Obesitas erkrankten Menschen steigt weltweit mit hohen Zuwachsraten an. Es ist daher zu erwarten, dass Medikamente, die im Feld dieser Erkrankung hohen therapeutischen Nutzen zeigen, in steigender Qualität und Menge zugänglich gemacht werden müssen.
Patentanmeldung US2004/0106547 A1 beschreibt von Exendin abgeleitete Peptide, die aufgrund ihrer Blutzucker-senkenden Wirkung in der Behandlung von Diabetes oder anderen Stoffwechselstörungen, die z.B. zur Fettleibigkeit führen können, als mögliche Medikamente eine wichtige Rolle spielen. Aufgrund ihres physiologischen Wirkungsmechanismus vermutet man derzeit insbesondere, dass sich diabetische Spätfolgen weniger ausgeprägt bzw. stark verzögert einstellen.
Die in US2004/0106547A1 beschriebenen Peptide erweisen sich aufgrund der Einführung von einem oder mehreren C-terminalen Lysinresten, von denen das endständige C-terminal amidiert ist, als besonders wirksam.
Für die Herstellung dieser Peptide werden in US2004/0106547A1 verschiedene
Herstellverfahren genannt. Eines betrifft ein biotechnologisches Verfahren, worin nach intrazellulärer Expression in Hefen die Isolation des Zielproteins aus dem Zellaufschluss erfolgt. Peptide, die C-terminal amidiert sind, werden von Mikroorganismen aber nur in Spuren gebildet, so dass eine biotechnologische Herstellung, wie sie US2004/0106547A1 vorschlägt, nur mit großem Aufwand bzw. kostenintensiv erfolgen kann. Alternativ beschreibt die Anmeldung die chemische Vollsynthese der jeweiligen Peptide. Dabei wird eine modifizierte Merryfield-Synthese vorgeschlagen, welche aber immer noch sehr aufwendig und mit hohen Kosten verbunden ist. Die Gründe hierfür liegen u.a. darin, dass die zur Synthese verwendeten Aminosäuren zunächst hergestellt und gereinigt werden müssen, um anschließend nach chemischer
Modifikation in der Peptidsynthese als Reaktanden spezifisch eingesetzt zu werden. Am Ende der Synthese müssen die Schutzgruppen entfernt werden und das Zielpeptid bzw. Produkt gereinigt werden, bevor es als Pharmazeutikum formuliert werden kann. Die chemische Vollsynthese ist also mit hohem und im ökologischen Sinn wenig vorteilhaftem Aufwand durchführbar.
Es sind bereits seit langem Enzyme bekannt, die in der Lage sind, Peptide C-terminal zu amidieren. Diese Enzyme tragen den Namen (Eipper et al. Mol. Endocrinol.1987 Nov;1 (11):1987) Peptidylglycine alpha-amidating Enzym (PAM) . Die Herstellung und Reinigung solcher PAM-Enzyme ist dem Fachmann geläufig und im Detail beschrieben: Solche Enzympräparationen sind darüber hinaus vielfach kommerziell erhältlich (z.B. K.Ohsuye et al., Cytotechnology 31 ,1999: 85-94, US4708934, US5789234, US6255067, US6319685, JP0177184).
Bradbury et al. (Biochem. Biophys Res. Commun. (1983) 112(2):372-377 zeigten 'in vitro', dass PAM als Substrat vorzugsweise Peptide erkennt, deren C-Terminus durch die Aminosäure Glycin gebildet wird. Sie beschreiben ferner, dass basische Aminosäuren in N-terminaler Position zu Glycin die Reaktionsgeschwindigkeit des PAM stark verlangsamen.
Es wurde nun gefunden, dass Exendin-Derivate mit einer C-terminalen Sequenz basischer Aminosäuren, insbesondere einer oligo- bzw. poly-Lysin-Sequenz, die ferner einen C-terminalen Glycin-Rest tragen, überraschend gut von PAM als Substrat erkannt werden.
Somit wird erfindungsgemäß überraschenderweise eine wesentlich kostengünstigere biotechnologische Herstellung von amidierten Peptiden ermöglicht, insbesondere solcher amidierter Peptide, wie sie in US2004/0106547A1 beschrieben sind, wobei das gewünschte Produkt aus seinem C-terminal um Glycin verlängerten Vorläufer- peptid/protein mittels eines einzigen enzymatischen Schrittes darstellbar ist.
In dem erfindungsgemäßen Verfahren werden biologisch aktive Peptide dargestellt, die ein oder mehrere basische Aminosäuren, vorzugsweise Lysin-, Histidin- und/oder Arginin-Reste, insbesondere Lysin-Reste mit einem C-terminale Lysinreste enthalten, wobei der letzte C-terminale Lysinrest C-terminal amidiert ist. Vorzugsweise weisen die nach dem erfindungsgemäßen Verfahren hergestellten Peptide die biologische Aktivität von GLP-1 , Exendin-4, oder deren biologisch aktiver Analoga oder Derivate auf.
Die vorliegende Erfindung erlaubt somit insbesondere die biotechnologische Darstellung der Verbindung Nr. 2 aus US2004/0106547. Die besagte Verbindung Nr. 2 hat die Sequenz (Seq ID No 1): NH2-HGEGTFTSDL SKQMEEEAVR LFIEWLKNGG PSSGAPPSKK KKKK-NH2
Gegenstand der vorliegenden Erfindung sind daher Peptide der allgemeinen Formel I
(AS)n-XmYp (Formel I),
worin
AS eine oder mehrere genetisch codierbare Aminosäure bedeutet; n 5-2000 ist, vorzugsweise 10-1000, insbesondere 15-500, ganz besonders bevorzugt 20-400;
X ein oder mehrere basische Aminosäure oder deren Derivate, vorzugsweise Lysin, Histidin und/oder Arginin, insbesondere Lysin bedeutet; m 1-15 ist, vorzugsweise 3-10, insbesondere 6-8;
Y eine oder mehrere ladungsneutrale Aminosäure bedeutet, vorzugsweise Glycin; p 1-10 ist, vorzugsweise 1-5, insbesondere 1 ; wobei n, m und p ganze Zahlen bedeuten und (AS)n und/oder (AS)nXm vorzugsweise ein biologisch aktives Peptid bzw. Protein bedeuten. Ganz besonders bevorzugt sind die Verbindungen der Formel I nach Seq ID No 2: NH2- HGEGTFTSDL SKQMEEEAVR LFIEWLKNGG PSSGAPPSKK KKKKG (Seq ID No 2) sowie deren biologisch aktive Derivate mit einer Homologie von mindestens 60%, vorzugsweise 80%, insbesondere 90%.
Weitere Erfindungsgegenstände vorliegender Erfindung sind auch: a) Nukleinsäuremoleküle, codierend für ein erfindungsgemäßes Peptid, vorzugsweise DNS-, cDNS oder RNS-Moleküle; b) die erfindungsgemäßen Nukleinsäuremoleküle enthaltenden Expressionskassetten; c) Vektoren, enthaltend die erfindungsgemäßen Nukleinsäuremoleküle oder Expressionskassetten, vorzugsweise Expressionsvektoren, insbesondere Expressionsvektoren für die Expression in Hefe- und/oder Bakterienzellen; d) Wirtszellen, enthaltend die erfindungsgemäßen Nukleinsäuremoleküle, Expressionskassetten, oder Vektoren, vorzugsweise Bakterien- oder
Hefezellen, gegebenenfalls zusätzlich das Enzym PAM co-exprimierend; e) In vitro Expressionssysteme, die die Translation von RNS -Molekülen in Protein erlauben.
Noch ein weiterer Erfindungsgegenstand sind auch Verfahren zur Herstellung von C- terminal amidierten Peptiden der allgemeinen Formel Il
(AS)n-Xm-NH2 (Formel II), worin AS eine oder mehrere genetisch codierbare Aminosäure bedeutet; n 5-2000 ist, vorzugsweise 10-1000, insbesondere 15-500, ganz besonders bevorzugt 20-400; und
(AS)n und/oder (AS)n-Xm ein biologisch aktives Peptid bzw. Protein bedeutet, X ein oder mehrere basische Aminosäure oder deren Derivate, vorzugsweise
Lysin, Histidin und/oder Arginin, insbesondere Lysin bedeutet; m 1-15 ist, vorzugsweise 3-10, insbesondere 6-8; und n und m ganze Zahlen bedeuten, und worin man a) die erfindungsgemäßen Wirtszellen in einem geeigneten Nährmedium kultiviert, b) die erfindungsgemäßen Peptide exprimiert, c) gegebenenfalls die erfindungsgemäßen Peptide aus einem geeigneten
Vorläuferpeptid mittels enzymatischer Spaltung freisetzt; d) die Expressionsprodukte aus Schritt b) bzw. die Zwischenprodukte aus Schritt c), gegebenenfalls nach erfolgter Aufreinigung mit einem alpha-amidierenden Enzym zu Verbindungen der allgemeinen Formel Il umsetzt; und e) die Verbindungen der allgemeinen Formel Il in geeigneter Weise aufreinigt, vorzugsweise durch präparative chromatographische Verfahren.
Dabei ist dem Fachmann bewußt, dass auch die Kombinationen bekannter biochemischer bzw. biophysikalischer Trennmethoden zu dem gewünschten Reinigungserfolg führen können.
Vorzugsweise dient das erfindungsgemäße Verfahren zur Herstellung von C-terminal amidierten Peptiden der Herstellung von Verbindungen gemäß Seq ID No 1.
Zunächst wird im Rahmen des erfindungsgemäßen Verfahrens die Fähigkeit von Mikroorganismen ausgenutzt, heterologe Peptide/Proteine herzustellen. Dazu übersetzt man die gewünschte Peptid/Proteinsequenz in die entsprechende DNA- Sequenz, die an eine wirtsspezifische Promotorsequenz gekoppelt wird. Je nach Expressionsstrategie kann man dabei das Zielpeptid so exprimieren, dass es von den Zellen intrazellulär verbleibend direkt oder indirekt als Fusionsprotein gebildet wird. Das Fusionsprotein kann entweder direkt mit PAM umgesetzt werden, bevor es chemisch oder enzymatisch zu dem gewünschten Zielprotein prozessiert wird, oder es wird - in umgekehrter Abfolge - zuerst in die Fusionsteile gespalten, bevor die Amidierung durch Umsetzung mit PAM erfolgt. Wählt man eine Fusionsstrategie, dann ist dem Fachmann klar, dass die Fusionspartner über ein Brückenglied miteinander verbunden sein müssen, dass die Aufspaltung der Partner so erlaubt, dass der N- Terminus des um Lys-Xm-Gly verlängerten Zielpeptides korrekt nach der Prozessierung vorliegt. Für die Ausgestaltung des Brückengliedes gibt es eine Vielzahl von Möglichkeiten. Wählt man z.B. die Aminosäure Methionin, so wird eine chemische Spaltung mit Halogencyan möglich. Wählt man z.B. als Brückenglied ein Pentapeptid der Sequenz DDDDK so ist eine Spaltung mit Enterokinase möglich. Wählt man z.B. die Tetrapeptidsequenz IEGR, so kann die Abspaltung über Faktor Xa erfolgen. Bei entsprechender Ausgestaltung kann man für Proteine, deren N-Terminus mit Histidin beginnen, Genenase® als Prozessierungsenzym verwenden. Im Beispielteil wird nachfolgend die Abspaltung mittels Enterokinase beschrieben.
Alternativ kann man aber auch das Zielpeptid, wenn es exportkompatibel ist, in das Medium entweder in Form eines Fusionsproteins oder direkt in nativer Form ausschleusen. Dafür kann man gentechnisch modifizierte Zellen, insbesondere von Mikroorganismen, vorzugsweise Bakterien oder Hefen, verwenden. Wählt man Bakterienzellen als Expressionssystem hat man ferner die Option, direkt das Zielprotein oder ein entsprechendes Fusionsprotein, welches das Zielprotein umfasst, in das Periplasma oder in das Kulturmedium auszuschleusen.
Dem Fachmann sind die hierfür grundsätzlich zur Verfügung stehenden Wirtsorganismen und Methoden bekannt. Diese sind zum großen Teil auch kommerziell von einer Vielzahl von Anbietern erhältlich. Stellvertretend seien die Firmen New England Biolabs, Invitrogen und Roche genannt. In den Katalogbeschreibungen solcher Firmen finden sich Literaturzitate, die einen Überblick über die Technologie liefern.
Dem Fachmann ist dabei auch klar, dass sich das Spektrum der zur Verwendung kommenden Mikroorganismen ständig erweitert, ebenso wie das biotechnologische Methodenrepertoire. Auch die in dieser Hinsicht spezialisierten Ausführungsformen werden vom Gegenstand der vorliegenden Erfindung umfasst.
Stellvertretend werden beispielhaft folgende Wirts/Vektorsystemen genannt: Bakterien des Typs E.coli , S.camosus, Salmonella, Bacillus subtilis oder Pseudomonas sowie Hefen vom Typ K. lactis, P. pastoris, Schizosaccharomyces pombe und S. cerevisiae. Nachfolgend ist beispielhaft die Verwendung von Systemen basierend auf E. coli K12 bzw. E. coli B beschrieben. Dem Fachmann ist jedoch bewusst, dass diese beispielhaft genannten Systeme eine Vielzahl von Variationsmöglichkeiten bieten, die sich z.B. aus der Wahl geeigneter Promotoren oder anderer regulatorischer Nukleinsäurese- quenzen, den genetischen Eigenschaften der Wirtszelle und der verwendeten Vektoren ergeben (z.B. Kopienzahl der DNA, Selektionsmittel etc.). Es ist dem Fachmann zudem klar, dass die im Text beschriebenen Ausführungsbeispiele nur eine sehr kleine Auswahl in Bezug auf die tatsächlich realisierbaren Möglichkeiten darstellen.
Eine Alternative zu der ,in vitro'-Amidierung mittels PAM ergibt sich, wenn man das Enzym mit dem zu amidierenden Vorläuferprotein in ein und derselben Wirtszelle co-exprimiert. Dies erreicht man, indem man eine Gensequenz, die für eine PAM- Aktivität kodiert unter Kontrolle einer wirtsspezifischen Regulationssequenz in die Wirtszelle einbringt. Diese Expressionssequenz kann entweder stabil in die jeweilige chromosomale DNA Sequenz eingebaut sein, oder auf einem zweiten Plasmid parallel zu dem Expressionsplasmid für das Zielprotein vorliegen, oder als zweite Expressionskassette auf ein und demselben Vektor integriert sein, oder sogar in einem polycistronischen Expressionsansatz in Phase mit der Gensequenz, die das Zielprotein kodiert unter Kontrolle der gleichen Promotor Sequenz Moniert sein.
Die vorliegende Erfindung umfasst somit biotechnologische Verfahren zur Herstellung von Peptiden der Formel I oder deren Derivate, die mindestens 60%, vorzugsweise mindestens 80%, insbesondere mindestens 90% Homologie zur Formel I aufweisen.
Die erfindungsgemäßen Verfahren sind dadurch gekennzeichnet, dass rekombinante Organismen hergestellt werden, die einen Peptidvorläufer synthetisieren, der anschließend in Gegenwart eines Enzyms direkt oder durch Verknüpfung mit einer oder mehreren basischen Aminosäure oder deren Derivaten in Reihe, vorzugsweise Lysin-, Histidin- und/oder Arginin-Resten in Reihe, insbesondere Lysin, wobei die
Sequenz C-terminal amidiert ist, in ein Peptid entsprechend der Formel I umgewandelt werden kann. Weitere Erfindungsgegenstände sind auch die Verwendungen der erfindungsgemäßen Verbindungen der allgemeinen Formel I oder der C-terminal amidierten Peptide der allgemeinen Formel II, die nach dem erfindungsgemäßen Verfahren hergestellt wurden, insbesondere der Verbindungen gemäß Seq ID No 1 oder 2, zur Herstellung eines pharmazeutischen Produktes oder einer pharmazeutischen Formulierung, vorzugsweise zur Behandlung von Kohlenhydratstoffwechsel-Störungen, besonders bevorzugt zur Behandlung von Diabetes mellitus.
Beispiele
Beispiel 1. Synthese einer E.coli spezifischen DNA Sequenz kodierend für AVE 1-44-GIy
Zunächst wurde die Gensequenz Seq ID No. 3 kodierend für das Peptid AVE -ι-44-Gly (Seq ID No. 2) hergestellt:
Seq ID No. 3 TTTTTTAAGCTTG CACGGTGAAG GTACCTTCAC CTCCGACCTG TCCAAACAGA TGGAAGAAGA AGCTGTTCGT CTGTTCATCG AATGGCTGAA AAACGGTGGT CCGTCCTCCG GTGCTCCGCC TTCGAAAAAG AAGAAAAAGA AAGGT TGATA ATAGCATGCA CGTGCGGCCG CACCTGGTCGA CGAATTCAAA AAAA
Die Synthese der Gensequenz erfolgte mittels PCR-Technologie. Dazu wurden die folgenden 5 Primer mittels chemischer DNA-Synthese hergestellt. Diese Synthese erfolgte mittels des ExpediteTm DNA-Synthese-Systems.
a) Primer zp5u hat die Sequenz (Seq ID No 4): 5'- TTTTTTAAGC TTGCACGGTG AAG -3'
Seq ID No 4 umfasst den Bereich 1-23 des Sinn-Stranges (,sense'). b) Primer zp3a hat die Sequenz (Seq ID No 5): δ'-CTTCCATCTG TTTGGACAGG TCGGAGGTGA AGGTACCTTC ACCGTGCAAG CTTAAAAAA-3'
Seq ID No 5 umfasst den Bereich 1-59 des Gegenstranges (,antisense')
c) Primer zp3b hat die Sequenz (Seq ID No 6):
5'- GGACGGACCA CCGTTTTTCA GCCATTCGAT GAACAGACGA ACAGCTTCTT CTTCCATCTG TTTGGACAG -3' Seq ID No 6 umfasst den Bereich 40-108 des Gegenstranges (.antisense1).
d) Primer zp3c hat die Sequenz (Seq ID No 7):
5- GTGCATGCTA TTATCAACCT TTCTTTTTCT TCTTTTTCGA AGGCGGAGCACCGGAGGACG GACCACCGTT TTTC -3' Seq ID No 7 umfasst den Bereich 91-164 des Gegenstranges (.antisense').
e) Primer zp3d hat die Sequenz (Seq ID No 8):
5'- TTTTTTGAAT TCGTCGACCA GGTGCGGCCG CACGTGCATG
CTATTATCAA CCTT -3'
Seq ID No 8 umfasst den Bereich 144-197 des Gegenstranges (,antisense').
Mit den Primern wurden in Folge 4 PCR-Reaktionen unter Standard-Bedingungen bei 540C durchgeführt. In Reaktion 1 wurden je 100ng der Primer zp3a und zp5u eingesetzt. Die PCR -Zyklenzahl war 5. In der zweiten Reaktion wurde 1/40 der Reaktion mit je 100ng der Primer zpδu und zp3b in 10 Zyklen umgesetzt. In Reaktion 3 wurden in weiteren 10 Zyklen 1/40 des Produktes der Reaktion 2 mit je 100ng der Primer zpδu und zp3c umgesetzt. Schließlich wurde in 25 PCR Zyklen mit 1/40 der Ausbeute aus Reaktion 3 und den Primern zpδu und zp3d das gewünschte DNA- Fragment synthetisiert, dessen Länge gelelektrophoretisch kontrolliert wurde. Das gewünschte DNA-Fragment wurde gereinigt und mit den Restriktionsenzymen EcoR1 und anschließend mit Hind3 nach Angaben des Herstellers (New England Biolabs) umgesetzt. Parallel wurde DNA des Plasmides pUC19 (New England Biolabs) mit den Enzymen EcoR1 und Hind3 umgesetzt. Die Fragmente der Spaltansätze wurden über ein 1 ,2%- iges Agarosegel separiert und anschließend das Restvektorfragment aus pUC19 und das gewünschte Produkt aus Reaktion 4 isoliert. Die gereinigten Fragmente wurden in einer T4-Ligase-Reaktion miteinander über Nacht bei 160C ligiert. Anschließend wurden kompetente E.coli Zellen (Stratagene, Stamm E. coli XL10 Gold), mit dem Ligationsansatz transformiert und auf Agarplatten enthaltend 25mg/i Ampicillin ausplattiert. Aus den Einzelklonen wurde Plasmid-DNA isoliert und mittels DNA Sequenzanaiyse charakterisiert.
Die Plasmid-DNA des gewünschten Fragmentes erhielt die Bezeichnung pSCHPUCZPIO. Sie diente als Ausgangsmaterial zur Herstellung von Expressionsvektoren zur Synthese der erfindungsgemäßen Vorläuferpeptide in E.coli K12 Zellen.
Beispiel 2: Konstruktion von Expressionsvektoren, die das Vorläuferpeptid AVE 1-44- GIy kodieren
Zur Herstellung des Peptides AVE 1.44 - GIy wurde die kodierende Sequenz in den Vektor pThioHisA der Firma Invitrogen (Catalog No. K360-01) eingeführt. Es entstand ein Fusionsprotein aus Thioredoxin, das über die Enterokinase- Erkennungssequenz DDDDK mit dem Vorläuferpeptid AVE 1-44 - GIy verbunden ist. Durch Umsetzung mittels Enterokinase (Invitrogen) wurde AVE -ι-44-Gly freigesetzt und kann anschließend gemäß Beispiel 7 (unten) in Gegenwart von PAM (Wako Pure Chemicals Ind., Ltd) in das Zielprotein AVE i-44 - NH2 umgewandelt werden.
Zwei Primer mit folgender Sequenz werden synthetisiert: Primer Zpjtiiohisf mit einer BamH1 -Schnittstelle (Seq ID No 9): 5'- TTTTTTGGAT CCGGTGATGA CGATGACAAG CACGGTGAAG GTACCTTC-3'
Primer ZP_thiohisrev mit einer EcoR1 -Schnittstelle (Seq ID No 10): 5' - TTTTTTGAAT TCGTCGACCA GGTGC -3' In einer PCR-Reaktion mit pSCHPUCZPIO DNA als Template' wurden die Primer Zp_thiohisf und ZP_thiohisrev unter Standardkonditionen eingesetzt. Es entstand ein PCR-Fragment, das nach Spaltung mit den Enzymen BamH1 und EcoR1 direkt in den - entsprechend mit BamH1 und EcoR1 geöffneten - pTHIOHisA-Vektor in einer T4- Ligasereaktion eingesetzt wird. Kompetente E. coli BL21 Zellen wurden mit dem Ligationsgemisch transformiert und auf selektivem Agar ausplattiert, der 25mg/l Ampicillin enthielt. Von einigen Klonen wurde die Plasmid-DNA re-isoliert und mittels PCR und anschließender DNA-Sequenzanalyse analysiert. Die gewünschten positiven Klone, die pTHIOHisAZP10-Gly genannt wurden, wurden in analoger Weise gemäß Beispiel 14 des Patents US5496924 auf Expression des Fusionsproteins überprüft. Aufgrund der positiven Expressionsanalyse wurde ein Klon ausgewählt und zur Herstellung von größeren Materialmengen fermentiert. Das entstehende Fusionsprotein umfasst Thioredoxin, das über eine Enterokinaseerkennungs-Sequenz mit AVE i-44-Gly verbunden ist (Seq ID No 12).
US5496924, deren Inhalt hiermit ausdrücklich durch Referenz in die vorliegende Anmeldung aufgenommen wird, schlägt ein Expressionssystem vor, das grundsätzlich die Herstellung von maßgeschneiderten Fusionsproteinen erlaubt. Der Vorteil des Systems liegt darin, dass man Fusionsproteine mit kleinem Ballastanteil herstellen kann. Fusioniert man die Sequenzabschnitte A-B über die Enterokinase- Erkennungssequenz DDDDK mit AVE 1-44 - GIy, so erhält man ein Fusionsprotein, mit folgender Gen- und Aminosäuresequenz (Seq ID No. 11 und 12):
Seq ID No. 11 GGAAACAGAATTC ATGGCGCCGA CCTCTTCTTC TACCAAAAAG CTCAACTGC AACTGGAACA CCTGCTGCTG GACCTGCAGA TGATCCTGAA CGGTATCAAC AACTACAAAA ACCCGAAACT GACGCGTATC GACGATGACG ATAAACACGG TGAAGGTACC TTCACCTCCG ACCTGTCCAA ACAGATGGAA GAAGAAGCTG TTCGTCTGTT CATCGAATGG CTGAAAAACG GTGGTCCGTC CTCCGGTGCT CCGCCTTCGA AAAAGAAGAA AAAGAAAGGT TGATAATAGC ATGCACGTGC GGCCGCAAGC TTAAAAAA Seq ID No. 12
MAPTSSSTKK TQLQLEHLLL DLQMILNGIN NYKNPKLTRI DDDDKHGEGT FTSDLSKQME EEAVRLFIEW LKNGGPSSGA PPSKKKKKKG
Die Herstellung der kodierenden Gensequenz erfolgte mittels PCR-Technologie. Dazu wurden folgende Primer synthetisiert:
1) Primer psw3_zpcolf (Seq ID No 13):
5'- CGTATCGACG ATGACGATAA ACACGGTGAA GGTACCTTC -3'
Die Sequenz des Primers überdeckt dabei die Enterokinaseerkennungstelle und den Anfang der AVE 1-44 - GIy kodierenden Sequenz.
2) Primer psw3_zpcolrev (Seq ID No 14): 5'- GTGTTTATCG TCATCGTCGA TACGCGTCAG TTTCGG -3'
Die Sequenz entspricht dabei der synthetischen Interleukin2-Sequenz, die entsprechend Tabelle I von US5496924 die Aminosäuren 34 -38 sowie 2/3 des Codons für die Aminosäure Methionin überdeckt. Der Rest der Primersequenz überlappt mit Primer psw3_zpcolf.
3) pBprimefi (Seq ID No 15):
5' - TGAGCGGATA ACAATTTCAC AC -3'
Der Primer hybridisiert stromaufwärts mit der EcoRI-Schnittstelle, die in Plasmid pK50 (Figur 33 der US5496924) enthalten ist.
4) psw3_zp10colrev mit Hind3 Schnittstelle (Seq ID No 16):
5' - TTTTTTAAGC TTGCGGCCGC ACGTGCATGC TATTATCAAC CTTC- 3'
Zwei PCR's wurden parallel durchgeführt. Die eine wurde auf DNA des Plasmides pK50 mit dem Primerpaar pBprimefi und psw3_zpcolrev bei 5O0C und die andere Reaktion mit dem Primerpaar psw3_zpcolf und psw3_zp10colrev bei 540C auf DNA des Plasmides pTHIOHisAZP10-Gly durchgeführt. Die PCR Ausbeuten wurden nach gelelektrophoretischer Auftrennung gereingt, je ein Aliquot im Verhältnis 1 :1 gemischt und anschließend in einer dritten PCR mit dem Primerpaar pBprimefi und psw3_zp10colrev umgesetzt. Die PCR Ausbeute wurde mit den Enzymen EcoR1 und Hind3 umgesetzt und in das parallel mit diesen Enzymen geöffnete Plasmid pK50 in einer T4-L.igasereakt.ion eingesetzt. Kompetente E.coli BL21 Zellen werden mit dem Ligationsgemisch transformiert und auf selektivem Agar, der 25mg/l Ampicillin enthielt, ausplattiert. Von einigen Klonen wurde Plasmid DNA re-isoliert und mittels PCR und anschließender DNA-Sequenzanalyse analysiert. Positive Klone wurden pBZP100 genannt, und auf Expression des Fusionsproteins überprüft.
Die Expressionsprodukte wurden massenspektrometrisch und mittels SDS-PAGE analysiert und der N-Terminus mittels Proteinsequenzanalyse bestimmt. Ein geeigneter Klon zur Fermentierung größerer Materialmengen wurde ausgewählt.
Beispiel 3: Fermentation der in Beispiel 2 konstruierten Stämme
E. coli BL21 -Zellen, transformiert mit verschiedenen, für Zielpeptid-Derivate(- Fusionsprotein) kodierenden Plasmid-Vektoren, wurden in Mineralsalzmedium oder Komplexmedium (siehe Beispiel 1 ) bei 300C oder 37°C und einem pH-Wert von 7,0 in einem Fermenter kultiviert. Die pH-Einstellung erfolgte mit einer NH4 +-Lösung (26% in Wasser). Die Belüftung der Kultur wurde durch eine Regelungsstrategie, die den Gelöstsauerstoff in der Kulturbrühe konstant bei 30% hielt, sichergestellt. Für Fed Batch Prozesse in Mineralsalzmedium wurde nach Beendigung der Batch-Phase eine Glucoselösung (60% w/v) zugefüttert (8 g/L/h bis 26g/L/h). Die Induktion der Proteinexpression erfolgte durch Zugabe von IPTG (1 - 4 mM Endkonz. (f.c.)). Die Zeitdauer der Induktion betrug 6-8 h. Die Expression der Zielproteine wurde durch SDS-Polyacrylamid-Gelelektrophorese (SDS-PAGE) nachgewiesen.
Die Expression von AVEi-44-Gly(-Fusionsprotein) in E. coli BL21/pBZP100 wurde wie nachfolgend beschrieben durchgeführt: Aus einer bei -800C gelagerten Dauerkultur von E. coli BL21-Zellen wurden 100 μl_ Zellsuspension entnommen und in 0,5 L Vorkulturmedium bei 37°C schüttelnd für 10- 16 h inkubiert. Die Hauptkultur im Fermenter wurde auf eine Animpfdichte von 0,01 bis 0,05 ODβoo mit der entsprechenden Menge Vorkultur inokuliert.
Vorkulturmedium: 5 g/L Bacto trypton 10 g/L Hefeextrakt 5 g/L NaCI
Hauptkulturmedium:
Definiertes Mineralsalzmedium (Minimalmedium) basierend auf Glukose als Kohlenstoffquelle (Jeffrey H. Miller: Experiments in Molecular Genetics, CoId Spring Harbor Laboratory (1972)).
Nach Aufbrauchen der initial im Hauptkulturmedium vorhandenen Glucose wurde eine Glucoselösung zugefüttert. Die Proteinexpression durch Zugabe von IPTG (1 mM f.c.) induziert und die maximale Expression des Fusionsproteins nach der Induktion beobachtet.
Unter Verwendung z.B. des SDS-PAGE Analysensystems der Firma Novex (NuPage® Novex 12% Gelsystem, I nvitrogen™) wurden entsprechend der Angaben des Herstellers in der Fermentation je 0,02 OD6oonm Zellsuspension, die zu unterschiedlichen Kultivierungszeitpunkten dem Fermenter entnommen wurden, analysiert.
Beispiel 4: Reinigung des Fusionsproteins
Isolierung des BZP-AVE1-44-Gly-Fusionsproteins: 200 g Biomasse eines rekombinanten E. coli-Stammes wurden in 300 ml Tris-Puffer (50 mM Tris/HCI, pH 7,4; 1 mM EDTA) resuspendiert. Der Zellaufschluss erfolgte durch zweimalige Hochdruckhomogenisation (Rannie-Hochdruckhomogenisator, 1000 bar). Unlösliche Bestandteile im Homogenisat wurden durch Zentrifugation abgetrennt. Der Überstand wurde druckfiltriert (Sartorius 0,22 μm Filter, Typ111) und auf eine zuvor mit Puffer (50 mM Tris/HCI pH 7,3; 1 mM EDTA) äquilibrierte Chromatographiesäule (Source S, Amersham Biosciences) aufgetragen. Nach dem Probenauftrag erfolgte ein Waschschritt mit Äqulibrierungspuffer (2 Säulenvolumen), gefolgt von einem weiteren Waschschritt mit 10% Hochsalzpuffer (50 mM Tris/HCI pH 7,3; 1 M NaCI, 1 mM EDTA). Die Fraktionierung erfolgte durch Anlegen eines Salzgradienten mittels Hochsalzpuffer über 5 Säulenvolumen. Die Überprüfung des Fusionsproteingehalts der einzelnen Fraktionen erfolgte über SDS-Gelelektrophorese (NuPage® Novex 12% Gelsystem, Invitrogen). Fusionsprotein-haltige Fraktionen wurden vereinigt und zwischen 5- und 10-fach ankonzentriert (Millipore Ultrafiltrationszelle, 10 kDa cut-off Membran). Das Konzentrat wurde nach Puffertausch in Enterokinasepuffer (50 mM Tris/HCI pH 7,4; 50 mM NaCI, 2mM CaCI2) direkt zur Proteasespaltungsreaktion eingesetzt, oder vor der Spaltreaktion über Gelfiltration (Superdex 75, Amersham Biosciences) zusätzlich gereinigt.
Die Spaltung der Fusionsproteine erfolgte mittels Enterokinase (Invitrogen) in Enterokinase-Puffer (20 mM Tris/HCI, 50 mM NaCI, 2 mM CaCI2 pH 7,4) nach Angaben des Herstellers.
Beispiel 5: Aufreinigung eines Thioredoxin-Fusionsproteins enthaltend Seq ID No. 3
200 g Biomasse eines rekombinanten E. coli-Stammes wurden in 50 mM Tris-Puffer (pH 7,4; 1 mM EDTA) resuspendiert. Der Zellaufschluss erfolgte durch zweimalige Hochdruckhomogenisation (Rannie-Hochdruckhomogenisator, 1000 bar). Unlösliche Bestandteile im Homogenisat wurden durch Zentrifugation abgetrennt. Der Überstand wurde druckfiltriert (Sartorius 0,22 μm Filter, Typ111 ) und auf eine zuvor mit Puffer (50 mM Tris/HCI pH 7,4; 1 mM EDTA) äquilibrierte Chromatographiesäule (Source Q, Amersham Biosciences) aufgetragen. Nachdem Probenauftrag erfolgte ein Waschschritt mit Äquilibrierungspuffer (2 Säulenvolumen) und die Fraktionierung erfolgte durch Anlegen eines Salzgradienten mittels Hochsalzpuffer (50 mM Tris/HCI pH 7,4; 0,3 M NaCI, 1 mM EDTA) über 6 Säulenvolumen. Die Überprüfung des Fusionsproteingehalts der einzelnen Fraktionen erfolgte über SDS-Gelelektrophorese ((NuPage® Novex 12% Gelsystem, Invitrogen™). Fusionsprotein-haltige Fraktionen wurden vereinigt und 5-10-fach ankonzentriert (Millipore Ultrafiltrationszelle, 10 kDa cut-off Membran). Das Konzentrat wurde durch Gelfiltrationschromatographie (Superdex 75, Amersham Biosciences) weiter fraktioniert. Eine zuvor äquilibrierte Säule (50 mM Tris/HCI pH 7,4; 200 mM NaCI) wurde mit bis zu 5% des Säulenvolumes mit ankonzentrierter Fusionsproteinlösung beladen. Die Elution erfolgt durch Spülen mit Äquilibrierungspuffer. Die Überprüfung des Fusionsproteingehalts der einzelnen Fraktionen erfolgte erneut über SDS-Gelelektrophorese ((NuPage® Novex 12% Gelsystem, Invitrogen™. Die entsprechenden Fraktionen wurden vereinigt, auf ca. 5 mg/ml ankonzentriert (Vivaspin-Konzentratoren mit 10 kD cut- off, Vivascience) und mittels Diafiltrationseinsätzen (Vivascience) erfolgte der Puffertausch in Enterokinasepuffer (20 mM Tris/HCI pH 7,4; 50 mM NaCI).
Die Prozessierung der AVEi-44-Gly-Vorstufe erfolgte anschließend mittels Enterokinase analog zu Beispiel 4.
Beispiel 6: Trennung der Spaltprodukte aus der Enterokinase-Spaltreaktion
Nach der Spaltung der Fusionsproteine mittels Enterokinase wurden die Spaltprodukte voneinander durch lonenaustauschchromatographie (Source 3OS, Amersham Biosciences) getrennt. Die lonenstärke der Lösung wurde auf ca. 10 mS/cm durch Zugabe von Natriumchlorid gebracht. Nach Aufgabe der Proteinlösung auf die zuvor äquilibrierte Säule (20 mM Tris/HCI, pH 7.4; mit NaCI auf eine Leitfähigkeit von ca. 10 mS/cm eingestellt) wurde nicht gebundenes Material mit Puffer (20 mM Tris/HCI, pH 7.4; mit NaCI auf eine Leitfähigkeit von ca. 10 mS/cm eingestellt) herausgewaschen. Die Elution des Avei-44-Gly Peptids erfolgte durch Anlegen eines Gradienten über 10 Säulenvolumen auf 500 mM NaCI.
Die Identifizierung AVEi-44-haltiger Fraktionen oder Vorstufen zu AVEi-44 erfolgte durch SDS-Gelelektrophorese , HPLC und massenspektrometrisch. Die entsprechenden Fraktionen wurden vereinigt und nach Entfernen von organischem Lösungsmittel lyophilisiert. Das isolierte AVE1-44-GIy wurde zur Absicherung der Aminosäuresequenz abschließend via Edman vollständig sequenziert.
Beispiel 7: Umwandlung von AVEi-44- GIy zu AVEi-44 -NH2
Die Reaktion wurde mit Hilfe des Enzyms PAM (Peptidiylglycine-amidating enzyme Wako Pure Chemicals Ind., Ltd. ( Best. Nr. 161-16971)) nach Angaben zu den Reaktionsbedingungen des Herstellers durchgeführt.
Folgende Lösung wurde angesetzt:
1 μM CuSO4
5 mM KI
3 mM Na-Ascorbat
230 U/ml Katalase (Rind, Fluka) 600 U/ml PAM (Wako Chemicals)
0.1 M Tris/HCI pH 7.0 mit 0.001 % Triton X-100
Die Lösung wurde bei 37°C 1 h vorinkubiert und dann die Proteinlösung AVEi-44GIy (Tris/HCI pH 7.0, 80 μg/ml Endkonzentration) zugegeben. Die Reaktionsmischung wurde dann bei 37° C weiter inkubiert. Der Reaktionsverlauf wird durch Probennahme zu verschiedenen Zeiten verfolgt. Bei maximaler Umsetzung wurde die Reaktion durch Zugabe einer 5OmM EDTA-Lösung gestoppt.
Das Reaktionsgemisch wurde anschließend über lonentauscherchromatographie (Fa. Shodex, Säule Typ IEC CM- 825 (8x75 mm)) aufgetrennt. An diese Säule wurde folgender Gradient angelegt:
Eluent A - 40 mMol Phosphatpuffer pH 7 + 20% Acetonitril
Eluent B - 50 mMol Phosphatpuffer pH 7 + 1M NaCL
Die Säule wurde bei Raumtemperatur mit einer Durchflussrate von 2ml/min oder 1 ml/min betrieben. Die eluierten Fraktionen (Detektion bei 280nm) wurden aufgefangen und die Masse des jeweiligen Peptides über MALDI-MS bestimmt. Die massenspektrometrischen Analysen wurden mit einem Gerät des Typs BRUKER Reflex IV durchgeführt. Die Proben wurden direkt für die MALDI-MS-Analytik eingesetzt, bzw. auf eine Konzentration von ca. 50 pmol/μL mit 50% TAaq ([1 +1] 0,1 % TFA + 50% Acetonitril) verdünnt.
Die erwartete Masse für das AVEi-44- NH2 wurde bestätigt. Das erhaltene Produkt kann der weiteren pharmazeutischen Verwendung zugeführt werden.
Pharmazeutische Formulierungen können im weiteren durch Beigabe geeigneter pharmazeutischer Formulierungshiifsstoffe zu dem biologisch aktiven Peptid bzw. Peptid-Derivat in einer dem Fachmann bekannten Weise hergestellt werden.

Claims

Patentansprüche:
1. Verbindung der allgemeinen Formel I:
(AS)n-XmYp (Formel I),
worin
AS eine oder mehrere genetisch codierbare Aminosäure bedeutet; n 5-2000 ist, vorzugsweise 10-1000, insbesondere 15-500, ganz besonders bevorzugt 20-400;
X ein oder mehrere basische Aminosäure oder deren Derivate, vorzugsweise Lysin, Histidin und/oder Arginin, insbesondere Lysin bedeutet; m 1-15 ist, vorzugsweise 3-10, insbesondere 6-8;
Y eine oder mehrere ladungsneutrale Aminosäure bedeutet, vorzugsweise Glycin;
p 1-10 ist, vorzugsweise 1-5, insbesondere 1 ; wobei n, m und p ganze Zahlen bedeuten und (AS)n und/oder (AS)nXm vorzugsweise ein biologisch aktives Peptid bzw. Protein bedeutet.
2. Verbindung gemäß Anspruch 1 , das durch Seq ID No. 2 definiert ist, sowie deren biologisch aktive Derivate mit einer Homologie von mindestens 60%.
3. Nukleinsäuremolkül, codierend für eine Verbindung wie in Anspruch 1-2 definiert.
4. Nukleinsäuremolekül nach Anspruch 3, das eine DNS oder RNS ist.
5. Nukleinsäuremolekül nach einem oder mehreren der Ansprüche 3-4, das eine cDNS ist.
6. Expressionskassette enthaltend ein Nukleinsäuremolekül nach einem oder mehreren der Ansprüche 3-5.
7. Vektor enthaltend ein Nukleinsäuremolekül nach einem oder mehreren der Ansprüche 3-5 oder eine Expressionskassette nach Anspruch 6, wobei besagter Vektor gegebenenfalls regulatorische Sequenzen enthält.
8. Expressionsvektor nach Anspruch 7.
9. Vektor nach einem oder mehreren der Ansprüche 7-8 zur Expression in Bakterien oder Hefen.
10. Wirtszelle enthaltend a) ein Nukleinsäuremolekül nach einem oder mehreren der Ansprüche 3-5, b) eine Expressionskassette nach Anspruch 6, oder c) einen Vektor nach einem oder mehreren der Ansprüche 7-9.
11. Wirtszelle nach Anspruch 10, die eine Bakterien- oder Hefezelle ist.
12. Wirtszelle nach einem oder mehreren der Ansprüche 10 bis 11 , die zusätzlich das Enzym PAM co-exprimiert.
13. In-vitro-Expressionssystem enthaltend ein Nukleinsäuremolekül nach einem oder mehreren der Ansprüche 2-3.
14. In-vitro-Expressionssystem nach Anspruch 13, das zusätzlich das Enzym PAM co-exprimiert.
15. Verfahren zur Herstellung von C-terminal amidierten Peptiden der allgemeinen Formel Il
(AS)n-Xm-NH2 (Formel II), worin AS eine oder mehrere genetisch codierbare Aminosäure bedeutet; n 5-2000 ist, vorzugsweise 10-1000, insbesondere 15-500, ganz besonders bevorzugt 20-400; und (AS)n und/oder (AS)nXm vorzugsweise ein biologisch aktives Peptid bzw. Protein bedeutet;
X ein oder mehrere basische Aminosäure oder deren Derivate, vorzugsweise
Lysin, Histidin und/oder Arginin, insbesondere Lysin bedeutet; m 1-15 ist, vorzugsweise 3-10, insbesondere 6-8; n und m ganze Zahlen bedeuten, und worin man a) Wirtszellen wie in Anspruch 10-12 definiert bzw. Expressionssysteme wie in
Anspruch 13-14 definiert in einem geeigneten Nährmedium kultiviert, b) die in Anspruch 1 definierten Verbindungen exprimiert, c) gegebenenfalls die in Anspruch 1 definierten Verbindungen aus einem geeigneten Vorläuferpeptid mittels enzymatischer oder chemischer Spaltung freisetzt; d) die Expressionsprodukte aus Schritt b) bzw. die Zwischenprodukte aus Schritt c), gegebenenfalls nach einem Reinigungsschritt mit einem alpha-amidierenden
Enzym umsetzt; und e) das C-terminal amidierte Peptid der allgemeinen Formel Il in geeigneter Weise aufreinigt, vorzugsweise durch ein präparatives chromatographisches Verfahren.
16. Verfahren gemäß Anspruch 15 zur Herstellung einer Verbindung wie in Anspruch 2, vorzugsweise gemäß Seq ID No 2 definiert.
17. Verfahren nach einem oder mehreren der Ansprüche 15-16, worin die gemäß Anspruch 1 definierten Verbindungen aus geeigneten Vorläuferpeptiden mittels enzymatischer Spaltung freigesetzt werden.
18. Verfahren nach Anspruch 17, worin die gemäß Anspruch 1 definierten Verbindungen aus geeigneten Vorläuferpeptiden mittels des Enzyms Enterokinase freigesetzt werden.
19. Verwendung eines C-terminal amidierten Peptides, das gemäß einem oder mehreren der Ansprüche 15-18 erhalten wurde, zur Herstellung eines pharmazeutischen Produktes oder einer pharmazeutischen Formulierung.
20. Verwendung einer Verbindung nach einem oder mehreren der Ansprüche 1-2 zur Herstellung eines pharmazeutischen Produktes oder einer pharmazeutischen Formulierung.
21. Verwendung nach einem oder mehreren der Ansprüche 20-21 zur Herstellung eines Medikamentes zur Behandlung von Kohlenhydratstoffwechsel-Störungen.
22. Verwendung nach Anspruch 21 zur Herstellung eines Medikamentes zur Behandlung von Diabetes.
PCT/EP2005/012365 2004-12-01 2005-11-18 Verfahren zur herstellung von carboxy-terminal amidierten peptiden Ceased WO2006058620A2 (de)

Priority Applications (15)

Application Number Priority Date Filing Date Title
HK08101877.8A HK1111426B (en) 2004-12-01 2005-11-18 Method for producing carboxy-terminal amidified peptides
CA2589951A CA2589951C (en) 2004-12-01 2005-11-18 Method for producing carboxy-terminal amidated peptides
EP05850211A EP1819729B8 (de) 2004-12-01 2005-11-18 Verfahren zur herstellung von carboxy-terminal amidierten peptiden
BRPI0518759-1A BRPI0518759A2 (pt) 2004-12-01 2005-11-18 processo para a produÇço de peptÍdeos amidados carbàxi-terminais
US11/720,006 US7939293B2 (en) 2004-12-01 2005-11-18 Method for producing carboxy-terminal-amidified peptides
CN2005800412833A CN101068833B (zh) 2004-12-01 2005-11-18 产生羧基端酰胺化肽的方法
KR1020077012501A KR101299417B1 (ko) 2004-12-01 2005-11-18 카복시-말단 아미드화 펩티드를 제조하는 방법
PL05850211T PL1819729T3 (pl) 2004-12-01 2005-11-18 Sposób wytwarzania karboksy-terminalnych amidowanych peptydów
DK05850211T DK1819729T3 (da) 2004-12-01 2005-11-18 Fremgangsmåde til fremstilling af carboxy-terminalt amiderede peptider
DE502005007161T DE502005007161D1 (de) 2004-12-01 2005-11-18 Verfahren zur herstellung von carboxy-terminal amidierten peptiden
AT05850211T ATE429445T1 (de) 2004-12-01 2005-11-18 Verfahren zur herstellung von carboxy-terminal amidierten peptiden
MX2007005840A MX2007005840A (es) 2004-12-01 2005-11-18 Metodo para producir peptidos amidados carboxi terminales.
JP2007543728A JP4857279B2 (ja) 2004-12-01 2005-11-18 カルボキシ末端をアミド化したペプチドの製造方法
AU2005312165A AU2005312165B2 (en) 2004-12-01 2005-11-18 Method for producing carboxy-terminal amidified peptides
IL183467A IL183467A0 (en) 2004-12-01 2007-05-28 Method for producing carboxy-terminal amidified peptides

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102004058306A DE102004058306A1 (de) 2004-12-01 2004-12-01 Verfahren zur Herstellung von Carboxy-terminal amidierten Peptiden
DE102004058306.4 2004-12-01

Publications (2)

Publication Number Publication Date
WO2006058620A2 true WO2006058620A2 (de) 2006-06-08
WO2006058620A3 WO2006058620A3 (de) 2006-08-03

Family

ID=36001270

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/012365 Ceased WO2006058620A2 (de) 2004-12-01 2005-11-18 Verfahren zur herstellung von carboxy-terminal amidierten peptiden

Country Status (19)

Country Link
US (1) US7939293B2 (de)
EP (1) EP1819729B8 (de)
JP (1) JP4857279B2 (de)
KR (1) KR101299417B1 (de)
CN (1) CN101068833B (de)
AT (1) ATE429445T1 (de)
AU (1) AU2005312165B2 (de)
BR (1) BRPI0518759A2 (de)
CA (1) CA2589951C (de)
CY (1) CY1110488T1 (de)
DE (2) DE102004058306A1 (de)
DK (1) DK1819729T3 (de)
ES (1) ES2324951T3 (de)
IL (1) IL183467A0 (de)
MX (1) MX2007005840A (de)
PL (1) PL1819729T3 (de)
PT (1) PT1819729E (de)
SI (1) SI1819729T1 (de)
WO (1) WO2006058620A2 (de)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007036299A3 (de) * 2005-09-27 2007-05-31 Sanofi Aventis Deutschland Verfahren zur amidierung von polypeptiden mit c-terminalen basischen aminosäuren unter verwendung spezifischer endoproteasen
DE102008003568A1 (de) 2008-01-09 2009-07-16 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008003566A1 (de) 2008-01-09 2009-07-16 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008025007A1 (de) 2008-05-24 2009-11-26 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008025008A1 (de) 2008-05-24 2009-11-26 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
US8048854B2 (en) 2006-07-11 2011-11-01 Sanofi-Aventis Deutschland Gmbh Amidated insulin glargine
US8410048B2 (en) 2006-07-11 2013-04-02 Sanofi-Aventis Deutschland Gmbh Method for producing insulin analogs having a dibasic B chain terminus
US8633156B2 (en) 2008-01-09 2014-01-21 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
US9526764B2 (en) 2008-10-17 2016-12-27 Sanofi-Aventis Deutschland Gmbh Combination of an insulin and a GLP-1-agonist
US9644017B2 (en) 2008-01-09 2017-05-09 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
US9707176B2 (en) 2009-11-13 2017-07-18 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist and methionine
US9821032B2 (en) 2011-05-13 2017-11-21 Sanofi-Aventis Deutschland Gmbh Pharmaceutical combination for improving glycemic control as add-on therapy to basal insulin
US9950039B2 (en) 2014-12-12 2018-04-24 Sanofi-Aventis Deutschland Gmbh Insulin glargine/lixisenatide fixed ratio formulation
US9981013B2 (en) 2010-08-30 2018-05-29 Sanofi-Aventis Deutschland Gmbh Use of AVE0010 for the treatment of diabetes mellitus type 2
US9987332B2 (en) 2011-09-01 2018-06-05 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition for use in the treatment of a neurodegenerative disease
US10029011B2 (en) 2009-11-13 2018-07-24 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist, an insulin and methionine
US10159713B2 (en) 2015-03-18 2018-12-25 Sanofi-Aventis Deutschland Gmbh Treatment of type 2 diabetes mellitus patients
US10434147B2 (en) 2015-03-13 2019-10-08 Sanofi-Aventis Deutschland Gmbh Treatment type 2 diabetes mellitus patients
US12558307B2 (en) 2009-07-06 2026-02-24 Sanofi-Aventis Insulin preparations containing methionine

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102007002580A1 (de) * 2007-01-11 2008-07-17 C-Lecta Gmbh Proteolytische Abspaltung von Protein-Tags in der rekombinanten Protein-Herstellung
JP5198427B2 (ja) * 2009-12-29 2013-05-15 ザインエレクトロニクス株式会社 シグマデルタ変調器
PL2750699T3 (pl) 2011-08-29 2015-12-31 Sanofi Aventis Deutschland Kombinacja farmaceutyczna do stosowania w kontroli glikemii u pacjentów z cukrzycą typu 2
TWI641381B (zh) 2013-02-04 2018-11-21 法商賽諾菲公司 胰島素類似物及/或胰島素衍生物之穩定化醫藥調配物
EP3091965A1 (de) 2014-01-09 2016-11-16 Sanofi Stabilisierte glycerinfreie pharmazeutische formulierungen von insulinanaloga und/oder insulinderivaten
SG11201604706TA (en) 2014-01-09 2016-07-28 Sanofi Sa Stabilized pharmaceutical formulations of insulin aspart
CN112957455A (zh) 2014-01-09 2021-06-15 赛诺菲 胰岛素类似物和/或胰岛素衍生物的稳定化药物制剂
CN115786426B (zh) * 2022-10-31 2023-09-08 杭州先为达生物科技有限公司 高特异性肠激酶酶切方法及乙醇在提高肠激酶酶切特异性中的用途
WO2025133045A1 (en) * 2023-12-22 2025-06-26 Novo Nordisk A/S Fermentation process

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4708934A (en) * 1984-09-27 1987-11-24 Unigene Laboratories, Inc. α-amidation enzyme
US5496924A (en) 1985-11-27 1996-03-05 Hoechst Aktiengesellschaft Fusion protein comprising an interleukin-2 fragment ballast portion
JP2598050B2 (ja) 1987-07-17 1997-04-09 サントリー株式会社 C−末端α−アミド化酵素
US5789234A (en) * 1987-08-14 1998-08-04 Unigene Laboratories, Inc. Expression systems for amidating enzyme
US6255067B1 (en) * 1987-09-15 2001-07-03 The Johns Hopkins University cDNA encoding peptidyl-glycine alpha-amidating monooxygenase (PAM)
US6319695B1 (en) * 1991-10-15 2001-11-20 The Scripps Research Insitute Production of fucosylated carbohydrates by enzymatic fucosylation synthesis of sugar nucleotides; and in situ regeneration of GDP-fucose
US5338833A (en) * 1992-07-23 1994-08-16 The University Of North Carolina At Chapel Hill Carboxy terminal IL-6 muteins
US5589364A (en) * 1994-07-29 1996-12-31 Magainin Pharmaceuticals Inc. Recombinant production of biologically active peptides and proteins
JP3291172B2 (ja) 1994-10-04 2002-06-10 キヤノン株式会社 金属製ミラーの製造方法
AU4415796A (en) 1994-12-07 1996-06-26 Bionebraska, Inc. Production of c-terminal amidated peptides from recombinant protein constructs
US6723530B1 (en) * 1997-02-05 2004-04-20 Amylin Pharmaceuticals, Inc. Polynucleotides encoding proexendin, and methods and uses thereof
US6461834B1 (en) 1998-11-06 2002-10-08 Bionebraska, Inc. Clostripain catalyzed amidation of peptides
US6924264B1 (en) * 1999-04-30 2005-08-02 Amylin Pharmaceuticals, Inc. Modified exendins and exendin agonists
EP1076066A1 (de) * 1999-07-12 2001-02-14 Zealand Pharmaceuticals A/S Peptide zur Senkung des Blutglukosespiegels
US6528486B1 (en) * 1999-07-12 2003-03-04 Zealand Pharma A/S Peptide agonists of GLP-1 activity
US6992172B1 (en) * 1999-11-12 2006-01-31 Fibrogen, Inc. Recombinant gelatins
DE10123348A1 (de) * 2001-05-14 2002-11-21 Fresenius Kabi De Gmbh DNS-Konstrukte für die Herstellung von Peptiden
BR0314996A (pt) * 2002-10-02 2005-08-09 Zealand Pharma As Composição, composição farmaceuticamente aceitável, método para produzir a composição, métodos para estabilizar a exendina-4 (1-39) ou uma sua variante, derivado ou análogo contra a degradação, antes, durante ou após o uso pretendido, para tratar doenças, para tratar de estados de doenças associados com nìveis elevados de glicose do sangue, para a regulação dos nìveis de glicose do sangue, para a regulação do esvaziamento gástrico, para estimular a liberação de insulina em um mamìfero para reduzir o nìvel de glicose do sangue em um mamìfero, para reduzir o nìvel de lipìdeos plasmáticos em um mamìfero, para reduzir a mortalidade e a morbidez após o infarto miocárdico em um mamìfero, para estimular a liberação de insulina em um mamìfero, e para produzir uma exendina (1-39) estabilizada, e, exendina (1-39) estabilizada

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8765910B2 (en) 2005-09-27 2014-07-01 Sanofi-Aventis Deutschland Gmbh Method for amidating polypeptides with basic amino acid C-terminals by means of specific endoproteases
WO2007036299A3 (de) * 2005-09-27 2007-05-31 Sanofi Aventis Deutschland Verfahren zur amidierung von polypeptiden mit c-terminalen basischen aminosäuren unter verwendung spezifischer endoproteasen
US8048854B2 (en) 2006-07-11 2011-11-01 Sanofi-Aventis Deutschland Gmbh Amidated insulin glargine
US8410048B2 (en) 2006-07-11 2013-04-02 Sanofi-Aventis Deutschland Gmbh Method for producing insulin analogs having a dibasic B chain terminus
US9644017B2 (en) 2008-01-09 2017-05-09 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
DE102008003568A1 (de) 2008-01-09 2009-07-16 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008003566A1 (de) 2008-01-09 2009-07-16 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
US8633156B2 (en) 2008-01-09 2014-01-21 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
DE102008025007A1 (de) 2008-05-24 2009-11-26 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008025008A1 (de) 2008-05-24 2009-11-26 Sanofi-Aventis Deutschland Gmbh Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
US10117909B2 (en) 2008-10-17 2018-11-06 Sanofi-Aventis Deutschland Gmbh Combination of an insulin and a GLP-1 agonist
US9526764B2 (en) 2008-10-17 2016-12-27 Sanofi-Aventis Deutschland Gmbh Combination of an insulin and a GLP-1-agonist
US12558307B2 (en) 2009-07-06 2026-02-24 Sanofi-Aventis Insulin preparations containing methionine
US10029011B2 (en) 2009-11-13 2018-07-24 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist, an insulin and methionine
US12303598B2 (en) 2009-11-13 2025-05-20 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1-agonist and methionine
US9707176B2 (en) 2009-11-13 2017-07-18 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist and methionine
US10028910B2 (en) 2009-11-13 2018-07-24 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1-agonist and methionine
US9981013B2 (en) 2010-08-30 2018-05-29 Sanofi-Aventis Deutschland Gmbh Use of AVE0010 for the treatment of diabetes mellitus type 2
US9821032B2 (en) 2011-05-13 2017-11-21 Sanofi-Aventis Deutschland Gmbh Pharmaceutical combination for improving glycemic control as add-on therapy to basal insulin
US9987332B2 (en) 2011-09-01 2018-06-05 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition for use in the treatment of a neurodegenerative disease
US12186374B2 (en) 2014-12-12 2025-01-07 Sanofi-Aventis Deutschland Gmbh Insulin glargine/lixisenatide fixed ratio formulation
US9950039B2 (en) 2014-12-12 2018-04-24 Sanofi-Aventis Deutschland Gmbh Insulin glargine/lixisenatide fixed ratio formulation
US10434147B2 (en) 2015-03-13 2019-10-08 Sanofi-Aventis Deutschland Gmbh Treatment type 2 diabetes mellitus patients
US10159713B2 (en) 2015-03-18 2018-12-25 Sanofi-Aventis Deutschland Gmbh Treatment of type 2 diabetes mellitus patients

Also Published As

Publication number Publication date
KR20070091131A (ko) 2007-09-07
CN101068833A (zh) 2007-11-07
SI1819729T1 (sl) 2009-10-31
DK1819729T3 (da) 2009-08-17
IL183467A0 (en) 2007-09-20
CN101068833B (zh) 2011-04-20
US20090005299A1 (en) 2009-01-01
AU2005312165A1 (en) 2006-06-08
CA2589951C (en) 2013-10-15
KR101299417B1 (ko) 2013-08-28
CY1110488T1 (el) 2015-04-29
AU2005312165B2 (en) 2011-08-04
PL1819729T3 (pl) 2009-09-30
EP1819729B8 (de) 2009-08-12
MX2007005840A (es) 2007-07-04
ATE429445T1 (de) 2009-05-15
DE102004058306A1 (de) 2006-07-27
DE502005007161D1 (de) 2009-06-04
EP1819729A2 (de) 2007-08-22
ES2324951T3 (es) 2009-08-20
HK1111426A1 (en) 2008-08-08
WO2006058620A3 (de) 2006-08-03
JP4857279B2 (ja) 2012-01-18
EP1819729B1 (de) 2009-04-22
PT1819729E (pt) 2009-06-12
CA2589951A1 (en) 2006-06-08
US7939293B2 (en) 2011-05-10
BRPI0518759A2 (pt) 2008-12-09
JP2008521415A (ja) 2008-06-26

Similar Documents

Publication Publication Date Title
EP1819729B1 (de) Verfahren zur herstellung von carboxy-terminal amidierten peptiden
EP1931705B1 (de) Verfahren zur amidierung von polypeptiden mit c-terminalen basischen aminosäuren unter verwendung spezifischer endoproteasen
FI102843B (fi) Menetelmä oleellisesti puhdistettujen insuliinijohdannaisten valmistam iseksi
CN101186940B (zh) 获得具有正确键合的胱氨酸键的胰岛素或胰岛素衍生物的方法
DE69020794T2 (de) Enzymatische Entfernung einer aminoterminalen Proteinsequenz.
DE69937272T2 (de) Verfahren zur herstellung eines peptids mittels eines hilfspeptids
DE3882593T2 (de) Polypeptid und dessen Herstellung.
EP0764172A1 (de) Synthetische peptidanaloge des lungenoberflächenproteins sp-c
EP0861325A1 (de) Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine
DE102008003566A1 (de) Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE69434909T3 (de) Herstellung von humaninsulin
EP2041170B1 (de) Verfahren zur herstellung von insulinanaloga mit dibasischem b-kettenende
DE69732583T2 (de) Verfahren zur Spaltung eines chimeren Proteins mittels eines 'processing'-Enzyms
DE3751081T2 (de) [Leu 13] Motilin, dessen kodierende DNS-Moleküle und Verfahren zu dessen Herstellung.
CN111363048B (zh) 一种具有穿膜活性的可溶性重组苦荞金属硫蛋白FtMT及其制备方法
US5459049A (en) Motilin-like polypeptide and use thereof
DE19535445A1 (de) Verfahren zur Herstellung von natriuretischen Peptiden über Streptavidin-Fusionsproteine
HK1111426B (en) Method for producing carboxy-terminal amidified peptides
DE102008025007A1 (de) Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: MX/a/2007/005840

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2005850211

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 183467

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2589951

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2005312165

Country of ref document: AU

Ref document number: 200580041283.3

Country of ref document: CN

Ref document number: 2007543728

Country of ref document: JP

Ref document number: 2344/CHENP/2007

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 1020077012501

Country of ref document: KR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2005312165

Country of ref document: AU

Date of ref document: 20051118

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2005312165

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2005850211

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11720006

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0518759

Country of ref document: BR