WO2004081225A2 - Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process - Google Patents
Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process Download PDFInfo
- Publication number
- WO2004081225A2 WO2004081225A2 PCT/US2004/006983 US2004006983W WO2004081225A2 WO 2004081225 A2 WO2004081225 A2 WO 2004081225A2 US 2004006983 W US2004006983 W US 2004006983W WO 2004081225 A2 WO2004081225 A2 WO 2004081225A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna
- polymerase
- nucleic acid
- primer
- mixture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Definitions
- the present invention is directed to the fields of genomics, molecular biology, genotyping, and expression profiling.
- the present invention relates to methods for the amplification of DNA or cDNA yielding a product that is a non-biased representation of the original genomic or transcribed sequences, wherein the methods utilize primers substantially incapable of forming primer dimers.
- PCRTM is a powerful technique to amplify DNA (Saiki, 1985). This in vitro technique amplifies DNA by repeated thermal denaturation, primer annealing and polymerase extension, thereby amplifying a single target DNA molecule to detectable quantities.
- PCRTM is not amenable to the amplification of long DNA molecules such as entire chromosomes, which in humans are approximately 10 8 bases in length.
- the commonly used polymerase in PCR reactions is Taq polymerase, which cannot amplify regions of DNA larger than about 5000 bases.
- knowledge of the exact nucleotide sequences flanking the amplification target is necessary in order to design primers used in the PCR reaction.
- Whole genome PCRTM involves converting total genomic DNA to a form which can be amplified by PCR (Kinzler and Vogelstein, 1989).
- total genomic DNA is fragmented via shearing or enzymatic digestion with, for instance, a restriction enzyme such as Mbol, to an average size of 200 - 300 base pairs.
- the ends ofthe DNA are made blunt by incubation with the Klenow fragment of DNA polymerase.
- the DNA fragments are ligated to catch linkers consisting of a 20 base pair DNA fragment synthesized in vitro.
- the catch linkers consist of two phosphorylated oligomers: 5'-GAGTAGAATTCTAATATCTA-3' (SEQ ID NO:l) and 5'- GAGATATTAGAATTCTACTC-3' (SEQ ID NO:2).
- the ligation product is cleaved with Xhol.
- Each catch linker has one half of an Xhol site at its termini; therefore, Xhol cleaves catch linkers ligated to themselves but will not cleave catch linkers ligated to most genomic DNA fragments.
- the linked DNA is in a form that can be amplified by PCRTM using the catch oligomers as primers.
- the DNA of interest can then be selected via binding to a specific protein or nucleic acid and recovered.
- the small amount of DNA fragments specifically bound can be amplified using PCRTM. The steps of selection and amplification may be repeated as often as necessary to achieve the desired purity. Although 0.5 ng of starting DNA was amplified 5000-fold, Kinzler and Vogelstein (1989) did report a bias toward the amplification of smaller fragments.
- Lone-linker PCRTM produces fragments ranging from 100 bases to ⁇ 2 kb that were reported to be amplified with similar efficiency.
- IRS-PCRTM interspersed repetitive sequence PCRTM
- ALU-PCRTM Alu element mediated-PCRTM
- IRS-PCRTM A major disadvantage of IRS-PCRTM is that abundant repetitive sequences like the Alu family are not uniformly distributed throughout the human genome, but preferentially found in certain areas (e.g., the light bands of human chromosomes) (Korenberg and Rykowski, 1988). Thus, IRS- PCRTM results in a bias toward these regions and a lack of amplification of other, less represented areas. Moreover, this technique is dependent on the knowledge of the presence of abundant repeat families in the genome of interest.
- IRS-PCRTM linker adapter technique
- This technique amplifies unknown restricted DNA fragments with the assistance of ligated duplex oligonucleotides (linker adapters).
- DNA is commonly digested with a frequently cutting restriction enzyme such as Rs l, yielding fragments that are on average 500 bp in length.
- PCRTM can be performed using primers complementary to the sequence ofthe adapters. Temperature conditions are selected to enhance annealing specifically to the complementary DNA sequences, which leads to the amplification of unknown sequences situated between the adapters.
- LA-PCRTM is technically more challenging than other whole genome amplification (WGA) methods.
- PCRTM amplification of a microdissected region of a chromosome is conducted by digestion with a restriction enzyme (e.g., Sau3A, MboT) to generate a number of short fragments, which are ligated to linker-adapter oligonucleotides that provide priming sites for PCRTM amplification (Saunders et al, 1989).
- a restriction enzyme e.g., Sau3A, MboT
- Vectorette is a synthetic oligonucleotide duplex containing an overhang complementary to the overhang generated by a restriction enzyme. The duplex contains a region of non-complementarity as a primer-binding site. After ligation of digested YACs and a Vectorette unit, amplification is performed between primers identical to Vectorette and primers derived from the yeast vector. Products will only be generated if, in the first PCRTM cycle, synthesis has taken place from the yeast vector primer, thus synthesizing products. from the termini of YAC inserts.
- PARM-PCRTM Priming Authorizing Random Mismatches-PCRTM
- PARM-PCRTM Priming Authorizing Random Mismatches-PCRTM
- Annealing temperatures are reduced to 30°C for the first two cycles and raised to 60°C in subsequent cycles to specifically amplify the generated DNA fragments.
- FISH fluorescent in situ hybridization
- SCOMP single cell comparative genomic hybridization
- DOP-PCRTM Degenerate oligonucleotide-primed PCRTM
- IRS-PCR oligonucleotide-primed PCR
- a system was described using non-specific primers (5'-TTGCGGCCGCATTNNNNTTC-3' (SEQ ID NO:5); showing complete degeneration at positions 4, 5, 6, and 7 from the 3' end (Wesley et al, 1990).
- the three specific bases at the 3 'end are statistically expected to hybridize every 64 (4 3 ) bases, thus the last seven bases will match due to the partial degeneration of the primer.
- the first cycles of amplification are conducted at a low annealing temperature (30°C), allowing sufficient priming to initiate DNA synthesis at frequent intervals along the template.
- the defined sequence at the 3' end of the primer tends to separate initiation sites, thus increasing product size.
- the annealing temperature is raised to 56°C after the first eight cycles.
- the system was developed to unspecifically amplify microdissected chromosomal DNA from Drosophila, replacing the microcloning system of L ⁇ decke et al. (1989) described above.
- DOP-PCRTM was introduced by Telenius et al. (1992) who developed the method for genome mapping research using flow sorted chromosomes.
- a single primer is used in DOP-PCRTM as used by Wesley et al. (1990).
- the primer (5'- CCGACTCGACNNNNNNATGTGG-3' (SEQ ID NO:6); shows six specific bases on the 3 '-end, a degenerate part with 6 bases in the middle and a specific region with a rare restriction site at the 5 '-end.
- Amplification occurs in two stages. Stage one encompasses the low temperature cycles. In the first cycle, the 3 '-end ofthe primers hybridize to multiple sites of the target DNA initiated by the low annealing temperature.
- a complementary sequence is generated according to the sequence of the primer.
- primer annealing is performed at a temperature restricting all non-specific hybridization. Up to 10 low temperature cycles are performed to generate sufficient primer binding sites. Up to 40 high temperature cycles are added to specifically amplify the prevailing target fragments.
- DOP-PCRTM is based on the principle of priming from short sequences specified by the 3 '-end of partially degenerate oligonucleotides used during initial low annealing temperature cycles of the PCRTM protocol. As these short sequences occur frequently, amplification of target DNA proceeds at multiple loci simultaneously. DOP-PCRTM is applicable to the generation of libraries containing high levels of single copy sequences, provided uncontaminated DNA in a substantial amount is obtainable (e.g., flow-sorted chromosomes). This method has been applied to less than one nanogram of starting genomic DNA (Cheung and Nelson, 1996).
- DOP-PCRTM in comparison to systems of totally degenerate primers are the higher efficiency of amplification, reduced chances for unspecific primer-primer binding and the availability of a restriction site at the 5' end for further molecular manipulations.
- DOP-PCRTM does not claim to replicate the target DNA in its entirety (Cheung and Nelson, 1996).
- specific amplification of fragments up to approximately 500 bp in length are produced (Telenius et al, 1992; Cheung and Nelson, 1996; Wells et al, 1999; Sanchez-Cespedes ei al, 1998; Cheung et al, 1998).
- This method achieves this by the 3 '-5' exonuclease proofreading activity of DNA polymerase Pwo and an increased annealing and extension time during DOP-PCRTM, which are necessary steps to generate longer products. Although an improvement in success rate was demonstrated in comparison with other DOP- PCRTM methods, this method did have a 15.3% failure rate due to complete locus dropout for the majority ofthe failures and sporadic locus dropout and allele dropout for the remaining genotype failures. There was a significant deviation from random expectations for the occurrence of failures across loci, thus indicating a locus-dependent effect on whole genome coverage.
- SIA sequence-independent DNA amplification
- TGGTAGCTCTTGATCANNNNN-3' (SEQ ID NO:7); consisted of a five base random 3'- segment and a specific 16 base segment at the 5' end containing a restriction enzyme site.
- Stage one of PCRTM starts with 97°C for denaturation, followed by cooling down to 4°C, causing primers to anneal to multiple random sites, and then heating to 37°C. A T7 DNA polymerase is used.
- primers anneal to products ofthe first round.
- a primer (5'-AGAGTTGGTAGCTCTTGATC-3' (SEQ ID NO:8); is used that contains, at the 3' end, 15 5 '-end bases of primer A. Five cycles are performed with this primer at an intermediate annealing temperature of 42°C. An additional 33 cycles are
- Primer-extension preamplification is a method that uses totally degenerate primers to achieve universal amplification of the genome (Zhang et al, 1992). PEP uses a random mixture of 15-base fully degenerated oligonucleotides as primers, thus any one of the four possible bases could be present at each position.
- the primer is composed of a mixture of 4 x 10 9 different oligonucleotide sequences. This leads to amplification of DNA sequences from randomly distributed sites.
- the template is first denatured at 92°C. Subsequently, primers are allowed to anneal at a low temperature (37°C), which is then continuously increased to 55°C and held for another four minutes for polymerase extension.
- I-PEP A method of improved PEP (I-PEP) was developed to enhance the efficiency of PEP, primarily for the investigation of tumors from tissue sections used in routine pathology to reliably perform multiple microsatellite and sequencing studies with a single or few cells (Dietmaier et al, 1999).
- I-PEP differs from PEP (Zhang et al, 1992) in cell lysis approaches, improved thermal cycle conditions, and the addition of a higher fidelity polymerase. Specifically, cell lysis is performed in EL buffer, Taq polymerase is mixed with proofreading Pwo polymerase, and an additional elongation step at 68°C for 30 seconds before the denaturation step at 94°C was added. This method was more efficient than PEP and DOP-PCRTM in amplification of DNA from one cell and five cells.
- DOP-PCRTM and PEP have been used successfully as precursors to a variety of genetic tests and assays. These techniques are integral to the fields of forensics and genetic disease diagnosis where DNA quantities are limited. However, neither technique claims to replicate DNA in its entirety (Cheung and Nelson, 1996) or provide complete coverage of particular loci (Paunio et al, 1996). These techniques produce an amplified source for genotyping or marker identification. The products produced by these methods are consistently short ( ⁇ 3kb) and as such cannot be used in many applications (Telenius et al, 1992). Moreover, numerous tests are required to investigate a few markers or loci.
- T-PCRTM Tagged PCRTM was developed to increase the amplification efficiency of PEP in order to amplify efficiently from small quantities of DNA samples with sizes ranging from 400 bp to 1.6 kb (Grothues et al, 1993).
- T-PCRTM is a two-step strategy, which
- 25393190.1 g ER509321880US uses, for the first few low-stringent cycles, a primer with a constant 17 base pair at the 5' end and a tagged random primer containing 9 to 15 random bases at the 3' end.
- the tagged random primer is used to generate products with tagged primer sequences at both ends, which is achieved by using a low annealing temperature.
- the unincorporated primers are then removed and amplification is carried out with a second primer containing only the constant 5' sequence ofthe first primer under high-stringency conditions to allow exponential amplification.
- This method is more labor intensive than other methods due to the requirement for removal of unincorporated degenerate primers, which also can cause the loss of sample material.
- TRHA tagged random hexamer amplification
- Klenow-synthesized molecules (size range 28 bp - ⁇ 23 kb) were then amplified with T7 primer (5'-GTAATACGACTCACTATAGGGC-3' (SEQ ID NO: 10). Examination of bias indicated that only 76% of the original DNA template was preferentially amplified and represented in the TRHA products.
- the right set of primers each have a portion complementary to nucleotide sequences flanking one side of a target nucleotide sequence
- primers in the left set of primers each have a portion complementary to nucleotide
- each member of each set has a portion complementary to a separate and non-overlapping nucleotide sequence flanking the target nucleotide sequence.
- Amplification proceeds by replication initiated at each primer and continuing through the target nucleic acid sequence.
- a key feature of this method is the displacement of intervening primers during replication. Once the nucleic acid strands elongated from the right set of primers reaches the region ofthe nucleic acid molecule to which the left set of primers hybridizes, and vice versa, another round of priming and replication commences. This allows multiples copies of a nested set ofthe target nucleic acid sequence to be synthesized.
- RCA The principles of RCA have been extended to WGA in a technique called multiple displacement amplification (MDA) (Dean et al, 2002; US 6,280,949 Bl).
- MDA multiple displacement amplification
- a random set of primers is used to prime a sample of genomic DNA.
- the primers in the set will be collectively, and randomly, complementary to nucleic acid sequences distributed throughout nucleic acids in the sample.
- Amplification proceeds by replication with a highly possessive polymerase, ⁇ 29 DNA polymerase, initiating at each primer and continuing until spontaneous termination. Displacement of intervening primers during replication by the polymerase allows multiple overlapping copies ofthe entire genome to be synthesized.
- telomere-binding proteins telomere-binding proteins
- dsDNA breaks leads to the activation of p53 and of the pl6/pRB checkpoint and to a growth arrest state that mimics senescence (Vaziri and Benchimol, 1996; Di Leonardo et al, 1994; Robles and Adami, 1998).
- Cell cycle progression in senescent cells is also blocked by the same two mechanisms (Bond et al, 1996; Hara et al, 1996; Shay et al, 1991).
- This block can be overcome by viral oncogenes, such as SV40 large T antigen, that can inactivate both p53 and pRB.
- viral oncogenes such as SV40 large T antigen
- SV40 large T antigen escape senescence but continue to lose telomeric repeats during their extended life span. These cells are not yet immortal, and terminal telomere shortening eventually causes the cells to reach a second non-proliferative stage termed 'crisis' (Counter et al, 1992; Wright and
- Telomerase is a specialized cellular reverse transcriptase that can compensate for the erosion of telomeres by synthesizing new telomeric DNA.
- the activity of telomerase is present in certain germline cells but is repressed during development inmost somatic tissues, with the exception of proliferative descendants of stem cells such as those in the skin, intestine and blood (Ulaner and Giudice, 1997; Wright et al, 1996; Yui et al, 1998; Ramirez et al, 1997; Hiyama et al, 1996).
- telomerase is a ribonuclear protein composed of at least two subunits; an integral RNA, that serves as a template for the synthesis of telomeric repeats (hTR), and a protein (hTERT), that has reverse transcriptase activity.
- hTR RNA component
- the RNA component (hTR) is ubiquitous in human cells, but the presence of the mRNA encoding hTERT is restricted to the cells with telomerase activity.
- the forced expression of exogenous hTERT in normal human cells is sufficient to produce telomerase activity in these cells and prevent the erosion of telomeres and circumvent the induction of both senescence and crisis (Bodnar et al, 1998; Vaziri and Benchimol, 1998).
- telomerase can immortalize a variety of cell types.
- Cells immortalized with hTERT have normal cell cycle controls, functional p53 and pRB checkpoints, are contact inhibited, are anchorage dependent, require growth factors for proliferation, and possess a normal karyotype (Morales et al, 1999; Jiang et al, 1999).
- Japan Patent No. JP8173164A2 describes a method of preparing DNA by sorting-out PCRTM amplification in the absence of cloning, fragmenting a double-stranded DNA, ligating a known-sequence oligomer to the cut end, and amplifying the resultant DNA fragment with a primer having the sorting-out sequence complementary to the oligomer.
- the sorting-out sequences consist of a fluorescent label and one to four bases at the 5 ' and 3 ' termini to amplify the number of copies ofthe DNA fragment.
- U.S. Patent No. 6,107,023 describes a method of isolating duplex DNA fragments which are unique to one of two fragment mixtures, i.e., fragments which are present in a mixture of duplex DNA fragments derived from a positive source, but absent from a fragment mixture derived from a negative source.
- double-strand linkers are attached to each of the fragment mixtures, and the number of fragments in each mixture is amplified by successively repeating the steps of (i) denaturing the fragments to produce single fragment strands; (ii) hybridizing the single strands with a primer whose sequence is complementary to the linker region at one end of each strand, to form strand/primer complexes;
- Patent WO/016545 Al details a method for amplifying DNA or RNA using a single primer for use as a fingerprinting method.
- This protocol was designed for the analysis of microbial, bacterial and other complex genomes that are present within samples obtained from organisms containing even more complex genomes, such as animals and plants.
- the advantage of this proceedure for amplifying targeted regions is the structure and sequence of the primer.
- the primer is designed to have very high cytosine and very low guanine content, resulting in a high melting temperature.
- the primer is designed in such a way as to have a negligible ability to form secondary structure.
- this method is only able to prime a subset of regions within a genome, due to the utilization of a single priming sequence.
- the structure of the primer contains only a constant priming region, as opposed to a constant amplification region and a variable priming region in the present invention.
- a single primer consisting of non-degenerate sequence results in priming of a limited number of areas within the genome, preventing amplification ofthe whole-genome.
- U.S. Patent No. 6,114,149 regards a method of amplifying a mixture of different-sequence DNA fragments that may be formed from RNA transcription, or derived from genomic single- or double-stranded DNA fragments.
- the fragments are treated with terminal deoxynucleotide transferase and a selected deoxynucleotide to form a homopolymer tail at the 3 ' end ofthe anti-sense strands, and the sense strands are provided with a common 3 '-end sequence.
- the fragments are mixed with a homopolymer primer that is homologous to the homopolymer tail of the anti-sense strands, and a defined-sequence primer which is homologous to the sense- strand common 3 '-end sequence, with repeated cycles of fragment denaturation, annealing, and polymerization, to amplify the fragments.
- the defined-sequence and homopolymer primers are the same, i.e., only one primer is used.
- the primers may contain selected restriction-site sequences to provide directional restriction sites at the ends of the amplified fragments.
- MSDA 25393190.1 1 3 ER 509321880US amplification
- Amplification takes place not in cycles, but in a continuous, isothermal replication.
- Two sets of primers are used, a right set and a left set complementary to nucleotide sequences flanking the target nucleotide sequence.
- Amplification proceeds by replication initiated at each primer and continuation through the target nucleic acid sequence through displacement of intervening primers during replication. This allows multiple copies of a nested set of the target nucleic acid sequence to be synthesized in a short period of time.
- WGSDA whole genome strand displacement amplification
- a random set of primers is used to randomly prime a sample of genomic nucleic acid.
- fragments of DNA are first concatenated together with linkers.
- the concatenated DNA is then amplified by strand displacement synthesis with appropriate primers.
- a random set of primers can be used to randomly prime synthesis ofthe DNA concatemers in a manner similar to whole genome amplification.
- Primers complementary to linker sequences can be used to amplify the concatemers. Synthesis proceeds from the linkers through a section of the concatenated DNA to the next linker, and continues beyond. As the linker regions are replicated, new priming sites for DNA synthesis are created. In this way, multiple overlapping copies ofthe entire concatenated DNA sample can be synthesized in a short time.
- U.S. Patent No. 6,365,375 describes a method for primer extension preamplification of DNA with completely random primers in a pre-amplification reaction, and locus- specific primers in a second amplification reaction using two thermostable DNA polymerases, one of which possesses 3 '-5' exonuclease activity.
- Pre-amplification is performed by 20 to 60 thermal cycles.
- the method uses a slow transition between the annealing phase and the elongation phase. Two elongation steps are performed: one at a lower temperature and a second at a higher temperature. Using this approach, populations of especially long amplicons are claimed.
- the specific primers used in the second amplification reaction are identical to a sequence ofthe target nucleic acid or its complementary sequence.
- Specific primers used to carry out a nested PCR in a potential third amplification reaction are selected according to the same criteria as the primers used in the second amplification reaction.
- a claimed advantage of the method is its improved sensitivity to the level of a few cells and increased fidelity of the amplification due to the presence of proof-reading 3 '-5' exonuclease activity, as compared to methods using only one thermostable DNA polymerase, i.e. Taq polymerase.
- Bohlander et al. (1992) have developed a method by which microdissected material can be amplified in two initial rounds of DNA synthesis with T7 DNA polymerase using a primer that contains a random five base sequence at its 3' end and a defined sequence at its 5'
- the pre-amplified material is then further amplified by PCR using a second primer equivalent to the constant 5' sequence ofthe first primer.
- Zheleznaya et al. (1999) developed a method to prepare random DNA fragments in which two cycles are performed with Klenow fragment of DNA polymerase I and primers with random 3 '-sequences and a 5 '-constant part containing a restriction site. After the first cycle, the DNA is denatured and new Klenow fragment is added. Routine PCR amplification is then performed utilizing the constant primer.
- the present invention provides a variety of new ways of preparing DNA templates, particularly for whole genome amplification, and preferentially in a manner representative of a native genome.
- RNA and regulatory transcripts encoded within DNA are the primary mechanism regulating cellular metabolism. Transcription and the post-transcriptional processing of RNA sets the framework for all phases of cellular function. For proteins that control essential cellular functions, such as replication and differentiation, the levels of RNA expression and protein synthesis are tightly correlated. Changes within the environment of a cell or tissue often result in necessary alterations in cellular functions. For example, a cell may alter the pattern of gene expression in response to environmental factors, such as ligand and metabolite stimulated signaling. Furthermore, cellular expression of RNA and proteins may be altered intentionally as with the use of some therapeutic drugs. These changes in gene expression may be due to both the beneficial and the toxic effects of these drugs. Alterations in gene expression
- ER 509321880US in both the normal or diseased state can be utilized for determining the efficacy and mechanisms of action of potential treatments.
- cells may exhibit subtle changes in expression during cancer progression. Changes in gene expression of key proteins involved in cellular transformation have the potential to be used as predictive markers of oncogenesis.
- the sequencing and mapping of the human genome has resulted in a database of potentially expressed genes.
- tools, including high-density micro-arrays have been developed to measure the expression of each of these genes, including potential splice variants.
- Transcribed genes at any given moment in the life of a cell or tissue represent the regulatory and protein-coding responses involved in cellular function.
- the present invention relates to the unbiased amplification of sequences representative of the RNA profile.
- High fidelity amplification of expressed genes from localized tissues, small groups of cells, or a single cell will allow the analysis of subtle alterations in gene expression.
- the need to profile a wide range of potentially expressed RNA molecules from limited sample material requires an amplification method that maintains the representation of the starting material.
- the invention described herein provides a method to produce a large amount of cDNA from amounts of RNA typically recovered in clinical and diagnostic applications that are not sufficient for direct processing.
- Whole transcriptome amplification has a relatively brief history with methods based primarily on quasi-linear amplification and exponential amplification.
- Linear transcription based and single primer amplification (SPA) based methods require an initial reverse transcription step using either random or poly-T priming.
- primers utilized for reverse transcription may contain a non-complementary tail introducing a specific universal sequence.
- iVT in vitro transcription
- specific binding and initiation sites are introduced as 5' oligo extensions corresponding to one of the phage RNA polymerase priming and recognition sites (Phillips and Eberwine, 1996; US005514545A).
- RNA/DNA duplexes resulting from reverse transcription or first strand cDNA synthesis serve as the template for second strand cDNA synthesis after degradation of the RNA strand by RNase H.
- Second strand cDNA products may be primed randomly or terminally to incorporate the RNA polymerase recognition sites in the tailed primers, thereby generating substrate for linear amplification.
- ER 509321880US Various modifications to the protocol include second strand priming utilizing terminal transferase to extend first strand cDNA products to introduce short stretches of guanine (Wang and Chung; US005932451A), and utilizing the native terminal transferase activity of Moloney murine leukemia virus reverse transcriptase, which has the propensity to add three to five cytosine ribonucleotides to the 3' terminus of extension products.
- RNA polymerase An alternative to linear amplification by RNA polymerase is "Single Primer Amplification” (SPA), whereby the initial reverse transcriptase incorporated primer sequence designates the binding site for primer annealing in sequential rounds of primer extension with Taq polymerase (Smith et al., 2003).
- SPA Single Primer Amplification
- the reaction is carried out under isothermal conditions whereby the primer consists partially of DNA and partially of RNA.
- each primer extension product generates substrate for RNase H within the 5' RNA component of the primer.
- Cleavage ofthe extension products generates successive priming sites, and the reaction cycles in a linear strand displacement isothermal mode.
- Sequential rounds of transcription and reverse transcription are capable of producing as much as a million fold amplification.
- PCR based amplification of RNA involves the same initial steps of reverse transcription and second strand synthesis. While those familiar with the art will appreciate the potential to introduce bias upon exponential amplification, several methods have demonstrated the amplified products to have minimal distortion and be highly representative of the original RNA transcripts.
- the standard method employs double stranded cDNA generated by classical first and second strand synthesis. Briefly, reverse transcriptase initiates from oligo dT and random primers to promote first strand synthesis followed by a cocktail of DNA polymerase I, RNase H and DNA ligase for second strand synthesis and repair. Universal adaptors, containing a known sequence, can then be ligated to the double strand cDNA molecules for subsequent amplification.
- This process can be substantially improved by avoiding the requirement for ligation mediated adapter ligation tlirough the use of a reverse transcriptase non-template directed addition of cytosine residues.
- a universal sequence is subsequently introduced as a primer for strand switching mediated second strand cDNA synthesis (Schmidt et al, 1999).
- ER 509321880US primer construction to co-amplify multiple samples that share a common distal primer sequence.
- the mixture of samples can be co-amplified, minimizing effects of any impurities or other factors affecting the amplification.
- the pooled samples are subsequently separated based on the individual sequence tags, from their respective proximal primer sequence, in either a secondary low cycle amplification or a primer extension labeling reaction.
- the present invention minimizes the introduction of bias by capturing transcripts, in a single step, in the form of amplimers with a uniform size distribution.
- WTA products are synthesized independent of the integrity of the RNA molecule, the ability to complete reverse transcription of the entire RNA molecule, the requirement for template switching during second strand synthesis, and the ligation of adapters. Subsequent amplification of the products using a universal non-self-complementary primer results in unbiased representation suitable for all applications, such as downstream expression studies.
- the present invention regards the amplification of a whole genome, or whole transcriptome, including various methods and compositions to achieve that goal.
- a whole genome is amplified from a single cell, whereas in another embodiment the whole genome is amplified from a plurality of cells.
- the whole transcriptome is amplified from poly A+ RNA, or in another embodiment the whole transcriptome is amplified from total RNA.
- the invention is directed to methods for the amplification of substantially the entire genome or entire transcriptome without loss of representation of specific sites (herein defined as “whole genome amplification” and “whole transcriptome amplification", respectively).
- whole genome amplification comprises simultaneous amplification of substantially all fragments of a genomic library.
- substantially entire or substantially all refers to about 80%, about 85%, about 90%, about 95%, about 97%, or about 99% of all sequence in a genome.
- a skilled artisan recognizes that amplification of the whole genome will, in some
- ER 509321880US embodiments comprise non-equivalent amplification of particular sequences over others, although the relative difference in such amplification is not considerable.
- the present invention regards immortalization of DNA following generation of a library comprising a representative amplifiable copy of the template DNA.
- the library generation step utilizes special self-inert degenerate primers designed to eliminate their ability to form primer-dimers and a polymerase comprising strand-displacement activity.
- a method for uniform amplification of DNA or RNA using self-inert degenerate primers comprised essentially of non- self-complementary nucleotides.
- the degenerate oligonucleotides do not participate in Watson-Crick base-pairing with one another.
- This lack of primer complementarity overcomes major problems known in the art associated with DNA amplification by random primers, such as excessive primer-dimer formation, complete or sporadic locus dropout, generation of very short amplification products, and in some cases the inability to amplify single stranded, short, or fragmented DNA and RNA molecules.
- the invention provides a two-step procedure that can be performed in a single tube or in a micro-liter plate, for example, in a high throughput format.
- the first step (termed the "library synthesis step") involves incorporation of known sequence at both ends of amplicons using highly degenerate primers and at least one enzyme possessing strand-displacement activity.
- the resulting branching process creates molecules having self- complementary ends.
- the resulting library of molecules are then amplified in a second step by PCRTM using, for example, Taq polymerase and a primer corresponding to the known sequence, resulting in several thousand-fold amplification of the entire genome or transcriptome without significant bias.
- the products of this amplification can be re-amplified additional times, resulting in amplification that exceeds, for example, several million fold.
- a method of preparing a nucleic acid molecule comprising obtaining at least one single stranded nucleic acid molecule; subjecting said single stranded nucleic acid molecule to a plurality of primers to form a single stranded nucleic acid molecule/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; and subjecting said single stranded nucleic acid molecule/ primer mixture to a strand-displacing polymerase, under conditions wherein said subjecting steps generate a plurality of molecules including all or part ofthe known nucleic acid sequence at each end.
- the method may further comprise the step of designing the primers such that they purposefully are substantially non-self-complementary and substantially noncomplementary to other primers in the plurality.
- the method may also further comprise the step of amplifying a plurality of the molecules comprising the l ⁇ iown nucleic acid sequence to produce amplified molecules.
- Such amplification may comprise polymerase chain reaction, such as that utilizes a primer complementary to the known nucleic acid sequence.
- the primers may comprise a constant region and a variable region, both of which include nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality.
- the constant region and variable region for a particular primer are comprised of the same two nucleotides, although the sequence ofthe two regions are usually different.
- the constant region is preferably known and may be a targeted sequence for a primer in amplification methods.
- the variable region may or may not be known, but in preferred embodiments is known.
- the variable region may be randomly selected or may be purposefully selected commensurate with the frequency of its representation in a source DNA, such as genomic DNA.
- the nucleotides of the variable region will prime at target sites in a source DNA, such as a genomic DNA, containing the conesponding Watson-Crick base partners. In a particular embodiment, the variable region is considered degenerate.
- the single stranded nucleic acid molecule may be DNA, in some embodiments, and in alternative embodiments the single stranded nucleic acid molecule is RNA or a DNA-RNA chimera.
- a tag is incorporated on the ends of the amplified molecules, preferably wherein the known sequence is penultimate to the tags on each end of the amplified molecules.
- the tag may be a homopolymeric sequence, in specific embodiments, such as a purine.
- the homopolymeric sequence may be single stranded, such as a single stranded poly G or poly C.
- the homopolymeric sequence may refer to a region of double stranded DNA wherein one strand of homopolymeric sequence comprises all of the same nucleotide, such as poly C, and the opposite strand ofthe double stranded region complementary thereto comprises the appropriate poly G.
- the incorporation of the homopolymeric sequence may occur in a variety of ways known in the art.
- the incorporation may comprise terminal deoxynucleotidyl transferase activity, wherein a homopolymeric tail is added via the terminal deoxynucleotidyl transferase enzyme.
- Other enzymes having analogous activites may be utilized, also.
- the incorporation of the homopolymeric sequence may comprise ligation of an adaptor comprising the homopolymeric sequence to the ends of the amplified molecules.
- ER 509321880US incorporation of the homopolymeric sequence employs replicating the amplified molecules with DNA polymerase by utilizing a primer comprising in a 5' to 3' orientation, the homopolymeric sequence, and the known sequence.
- the amplified molecules comprising the homopolymeric sequence are further amplified using a primer complementary to a known sequence and a primer complementary to the homopolymeric sequence.
- a primer complementary to a known sequence for example, surprisingly, the amplification of molecules with just the homo-cytosine primer is suppressed in favor of amplification of molecules with the primer complementary to a specific sequence (such as the known sequence) and the homo-cytosin ⁇ primer.
- the obtaining step may be further defined as comprising the steps of obtaining at least one double stranded DNA molecule and subjecting the double stranded DNA molecule to heat to produce at least one single stranded DNA molecule.
- Nucleic acids processed by methods described herein may be DNA, RNA, or DNA-RNA chimeras, and they may be obtained from any useful source, such as, for example, a human sample.
- a double stranded DNA molecule is further defined as comprising a genome, such as, for example, one obtained from a sample from a human.
- the sample may be any sample from a human, such as blood, serum, plasma, cerebrospinal fluid, cheek scrapings, nipple aspirate, biopsy, semen (which may be refened to as ejaculate), urine, feces, hair follicle, saliva, sweat, immunoprecipitated or physically isolated chromatin, and so forth.
- the sample comprises a single cell.
- the prepared nucleic acid molecule from the sample provides diagnostic or prognostic information.
- the prepared nucleic acid molecule from the sample may provide genomic copy number and/or sequence information, allelic variation information, cancer diagnosis, prenatal diagnosis, paternity information, disease diagnosis, detection, monitoring, and/or treatment information, sequence infonnation, and so forth.
- the primers are further defined as having a constant first and variable second regions each comprised of two non-complementary nucleotides.
- the first and second regions may be each comprised of guanines, adenines, or both; of cytosines, thymidines, or both; of adenines, cytosines, or both; or of guanines, thymidines, or both.
- the first region may comprise about 6 to about 100 nucleotides.
- the second region may comprise about 4 nucleotides to about 20 nucleotides.
- the polynucleotide (primer) may be further comprised of 0 to about 3 random bases at its distal 3 ' end.
- the nucleotides are base or backbone analogs.
- the first region and the second region are each comprised of guanines and thymidines and the polynucleotide (primer) comprises about 1, 2, or 3 random bases at its 3' end, although it may comprise 0 random bases at its 3' end.
- the known nucleic acid sequence may be used for subsequent amplification, such as with polymerase chain reaction.
- methods of the present inveniton utilize a strand- displacing polymerase, such as ⁇ 29 Polymerase, Bst Polymerase, Vent Polymerase, 9°Nm Polymerase, Klenow fragment of DNA Polymerase I, MMLV Reverse Transcriptase, AMV reverse transcriptase, HIV reverse transcriptase, a mutant form of T7 phage DNA polymerase that lacks 3' -5' exonuclease activity, or a mixture thereof.
- the strand- displacing polymerase is Klenow or is the mutant form of T7 phage DNA polymerase that lacks 3' — > 5' exonuclease activity.
- Methods utilized herein may further comprise subjecting single stranded nucleic acid molecule/ primer mixtures to a polymerase-processivity enhancing compound, such as, for example, single-stranded DNA binding protein or helicase.
- a polymerase-processivity enhancing compound such as, for example, single-stranded DNA binding protein or helicase.
- RNA molecule/ primer mixture comprising obtaining an RNA molecule; subjecting the RNA molecule to a plurality of primers to form a RNA molecule/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein the sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting the RNA molecule/ primer mixture to a polymerase, under conditions wherein the subjecting steps generate a plurality of DNA molecules comprising the constant region at each end; and amplifying a plurality of the DNA molecules through polymerase chain reaction, said reaction utilizing a primer complementary to the constant region.
- the RNA molecule may be obtained from a sample, such as a sample comprising total cellular RNA, a transcriptome, or both; the sample may be obtained from one or
- the sample may comprise mRNA, such as mRNA that is obtained by affinity capture
- a method of amplifying a genome, transcriptome, or both comprising obtaining genomic DNA, RNA (such as mRNA) or both; modifying the genomic DNA, RNA, or both to generate at least one single stranded nucleic acid molecule; subjecting said single stranded nucleic acid molecule to a plurality of primers to form a nucleic acid/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting said nucleic acid/ primer mixture to a strand-displacing polymerase, under conditions wherein said subjecting steps generate a plurality of DNA molecules comprising the constant region at each end; and amplifying a plurality of the DNA molecules through polymerase chain reaction, said reaction utilizing a primer complementary to the constant nucleic acid sequence
- the method may further comprise the steps of modifying double stranded DNA molecules to produce single stranded molecules, said single stranded molecules comprising the known nucleic acid sequence at both the 5' and 3' ends; hybridizing a region of at least one of the single stranded DNA molecules to a complementary region in the 3' end of an oligonucleotide immobilized to a support to produce a single stranded DNA/oligonucleotide hybrid; and extending the 3 ' end of the oligonucleotide to produce an extended polynucleotide.
- the method further comprises the step of removing the single stranded DNA molecule from the single stranded DNA/oligonucleotide hybrid.
- a method of obtaining a total nucleic acid from a sample comprising a mixture of DNA and RNA comprising providing the mixture of DNA and RNA; optionally heating the mixture to a temperature that denatures double stranded nucleic acids; and subjecting the mixture to a polymerase that replicates both single stranded DNA and RNA.
- the method consists essentially of said providing, optionally heating, and subjecting steps.
- the subjecting step may be further defined as subjecting the mixture to a plurality of primers to form a nucleic acid/primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting said nucleic acid/ primer mixture to the polymerase that efficiently replicates both DNA and RNA, under conditions wherein said subjecting steps generate a plurality of DNA molecules comprising the constant
- RNA/ primer mixture comprising nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting said RNA/ primer mixture to a reverse transcriptase, under conditions wherein said subjecting steps generate a plurality of DNA molecules comprising the constant region at each end; and amplifying a plurality of the DNA molecules through polymerase chain reaction, said reaction utilizing a primer complementary to the known nucleic acid sequence.
- a method of amplifying a protein-coding transcriptome comprising obtaining mRNA; subjecting the mRNA molecule to a plurality of primers to form an mRNA/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting said mRNA/ primer mixture to a reverse transcriptase, under conditions wherem said subjecting steps generate a plurality of DNA molecules comprising the constant region at each end; and amplifying a plurality of the DNA molecules through polymerase chain reaction, said reaction utilizing a primer complementary to the constant region.
- a method of amplifying a DNA molecule generated from at least one mRNA molecule comprising obtaining a cDNA molecule from the mRNA molecule; modifying the cDNA molecule to generate at least one ssDNA molecule; subjecting the ssDNA molecule to a plurality of primers to form a ssDNA molecule/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein the sequence comprises, in a 5' to 3' orientation, a constant region and a variable region; subjecting the ssDNA molecule/ primer mixture to a strand-displacing polymerase, under conditions wherein the subjecting steps generate a plurality of DNA molecules comprising the constant region at each end; and amplifying a plurality of the DNA molecules comprising the constant region at each end through polymerase chain reaction, said reaction utilizing a primer complementary
- the obtaining step may be further defined as comprising generation of the cDNA molecule by reverse transcribing the mRNA molecule with a reverse transcriptase, such as, for example Tth DNA polymerase, HIV Reverse Transcriptase, AMV Reverse Transcriptase, MMLV Reverse Transcriptase, or a mixture thereof.
- a reverse transcriptase such as, for example Tth DNA polymerase, HIV Reverse Transcriptase, AMV Reverse Transcriptase, MMLV Reverse Transcriptase, or a mixture thereof.
- kits comprising a plurality of polynucleotides, wherein the polynucleotides comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other polynucleotides in the plurality, said plurality dispersed in a suitable container.
- the kit may further comprise a polymerase, such as a strand displacing polymerase, including, for example, ⁇ 29 Polymerase, Bst Polymerase, Vent Polymerase, 9°Nm Polymerase, Klenow fragment of DNA Polymerase I, MMLV Reverse Transcriptase, a mutant form of T7 phage DNA polymerase that lacks 3' -5' exonuclease activity, or a mixture thereof.
- a polymerase such as a strand displacing polymerase, including, for example, ⁇ 29 Polymerase, Bst Polymerase, Vent Polymerase, 9°Nm Polymerase, Klenow fragment of DNA Polymerase I, MMLV Reverse Transcriptase, a mutant form of T7 phage DNA polymerase that lacks 3' -5' exonuclease activity, or a mixture thereof.
- a method of amplifying a population of DNA molecules comprised in a plurality of populations of DNA molecules comprising the steps of obtaining a plurality of populations of DNA molecules, wherein at least one population in said plurality comprises DNA molecules having in a 5' to 3' orientation a known identification sequence specific for the population and a known primer amplification sequence; and amplifying the population of DNA molecules by polymerase chain reaction, the reaction utilizing a primer for the identification sequence.
- the obtaining step may be further defined as obtaining a population of DNA molecules comprising a known primer amplification sequence; amplifying said DNA molecules with a primer having in a 5' to 3' orientation the known identification sequence and the known primer amplification sequence, and mixing the population with at least one other population of DNA molecules.
- the population of DNA molecules comprises genomic DNA, is a genome, or is a transcriptome.
- a method of amplifying a population of DNA molecules comprised in a plurality of populations of DNA molecules by obtaining a plurality of populations of DNA molecules, wherein at least one population in the plurality comprises DNA molecules, wherein the 5' ends ofthe DNA molecules comprise in a 5' to 3 ' orientation a single-stranded region comprising a known identification sequence specific for the population and a Icnown primer amplification sequence; isolating the population through binding of at least part of the single stranded known identification sequence of a plurality of the DNA molecules to a surface; and amplifying the isolated DNA molecules by polymerase chain reaction that utilizes a primer complementary to the primer amplification sequence.
- the obtaining step may be further defined as obtaining a population of DNA molecules comprising a known primer amplification sequence; amplifying the DNA molecules with a primer comprising in a 5' to 3' orientation: the known identification sequence; a non- replicable linker; and the known primer amplification sequence; and mixing the population with at least one other population of DNA molecules.
- the isolating step may be further defined as binding at least part of the single stranded known identification sequence to an immobilized oligonucleotide comprising a region complementary to the known identification sequence.
- polynucleotides in the plurality comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other polynucleotides in the plurality.
- the nucleic acid sequence may be further defined as rendering the polynucleotides substantially incapable of at least one of the following self-hybridization; self-priming; hybridization to another polynucleotide in the plurality; and initiation of a polymerization reaction in the plurality.
- the polynucleotides in the plurality may be further defined as having a 5' to 3' orientation and comprising a constant first region 5' to a variable second region.
- the constant region is for subsequent amplification and/or the variable region is for random annealing, random priming, or both.
- the first and second regions ofthe polynucleotides may each be comprised of two non-complementary nucleotides, such as guanines, adenines, or both; cytosines, thymidines, or both; adenines, cytosines, or both; or guanines, thymidines, or both.
- the first region may comprise about 6 to about 100 nucleotides and/or the second region may comprise about 4 nucleotides to about 20 nucleotides.
- the polynucleotide may further comprise 0 to about 3 random bases at its distal 3' end.
- the nucleic acid sequence may be comprised of base or backbone analogs, or both, in some embodiments.
- the first region and the second region are each comprised of guanines and thymidines and the polynucleotide comprises 0, 1, 2, or 3 random bases at its 3 ' end.
- RNA from a sample comprising dsDNA and RNA comprising providing the mixture of dsDNA and RNA; optionally heating said mixture to a temperature not exceeding about 75°C to prevent denaturation of dsDNA; and subjecting the mixture to a polymerase that replicates only single stranded RNA templates.
- the method consists essentially of the providing and subjecting steps, or ofthe providing, optionally heating, and subjecting steps.
- the subjecting step is further defined as subjecting the mixture to a plurality of primers to form a
- ER 509321880US ssRNA/dsDNA/primer mixture wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting said ssRNA/ dsDN A/primer mixture to a polymerase that prime and replicate only single-stranded RNA, under conditions wherein said subjecting steps generate a plurality of DNA molecules comprising the constant nucleic acid sequence at each end; and amplifying a plurality ofthe DNA molecules comprising the constant region at each end through polymerase chain reaction, said reaction utilizing a primer complementary to the constant region.
- a method of immobilizing an amplified genome, transcriptome, or both by obtaining an amplified genome, transcriptome, or both, wherein a plurality of molecules from the genome, transcriptome, or both comprise a known primer amplification sequence at both the 5' and 3' ends ofthe molecules; and attaching a plurality ofthe molecules to a support.
- the attaching step may be further defined as comprising covalently attaching the plurality of molecules to the support through said known primer amplification sequence.
- the covalently attaching step is further defined as hybridizing a region of at least one single stranded molecule to a complementary region in the 3' end of a oligonucleotide immobilized to said support; and extending the 3' end of the oligonucleotide to produce a single stranded molecule/ extended polynucleotide hybrid.
- the method may also further comprise the step of removing the single stranded molecule from the single stranded molecule/extended polynucleotide hybrid to produce an extended polynucleotide.
- the method may also further comprise the step of replicating the extended polynucleotide.
- the replicating step may be further defined as providing to said extended polynucleotide a polymerase and a primer complementary to the known primer amplification sequence; extending the 3 ' end of • said primer to form an extended primer molecule; and releasing said extended primer molecule.
- a method of immobilizing an amplified genome comprising the steps of obtaining an amplified genome, wherem a plurality of DNA molecules from the genome and comprise a tag; and a known primer amplification sequence at both the 5' and 3' ends of the molecules; and attaching a plurality of the DNA molecules to a support.
- the attaching step is further defined as comprising attaching the plurality of DNA molecules to the support through said tag.
- the tag may be biotin and the support may comprise streptavidin.
- the tag comprises an amino group or a carboxy group, for example, although other tags useful in the art are contemplated.
- the tag comprises a single stranded region and the support comprises an oligonucleotide comprising a sequence complementary to a region of the tag.
- the tag may comprise a single stranded region further defined as an identification sequence.
- the DNA molecules may be further defined as comprising a non-replicable linker that is 3' to the identification sequence and that is 5' to the known primer amplification sequence.
- the method further comprises the steps of removing contaminants from the immobilized genome.
- Methods having amplified molecules may further comprise the steps of modifying the amplified molecules, the molecules further defined as double stranded molecules, to incorporate modified nucleotide bases, thereby producing labeled molecules; generating single stranded molecules from the labeled molecules, the single stranded molecules capable of hybridizing to complementary sequences anayed in known locations on a substrate; and analyzing at least one hybridization signal.
- the modifying step may comprise chemical, enzymatic, or physical incorporation of modified nucleotide bases, which, for example, are radioactive or fluorescent.
- the generating step comprises denaturation of the double stranded molecules.
- the substrate may comprise a microanay substrate.
- the analyzing step may comprise measuring the background subtracted intensity of the at least one hybridization signal and/or measuring copy number, representation, or both ofthe amplified molecules.
- a method of differentially obtaining DNA or RNA, respectively, from a sample comprising a mixture of DNA and RNA comprising providing the mixture of DNA and RNA; heating the mixture to a temperature that selectively affects the DNA or RNA; subjecting the mixture to a polymerase that selectively replicates the respective DNA or RNA.
- the subjecting step may be further defined as subjecting the mixture to a plurality of primers to form a ssDNA/ RNA/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting said ssDNA/ RNA/ primer mixture to the polymerase that selectively replicates the respective DNA or RNA, under conditions wherein said subjecting steps generate a plurality of DNA molecules comprising the constant region at each end; and amplifying a plurality of the DNA molecules comprising the constant region at each end through polymerase chain reaction that utilizes a primer complementary to the constant region.
- the method may further comprise subjecting the mixture to a plurality of primers to form a ssDNA/ RNA/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; and subjecting said ssDNA/ RNA primer mixture to a polymerase that selectively replicates DNA, under conditions wherein the subjecting steps generate a plurality of DNA molecules comprising the l ⁇ iown nucleic acid sequence at each end.
- the method may further comprise the step of amplifying a plurality of the DNA molecules through polymerase chain reaction, said reaction utilizing a primer complementary to the constant region.
- the polymerase may be a DNA-dependent DNA polymerase, in specific embodiments, such as ⁇ 29 Polymerase, Bst Polymerase, Vent Polymerase, 9°Nm Polymerase, Klenow Exo " fragment of DNA Polymerase I, a mutant form of T7 phage DNA polymerase that lacks 3' -5' exonuclease activity, or a mixture thereof.
- the DNA-dependent DNA polymerase is preferably Klenow Exo " fragment of DNA Polymerase I.
- RNA from a sample comprising DNA and RNA comprising providing the mixture of DNA and RNA; heating said mixture to a temperature not exceeding about 75°C, to prevent denaturing of dsDNA; and subjecting the mixture to a polymerase that replicates only single stranded RNA templates.
- the method may ftirther comprise subjecting the mixture to a plurality of primers to form a ssRNA/ dsDNA/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality and wherein the primers comprise a known nucleic acid sequence; and subjecting said ssRNA/ dsDNA/ primer mixture to a polymerase that primes and replicates only single stranded RNA, such as M-MuLV reverse transcriptase, under conditions wherein the subjecting steps generate a plurality of DNA molecules comprising the known nucleic acid sequence at each end.
- a polymerase that primes and replicates only single stranded RNA, such as M-MuLV reverse transcriptase
- the method further comprises the step of amplifying a plurality of the DNA molecules through polymerase chain reaction, said reaction utilizing a primer complementary to the known nucleic acid sequence.
- ds DNA molecules comprising genomic DNA, wherein when the molecules are denatured to produce first and second strand molecules, each of which comprises a first and second end region at the respective ends ofthe first and second strand molecules, each of the first and second end regions
- each of the first and second end regions of the first strand molecule are substantially non-complementary to the first and second end regions of the first sfrand of other molecules in the plurality, and wherein each of the first and second end regions of the second strand molecule are substantially non-complementary to the first and second end regions of the second strand of other molecules in the plurality.
- the DNA molecules may further comprise a homopolymeric tag at the first and second end regions, wherein said end regions are penultimate on the molecules to the homoporymeric tag.
- the amplified molecules are further defined as a genomic library.
- a method of sequencing a genome from a limited source of material comprising the steps of: obtaining at least one double stranded or single stranded DNA molecule from a limited source of material; subjecting said double stranded DNA molecule to heat to produce at least one single stranded DNA molecule; subjecting said single stranded DNA molecule to a plurality of primers to form a DNA molecule/ primer mixture, wherein the primers comprise nucleic acid sequence that is substantially non-self-complementary and substantially non-complementary to other primers in the plurality, wherein said sequence comprises in a 5' to 3' orientation a constant region and a variable region; subjecting said DNA molecule/ primer mixture to a polymerase, under conditions wherein said subjecting steps generate a plurality of DNA molecules comprising the constant region at each end; and amplifying a plurality of the DNA molecules through polymerase chain reaction, said reaction utilizing a primer complementary to the constant region;
- the incorporating of the homopolymeric sequence comprises one of the following steps: extending the 3' end of the amplified DNA fragments by terminal deoxynucleotidyl transferase in the presence of dGTP; ligating an adaptor comprising
- the sequencing step may be further defined as cloning the amplified DNA fragments from the first sample into a vector; and sequencing at least some ofthe cloned fragments.
- the specific sequence of the amplified molecule may be obtained by the sequencing step ofthe first sample and wherein one or more of the additional specific sequences is obtained by the sequencing step of amplified molecules from the second sample.
- the limited source of material may be a microorganism substantially resistant to culturing, or an extinct species, for example. In specific embodiments, sequencing a genome is achieved with minimal redundancy.
- FIG. 1 illustrates a schematic presentation of whole genome and whole transcriptome amplification by incorporating known sequence with self-inert degenerate primers followed by PCR amplification. Dashed lines represent newly synthesized strands. Thicker lines represent the known sequence.
- FIG. 2 is a schematic presentation of design of exemplary self-inert degenerate primers designed to eliminate their ability to form primer-dimers.
- FIGS. 3A through 3C provide an analysis of self-priming and extension of degenerate YN-primers (primers containing from 0 to about 6 completely random bases (N) at the 3' end, 10 degenerate pyrimidine bases Y, and the known pyrimidine sequence YU at the 5' end (FIG. 2)).
- degenerate YN-primers primers containing from 0 to about 6 completely random bases (N) at the 3' end, 10 degenerate pyrimidine bases Y, and the known pyrimidine sequence YU at the 5' end (FIG. 2)
- YN primers containing 0, 1, 2 or 3 random N bases were used with or without dNTPs.
- FIG. 3B YN primers containing 0, 1, 2 or 3 random N bases and a model
- FIG. 4 shows an assay for primer- dimer formation by degenerate YN primers having from 0 to 6 completely random bases at the 3' end or by a primer comprised of T7 promoter sequence at the 5' region and 6 completely random bases at the 3' end (Table III, primer 17) in human whole genome amplification with the Klenow Exo- fragment of DNA Polymerase I.
- N The number of completely random bases (N) is shown at the end of each primer's abbreviation.
- FIG. 5 demonstrates real-time PCR amplification of 5 ng aliquots of whole genome libraries synthesized with Klenow exo- fragment of DNA Polymerase I and self-inert degenerate primers described in FIG. 4.
- FIGS. 6A and 6B show representation analysis of 30 exemplary human STS markers following whole genome amplification with exemplary degenerate pyrimidine YN primers specified in the description of FIG. 4 and the Klenow Exo- fragment of DNA Polymerase I. Aliquots conesponding to 10 ng of amplified DNA were used for PCR analysis of STS markers.
- pyrimidine primers with 0 to 3 random 3' bases were used for the library synthesis step
- FIG. 6B pyrimidine primers with 4 to 6 random 3' bases were used.
- the number of completely random bases (N) is shown at the end of each primer's abbreviation.
- FIG. 7 shows real-time PCR amplification of 5 ng aliquots of whole genome pre-amplifiied samples of thermally fragmented human genomic DNA with Klenow Exo- fragment of DNA Polymerase I or Sequenase version 2 using self-inert degenerate pyrimidine primer Y(N) 2 with 2 random bases at the 3 ' end.
- FIG. 8 demonstrates gel analysis of amplification products of thermally fragmented human genomic DNA with Klenow Exo- fragment of DNA Polymerase I or Sequenase version 2 using self-inert degenerate pyrimidine primer Y(N) 2 as specified in the description to FIG. 7.
- FIG. 9 shows representation analysis of 33 exemplary human STS markers following whole genome amplification with exemplary self-inert degenerate pyrimidine primer Y(N) 2 and Klenow Exo- fragment of DNA Polymerase I or Sequenase version 2. Aliquots corresponding to 10 ng of amplified DNA were used for PCR analysis of STS markers.
- FIG. 10 illustrates comparison between four self-inert degenerate primers comprising four possible base pair combinations known not to participate in Watson-Crick base pairing and containing two completely random bases at their 3' ends in library synthesis reactions
- FIGS. 11 A through 1 IE show representation analysis of 35 exemplary human STS markers following whole genome amplification with self-inert degenerate primers specified in the description to FIG. 10 and Sequenase version 2 DNA polymerase or a combined sample in which equal amounts of four individual reactions each with a separate degenerate primer were combined prior to PCR amplification of the STS markers. Aliquots conesponding to 10 ng of amplified DNA were used for PCR analysis of STS markers. Abbreviations show the base composition ofthe self-inert degenerate primers.
- FIG. 12 demonstrates comparison between isothermal incubation at 24°C for 60 min, a three-step incubation at 16°C, 24°C, and 37°C for 20 min each, and a cycling incubation for 19 cycles at 16°C, 24°C, and 37°C for 1 min each in whole genome amplification of human DNA with Sequenase version 2 DNA polymerase and self-inert degenerate primer Y(N) 2 . Aliquots conesponding to 5 ng of input DNA of the WGA library synthesis reactions were amplified by quantitative real-time PCR.
- FIG. 13 shows representation analysis of 17 Human STS markers following whole genome amplification with self-inert degenerate primer Y(N) 2 and Sequenase version 2 DNA polymerase as detailed in the description to FIG. 12 Aliquots conesponding to 10 ng of amplified DNA were used for PCR analysis of STS markers.
- FIG. 14 shows titration from 0.5 ⁇ M to 33 ⁇ M of self-inert degenerate primer K(N) 2 in human WGA with Sequenase version 2 DNA polymerase. Aliquots conesponding to 5 ng of input DNA ofthe WGA library synthesis reactions were amplified by quantitative real-time PCR.
- FIG. 15 shows representation analysis of 17 exemplary human STS markers following whole genome amplification with exemplary self-inert degenerate primer K(N) 2 applied at concentrations of 0.5 to 10 ⁇ M and Sequenase version 2 DNA polymerase as specified in the description to FIG 14. Aliquots conesponding to 10 ng of amplified DNA were used for PCR analysis of STS markers. Shown is a distribution plot of DNA amounts derived from quantitative real-time PCR. Horizontal bars represent median values.
- FIG. 16 shows titration from 5 ng to 100 ng of thermally fragmented genomic DNA in WGA reaction with self-inert degenerate primer K(N) 2 and Sequenase version 2 DNA polymerase. Aliquots conesponding to 5 ng of input DNA ofthe WGA library synthesis reactions were amplified by quantitative real-time PCR.
- FIG. 17 shows representation analysis of 20 exemplary human STS markers following whole genome amplification of between 5 ng and 100 ng of thermally fragmented DNA with self-inert degenerate primer K(N) 2 and Sequenase version 2 DNA polymerase as specified in the description to FIG. 16. Aliquots conesponding to 10 ng of amplified DNA were used for PCR analysis of STS markers. Shown is a distribution plot of DNA amounts derived from quantitative real-time PCR. Horizontal bars represent median values.
- FIGS. 18A through 18C show the structure of the known primer with the ID tags.
- FIG. 18A illustrates replicable known primer with the known primer sequence U at the 3'- end and individual ID sequence tag T at the 5' end.
- FIG. 18B shows non-replicable known primer with the known primer sequence U at the 3 ' end, individual ID sequence tag T at the 5 ' end, and non-replicable organic linker L between them.
- FIG. 18C shows 5' overhanging structure of the ends of DNA fragments in the WGA library after amplification with non-replicable known primer.
- FIG. 19 shows the process of synthesis of WGA libraries with the replicable identification (ID) tag and their usage, for example for security and/or confidentiality purposes, by mixing several libraries and recovering individual library by ID-specific PCR.
- ID replicable identification
- FIG. 20 shows the process of synthesis of WGA libraries with the non- replicable ID tag and their usage, for example for security and/or confidentiality purposes, by mixing several libraries and recovering individual libraries by ID-specific hybridization capture.
- FIG. 21 shows the process of conversion of amplified WGA libraries into libraries with additional G n or Cio sequence tag located at the 3' or 5' end, respectively, of the universal known primer sequence U with subsequent use of these modified WGA libraries for targeted amplification of one or several specific genomic sites using universal primer C 10 and unique primer P.
- FIG. 22 shows the process for covalent immobilization of WGA library on a solid support.
- FIGS. 23A through 23B show WGA libraries in the micro-anay format.
- FIG. 22A illustrates an embodiment utilizing covalent attachment of the libraries to a solid support.
- FIG. 22B illustrates an embodiment utilizing non-covalent attachment of the libraries to a solid support.
- FIG. 24 shows an embodiment wherein the immobilized WGA library may be used repeatedly.
- FIG. 25 describes the method of WGA product purification utilizing a non- replicable known primer and magnetic bead affinity capture.
- FIG. 26A and 26B shows comparison between the whole genome amplification described in the present invention and a commercially available kit for DOP-PCR amplification.
- Aliquots of 5 ng and 20 pg of genomic DNA were amplified with Klenow Exo- fragment of DNA polymerase I and 1 ⁇ M of self-inert degenerate primer K(N) 2 or with DOP PCR MasterTM Kit (Roche Molecular Biochemicals).
- A Real-time PCR amplification curves for libraries form 5 ng gDNA, 20 pg gDNA, or blank control.
- B Logarithmic distribution plots of 16 genomic STS markers amplified from the whole genome libraries amplified in FIG. 25 A. Amplification with Klenow Exo- fragment of DNA polymerase I and self-inert degenerate primer K(N) 2 was superior both in sensitivity and in representation of genomic markers as compared to that with DOP PCR
- FIG. 27 displays the amplification curves of libraries generated from DNA isolated from serum collected in a serum separator tube. The amplification was performed for 17 cycles.
- FIGS. 28A and 28B represent the analysis of the amplified products from serum DNA.
- FIG. 28A there is gel analysis of both serum DNA (Right) and amplified products (Left). Both the starting serum DNA and amplified material demonstrate a size range of 200 bp to 1.6 kb, indicating that the amplified material maintains the same size distribution as the DNA isolated from the serum.
- FIG. 28B there is real-time STS analysis of 8 STS sites in amplified products from serum DNA.
- the solid line crossing the entire graph represents both the amount of DNA added to the STS assay based on optical density, and the average value of the 8 STS sites.
- the short line represents the median value of the 8 STS sites obtained by real-time PCR analysis. All 8 sites were represented within a factor of 5 ofthe mean amplification
- FIG. 29 illustrates amplification of single blood nucleated cells by a method of the present invention.
- FIG. 30 shows amplification of single sperm cells by a method of the present invention.
- FIG. 31 shows dilution of hair follicle samples for an exemplary forensic application of a method described herein.
- FIG. 32 illustrates amplification of a single copy chromosome.
- FIG. 33 shows micro-anay hybridization analysis ofthe amplified DNA from a single-cell DNA produced by whole genome amplification.
- FIG. 34 illustrates single-cell DNA anays for detection and analysis of cells, such as cancer cells.
- FIG. 35 shows real-time PCR amplification using two X-chromosome specific primer pairs to evaluate loci copy number values in WGA libraries synthesized from patient DNA of known aneuploidies of XO, XX, and XXX.
- Panels A and C show curves from each of 5 individual amplifications.
- Panels B and D show mixtures ofthe five libraries tested in triplicate demonstrating the maintenance of copy number information in WGA libraries.
- FIG. 36 shows real-time PCR amplification of WTA libraries prepared from lOng and lOOng from human B-lymphocyte RNA using self-inert degenerate primer K(N)2 and MMLV reverse transcriptase. Amplification profiles show about a one-cycle difference between lOOng of input and lOng of input template.
- FIG. 37 shows real-time PCR amplification of WTA libraries prepared with two different self-inert primers K(N) 2 and K(T20) and their combination. Significant improvement was observed when a combination of K(N) 2 and K(T20) is used.
- FIG. 38 shows gel electrophoretic analysis of amplified WTA libraries.
- the observed pattern of ethidium bromide staining visualized by fluorescence fransilumination shows the range of fragment sizes and intensity resulting from varying the amounts of input RNA in library synthesis and from varying the primer combinations utilized.
- lOOng of input RNA yields larger products without significant effect of the primer K(T20).
- Libraries from lOng of input RNA yield generally smaller amplification products and show significant improvement with the addition of K(T20) primer.
- FIG. 39 provides quantitative real-time PCR analysis of amplified WTA libraries.
- the plots show analysis of 11 sites conesponding to human STS markers.
- the long bar in each column represents the average value while the short bar represents the median value.
- the line at 10 ng represents the amount of amplified DNA, by spectrophotometric analysis, added to each assay. All 11 sites were detected in each sample, indicating that all sites were efficiently amplified in all samples.
- the representation of these 11 markers is similar between the K(N2) and K(N2) + K(T20) 100 ng libraries.
- the distribution is wider for the 10 ng libraries than the 100 ng libraries and the distribution ofthe 10 ng K(N2) library is slightly broader than the 10 ng K(N2) + K(T20) library.
- FIG. 40 illustrates results of real-time PCR analysis of three exemplary expressed mRNA loci at three different distances from the 3 ' end using human STS markers.
- the lengths of the mRNA for each STS are 6,642 bp for STS 42, 3,100 bp for STS 85, and 9,301 bp for STS 119.
- the distances from the 3' end for the STS 42 locus are 1,087 bp, 1,795 bp, and 5,835 bp.
- the distances from the 3' end for the STS 85 locus are 77 bp, 1,331 bp, and 1,827 bp.
- results are shown for lOOng and lOng input libraries with either K(N) 2 or K(N) 2 + K(T20) library
- FIG. 41 illustrates results of real-time PCR analysis of input template and two principal MgCl 2 concentrations typically used with the RNA dependent DNA polymerase, reverse transcriptase.
- FIG. 42 shows the resulting representation of specific sites analyzed by realtime PCR for their relative abundance within a subset of the samples described in FIG.41 41 (lOng and 0.25ng input template; 3mM and lOmM MgCl 2 concentration). As is typical of such experiments, samples that amplify more robustly also show better representation of specific sites.
- FIG. 43 illustrates the effect of MgC12 concentration on WTA amplification of total RNA.
- MgCl 2 concentration was varied over a range of between 3mM and 12mM. A clear dependence is observed in WTA performance under these reaction conditions, with optimal amplification performance occurring between 6mM and lOmM.
- FIG. 44 demonstrates the selective amplification of single stranded templates in WTA library synthesis using either DNA or RNA with or without denaturation.
- Panel A shows real-time PCR curves of the amplification of these libraries.
- Panel B shows the resulting products run on a 0.8% agarose gel stained with ethidium bromide. Only about 1% of DNA sample can be converted into library amplimers without denaturation, while denaturation had little effect on RNA templates.
- FIG. 45 illustrates principle of selective amplification of DNA and RNA from a total nucleic acid isolate using self-inert degenerate primers in combination with Klenow Exo- fragment of DNA polymerase I and heat-denatured nucleic acid (WGA) or MMLV reverse transcriptase and non-denatured nucleic acid (WTA), and a hypothetical device for isolation of DNA and RNA by selective amplification from total nucleic acid preparation.
- WGA heat-denatured nucleic acid
- WTA non-denatured nucleic acid
- FIGS. 46A and 46B show the inhibitory effect of poly-C tags on amplification of synthesized WGA libraries.
- FIG. 46A shows real-time PCR amplification chromatograms of different length poly-C tags incorporated by polymerization.
- FIG. 46B shows delayed kinetics or suppression of amplification of C-tagged libraries amplified with conesponding poly-C primers.
- FIGS. 47A and 47B display real-time PCR results of targeted amplification using a specific primer and the universal C 10 tag primer.
- Panel A shows the sequential shift with primary and secondary specific primers with a combined enrichment above input template concentrations.
- FIG. 47B shows the effect of specific primer concentration on selective
- FIGS. 48A and 48B detail the individual specific site enrichment for each unique primary oligonucleotide in the multiplexed targeted amplification.
- FIG. 48A shows values of enrichment for each site relative to an equal amount of starting template, while FIG. 48B displays the same data as a histogram of frequency of amplification.
- FIG. 49A shows the analysis of secondary "nested" real-time PCR results for 45 multiplexed specific primers. Enrichment is expressed as fold amplification above starting template ranging from 100,000 fold to over 1,000,000 fold.
- FIG. 49B shows the distribution frequency for all 45 multiplexed sites.
- FIG. 50 shows a schematic representation of a whole genome sequencing project using tagged libraries synthesized from limited starting material. Libraries provide a means to recover precious or rare samples in an amplifiable form that can function both as substrate for cloning approaches and through conversion to C-tagged format a directed sequencing template for gap filling and primer walking.
- FIG. 51 shows a diagram illustrating universality of the nucleic acid amplification methods of the present invention and their compatibility with different sources of DNA or RNA, and the diversity of possible applications for the amplified material.
- base analog refers to a compound similar to one of the four DNA bases (adenine, cytosine, guanine, and thymine) but having a different composition and, as a result, different pairing properties.
- base analog refers to a compound similar to one of the four DNA bases (adenine, cytosine, guanine, and thymine) but having a different composition and, as a result, different pairing properties.
- 5-bromouracil is an analog of thymine but sometimes pairs with guanine
- 2-aminopurine is an analog of adenine but sometimes pairs with cytosine.
- backbone analog refers to a compound wherein the deoxyribose phosphate backbone of DNA has been modified.
- the modifications can be made in a number of ways to change nuclease stability or cell membrane permeability of the modified DNA.
- peptide nucleic acid PNA
- PNA peptide nucleic acid
- Other examples in the art include methylphosphonates.
- locked 3' end as used herein is defined as a 3' end of DNA lacking a hydroxyl group.
- blunt end refers to the end of a double stranded DNA molecule having 5' and 3' ends, wherein the 5' and 3' ends terminate at the same position. Thus, the blunt end comprises no 5' or 3' overhang.
- complementarity refers to the ability to form a Watson-Crick base pair through specific hydrogen bonds.
- sequence refers to a contiguous (continuous) sequence of DNA constructed from overlapping sequences.
- degenerate refers to a nucleotide or series of nucleotides wherein the identity can be selected from a variety of choices of nucleotides, as opposed to a defined sequence. In specific embodiments, there can be a choice from two or more
- the selection of a nucleotide at one particular position comprises selection from only purines, only pyrimidines, or from non-pairing purines and pyrimidines.
- self-inert refers to the inability of a primer or a mixture of primers to self-prime and initiate DNA synthesis in the presence of DNA polymerase and dNTPs but in the absence of other DNA templates. It may also refer to a collective set of mRNAs in a cell.
- DNA immortalization refers to the conversion of a mixture of DNA molecules into a fonn that allows repetitive, unlimited amplification without loss of representation and/or without size reduction.
- the mixture of DNA molecules comprises more than one copy of a particular DNA sequence.
- the mixture of DNA molecules comprises a genome.
- genomic as used herein is defined as the collective gene set canied by an individual, cell, or organelle.
- genomic DNA as used herein is defined as DNA material comprising the partial or full collective gene set carried by an individual, cell, or organelle.
- RNAscriptome as used herein is defined as the collective RNA set expressed within a cell.
- hybridization refers to a process of formation of double stranded DNA regions between one, two or many complementary single stranded DNA molecules, fri some embodiments, however, triple stranded DNA regions are generated through hybridization.
- non-canonical or non-Watson-Crick base pair refers to all possible interactions between bases that do not include standard (Watson-Crick) A-T and G-C pairing.
- the non-canonical base pair comprises an adenine nucleobase and a guanine nucleobase, an adenine nucleobase and a cytosine nucleobase, a cytosine nucleobase and a thymidine nucleobase, a guanine nucleobase and a thymidine nucleobase, an adenine nucleobase and an adenine nucleobase, a guanine nucleobase and a
- non-complementary refers to nucleic acid sequence that lacks the ability to form intermolecularly at least one Watson-Crick base pair through specific hydrogen bonds.
- non-self-complementary refers to nucleic acid sequence that lacks the ability to form intramolecularly at least one Watson-Crick base pair through specific hydrogen bonds.
- non strand-displacing polymerase as used herein is defined as a polymerase that extends until it is stopped by the presence of, for example, a downstream primer. In a specific embodiment, the polymerase lacks 5 '-3' exonuclease activity.
- randomly fragmenting refers to fragmenting a DNA molecule in a non-ordered fashion, such as inespective ofthe sequence identity or position ofthe nucleotide comprising and/or sunounding the break.
- the random fragmentation is mechanical, chemical, or enzymatic, by well-known methods in the art.
- RNA immortalization refers to the conversion of a mixture of RNA molecules, such as a franscriptome, into a form that allows repetitive, unlimited amplification without loss of representation and/or without size reduction.
- a franscriptome is defined as a collection of transcribed mRNA molecules from a cell, an individual, or an organelle.
- single stranded nucleic acid molecule/primer mixture refers to a mixture comprising at least one single stranded nucleic acid molecule wherein at least one primer, as described herein, is hybridized to a region in said single stranded nucleic acid molecule.
- multiple degenerate primers comprise complementary sequence to at least some part of the single stranded nucleic acid molecule.
- the mixture comprises a plurality of single stranded nucleic acid molecules having multiple degenerate primers hybridized thereto.
- the single stranded nucleic acid molecule is DNA or RNA.
- strand-displacing polymerase as used herein is defined as a polymerase that will displace downstream fragments as it extends.
- the polymerase comprises 5 '-3' exonuclease activity.
- substantially incapable refers to a majority of polynucleotides being incapable of an activity upon subjection to standard conditions known in the art.
- the activities include self-hybridization; self-priming; hybridization to another polynucleotide in the plurality; initiation of a polymerization reaction in
- the term refers to at least about 70% of a primer molecule being comprised of two noncomplementary and non-self- complementary nucleotides, more preferably at least about 75%, more preferably at least about 80%, more preferably at least about 85%, more preferably at least about 90%, more preferably at least about 95%, more preferably at least about 97%, more preferably at least about 99%, and most preferably 100% of a primer molecule being comprised of two noncomplementary and non- self-complementary nucleotides.
- substantially non-self-complementary and substantially non- complementary refers to a plurality of primers that lack the ability to form intramolecularly and intermolecularly a Watson-Crick base pair through specific hydrogen bonds, hi a specific embodiment, at least about 70% of a primer molecule in the plurality is comprised of two noncomplementary and non-self-complementary nucleotides, more preferably at least about 15%, more preferably at least about 80%, more preferably at least about 85%, more preferably at least about 90%, more preferably at least about 95%>, more preferably at least about 97%, more preferably at least about 99%, and most preferably 100%) of a primer molecule in the plurality is comprised of two noncomplementary and non-self-complementary nucleotides.
- thermophilic DNA polymerase refers to a heat- stable DNA polymerase.
- R refers to A or G
- Y refers to C or T
- M refers to A or C
- K refers to G or T
- S refers to C or G
- W refers to A or T
- H refers to A or C or T
- B refers to C or G or T
- V refers to A or C or G
- D refers to A or G or T
- N refers to A or C or G or T.
- a YN primer comprises at least one, and preferably more, series of dinucleotide sets each comprising a C or a T at the first position and an A, C, G, or T at the second position. These dinucleotide sets may be repeated in the primer (and/or adaptor).
- the primers for incorporating the known universal sequence comprise a degenerate region, and in further specific embodiments, the l ⁇ iown universal sequence and the degenerate region comprise non-self-complementary
- primer dimers are a common problem in existing methods for DNA or RNA amplification using random primers.
- random primers In order to achieve efficient priming for each individual sequence, random primers must be applied at very high concentrations. The efficiency of annealing to a specific target DNA or RNA template or the entire population of template molecules is greatly reduced by the formation of primer-dimers resulting from the high primer concentrations required for efficient priming.
- the described invention utilizes a novel type of oligonucleotide primer comprising at least as the majority of its sequence only two types of nucleotide bases that do not participate in stable Watson-Crick pairing with each other, and thus do not self-prime.
- the primers comprise a constant known sequence at their 5 'end and a variable degenerate nucleotide sequence located 3' to the constant known sequence. There are four possible two-base combinations known not to participate in Watson-Crick base pairing: C-T, G-A, A-C and G-T. .
- Y-primers have a 5' known sequence Yu comprised of C and T bases and a degenerate region (Y) ⁇ 0 at the 3' end comprising ten, for example, randomly selected pyrimidine bases of C and T.
- R-primers have a 5' known sequence Ru comprised of G and A bases and a degenerate region (R) 10 at the 3' end comprising ten, for example, randomly selected purine bases of G and A.
- M-primers have a 5' known sequence Mu comprised of A and C bases and a degenerate region (M) ⁇ 0 at the 3' end comprising tenfor example, randomly selected bases of A and C.
- K-primers have a 5' known sequence Ku comprised of G and T bases and a degenerate region (K) 10 at the 3' end comprising ten, for example, randomly selected bases of G and T. Primers ofthe described design will not self-prime and thus will not form primer dimers. For this reason, the term"self-inert primers" is used herein. However, they will prime at target sites containing the conesponding Watson-Crick base partners, albeit with reduced overall
- these primers under specific conditions are capable of forming primer dimers, but at a greatly reduced level compared to primers lacking such structure.
- these primers are supplemented with a completely random (i.e. containing any of the four bases) short nucleotide sequence at their 3' end.
- a completely random (i.e. containing any of the four bases) short nucleotide sequence at their 3' end Such primers are shown on FIG. 2 and labeled as YN, RN, MN and KN. If a limited number of completely random bases are present at the 3' end ofthe Y, R, M or K primers, that will increase their priming frequency, yet maintain limited ability for self-priming.
- a different number of completely random bases at the 3' end ofthe degenerate Y, R, M or K primers and by carefully optimizing the reaction conditions one can precisely control the outcome of the polymerization reaction in favor of the desired DNA product with minimum primer-dimer formation.
- primers of the described design are randomly incorporated in an extension/polymerization reaction with a DNA polymerase possessing at least a limited strand-displacement activity.
- the resulting branching process creates DNA molecules having known (universal) self-complementary sequences at their ends.
- these molecules are amplified exponentially by polymerase chain reaction using Taq polymerase (or other thermostable DNA polymerase) and a single primer conesponding to at least part of the known 5 '-tail of the random primers.
- FIG. 1 presents a schematic outline of the invention.
- the invention overcomes major problems known in the art for DNA and RNA amplification by previously described random primers.
- Single-stranded or double-stranded nucleic acid of any source or complexity, or fragments thereof can be used as a source material and amplified by the method described in the invention. That is, in some embodiments single stranded DNA is obtained and processed according to the methods described herein, and in other embodiments double stranded DNA is obtained and manipulated to generate ssDNA, wherein the ssDNA is subjected to the methods described herein.
- dsDNA is denatured with heat, chemical treatment (such as alkaline pH), mechanical manipulation, radiation, or a combination thereof.
- substantially single stranded RNA is obtained and processed according to the methods described herein.
- total nucleic acid is obtained as a mixture of double stranded DNA and single stranded RNA molecules and then processed to selectively amplify the DNA fraction or RNA fraction only, or both separately, or both in a mixture.
- FIG. 2 illustrates the design of degenerate primers utilized in this aspect ofthe invention.
- the invention employs application of oligonucleotide primers comprising a constant known sequence at their 5 'end (which may be referred to as universal sequence) and a variable degenerate nucleotide sequence at their 3' end, each comprised of any of at least four possible base combinations known not to participate in Watson-Crick base pairing.
- the possible primer compositions include pyrimidines only (C and T), purines only (A and G), or non-pairing purines and pyrimidines (A and C or G and T).
- the last combination is l ⁇ iown in the art to permit non-canonical Watson-Crick base-pairing, hi a prefened embodiment, the G and T pair is utilized in the invention, hi a specific embodiment, the primers comprise a constant part of about 18 base sequence comprised of C and T, G and A, A and C, or G and T bases at the 5' end, followed by about 10 random Y, R, M or K bases, respectively, and between 0 and about 6 completely random bases, N, at the 3' end (FIG. 2, Table III, primers 1-7).
- Examples 1 and 2 show that Y and YN primers form only a limited amount of primer-dimers, and this is proportional to the number of completely random bases N at their 3 ' termini.
- a primer of similar design but comprised of bases that can participate in Watson-Crick base-pairing generates an excessive amount of primer-dimers, which greatly reduces the efficiency of DNA or RNA amplification (see Example 2).
- primers will depend on the base composition, complexity, and the presence and abundance of repetitive elements in the target DNA or RNA. By combining the products of individual amplification reactions with degenerate primers comprising different non- Watson-Crick pairs, but having the same known sequence at the ends, one can achieve the highest possible level of representative and uniform DNA amplification. A skilled artisan recognizes how to select the optimal primers and reaction conditions to achieve the desired result.
- Example 2 describes a comparison of different pyrimidine-only primers in their ability to form primer-dimers, efficiency of amplification, and uniformity (representation of randomly selected genomic markers) in a human whole genome amplification reaction with Klenow fragment of DNA Polymerase I.
- primers with two random 3 ' bases Y(N) 2
- Y(N) 2 primers with two random 3 ' bases
- degenerate primers comprising between about 1 and about 3 completely random bases at their 3' end are utilized.
- a DNA polymerase is utilized that possesses strand-displacement activity.
- Prefened strand-displacement DNA polymerases are: Klenow fragment of E. coli DNA polymerase I, exo- DNA polymerases ofthe T7 family, i.e.
- polymerases that require host thioredoxin subunit as co-factor, such as: T7, T3, f ⁇ , fll, W31, H, Y, gh-1, SP6, or AU22, Studier (1979), exo- Bst large fragment, Bca DNA polymerase, 9oNm polymerase, MMLV Reverse Transcriptase, AMV Reverse Transcriptase, HIV Reverse Transcriptase, phage f29 polymerase, phage M2 polymerase, phage fPRDl polymerase, exo- VENT polymerase, and phage T5 exo- DNA polymerase.
- host thioredoxin subunit such as co-factor, such as: T7, T3, f ⁇ , fll, W31, H, Y, gh-1, SP6, or AU22, Studier (1979), exo- Bst large fragment, Bca DNA polymerase, 9oNm polymerase, MMLV
- Klenow exo- fragment of DNA Polymerase I, phage T7 DNA polymerase with reduced or eliminated 3 '-5' exonuclease activities, and MMLV Reverse Transcriptase are most prefened in the present invention.
- Klenow exo- fragment of DNA Polymerase I, or Sequenase version 2 is used as the polymerase for whole genome amplification (Example 2)
- MMLV reverse transcriptase is used as the polymerase for whole transcriptome amplification (Example 14).
- any polymerase that can perform strand-displacement replication, in the presence or in the absence of such strand-displacement or processivity enhancing factors, is suitable for use in the disclosed invention, even if the polymerase does not perform strand-displacement replication in the absence of such factor.
- Factors useful in strand-displacement replication are (i) any of a number of single- stranded DNA binding proteins (SSB proteins) of bacterial, viral, or eukaryotic origin, such as SSB protein of E.
- SSB proteins single- stranded DNA binding proteins
- coli phage T4 gene 32 product, phage T7 gene 2.5 protein, phage Pf3 SSB, replication protein A RPA32 and RPA14 subunits (Wold, 1997); (ii) other DNA binding proteins, such as adenovirus DNA-binding protein, herpes simplex protein ICP8, BMRF1 polymerase accessory subunit, herpes virus UL29 SSB-like protein; (iii) any of a number of replication complex proteins l ⁇ iown to participate in DNA replication such as phage T7 helicase/primase, phage T4 gene 41 helicase, E. coli Rep helicase, E. coli recBCD helicase, E. coli and eukaryotic topoisomerases (Champoux, 2001).
- other DNA binding proteins such as adenovirus DNA-binding protein, herpes simplex protein ICP8, BMRF1 polymerase accessory subunit, herpes virus UL29 SSB-like protein; (
- Random fragmentation of DNA, and if necessary, RNA can be performed by mechanical, chemical, or enzymatic treatment as described.
- DNA is fragmented by heating at about 95°C in low salt buffers such as TE (10 mM Tris-HCl, ImM EDTA, having pH between 7.5 and 8.5) or TE-L (10 mM Tris-HCl, 0.1 mM EDTA, having pH between 7.5 and 8.5) for between about 1 min and about 10 min (for example, see U.S. Patent Application Serial No. 10/293,048, filed November 13, 2002, incorporated by reference herein in its entirety).
- TE mM Tris-HCl, ImM EDTA, having pH between 7.5 and 8.5
- TE-L 10 mM Tris-HCl, 0.1 mM EDTA, having pH between 7.5 and 8.5
- An exemplary library synthesis reaction ofthe present invention is performed in a mixture having volume ranging between about 10 and about 25 ⁇ l.
- the reaction mixture preferably comprises about 0.5 to about 100 ng of thermally or mechanically fragmented DNA, or in particular embodiments less than about 0.5 ng DNA, about 0.5 - about 30 ⁇ M of self-inert degenerate primer, about 0- about 200 nM of known sequence primer (i.e., primer conesponding to the known 5' end of the respective degenerate primer), between about 2 and about 10 units of Klenow Exo " (New England Biolabs) or Sequenase version 2 (USB Corporation), between 0 - about 360 ng SSB protein, and between about 5- about 10 mM MgCl 2 , and between 0 and about 100 mM NaCl.
- the reaction buffer preferably has a buffering capacity that is operative at physiological pH between about 6.5 and about 9.
- the incubation time of the reaction is between about 10 - about 180 min, and the incubation temperature between about 12°C and about 37°C.
- Incubation is performed by cycling between about 12°C and about 37°C for a total of 3 to 5 min per cycle, or preferably by a single isothermal step between about 12°C and about 30°C or sequential isothermal steps between about 12°C and about 37°C.
- the reaction is terminated by addition of a sufficient amount of EDTA to chelate Mg 2+ or preferably by heat- inactivation ofthe polymerase, or both.
- the library synthesis reaction is performed in a volume of about 15 ⁇ l.
- the reaction mixture comprises about 5 ng or less of thermally or mechanically fragmented DNA, for example, about 2 ⁇ M of self-inert degenerate primer K(N) 2 comprising G and T bases at the known and degenerate regions and 2 completely random 3' bases, (Table III, primer #14), between about 2 units and about 4 units of Sequenase version 2 DNA polymerase (USB Corporation), between about 5 mM and about 10
- the incubation time of the reaction is between about 60 min and about 120 min and the incubation temperature is about 24°C in an isothermal mode or in another prefened embodiment by sequential isothermal steps at between about 16°C and about 37°C.
- the library synthesis reaction is performed in a volume of about 20 ⁇ l.
- the reaction mixture comprises about 25 ng or less of thermally or fragmented or unfragmented RNA, for example, about 1 ⁇ M of self- inert degenerate primer K(N) 2 comprising G and T bases at the known and degenerate regions and 2 completely random 3' bases, (Table III, primer #14), about 200 nM of a primer K(T) 20 comprising G and T bases at the 5' known and poly T bases at the 3' end (Table III, primer #19) between about 50 units and about 200 units of MMLV Reverse transcriptase (Epicentre Corporation), between about 3 mM and about 10 mM MgCl 2 , about 75 mM KCl, about 50 mM Tris-HCl buffer having pH of about 8.3, and about 10 mM dithiothreitol.
- the incubation time of the reaction is between about 30 min and
- a typical amplification step with known sequence primer comprises between about 1 and about 10 ng of library synthesis products and between about 0.3 and about 2 ⁇ M of known sequence primer in a standard PCR reaction well known in the art, under conditions optimal for thermostable DNA polymerases, such as Taq DNA polymerase, Pfu polymerase, or derivatives and mixtures thereof.
- thermostable DNA polymerases such as Taq DNA polymerase, Pfu polymerase, or derivatives and mixtures thereof.
- reaction additives such as DMSO and/or 7-Deaza dGTP may also improve representation in libraries constructed by the method of the invention.
- nucleic acid or “polynucleotide” will generally refer to at least one molecule or strand of DNA, RNA, DNA-RNA chimera or a derivative or analog thereof, comprising at least one nucleobase, such as, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g. adenine "A,” guanine “G,” thymine “T” and cytosine “C”) or RNA (e.g. A, G, uracil "U” and C).
- nucleobase such as, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g. adenine "A,” guanine “G,” thymine “T” and cytosine "C”) or RNA (e.g. A, G, uracil "U” and C).
- nucleic acid encompasses the terms “oligonucleotide” and “polynucleotide.”
- oligonucleotide refers to at least one molecule of between about 3 and about 100 nucleobases in length.
- polynucleotide refers to at least one molecule of between about 3 and about 100 nucleobases in length.
- ER 509321880US refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to at least one single-stranded molecule, but in specific embodiments will also encompass at least one additional strand that is partially, substantially, or fully complementary to at least one single-stranded molecule. Thus, a nucleic acid may encompass at least one double- stranded molecule or at least one triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a strand of the molecule.
- a single stranded nucleic acid may be denoted by the prefix "ss”, a double stranded nucleic acid by the prefix "ds”, and a triple stranded nucleic acid by the prefix "ts.”
- Nucleic acid(s) that are "complementary” or “complement(s)” are those that are capable of base-pairing according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules.
- a primer of the present invention comprises a majority of nucleotides that are incapable of forming standard Watson-Crick base pairs, particularly with other nucleotides within the same primer.
- the term “complementary” or “complement(s)” may refer to nucleic acid(s) that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above.
- substantially complementary may refer to a nucleic acid comprising at least one sequence of consecutive nucleobases, or semiconsecutive nucleobases if one or more nucleobase moieties are not present in the molecule, are capable of hybridizing to at least one nucleic acid strand or duplex even if less than all nucleobases do not base pair with a counterpart nucleobase.
- a "substantially complementary" nucleic acid contains at least one sequence in which about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%o, about 98%o, about 99%, to about 100%>, and any range therein, ofthe nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization.
- the term “substantially complementary” refers to at least one nucleic acid that may hybridize to at least one nucleic acid strand or duplex in stringent conditions.
- a “partially complementary" nucleic acid comprises at least one sequence that may hybridize in low stringency conditions to at least one single or double stranded nucleic acid, or contains at least one sequence in which less than about 70%> of the nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization.
- hybridization As used herein, “hybridization”, “hybridizes” or “capable of hybridizing” is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature.
- stringent condition(s) or “high stringency” are those that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are prefened for applications requiring high selectivity. Non-limiting applications include isolating at least one nucleic acid, such as a gene or nucleic acid segment thereof, or detecting at least one specific mRNA transcript or nucleic acid segment thereof, and the like.
- Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content ofthe target sequence(s), the charge composition ofthe nucleic acid(s), and to the presence of formamide, tetramethylammonium chloride or other solvent(s) in the hybridization mixture. It is generally appreciated that conditions may be rendered more stringent, such as, for example, the addition of increasing amounts of formamide.
- low stringency or “low stringency conditions”
- non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20°C to about 50°C.
- hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20°C to about 50°C.
- nucleobase refers to a naturally occurring heterocyclic base, such as A, T, G, C or U ("naturally occurring nucleobase(s)"), found in at least one
- nucleobases include purines and pyrimidines, as well as derivatives and analogs thereof, which generally can form one or more hydrogen bonds (“anneal” or “hybridize”) with at least one naturally occurring nucleobase in a manner that may substitute for naturally occurring nucleobase pairing (e.g. the hydrogen bonding between A and T, G and C, and A and U).
- nucleotide refers to a nucleoside further comprising a "backbone moiety” generally used for the covalent attachment of one or more nucleotides to another molecule or to each other to form one or more nucleic acids.
- the "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5'-position of the 5-carbon sugar.
- other types of attachments are known in the art, particularly when the nucleotide comprises derivatives or mimics of a naturally occurring 5-carbon sugar or phosphorus moiety, and non-limiting examples are described herein.
- Nucleic acids useful as templates for amplification are generated by methods described herein.
- the DNA molecule from which the methods generate the nucleic acids for amplification may be isolated from cells, tissues or other samples according to standard methodologies (Sambrook et al, 1989).
- primer is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process.
- primers are oligonucleotides from ten to twenty and/or thirty base pairs in length, but longer sequences can be employed.
- Primers may be provided in double-stranded and/or single- stranded form, although the single-stranded form is prefened.
- Pairs of primers designed to selectively hybridize to nucleic acids are contacted with the template nucleic acid under conditions that permit selective hybridization.
- high stringency hybridization conditions may be selected that will only allow hybridization to sequences that are completely complementary to the primers.
- hybridization may occur under reduced stringency to allow for amplification of nucleic acids containing one or more mismatches with the primer sequences.
- the template-primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also
- cycles 25393190.1 5J ER 509321880US referred to as "cycles,” are conducted until a sufficient amount of amplification product is produced.
- the amplification product may be detected or quantified.
- the detection may be performed by visual means.
- the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incorporated radiolabel or fluorescent label or even via a system using electrical and/or thermal impulse signals (Affymax technology).
- PCRTM polymerase chain reaction
- two synthetic oligonucleotide primers which are complementary to two regions of the template DNA (one for each sfrand) to be amplified, are added to the template DNA (that need not be pure), in the presence of excess deoxynucleotides (dNTP's) and a thermostable polymerase, such as, for example, Taq (Thermus aquaticus) DNA polymerase.
- dNTP's deoxynucleotides
- a thermostable polymerase such as, for example, Taq (Thermus aquaticus) DNA polymerase.
- the target DNA is repeatedly denatured (around 95°C), annealed to the primers (typically at 50-60°C) and a daughter strand extended from the primers (72°C). As the daughter strands are created they act as templates in subsequent cycles.
- the template region between the two primers is amplified exponentially, rather than linearly.
- a reverse transcriptase PCRTM amplification procedure may be performed to quantify the amount of mRNA amplified.
- Methods of reverse transcribing RNA into cDNA are well known and described in Sambrook et al, 1989.
- Alternative methods for reverse transcription utilize thermostable DNA polymerases. These methods are described in WO 90/07641.
- Polymerase chain reaction methodologies are well known in the art. Representative methods of RT-PCRTM are described in U.S. Patent No. 5,882,864.
- LCR ligase chain reaction
- Qbeta Replicase described in PCT Patent Application No. PCT/US87/00880, also may be used as still another amplification method in the present invention. Jh this method, a replicative sequence of RNA which has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase. The polymerase will copy the replicative sequence which can then be detected and quantified
- An isothermal amplification method in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide thiophosphates in one strand of a restriction site also may be useful in the amplification of nucleic acids in the present invention.
- Such an amplification method is described by Walker et al. 1992, incorporated herein by reference.
- SDA Strand Displacement Amplification
- RCR Repair Chain Reaction
- Target specific sequences can also be detected using a cyclic probe reaction (CPR).
- CPR cyclic probe reaction
- a probe having 3' and 5' sequences of non-specific DNA and a middle sequence of specific RNA is hybridized to DNA which is present in a sample.
- the reaction is treated with RNase H, and the products ofthe probe identified as distinctive products which are released after digestion.
- the original template is annealed to another cycling probe and the reaction is repeated.
- TAS transcription-based amplification systems
- NASBA nucleic acid sequence based amplification
- 3SR Kwoh et al, 1989
- PCT Patent Application WO 88/10315 PCT Patent Application WO 88/10315, each incorporated herein by reference.
- the nucleic acids can be prepared for amplification by standard phenol/chloroform extraction, heat denaturation of a clinical sample, treatment with lysis buffer and minispin columns for isolation of DNA and RNA or guanidinium chloride extraction of RNA.
- amplification techniques involve annealing a primer which has target specific sequences.
- DNA/RNA hybrids are digested with RNase H while double stranded DNA molecules are heat denatured again. In either case the single stranded DNA is made fully double stranded by addition of a second target specific primer, followed by polymerization.
- the double-sfranded DNA molecules are then multiply transcribed by an RNA polymerase, such as T7 or SP6.
- RNAs are reverse transcribed into double stranded DNA, and transcribed once again with an RNA polymerase, such as T7 or SP6.
- an RNA polymerase such as T7 or SP6.
- Rolling circle amplification (U.S. Patent No. 5,648,245) is a method to increase the effectiveness of the strand displacement reaction by using a circular template.
- the polymerase which does not have a 5' exonuclease activity, makes multiple copies of the information on the circular template as it makes multiple continuous cycles around the template.
- the length of the product is very large—typically too large to be directly sequenced. Additional amplification is achieved if a second strand displacement primer is added to the reaction using the first strand displacement product as a template.
- Suitable amplification methods include “RACE” and “one-sided PCRTM” (Frohman, 1990; Ohara et al, 1989, each herein incorporated by reference). Methods based on ligation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting "di-oligonucleotide", thereby amplifying the di-oligonucleotide, also may be used in the amplification step of the present invention, Wu et al, 1989, incorporated herein by reference).
- Enzymes that may be used in conjunction with the invention include nucleic acid modifying enzymes listed in the following tables.
- DNA Polymerase I Klenow Fragment, Exonuclease Minus
- a DNA polymerase is used in methods of the present invention.
- the methods ofthe invention could be carried out with one or more enzymes where multiple enzymes combine to carry out the function of a single DNA polymerase molecule retaining 5'-3' exonuclease activities.
- Effective polymerases that retain 5'-3' exonuclease activity include, for example, E. coli DNA polymerase I, Taq DNA polymerase, S. pneumoniae DNA polymerase I, Tfl DNA polymerase, D. radiodurans DNA polymerase I, Tth DNA polymerase, Tth XL DNA polymerase, M.tuberculosis DNA polymerase I, M.
- thermoautotrophicum DNA polymerase I Herpes simplex- 1 DNA polymerase, E. coli DNA polymerase I Klenow fragment, Vent DNA polymerase, thermosequenase and wild-type or modified T7 DNA polymerases.
- the effective polymerase is E. coli DNA polymerase I, Klenow, or Taq DNA polymerase, or MMLV reverse transcriptase.
- a break in the substantially double stranded nucleic acid template is a gap of at least a base or nucleotide in length that comprises, or is reacted to comprise, a 3' hydroxyl group
- the range of effective polymerases that may be used is even broader.
- the effective polymerase may be, for example, E. coli DNA polymerase I, Taq DNA polymerase, & pneumoniae DNA polymerase I, Tfl DNA polymerase, D. radiodurans DNA polymerase I, Tth DNA polymerase, Tth XL DNA polymerase, M. tuberculosis DNA polymerase I, M.
- thermoautotrophicum DNA polymerase I He ⁇ es simplex- 1 DNA polymerase, E. coli DNA polymerase I Klenow fragment, T4 DNA polymerase, Vent DNA polymerase, thermosequenase or a wild-type or modified T7 DNA polymerase.
- the effective polymerase is E. coli DNA polymerase I, M. tuberculosis DNA polymerase I, Taq DNA polymerase, or T4 DNA polymerase.
- relatively high stringency conditions For applications requiring high selectivity, one will typically desire to employ relatively high stringency conditions to form the hybrids.
- relatively low salt and/or high temperature conditions such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C.
- Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting specific
- Conditions may be rendered less stringent by increasing salt concentration and/or decreasing temperature.
- a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20°C to about 55°C.
- Hybridization conditions can be readily manipulated depending on the desired results.
- hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 35 mM MgCl 2 , 1.0 mM dithiothreitol, at temperatures between approximately 20°C to about 37°C.
- Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl 2 , at temperatures ranging from approximately 40°C to about 72°C.
- EXAMPLE 1 DESIGN OF DEGENERATE PYRIMD3INE PRIMERS AND ANALYSIS
- Pyrimidine primers comprising a constant 18 base sequence, followed by 10 random pyrimidines and between 0 and 6 completely random bases at the 3' end (Table III, primers 1-7), are compared for their ability to self prime and to extend a model template oligonucleotide.
- the model template oligonucleotide (Table III, Oligonucleotide 9) was comprised of T7 promoter sequence followed by 10 random purine bases at its 3 '-terminus.
- the reaction mixture contained 1 x ThermoPol reaction buffer (NEB), 4 units of Bst DNA Polymerase Large Fragment (NEB), 200 uM dNTPS, 350 nM template oligo 9, and 3.5 or 35 ⁇ M of degenerate pyrimidine primers Y and YN (Table III, primers 1 to 7) in a final volume of 25 ⁇ l. Controls comprising no dNTPs are also included for each Y or YN primer.
- FIG. 3 shows the result of the comparison experiment. No evidence of self-priming was found with primers having up to 3 random bases at their 3 '-end when applied at 35 ⁇ M concenfration after 5 min incubation with Bst polymerase and dNTPs at 45°C (FIG. 3A).
- the PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 ⁇ M each dNTP, 100,000x dilutions of fluorescein and SybrGold I (Molecular Probes), 1 ⁇ M l ⁇ iown Y primer (or in the case of degenerate T7(N) 6 primers, known primer T7 (Table III, primer 17), 5 units of Titanium Taq polymerase (Clontech), and 3 ⁇ l aliquots (approximately 5 ng input genomic DNA) ofthe Klenow library synthesis reactions in a final volume of 50 ⁇ l.
- FIG. 5 shows the chromatograms ofthe real-time PCR. All degenerate pyrimidine primers showed similar efficiency of amplification with a signal conesponding to 50% of the maximum centered around cycle 9, whereas the T7 sequence with random hexamers at the 3' end (Table III, primer 16) is more than an order of
- Y(N) 2 supported the most uniform whole genome amplification (FIG. 6A) with Klenow fragment of DNA polymerase I, yet produced limited amount of primer dimers (FIG. 3 and FIG. 4). Eighty three percent ofthe STS markers analyzed after whole genome amplification with Y(N) 2 primer were within a factor of 2 times the mean and 90 % within a factor of 3 times the mean, whereas on average these numbers were in the range of 63 to 70 % and 73 to 80 % respectively for all other YN-primers analyzed.
- the PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM known Yu primer (or in the case of random T7(N) 6 primers, known T7 (primer 18), 5 units of Titanium Taq polymerase (Clontech), and a volume ofthe library synthesis reaction conesponding to 5 ng ofthe input genomic DNA in a final volume of 50 ⁇ l. Reactions were carried out for 17 cycles at 94°C for 15 sec and 65°C for 2 min on an I-Cycler real-time PCR instrument (Bio-Rad).
- Sequenase version 2 showed an order of magnitude higher efficiency as compared to Klenow Exo " polymerase at both concenfrations tested. Aliquots of the PCR amplification reactions were analyzed on a 1% agarose gel after staining with EtBr. Sequenase synthesis yielded amplicons of larger average size compared to Klenow Exo " polymerase (FIG. 8).
- Sequenase library preparations resulted in a more representative amplification compared to Klenow Exo " with fewer outliers. Between 80 and 85 % of the STS markers analyzed after amplification of libraries prepared with Sequenase were within a factor of 2 times the mean value, whereas those
- the PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 ⁇ M each dNTP, 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM known Yu, Ru, Mu, or Ku primer whose sequence is identical to the known 5 ' portion of the respective degenerate primer (Table III, primers 8, 11, 13, and 16), 5 units of Titanium Taq polymerase (Clontech), and 5 ng input genomic DNA equivalent of the libarary synthesis reactions in a final volume of 50 ul. Amplifications were carried out for 16 cycles at 94°C for 15 sec and 65°C for 2 min on the I-Cycler real-time PCR instrument (Bio-Rad).
- K(N) 2 primer degenerate primer containing guanine and thymidine
- R(N) 2 and K(N) 2 both guanine containing degenerate primers
- M(N) 2 and Y(N) 2 cytosine containing primers
- K(N) 2 primer was about an order of magnitude more effective as compared to Y(N) 2 primer (FIG. 10).
- the PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 ⁇ M each dNTP, 100,000x dilutions of fluorescein and SybrGreen
- FIG. 12 shows the chromatogram of the real-time
- PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 ⁇ M each dNTP, 100,000x dilutions of fluorescein and SybrGreen
- FIG. 14 shows the chromatograms of the real-time PCR. The efficiency of amplification was similar at concentrations ofthe self-inert degenerate primer K(N) 2 between 0.5 and 2 ⁇ M. At 10 ⁇ M and at
- the material amplified by PCR with the known Ku primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed
- EXAMPLE 7 TITRATION OF THE INPUT AMOUNT OF DNA IN HUMAN WHOLE GENOME AMPLIFICATION WITH DEGENERATE PRIMER K(N) AND SEQUENASE
- the PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 ⁇ M each dNTP, 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 ⁇ M known Ku primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and 5 ng input genomic DNA of the library synthesis reactions in a final volume of 75 ⁇ l. Reactions were carried out for 14 cycles at 94°C for 15 sec and 65°C for 2 min on I-Cycler real-time PCR instrument (Bio-Rad). FIG. 16 shows the chromatograms of the real-time PCR.
- Representation analysis of the samples amplified by PCR was done using a panel of 20 human STS markers (Table IV, STS markers: 40, 42-44, 46, 47, 49, 52, 54, 55, 58, 60, 62, 63, 66-69, and 74).
- the material amplified by PCR with known Ku primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94°C for 15 sec and 68°C for 1 min on I-Cycler (Bio-Rad), in a 25 ⁇ l volume. Standards conesponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantitation was done by standard curve fit for each STS (I-Cycler software, Bio-Rad), and
- Genomic libraries described herein provide a very efficient resource for highly representative whole genome amplification. Size (200-2,000 bp) and a known priming (known sequence) site make them also very attractive for such applications as DNA archiving, storing, retrieving and re-amplification. Multiple libraries can be immobilized and stored as micro-anays. Libraries covalently attached by one end to the bottom of tubes, micro-plates or magnetic beads can be used many times by replicating immobilized amplicons, dissociating replicated molecules for immediate use, and returning the original immobilized WGA library for continuing storage.
- WGA amplicons can also be easily modified to introduce a personal identification (ID) DNA tag to every genomic sample to prevent an unauthorized amplification and use of DNA. Only those who know the sequence of the ID tag will be able to amplify and analyze genetic material.
- ID personal identification
- the tags can be useful for preventing genomic cross- contaminations when dealing with many clinical DNA samples
- WGA libraries created from large bacterial clones can be amplified and used to produce genomic micro-anays.
- This example describes two processes of tagging individual WGA library (ies) with the DNA identification sequence (ID) for the pu ⁇ ose of subsequent recovery of this library from the mixture containing other WGA libraries.
- ID DNA identification sequence
- Both processes involve known primers with known sequence U at the 3 ' end and individual ID sequence tag at the 5' end (FIG. 18).
- the known primer is
- ER 509321880US comprised of regular bases (A, T, G and C) and can be replicated (FIG. 18A).
- the known primer has a non-nucleotide linker L (for example, hexa ethylene glycole, HEG) and cannot be replicated (FIGS. 18B and 18C).
- FIG. 19 The process of tagging, mixing and recovery of 3 different WGA libraries using replicable known primers is shown on FIG. 19. It comprises four steps: 1) Three genomic DNA samples are converted into 3 WGA libraries using the methods described earlier in the patent application ⁇ ) Three WGA libraries are amplified using 3 individual replicable known primers TiU, T 2 U, and T 3 U with the conesponding ID DNA tags Ti, T 2 , and T 3 at the 5' end (FIG. 18 A); 3) All three libraries are mixed together. Any attempt to amplify and genotype the mix would result in a mixed pattern; and4) The WGA libraries are segregated by PCR using individual ID primers tags T 1 ⁇ T 2 , and T 3 .
- FIG. 20 The process of tagging, mixing and recovery of 3 different WGA libraries using non-replicable known primers is shown in FIG. 20. It comprises five steps: 1.) Three genomic DNA samples are converted into 3 WGA libraries using the method described earlier in the patent application; 2.) Three WGA libraries are amplified using 3 individual non-replicable known primers TiU, T 2 U, and T 3 U with the conesponding ID DNA tags T 1 ⁇ T 2 , and T 3 at the 5' end (FIGS. 18B and 18C). The resulting products have 5' single stranded tails formed by ID regions of the primers; 3.) All three libraries are mixed together.
- the WGA libraries are segregated by hybridization of their 5' tails to the complementary oligonucleotides T ⁇ , T 2 , and T 3 immobilized on the solid support; and 5.) The segregated libraries are amplified by PCR using known primer U.
- WGA (or WTA) libraries prepared by the method of library synthesis described in the invention may be modified or tagged to inco ⁇ orate specific sequences.
- the tagging reaction may incorporate a functional tag.
- the functional 5' tag composed of poly cytosine may serve to suppress library amplification with a terminal CIO sequence as a primer.
- Terminal complementary homo-polymeric G sequence can be added to the 3' ends of amplified WGA library by terminal deoxynucleotidyl fransferase (FIG. 21 A), by ligation of adapter containing poly-C sequence (FIG. 2 IB), or by DNA polymerization with a primer
- the C-tail may be from 8 - 30 bases in length. In a prefened embodiment the length of C-tail is from 10 to 12 bases.
- genomic DNA libraries flanked by homo-polymeric tails consisting of G/C base paired double stranded DNA, or poly-G single stranded 3-extensions, are suppressed in their amplification capacity with poly-C primer.
- This suppression effect is diminished for a targeted site when balanced with a second site-specific primer, whereby amplification of a plurality of fragments containing the unique priming site and the universal terminal sequence are amplified selectively using a specific primer and a poly-C primer, for instance primer C ⁇ 0 .
- genomic complexity may dictate the requirement for sequential or nested amplifications to amplify a single species of DNA to purity from a complex WGA library.
- FIG. 22 shows the process of covalent immobilization. It comprises 3 steps: Step 1. Hybridization of single sfranded (denatured) WGA amplicons to the known primer-oligonucleotide U covalently attached to the solid support. Step 2.
- Step 3 Washing with 100 mM sodium hydroxide solution and TE buffer.
- Non-covalent immobilization can be achieved by using WGA libraries with affinity tags (like biotin) or DNA sequence tags at the 5' ends of amplicons. Biotin can be located at the 5' end of the known primer U. Single stranded 5' affinity and/or ID tags can be introduced by using non- replicable primers (FIG. 18 and FIG. 20). Biotinylated libraries can be immobilized through
- WGA libraries with a DNA sequence tag in the form of a 5 ' overhang can be hybridized to complementary oligonuceotides covalently attached to the surface of the micro-anay. Examples of both covalently and noncovalently anayed libraries are shown in FIG. 23.
- Covalently immobilized WGA libraries can be used repeatedly to produce replica libraries for whole genome amplification (FIG. 24).
- the process comprises four steps: 1) Retrieval of the immobilized library from the long term storage; 2) Replication of the immobilized library using DNA polymerase and known primer U; 3) Dissociating replica molecules by sodium hydroxide, neutralization and amplification; and 4) Neutralization and return ofthe solid phase library for a long term storage.
- WGA libraries with 5' overhangs can be hybridized to complementary oligonuceotides covalently attached to the surface of magnetic beads, tubes or micro-plates, washed with TE buffer or water to remove excess of dNTPs, buffer and DNA polymerase and then released by heating in a small volume of TE buffer.
- the single stranded 5 '-affinity tag can be introduced by using a non- replicable primer (FIG. 25).
- This example describes a side-by-side comparison between the whole genome amplification described in the present invention and a commercially available kit for DOP-PCR amplification.
- Human lymphocyte genomic DNA was isolated by standard protocol using phenol-chloroform extraction.
- the synthesis reactions were amplified by real-time PCR.
- the PCR reaction mixture contained: 1 x Titanium Taq reaction buffer (Clontech), 200 ⁇ M of each dNTP, 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 ⁇ M universal Ku primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and the entire 15 ⁇ l library synthesis reactions in a final volume of 75 ⁇ l. Reactions were carried out at 94°C for 15 sec and 65°C for 2 min on I-Cycler real-time PCR instrument (Bio-Rad).
- Amplifications by DOP-PCR were done using DOP PCR MasterTM Kit purchased from Roche Molecular Biochemicals (Catalog # 1644963). Amplification reactions were carried out under Protocol 2 ofthe manufacturer's manual. Briefly, samples containing 5 ng or 20 pg of DNA (or control samples without DNA) in a 50 ⁇ l standard DOP PCR reaction mixture supplemented with 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) were amplified after denaturing for 5 min at 95°C by cycling for 5 cycles at: 94°C for 30 sec, 30°C for 30 sec, ramping at 30°C to 72°C for 30 sec (1.4°C/sec), and 72°C for 1.5 min, followed by 45 cycles at: 94°C for 30 sec, 62°C for 30 sec, and 72°C for 1.5 min, and final extension at 72°C for 7 min on I-Cycler real-time PCR instrument (Bio-Rad).
- FIG. 26A shows the real-time PCR curves ofthe whole genome amplification by Klenow Exo- and DOP-PCR.
- the whole genome amplification of libraries prepared with Klenow fragment of DNA polymerase-I and degenerate K(N) 2 primer was about 25 PCR cycles more efficient than amplification with DOP-PCR. This result indicates that the methods in the present invention are several orders of magnitude more sensitive than DOP-PCR technology.
- Representation analysis was performed using a panel of 16 random human genome STS markers (Table IV, STS markers: 40, 4-44, 46, 47, 49, 52, 54, 55, 58, 60, 62, 63, and 66).
- the material amplified by PCR with universal Ku primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94°C for 15 sec and 68°C for 1 min on I-Cycler (Bio-Rad), in a 25 ⁇ l volume. Standards conesponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantitation was by standard curve fit for each STS.
- FIG. 26B shows a logarithmic distribution plot of the STS markers analyzed derived from the real-time PCR standard curve fit.
- the distribution of all 16 genome markers was tighter and with significantly reduced representation bias in PCR amplified whole genome libraries prepared by Klenow fragment of DNA polymerase I and degenerate K(N) 2 primer as compared to DOP-PCR products.
- the average quantity of STS markers by the proposed method was approximately an order of magnitude higher in the library amplified form 20 pg of genomic DNA (about 3 diploid genome equivalents) as compared to the DNA productprepared from 5 ng DNA (almost 1000 diploid genome equivalents) by DOP-PCR.
- This example describes the amplification of genomic DNA that has been isolated from serum collected in serum separator tubes (SST). Blood was collected into 8 ml vacutainer SST tubes. The serum tubes were allowed to sit at room temperature for 30'. The tubes were centrifuged for 10' at 1,000 x G with minimal acceleration and braking. The serum was subsequently transfened to a clean tube. Isolated serum samples may be used immediately for DNA extraction or stored at -20°C prior to use.
- DNA from 1 ml of serum was purified using the DRI ChargeSwitch Blood Isolation kit according to the manufacturer's protocols.
- the resulting DNA was precipitated using the pellet paint DNA precipitation kit (Novagen) according to the manufacturer's instructions and the sample was resuspended in TE-Lo to a final volume of 30 ml for serum.
- the quantity and concenfration of DNA present in the sample was quantified by real-time PCR using Yb8 Alu primer pairs; Yb8F 5'-CGAGGCGGGTGGATCATGAGGT-3' (SEQ. ID NO: 120), and Yb8R 5'-TCTGTCGCCCAGGCCGGACT-3' (SEQ. ID NO:121).
- DNA isolated from serum was randomly fragmented in TE-L buffer by heating at 95°C for 4 min.
- the reaction mixture contained 10 ng of thermally fragmented DNA in lx EcoPol buffer (NEB), 200 ⁇ M of each dNTP, and 1 uM of degenerate K(N) 2 primer (Table III, primer 14) in a final volume of 15 ⁇ l. After a denaturing step of 2 min at 95°C, the samples
- 74 ER 509321880US were cooled to 4°C and the reaction initiated by adding 5 units Klenow Exo- (NEB).
- WGA library synthesis was carried out by a three-step incubation protocol for 20 min at 16°C, 20 min at 24°C, and 20 min at 37°C. Reactions were stopped by heating for 15 min at 75°C and subsequently cooling to 4°C. The entire library reaction was ftirther amplified by real-time PCR.
- the PCR reaction mixture contained: 1 x Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 10,000x dilutions of fluorescein and SybrGold I (Molecular Probes) 1 uM known Ku primer (Table III, primer 15), 0.5X Titanium Taq polymerase (Clontech), and 10 ng input genomic DNA ofthe library reactions in a final volume of 75 ⁇ l. Reactions were carried out for 17 cycles at 94°C for 15 sec and 65°C for 2 min on an I-Cycler real-time PCR instrument (Bio- Rad). The amplification curve is illustrated in FIG. 27.
- the amplified material was purified by Millipore Multiscreen PCR plates and quantified by optical density. Gel analysis of the amplified products indicated a size distribution (200 bp to 1.6 kb) similar to the original serum DNA (FIG. 28 A). Additionally, the amplified DNA was analyzed using real-time, quantitative PCR using a panel of human genomic STS markers. The markers that make up the panel are listed in Table IV. Quantitative Real-Time PCR was performed using an I-Cycler Real-Time Detection System (Bio-Rad), as per the manufacturer's directions. Briefly, 25 ⁇ l reactions were amplified for 40 cycles at 94°C for 15 sec and 65°C for 1 min.
- FIG. 28B is a scatte ⁇ lot ofthe representation ofthe human genomic STS markers in the amplified DNA.
- This example describes the whole genome amplification of total DNA from single human blood cells, single sperm cells, and individual hair follicles.
- the synthesized libraries were amplified by real-time PCR.
- the PCR reaction mixture contained: 1 x Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM universal Ku primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and the entire 15 ⁇ l library synthesis reaction in a final volume of 75 ⁇ l. In the case of hair follicle dilutions a blank confrol without DNA was included.
- Redundant single cell samples at different dilutions were amplified which served as auto-controls, i.e. one cell or no cells were amplified at the highest dilutions. Reactions were carried out at 94°C for 15 sec and 65°C for 2 min on I-Cycler real-time PCR instrument (Bio-Rad).
- FIG. 29 shows amplification of single nucleated blood cells. Approximately 8 cycles separate the resulting amplification profiles between single cells and no cells, allowing clear distinction between the presence or absence of a single blood cell.
- FIG. 30 shows amplification of single sperm cells.
- the distance between samples with a single cell and samples without cells in this case was only about 2 cycles (not the expected approximately 6 cycles for a haploid genome as compared to blood nucleated cells).
- this difference is attributed to either inefficient lysis or the presence of inhibitors ofthe amplification in sperm cells. Nonetheless, even with 2 cycles difference one can still distinguish between a single cell and no cell.
- EXAMPLE 16 AMPLIFICATION OF SINGLE HUMAN CHROMOSOMES WITH DEGENERATE K(N) 0 PRIMER AND KLENOW EXO- FRAGMENT OF DNA
- This example describes the amplification of total DNA from single copy human chromosomes.
- the library synthesis reactions were amplified by real-time PCR in a mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM universal Ku primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and the entire 15 ⁇ l library synthesis reaction in a final volume of 75 ⁇ l. Blank controls without DNA were also included. Reactions were carried out at 94°C for 15 sec and 65°C for 2 min on I-Cycler real-time PCR instrument (Bio-Rad).
- FIG. 32 shows amplification of single copy human chromosomes. Approximately 4 cycles distance between single chromosomes and no DNA blank confrols was observed.
- WGA amplified single-cell DNA can be used to analyze tissue cell heterogeneity on the genomic level, hi the case of cancer diagnostics it would facilitate the detection and statistical analysis of heterogeneity of cancer cells present in blood and/or biopsies. In the case of prenatal diagnostics it would allow the development of non-invasive approaches based on the identification and genetic analysis of fetal cells isolated from blood and/or cervical smears. Analysis of DNA within individual cells could also facilitate the discovery of new cell markers, features, or properties that are usually hidden by the complexity and heterogeneity ofthe cell population.
- amplified single-cell DNA can be performed in two ways.
- amplified DNA samples are analyzed one by one using hybridization to genomic micro-anay, or any other profiling tools such as PCR, sequencing, SNP genotyping, micro-satellite genotyping, etc.
- the method would include: 1.) Dispersal of the tissue into individual cells; 2.) Preparation and amplification of individual
- amplified DNA samples are spotted on the membrane, glass, or any other solid support, and then hybridized with a nucleic acid probe to detect the copy number of a particular genomic region.
- the method would include: 1.) Dispersal of the tissue of interest into individual cells; 2.) Preparation and amplification of individual (single-cell) WGA libraries; 3.) Preparation of micro-anays of individual (single-cell) WGA DNAs; 4.) Hybridization ofthe single-cell DNA micro-anays to a locus-specific probe; 5.) and Quantitative analysis of the cell heterogeneity. This approach can be especially valuable in situations when only limited number of genomic regions should be analyzed in a large cell population.
- EXAMPLE 18 APPLICATION OF WHOLE GENOME AMPLIFICATION FOR DETECTION AND ANALYSIS OF GENE COPY NUMBER
- WGA amplified DNA retains both sequence and copy number integrity during library synthesis and amplification.
- This feature of the libraries facilitates the potential evaluation of cells or tissues suspected of having undergone gene amplification events such as those observed in oncogenic transformation. Early detection of gene amplification events requires the ability to examine the event in a few suspect cells or biopsy material. This application is best illustrated with a set of model samples from patients of known chromosomal aneuploidy in the X-chromosome as described in this example.
- DNA from patients with XO, XX, and XXX served as template for WGA library synthesis (kindly provided by Dr. Aral Chinnaiyan, University of Michigan). DNA isolated by standard procedures was randomly fragmented in TE-L buffer by heating at 95°C for 4 min. The reaction mixtures contained 25 ng of thermally fragmented DNA (or just TE-L buffer as negative control) in lx EcoPol buffer (NEB), 200 ⁇ M of each dNTP, and 1 uM degenerate K(N) 2 primer (Table III, primer 14) 15 ng/ ⁇ l SSB (USB) in a total volume of 14 ⁇ l.
- the PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200 ⁇ M each dNTP, 100,000x dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 ⁇ M known Ku primer (Table III,
- FIG. 35 shows the normalized STS real-time PCR curves for each set of primers.
- Panels A and C display the clustering of the individual 5ng aliquots amplified from a single 25ng WGA library for samples with IX, 2X, and 3X chromosome copies. In each case the variation is approximately +/- 0.5 cycles.
- FIG. 35 panels B and D display how the variation is averaged upon reconstitution of the individual amplifications. In each case the reconstituted mixture is tested in triplicate showing a full cycle shift in the doubling of the template between IX and 2X and the predicted approximately half cycle shift when a third copy (3X) is added in the case of trisomy for the X chromosome.
- This example describes application of the invention for the creation of an amplifiable library faithfully representing the expression patterns of transcribed RNA within a cell or population of cells herein termed "Whole Transcriptome Amplification" (WTA).
- WTA Whole Transcriptome Amplification
- RNA from EBV transformed human B lymphocytes, Raji cells (Clontech) served as input template for WTA library preparation.
- WTA is performed in two steps: library synthesis and library amplification.
- Library synthesis involves similar self-inert degenerate primers (primers K), but a different DNA polymerase, specifically MMLV reverse transcriptase. It proceeds through the extension/strand displacement reactions similar to WGA, but requires no fragmentation of the RNA template (although fragmentation can be applied to reduce the average amplicon size if desireable).
- primer K(T) 20 (Table III primer 19) complementary to the polyA tails was also added.
- primers were annealed to polyA+ RNA templates.
- Annealing was facilitated by briefly heating the mixture of lOOng or lOng polyA+ RNA, primers K(N) 2 [l ⁇ M] (Table III primer 14) and K(T) 20 [200nM] (Table III primer 19) either in combination, or K(N) 2 [I ⁇ M] alone, dNTP mix [l ⁇ M ea.] and RNase free water to 17 ⁇ l at 70°C for 5 minutes followed by immediate removal to ice.
- the polymerase reaction was initiated by addition of 2 ⁇ l of lOx MMLV buffer to a final concentration of 75mM KCL, 50mM Tris-HCl, 3mM MgCl 2 , lOmM dithiothreitol, pH 8.3) and I ⁇ l (200 units) MMLV reverse transcriptase (NEB). Reactions were mixed, and incubated for 1 hour at 42°C. Enzyme activity was halted by heat inactivation for 5 minutes at 95°C.
- PCR reaction mixture contained: lx Titanium Taq reaction buffer (Clontech), 200nM each dNTP, 100,000x dilutions of fluorescein and SyberGreen I (Molecular Probes) l ⁇ M Ku primer (Table III primer 16), 5 units of Titanium Taq polymerase (Clontech) and volumes representing lOng equivalents of the input polyA+ RNA from the library synthesis reactions in a final volume of 75 ⁇ l.
- RNA amplification methods employ priming of polyA tails present within the mRNA pool of transcripts.
- the micro-array studies to date have been biased toward the 3' end of mRNAs.
- the K(T) 20 primer was employed. To demonstrate the effect of this added priming, the amplifications were tested in the presence and absence of each primer.
- FIG. 38 shows the molecular weight range of products amplified from each of these libraries with the various primer conditions.
- the combination of priming both at the polyA tail and at random internal sites yields a more robust amplification over a larger product size range.
- the absence of K(T) 20 priming has much less of an effect on performance than does the absence of the K(N) 2 primer, which essentially eliminates products competent for amplification by failing to generate the second universal priming site on each amplicon.
- lOOng input template libraries exhibit a broader size distribution of amplimers suggestive of less frequent priming or simply a greater starting quantity of larger RNA molecules.
- FIG. 39 demonsfrates the representation of these STS sites. Each of the chosen STS sites was represented for each condition with noticeable improvement observed when the K(N) 2 and K(T) 20 primers are combined and somewhat improved average performance for the lOOng input libraries.
- Another unique feature ofthe invention relates to WTA library representation across a particular mRNA locus.
- three large transcripts were examined using STS primer pairs at varying distances from the 3' end (Table IV STS 42, 42a, 42b, 85, 85a, 85b, 119, 119a, 119b).
- FIG. 40 illusfrates the real-time PCR analysis of WTA amplification for these loci. The results indicate representation at all sites with improvement in 3 ' representation attributed to the inclusion of the K(T20) primer.
- RNA from systematic sampling of tissues such as biopsy tissues and laser capture micro-dissection, or where sample is limiting as in the case of rare collections from unique cohorts, dictates the need for robust amplification from low input template amounts.
- total RNA from normal pooled prostate (CPP, Clontech) was examined from 0.25ng to lOng at 3mM and lOmM MgCi 2 .
- Annealing was facilitated by briefly heating the mixture of lOng, lng, 0.5ng, or 0.25ng CPP total RNA (Clontech), primers K(N) 2 [l ⁇ M] (Table III primer 14) and K(T20) [200nM] (Table III; primerl9), dNTP mix [l ⁇ M ea.] and RNase free water to 17 ⁇ l at 70°C for 5 minutes followed by immediate removal to ice.
- the library synthesis reaction was initiated by addition of 2 ⁇ l of lOx MMLV buffer to a final concentration of 75mM KCL, 50mM Tris-HCl, 3mM or lOmM MgCl 2 , lOmM dithiothreitol, pH 8.3) and l ⁇ l (200 units) MMLV reverse transcriptase (NEB) or l ⁇ l (50 units) MMLV reverse transcriptase (Epicentre). Reactions were mixed, and incubated for 1 hour at 42°C. Enzyme activity was halted by heat inactivation for 5 minutes at 95°C.
- the library synthesis reactions were amplified by real-time PCR in a reaction mixture that contained: lx Titanium Taq reaction buffer (Clontech), 200nM each dNTP, 100,000x dilutions of fluorescein and SyberGreen I (Molecular Probes) l ⁇ M Ku primer (Table III primer 16), 5 units of Titanium Taq polymerase (Clontech) and 50% ⁇ of the library synthesis reaction (12.5 ⁇ l) representing 5ng, 0.5ng, 0.25ng and 0.125ng of starting template in a final volume of 75 ⁇ l. Reactions were carried out for 17 - 33 cycles (94°C for 20 sec and 65°C for 2 min) in real-time PCR I-CyclerTM (Bio-Rad).
- FIG. 42 shows the relative quantities of each of genes assayed. Reducing the input to 0.25ng under low (3mM, NEB) MgCl 2 conditions reduces the representation of rare messages below confidence levels. Representation is markedly increased with the increased (lOmM, Epicentre) MgC12 conditions as predicted by the real-time amplification kinetics.
- RNA from normal pooled prostate (CPP, Clontech) lOng was amplified over a 3 - 12 mM range of MgCl 2 . Annealing was facilitated by briefly heating the mixture of lOng CPP total RNA (Clontech), primers K(N) 2 [l ⁇ M] (Table III, primer 14) and K(T) 20 [200nM] (Table III, primerl9), dNTP mix [l ⁇ M ea.] and RNase free water to 17 ⁇ l at 70°C for 5 minutes followed by immediate removal to ice.
- CPP normal pooled prostate
- the library synthesis reaction was initiated by addition of 2 ⁇ l of lOx MMLV buffer to a final concenfration of 75mM KCL, 50mM Tris-HCl, 3mM or supplemented in ImM increments to 12mM MgCl 2 , lOmM dithiothreitol, pH 8.3) and l ⁇ l (50 units) MMLV reverse transcriptase (Epicentre). Reactions were mixed, and incubated for 1 hour at 42°C. Enzyme activity was halted by heat inactivation for 5 minutes at 95°C.
- the library synthesis reactions were further amplified by real-time PCR in a reaction mixture that contained: lx Titanium Taq reaction buffer (Clontech), 200nM each dNTP, 100,000x dilutions of fluorescein and SyberGreen I (Molecular Probes) l ⁇ M Ku primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech) and 50% of each library synthesis reaction (lO ⁇ l) representing 5ng of starting template in a final volume of 75 ⁇ l. Reactions were carried out for 19 cycles (94°C for 20 sec and 65°C for 2 min) in real-time PCR I-CyclerTM (Bio-Rad).
- MgCl 2 shows real-time PCR curves detailing the effect of MgCl 2 on WTA library generation. Conditions at or above 6mM to about 12 mM MgCl 2 during library preparation step yield optimal kinetics. MgCl 2 is known to affect base pairing which can manifest itself at the level of primer binding as well as sfrand displacement in the WTA
- the ability to selectively amplify DNA or RNA from the same sample can be beneficial.
- the WTA protocol is applied to samples of total RNA or genomic DNA with and without fragmentation and denaturation.
- Fragmentation and denaturation were performed by heating to 95°C for 4 minutes, snap cooling to ice (4°C), addition of 1.5 ⁇ l of lOx MMLV buffer (Epicentre) to a final concentration of 75mM KCL, 50mM Tris-HCl, lOmM MgCl 2 , lOmM dithiothreitol, pH 8.3), primers K(N) 2 [l ⁇ M] (Table III primer 14) and K(T) 20 [200nM] (Table III, primerl9), dNTP mix [l ⁇ M ea.] and RNase free water to 14 ⁇ l, followed by a brief 2 minute heating to 95°C and cooling to ice to anneal primers.
- the polymerase reaction was initiated by addition of l ⁇ l (50 units) MMLV reverse transcriptase (Epicentre). Reactions were mixed, and incubated for 15 minutes at 23°C followed by 1 hour at 42°C. Enzyme activity was halted by heat inactivation for 5 minutes at 95°C.
- the library reactions were amplified by real-time PCR in a reaction mixture that contained: lx Titanium Taq reaction buffer (Clontech), 200nM each dNTP, 100,000x dilutions of fluorescein and SyberGreen I (Molecular Probes) l ⁇ M Ku primer (Table III primer 16), 5 units of Titanium Taq polymerase (Clontech) and 100%o of the library reaction (15 ⁇ l) representing the entire lOng of starting template in a final volume of 75 ⁇ l. Reactions were carried out for 13 - 17 cycles (94°C for 20 sec and 65°C for 2 min) in real-time PCR I-CyclerTM (Bio-Rad).
- FIG. 44A shows the real-time amplification profiles from each template. Libraries amplified from DNA after fragmentation and denaturation show profiles similar to WGA
- MMLV polymerase activity can efficiently substitute for other polymerases in WGA library synthesis.
- DNA is severely inhibited, showing an approximately 6 cycle delay in amplification, or roughly 1% of template participating in the reaction.
- RNA templates only display a minor effect of fragmentation and denaturation conditions compared to direct annealing and extension. Differences in the molecular weight of products amplified in each of these reactions and the control reactions without template are shown in FIG. 44B. Each reaction was allowed to proceed to plateau and evaluated by agarose gel electrophoresis. The distribution of library fragments from DNA template is consistent with that observed for WGA products. Thermal treatment of RNA shifts the size distribution of library fragments by 50 to 100 base pairs shorter, demonstrating the ability to tailor amplicon size. No template controls failed to generate amplicons above 200bp after 28 cycles of amplification.
- genomic and expression (RNA) information are required to provide a complete analysis of the tissue or cells evaluated. Only when alterations in gene sequence, copy number, and the effective expression of transcribed sequences are taken together can a complete analysis ofthe sample be achieved. In many cases, a clinical isolate or archival sample is limited and may only be sufficient for one isolation scheme. Amplification of genomic and expression libraries may be streamlined through a total amplification platform using the present invention.
- FIG. 45 illustrates selective amplification of DNA and RNA from a total nucleic acid isolate using self-inert degenerate primers in combination with Klenow Exo- fragment of DNA polymerase I and heat-denatured nucleic acid (WGA) or MMLV reverse transcriptase and non-denatured nucleic acid (WTA).
- WGA heat-denatured nucleic acid
- WTA MMLV reverse transcriptase and non-denatured nucleic acid
- EXAMPLE 23 APPLICATION OF HOMOPOLYMERIC G/C TAGGED WGA LIBRARIES FOR TARGETED DNA AMPLIFICATION
- Targeted amplification may be applied to genomes for which limited sequence infonnation is available or where reanangement or sequence flanking a known region is in question.
- transgenic constructs are routinely generated by random integration events.
- directed sequencing or primer walking from sequences known to exist in the insert may be applied.
- the invention described herein can be used in a directed amplification mode using a primer specific to a known region and a universal primer.
- the universal primer is potentiated in its ability to amplify the entire library, thereby substantially favoring amplification of product between the specific primer and the universal sequence, and substantially inhibiting the amplification ofthe whole genome library.
- WGA libraries prepared by the methods described in the invention can be converted for targeted amplification by PCR re-amplification using poly-C extension primers.
- FIG. 46A shows potentiated amplification with increasing length of poly-C in real-time PCR. The reduced slope ofthe curves for C 15 U and C 20 U show delayed kinetics and suggest reduced template availability or suppression of priming efficiency.
- FIG. 46B shows real-time PCR results that reflect the suppression of whole genome amplification. Only the short C 10 tagged libraries retain a modest amplification capacity, while C 15 and C 20 tags remain completely suppressed after 40 cycles of PCR.
- EXAMPLE 24 APPLICATION OF HOMOPOLYMERIC G/C TAGGED WGA LIBRARIES FOR MULTIPLEXED TARGETED DNA AMPLIFICATION
- G/C tagged libraries for targeted amplification uses a single specific primer to amplify a plurality of library amplimers.
- the complexity of the target library dictates the relative level of enrichment for each specific primer. In low complexity bacterial genomes a single round of selection is sufficient to amplify an essentially pure product for sequencing or cloning pu ⁇ oses, however in high complexity genomes a secondary, internally "nested", targeting event may be necessary to achieve the highest level of purity.
- FIG. 47A shows the chromatograms from real-time PCR amplification for sequential primary 1° and secondary 2° targeting primers in combination with the universal tag specific primer C 10 , or C 10 alone.
- the enrichment for this particular targeted amplicon achieved in the primary amplification is approximately 10,000 fold.
- Secondary amplification with a nested primer enriches to near purity with an additional two orders of magnitude for a total enrichment of 1,000,000 times the starting template. It is understood to those familiar with the art that enrichment levels may vary with primer specificity, while primers of high specificity applied in sequential targeted amplification reactions generally combine to enrich products to near purity.
- the amplified material was purified by Qiaquick spin column (Qiagen), and quantified spectrophotometrically.
- Quantitative Real-Time PCR was performed using an I-Cycler Real-Time Detection System (Bio-Rad), as per the manufacturer's directions. Briefly, 25 ⁇ l reactions were amplified for 40 cycles at 94°C for 15 sec and 68°C for 1 min. Standards conesponding to 10, 1, and 0.2 ng of fragmented DNA were used for each STS, quantities were calculated by standard curve fit for each STS (I-Cycler software, Bio-Rad) and were plotted as distributions.
- FIG. 48A shows the relative fold amplification for each targeted site.
- Secondary targeted amplifications were performed using primary targeting products as template and secondary nested primers (Table VII) in combination with the universal Cio primer. Reactant concentrations and amplification parameters were identical to primary amplifications above. Multiplexed secondary amplifications were purified by Qiaquick spin column (Qiagen) and quantified by specfrophotometer. Enrichment of specific sites was evaluated in real-time PCR using an I-Cycler Real-Time Detection System (Bio-Rad), as per the manufacturer's directions. Briefly, 25 ⁇ l reactions were amplified for 40 cycles at 94°C for 15 sec and 68°C for 1 min.
- FIG. 49A shows the relative abundance of each site after nested amplification and FIG. 49B plots the data in terms of frequency.
- Targeted amplification applied in this format reduces the primer complexity required for multiplexed PCR.
- the resulting pool of amplimers can be evaluated on sequencing or genotyping platforms.
- EXAMPLE 25 NON-REDUNDANT GENOMIC SEQUENCING OF UNCULTURABLE OR LIMITED SPECIES FACILITATED BY WHOLE GENOME
- FIG. 50 25393190.1 gO. ER 509321880US FIG. 50.
- a fraction of amplified WGA DNA is cloned in a bacterial vector (FIG. 50C) while another fraction of amplified WGA DNA is converted into C-tagged WGA library (FIG. 50D).
- STS 14P AAGGATCAGAGATACCCCACGG (SEQ ⁇ ) NO:38) STS 14S TCATGGTATTAGGGAAGTGGGAG
- STS 70P GGGCTTTGTCTGTGGTTGGTA (SEQ ID NO:59)STS 70S TAAATGTAACCCCCTTGAGCC
- EXAMPLE 26 UNIVERSALITY OF THE NOVEL NUCLEIC AMPLIFICATION METHOD AND ITS COMPATIBILITY WITH DIFFERENT SOURCES OF DNA AND RNA AND DIFFERENT METHODS OF ANALYSIS OF THE AMPLIFIED MATERIAL
- FIG. 51 The diagram presented on FIG. 51 illustrates the diversity of DNA and RNA samples that are compatible with the proposed method of amplification of nucleic acid, universality ofthe amplification technique, and the diversity of possible applications.
- Nucleic acid sources include but not limited to all animals (including humans), plants, fungi, culturable and non-culturable bacteria and viruses, and extinct species found in amber and stones. They can be isolated from any fresh, frozen, or paraffin embedded formalin fixed tissue, body fluids, forensic sample, cell culture, single cell, single chromosome, etc.
- the library preparation step can use total nucleic acid as a template (the protocol shown in cenfral part ofthe diagram, anow A), and result in the amplification of both DNA and RNA, or use purified DNA, and result in the amplification of the whole genome (the protocol shown in left part of the diagram, anow B), or use purified RNA,
- Library prepared and amplified from total nucleic acid, DNA, or RNA can be modified to incorporate polyC regions at the 5 'end of the universal constant sequence (anows F and G). C-tailed libraries can be used for targeted amplification and analysis of specific genomic regions or RNA franscripts.
- Library prepared and amplified from total nucleic acid, DNA, or RNA can be modified to inco ⁇ orate other tags (see FIG. 19-25) and used for LD identification, immobilization on a solid support or a micro-anay, or multiple usage (not shown in FIG. 51).
- Applications of the proposed nucleic acid amplification technology include but not limited to genotyping of small DNA/RNA samples, gene expression analysis, sequencing of un-culturable or extinct organisms, molecular diagnostics of different diseases, prenatal diagnostics, viral/bacterial diagnostics, forensics, etc.
- Antisense RNA amplification a linear amplification method for analyzing the mRNA population from single living cells. Methods 10:283-8
- DOP-PCR Degenerate oligonucleotide- primed PCR
- VanDevanter D.R., Choongkittaworn, N.M., Dyer, K.A., Aten, J., Otto, P., Behler, C, Bryant, E.M., Rabinovitch, P.S. 1994. Pure chromosome-specific PCR libraries from single sorted chromosome. Proc. Natl. Acad. Sci. USA, 91-5858-5862.
- telomere loss/DNA damage model of cell aging From telomere loss to p53 induction and activation of a DNA-damage pathway at senescence: the telomere loss/DNA damage model of cell aging. Exp. Gerontol., 31:295-301.
- Strand displacement amplification an isothermal, in vitro DNA amplification technique. Nucleic Acids Res., 20:1691-1696.
- TRHA tagged random hexamer amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK04718499.9T DK1604040T3 (da) | 2003-03-07 | 2004-03-08 | Amplifikation og analyse af hele genom- og hele transkriptom-biblioteket genereret ved en DNA-polymerisationsproces |
| EP04718499A EP1604040B1 (en) | 2003-03-07 | 2004-03-08 | Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process |
| JP2006509236A JP4773338B2 (ja) | 2003-03-07 | 2004-03-08 | Dna重合プロセスにより生成される全ゲノムおよび全トランスクリプトームライブラリーの増幅および分析 |
| AT04718499T ATE484598T1 (de) | 2003-03-07 | 2004-03-08 | Amplifikation und analyse von gesamtgenom- und gesamttranskriptom- bibliotheken, die durch ein dns-polymerisierungsverfahren produziert wurden |
| HK06106593.2A HK1089485B (en) | 2003-03-07 | 2004-03-08 | Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process |
| DE602004029560T DE602004029560D1 (de) | 2003-03-07 | 2004-03-08 | Amplifikation und analyse von gesamtgenom- und gesamttranskriptom- bibliotheken, die durch ein dns-polymerisierungsverfahren produziert wurden |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US45306003P | 2003-03-07 | 2003-03-07 | |
| US60/453,060 | 2003-03-07 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2004081225A2 true WO2004081225A2 (en) | 2004-09-23 |
| WO2004081225A3 WO2004081225A3 (en) | 2004-11-25 |
Family
ID=32990716
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2004/006983 Ceased WO2004081225A2 (en) | 2003-03-07 | 2004-03-08 | Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US7718403B2 (https=) |
| EP (2) | EP1604040B1 (https=) |
| JP (1) | JP4773338B2 (https=) |
| AT (1) | ATE484598T1 (https=) |
| DE (1) | DE602004029560D1 (https=) |
| DK (2) | DK2374900T3 (https=) |
| WO (1) | WO2004081225A2 (https=) |
Cited By (107)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1721970A4 (en) * | 2004-03-03 | 2007-04-11 | Res Org Information & Systems | METHOD FOR GENERATING A GENERAL LIBRARY AND GENOMIBIBLE LABEL THEREOF |
| US7449297B2 (en) | 2005-04-14 | 2008-11-11 | Euclid Diagnostics Llc | Methods of copying the methylation pattern of DNA during isothermal amplification and microarrays |
| KR20100074188A (ko) * | 2007-10-15 | 2010-07-01 | 시그마-알드리치컴퍼니 | 축퇴 올리고뉴클레오티드 및 이의 용도 |
| WO2010102823A1 (en) | 2009-03-13 | 2010-09-16 | Oncomethylome Sciences Sa | Novel markers for bladder cancer detection |
| US20110171652A1 (en) * | 2009-01-06 | 2011-07-14 | Qimin You | Cross primingamplification of target nucleic acids |
| WO2011131192A1 (en) * | 2010-04-22 | 2011-10-27 | Statens Serum Institut | New nucleotide sequence amplification method |
| WO2014018093A1 (en) * | 2012-07-26 | 2014-01-30 | Illumina, Inc. | Compositions and methods for the amplification of nucleic acids |
| EP2722403A1 (en) * | 2012-10-18 | 2014-04-23 | Roche Diagniostics GmbH | Method for preventing high molecular weight products during amplification |
| CN103890191A (zh) * | 2011-05-27 | 2014-06-25 | 哈佛大学校长及研究员协会 | 单细胞全基因组扩增方法 |
| WO2016037537A1 (en) * | 2014-09-12 | 2016-03-17 | Tsinghua University | Method for constructing a sequencing library based on a single-stranded dna molecule and application thereof |
| CN105506125A (zh) * | 2016-01-12 | 2016-04-20 | 上海美吉生物医药科技有限公司 | 一种dna的测序方法及一种二代测序文库 |
| US9322065B2 (en) | 2007-09-17 | 2016-04-26 | Mdxhealth Sa | Methods for determining methylation of the TWIST1 gene for bladder cancer detection |
| CN105602939A (zh) * | 2015-09-02 | 2016-05-25 | 序康医疗科技(苏州)有限公司 | 扩增dna的方法 |
| WO2016156529A1 (en) * | 2015-03-31 | 2016-10-06 | Qiagen Gmbh | Efficiency improving ligation methods |
| EP3208343A4 (en) * | 2014-10-13 | 2018-03-21 | BGI Shenzhen Co., Limited | Nucleic acid fragmentation method and sequence combination |
| CN107849603A (zh) * | 2015-04-24 | 2018-03-27 | 阿提拉生物系统公司 | 利用有限核苷酸组成的引物扩增 |
| WO2018061674A1 (ja) | 2016-09-30 | 2018-04-05 | 富士フイルム株式会社 | 脊椎動物由来の単一細胞の塩基配列情報を取得する方法 |
| EP3208344A4 (en) * | 2014-10-17 | 2018-05-30 | MGI Tech Co., Ltd. | Primer for nucleic acid random fragmentation and nucleic acid random fragmentation method |
| EP3262175A4 (en) * | 2015-02-25 | 2018-10-31 | Jumpcode Genomics, Inc. | Methods and compositions for in silico long read sequencing |
| EP2464747B1 (fr) * | 2009-08-13 | 2019-04-10 | Ulrich Bockelmann | Procede de detection d'un adn circularise et utilisation de ce procede pour la detection de mutations |
| US10640763B2 (en) | 2016-05-31 | 2020-05-05 | Cellular Research, Inc. | Molecular indexing of internal sequences |
| US10669570B2 (en) | 2017-06-05 | 2020-06-02 | Becton, Dickinson And Company | Sample indexing for single cells |
| WO2021028682A1 (en) * | 2019-08-12 | 2021-02-18 | Queen Mary University Of London | Methods for generating a population of polynucleotide molecules |
| US10927419B2 (en) | 2013-08-28 | 2021-02-23 | Becton, Dickinson And Company | Massively parallel single cell analysis |
| US10941396B2 (en) | 2012-02-27 | 2021-03-09 | Becton, Dickinson And Company | Compositions and kits for molecular counting |
| WO2021216223A1 (en) * | 2020-04-24 | 2021-10-28 | Microsoft Technology Licensing, Llc | Homopolymer primers for amplification of polynucleotides created by enzymatic synthesis |
| USRE48913E1 (en) | 2015-02-27 | 2022-02-01 | Becton, Dickinson And Company | Spatially addressable molecular barcoding |
| CN114144520A (zh) * | 2019-06-26 | 2022-03-04 | 斯特拉托斯基因公司 | 通过芳香族化合物增强核酸聚合 |
| US11319583B2 (en) | 2017-02-01 | 2022-05-03 | Becton, Dickinson And Company | Selective amplification using blocking oligonucleotides |
| US11332776B2 (en) | 2015-09-11 | 2022-05-17 | Becton, Dickinson And Company | Methods and compositions for library normalization |
| US11339427B2 (en) | 2016-02-12 | 2022-05-24 | Jumpcode Genomics, Inc. | Method for target specific RNA transcription of DNA sequences |
| US11365409B2 (en) | 2018-05-03 | 2022-06-21 | Becton, Dickinson And Company | Molecular barcoding on opposite transcript ends |
| US11390914B2 (en) | 2015-04-23 | 2022-07-19 | Becton, Dickinson And Company | Methods and compositions for whole transcriptome amplification |
| US11460468B2 (en) | 2016-09-26 | 2022-10-04 | Becton, Dickinson And Company | Measurement of protein expression using reagents with barcoded oligonucleotide sequences |
| US11492660B2 (en) | 2018-12-13 | 2022-11-08 | Becton, Dickinson And Company | Selective extension in single cell whole transcriptome analysis |
| US11525157B2 (en) | 2016-05-31 | 2022-12-13 | Becton, Dickinson And Company | Error correction in amplification of samples |
| US11535882B2 (en) | 2015-03-30 | 2022-12-27 | Becton, Dickinson And Company | Methods and compositions for combinatorial barcoding |
| US11639517B2 (en) | 2018-10-01 | 2023-05-02 | Becton, Dickinson And Company | Determining 5′ transcript sequences |
| US11649497B2 (en) | 2020-01-13 | 2023-05-16 | Becton, Dickinson And Company | Methods and compositions for quantitation of proteins and RNA |
| WO2023086880A1 (en) * | 2021-11-10 | 2023-05-19 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| US11661631B2 (en) | 2019-01-23 | 2023-05-30 | Becton, Dickinson And Company | Oligonucleotides associated with antibodies |
| US11661625B2 (en) | 2020-05-14 | 2023-05-30 | Becton, Dickinson And Company | Primers for immune repertoire profiling |
| US11702698B2 (en) | 2019-11-08 | 2023-07-18 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US11702693B2 (en) | 2020-01-21 | 2023-07-18 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US11732292B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays correlating target nucleic acid to tissue section location |
| US11733238B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11732300B2 (en) | 2020-02-05 | 2023-08-22 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US11732299B2 (en) | 2020-01-21 | 2023-08-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US11739372B2 (en) | 2015-04-10 | 2023-08-29 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11739443B2 (en) | 2020-11-20 | 2023-08-29 | Becton, Dickinson And Company | Profiling of highly expressed and lowly expressed proteins |
| US11753675B2 (en) | 2019-01-06 | 2023-09-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11753673B2 (en) | 2021-09-01 | 2023-09-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US11753674B2 (en) | 2013-06-25 | 2023-09-12 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US11767557B2 (en) | 2017-12-07 | 2023-09-26 | Massachusetts Institute Of Technology | Single cell analyses |
| US11773436B2 (en) | 2019-11-08 | 2023-10-03 | Becton, Dickinson And Company | Using random priming to obtain full-length V(D)J information for immune repertoire sequencing |
| US11773433B2 (en) | 2020-04-22 | 2023-10-03 | 10X Genomics, Inc. | Methods for spatial analysis using targeted RNA depletion |
| US11773441B2 (en) | 2018-05-03 | 2023-10-03 | Becton, Dickinson And Company | High throughput multiomics sample analysis |
| US11781130B2 (en) | 2020-06-08 | 2023-10-10 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11788122B2 (en) | 2011-04-13 | 2023-10-17 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US11795507B2 (en) | 2019-12-23 | 2023-10-24 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
| US11866767B2 (en) | 2020-05-22 | 2024-01-09 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US11873482B2 (en) | 2020-12-21 | 2024-01-16 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US11891654B2 (en) | 2020-02-24 | 2024-02-06 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| US11898205B2 (en) | 2020-02-03 | 2024-02-13 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
| US11926867B2 (en) | 2019-01-06 | 2024-03-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11926822B1 (en) | 2020-09-23 | 2024-03-12 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| US11933957B1 (en) | 2018-12-10 | 2024-03-19 | 10X Genomics, Inc. | Imaging system hardware |
| US11932901B2 (en) | 2020-07-13 | 2024-03-19 | Becton, Dickinson And Company | Target enrichment using nucleic acid probes for scRNAseq |
| US11932849B2 (en) | 2018-11-08 | 2024-03-19 | Becton, Dickinson And Company | Whole transcriptome analysis of single cells using random priming |
| US11939622B2 (en) | 2019-07-22 | 2024-03-26 | Becton, Dickinson And Company | Single cell chromatin immunoprecipitation sequencing assay |
| US11959130B2 (en) | 2020-05-22 | 2024-04-16 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US11965213B2 (en) | 2019-05-30 | 2024-04-23 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| WO2024083473A1 (de) * | 2022-10-19 | 2024-04-25 | Robert Bosch Gmbh | Verfahren und vorrichtung zur voramplifikation eines nukleinsäuregemisches |
| US11970737B2 (en) | 2009-12-15 | 2024-04-30 | Becton, Dickinson And Company | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US11981958B1 (en) | 2020-08-20 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using DNA capture |
| US11981960B1 (en) | 2020-07-06 | 2024-05-14 | 10X Genomics, Inc. | Spatial analysis utilizing degradable hydrogels |
| US12031177B1 (en) | 2020-06-04 | 2024-07-09 | 10X Genomics, Inc. | Methods of enhancing spatial resolution of transcripts |
| USRE50065E1 (en) | 2012-10-17 | 2024-07-30 | 10X Genomics Sweden Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US12060604B2 (en) | 2020-06-25 | 2024-08-13 | 10X Genomics, Inc. | Spatial analysis of epigenetic modifications |
| US12071655B2 (en) | 2021-06-03 | 2024-08-27 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| US12071617B2 (en) | 2019-02-14 | 2024-08-27 | Becton, Dickinson And Company | Hybrid targeted and whole transcriptome amplification |
| US12076701B2 (en) | 2020-01-31 | 2024-09-03 | 10X Genomics, Inc. | Capturing oligonucleotides in spatial transcriptomics |
| US12110541B2 (en) | 2020-02-03 | 2024-10-08 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US12117439B2 (en) | 2019-12-23 | 2024-10-15 | 10X Genomics, Inc. | Compositions and methods for using fixed biological samples |
| US12129516B2 (en) | 2020-02-07 | 2024-10-29 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| US12153043B2 (en) | 2020-02-25 | 2024-11-26 | Becton, Dickinson And Company | Bi-specific probes to enable the use of single-cell samples as single color compensation control |
| US12157913B2 (en) | 2020-06-02 | 2024-12-03 | Becton, Dickinson And Company | Oligonucleotides and beads for 5 prime gene expression assay |
| US12188010B2 (en) | 2020-01-29 | 2025-01-07 | Becton, Dickinson And Company | Barcoded wells for spatial mapping of single cells through sequencing |
| US12195790B2 (en) | 2021-12-01 | 2025-01-14 | 10X Genomics, Inc. | Methods for improved in situ detection of nucleic acids and spatial analysis |
| US12203134B2 (en) | 2021-04-14 | 2025-01-21 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| US12209280B1 (en) | 2020-07-06 | 2025-01-28 | 10X Genomics, Inc. | Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis |
| US12270077B2 (en) | 2018-08-28 | 2025-04-08 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12281357B1 (en) | 2020-02-14 | 2025-04-22 | 10X Genomics, Inc. | In situ spatial barcoding |
| US12297486B2 (en) | 2020-01-24 | 2025-05-13 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US12365942B2 (en) | 2020-01-13 | 2025-07-22 | 10X Genomics, Inc. | Methods of decreasing background on a spatial array |
| US12365935B2 (en) | 2021-05-06 | 2025-07-22 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| US12392771B2 (en) | 2020-12-15 | 2025-08-19 | Becton, Dickinson And Company | Single cell secretome analysis |
| US12391940B2 (en) | 2020-07-31 | 2025-08-19 | Becton, Dickinson And Company | Single cell assay for transposase-accessible chromatin |
| US12405264B2 (en) | 2020-01-17 | 2025-09-02 | 10X Genomics, Inc. | Electrophoretic system and method for analyte capture |
| EP4628594A1 (en) * | 2024-04-05 | 2025-10-08 | 4basebio UK Ltd | Methods of amplifying dna and dna products with inhibitory regions |
| US12529094B2 (en) | 2018-12-10 | 2026-01-20 | 10X Genomics, Inc. | Imaging system hardware |
| EP4469605A4 (en) * | 2022-01-28 | 2026-01-21 | Flagship Pioneering Innovations Vi Llc | COMPOSITIONS AND METHODS OF PRODUCTION AND USE OF AN IMMORTALIZED BANK |
| US12566113B2 (en) | 2019-12-23 | 2026-03-03 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| US12571029B1 (en) | 2022-11-09 | 2026-03-10 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of multiple analytes in a biological sample |
| US12606859B2 (en) | 2020-01-13 | 2026-04-21 | Becton, Dickinson And Company | Cell capture using DU-containing oligonucleotides |
Families Citing this family (71)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040024193A1 (en) * | 2002-07-26 | 2004-02-05 | Williams Gregg T. | Method of detecting and quantifying hepatitis C virus |
| US20060183132A1 (en) * | 2005-02-14 | 2006-08-17 | Perlegen Sciences, Inc. | Selection probe amplification |
| US20090124514A1 (en) * | 2003-02-26 | 2009-05-14 | Perlegen Sciences, Inc. | Selection probe amplification |
| US8206913B1 (en) | 2003-03-07 | 2012-06-26 | Rubicon Genomics, Inc. | Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process |
| US20050181394A1 (en) * | 2003-06-20 | 2005-08-18 | Illumina, Inc. | Methods and compositions for whole genome amplification and genotyping |
| WO2005003304A2 (en) | 2003-06-20 | 2005-01-13 | Illumina, Inc. | Methods and compositions for whole genome amplification and genotyping |
| WO2005085477A1 (en) * | 2004-03-02 | 2005-09-15 | Orion Genomics Llc | Differential enzymatic fragmentation by whole genome amplification |
| EP2380993B1 (en) | 2004-03-08 | 2015-12-23 | Rubicon Genomics, Inc. | Method for generating and amplifying DNA libraries for sensitive detection and analysis of DNA methylation |
| ES2610781T3 (es) * | 2004-09-14 | 2017-05-03 | Argos Therapeutics, Inc. | Amplificación de patógenos independiente de la cepa y vacunas para estos |
| EP1836302B1 (en) * | 2004-12-23 | 2010-04-14 | Amersham Biosciences Corp. | Ligation-based rna amplification |
| US8315816B2 (en) * | 2005-02-16 | 2012-11-20 | Genetic Technologies Limited | Methods of genetic analysis involving the amplification of complementary duplicons |
| EP3257949A1 (en) | 2005-06-15 | 2017-12-20 | Complete Genomics Inc. | Nucleic acid analysis by random mixtures of non-overlapping fragments |
| US20070003938A1 (en) * | 2005-06-30 | 2007-01-04 | Perlegen Sciences, Inc. | Hybridization of genomic nucleic acid without complexity reduction |
| WO2007018601A1 (en) | 2005-08-02 | 2007-02-15 | Rubicon Genomics, Inc. | Compositions and methods for processing and amplification of dna, including using multiple enzymes in a single reaction |
| WO2007018602A1 (en) * | 2005-08-02 | 2007-02-15 | Rubicon Genomics, Inc. | Isolation of cpg islands by thermal segregation and enzymatic selection-amplification method |
| US20090137415A1 (en) * | 2005-08-05 | 2009-05-28 | Euclid Diagnostics Llc | SUBTRACTIVE SEPARATION AND AMPLIFICATION OF NON-RIBOSOMAL TRANSCRIBED RNA (nrRNA) |
| JP2009508495A (ja) * | 2005-09-16 | 2009-03-05 | 454 ライフ サイエンシーズ コーポレイション | cDNAライブラリー調製 |
| US9134237B2 (en) * | 2005-09-20 | 2015-09-15 | Janssen Diagnotics, LLC | High sensitivity multiparameter method for rare event analysis in a biological sample |
| CA2623405C (en) * | 2005-09-20 | 2014-11-25 | Immunivest Corporation | Methods and composition to generate unique sequence dna probes labeling of dna probes and the use of these probes |
| US20070092899A1 (en) * | 2005-10-21 | 2007-04-26 | The Regents Of The University Of California | Multiple displacement amplification with blocker DNA |
| JP2009514555A (ja) | 2005-11-08 | 2009-04-09 | ユークリッド ダイアグノスティックス リミテッド ライアビリティー カンパニー | 癌評価の遺伝子関連CpGアイランドのメチル化アッセイのための材料と方法 |
| US20080057499A1 (en) * | 2006-02-06 | 2008-03-06 | Affymetrix, Inc. | Methods for high specificity whole genome amplification and hybridization |
| DK2002016T3 (da) * | 2006-04-12 | 2010-03-29 | Medical Res Council | Fremgangsmåde til bestemmelse af kopital |
| WO2007136874A2 (en) * | 2006-05-18 | 2007-11-29 | President And Fellows Of Harvard College | Genomic library construction |
| WO2009035447A1 (en) * | 2006-06-14 | 2009-03-19 | Living Microsystems, Inc. | Diagnosis of fetal abnormalities by comparative genomic hybridization analysis |
| US9051601B2 (en) | 2006-08-01 | 2015-06-09 | Gen-Probe Incorporated | Methods of nonspecific target capture of nucleic acids |
| US9149473B2 (en) * | 2006-09-14 | 2015-10-06 | Ibis Biosciences, Inc. | Targeted whole genome amplification method for identification of pathogens |
| ES2582602T3 (es) * | 2007-03-28 | 2016-09-14 | Signal Diagnostics | Sistema y método de análisis de alta resolución de ácidos nucleicos para detectar variaciones de secuencia |
| US7794985B2 (en) * | 2007-04-04 | 2010-09-14 | Ghc Technologies, Inc. | Methods and compositions for rapid amplification, capture and detection of nucleic acids and proteins |
| JP2010528608A (ja) * | 2007-06-01 | 2010-08-26 | 454 ライフ サイエンシーズ コーポレイション | 複合的な混合物から個々の試料を特定するためのシステムおよび方法 |
| US8221981B2 (en) * | 2007-07-30 | 2012-07-17 | Argos Therapeutics, Inc. | Primers and probes for the amplification and detection of HIV Gag, Rev and Nef polynucleotides |
| US8592150B2 (en) | 2007-12-05 | 2013-11-26 | Complete Genomics, Inc. | Methods and compositions for long fragment read sequencing |
| US20090291475A1 (en) * | 2008-04-23 | 2009-11-26 | Kai Qin Lao | Sequence amplification with linear primers |
| WO2009148560A2 (en) * | 2008-05-30 | 2009-12-10 | Board Of Regents, The Universtiy Of Texas System | Methods and compositions for nucleic acid sequencing |
| US20100028955A1 (en) * | 2008-07-22 | 2010-02-04 | Life Technologies Corporation | Sequence Amplification with Target Primers |
| JP5652843B2 (ja) * | 2008-10-17 | 2015-01-14 | 独立行政法人農業・食品産業技術総合研究機構 | Dna増幅法 |
| US10669574B2 (en) | 2008-11-18 | 2020-06-02 | XCR Diagnostics, Inc. | DNA amplification technology |
| US9524369B2 (en) * | 2009-06-15 | 2016-12-20 | Complete Genomics, Inc. | Processing and analysis of complex nucleic acid sequence data |
| WO2011044437A2 (en) * | 2009-10-09 | 2011-04-14 | Stc.Unm | Polony sequencing methods |
| US20110195457A1 (en) * | 2010-02-09 | 2011-08-11 | General Electric Company | Isothermal amplification of nucleic acid using primers comprising a randomized sequence and specific primers and uses thereof |
| KR101334072B1 (ko) * | 2010-11-25 | 2013-11-29 | 한국표준과학연구원 | 핵산 정량 방법 및 키트 |
| US9738930B2 (en) | 2011-01-28 | 2017-08-22 | The Broad Institute, Inc. | Paired end bead amplification and high throughput sequencing |
| US9290815B2 (en) | 2011-02-21 | 2016-03-22 | Qiagen Gmbh | Method for quantifying human DNA |
| US10364464B2 (en) | 2011-08-08 | 2019-07-30 | The Broad Institute, Inc. | Compositions and methods for co-amplifying subsequences of a nucleic acid fragment sequence |
| WO2013101783A2 (en) | 2011-12-30 | 2013-07-04 | Bio-Rad Laboratories, Inc. | Methods and compositions for performing nucleic acid amplification reactions |
| LT2825672T (lt) * | 2012-03-13 | 2019-06-10 | Swift Biosciences, Inc. | Būdai ir kompozicijos, skirti valdomam pagal dydį substrato polinukleotidų homopolimeriniam uodegų formavimui su nukleorūgščių polimeraze |
| WO2013143133A1 (zh) * | 2012-03-30 | 2013-10-03 | 深圳华大基因科技服务有限公司 | 全基因组扩增方法及其应用 |
| US20150141258A1 (en) * | 2012-04-30 | 2015-05-21 | Qiagen Gmbh | Targeted dna enrichment and sequencing |
| WO2014043140A1 (en) * | 2012-09-12 | 2014-03-20 | The Regents Of The University Of California | Accurate genome sequencing of single cells by single-stranded amplification and sequencing |
| KR101451874B1 (ko) * | 2013-02-27 | 2014-10-16 | 국민대학교산학협력단 | 실시간 pcr을 이용한 미생물의 최단시간 검출방법 |
| KR102323375B1 (ko) | 2013-10-09 | 2021-11-08 | 플루어레센트릭 인코포레이티드 | 다중 프로브 |
| CN105917002A (zh) | 2013-11-18 | 2016-08-31 | 鲁比康基因组学公司 | 用于减少背景的可降解适体 |
| US9293316B2 (en) | 2014-04-04 | 2016-03-22 | Thermo Finnigan Llc | Ion separation and storage system |
| US10301660B2 (en) | 2015-03-30 | 2019-05-28 | Takara Bio Usa, Inc. | Methods and compositions for repair of DNA ends by multiple enzymatic activities |
| MX2018000729A (es) | 2015-07-17 | 2018-09-06 | Harvard College | Métodos para amplificar las secuencias de ácido nucleico. |
| EP3332024B1 (en) * | 2015-08-06 | 2020-10-28 | F.Hoffmann-La Roche Ag | Target enrichment by single probe primer extension |
| US10301677B2 (en) | 2016-05-25 | 2019-05-28 | Cellular Research, Inc. | Normalization of nucleic acid libraries |
| JP7343264B2 (ja) * | 2016-06-29 | 2023-09-12 | トヨタ自動車株式会社 | Dnaライブラリーの作製方法及びdnaライブラリーを用いたゲノムdna解析方法 |
| WO2018003220A1 (ja) * | 2016-06-29 | 2018-01-04 | トヨタ自動車株式会社 | Dnaライブラリーの作製方法及びdnaライブラリーを用いたゲノムdna解析方法 |
| JP6889769B2 (ja) * | 2016-07-18 | 2021-06-18 | エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft | 核酸配列決定の非対称な鋳型および非対称な方法 |
| RU2736351C2 (ru) * | 2016-08-31 | 2020-11-16 | Президент Энд Фэллоуз Оф Харвард Коллидж | Способы дискретной амплификации полного генома |
| CN110012671B (zh) | 2016-09-06 | 2024-05-28 | 合成Dna技术公司 | Ngs文库浓度的标准化 |
| JP7056012B2 (ja) | 2017-05-19 | 2022-04-19 | トヨタ自動車株式会社 | ランダムプライマーセット、及びこれを用いたdnaライブラリーの作製方法 |
| WO2019018561A1 (en) * | 2017-07-19 | 2019-01-24 | The Scripps Research Institute | GENOMIC LIBRARY GENERATION IN SOLID PHASE FOR HIGH FLOW SEQUENCING |
| WO2019033065A1 (en) | 2017-08-11 | 2019-02-14 | Atila Biosystems, Inc. | DIGITAL AMPLIFICATION WITH LIMITED NUCLEOTIDE COMPOSITION PRIMERS |
| CN109971843B (zh) * | 2017-12-27 | 2022-11-11 | 复旦大学泰州健康科学研究院 | 一种单细胞转录组的测序方法 |
| KR102933367B1 (ko) | 2018-02-27 | 2026-03-03 | 코넬 유니버시티 | 게놈-와이드 통합을 통한 순환 종양 dna의 초민감 검출 |
| US20210381035A1 (en) * | 2019-02-15 | 2021-12-09 | Takara Bio Usa, Inc. | Methods of Preparing and Analyzing Nucleic Acid Libraries |
| WO2020191521A1 (zh) * | 2019-03-22 | 2020-10-01 | 深圳华大智造科技有限公司 | 核酸序列、rna目标区域测序文库的构建方法及应用 |
| WO2021127406A1 (en) * | 2019-12-19 | 2021-06-24 | The Regents Of The University Of California | Methods of producing target capture nucleic acids |
| US11280028B1 (en) * | 2021-02-24 | 2022-03-22 | Agency For Science, Technology And Research (A*Star) | Unbiased and simultaneous amplification method for preparing a double-stranded DNA library from a sample of more than one type of nucleic acid |
Family Cites Families (73)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4883750A (en) | 1984-12-13 | 1989-11-28 | Applied Biosystems, Inc. | Detection of specific sequences in nucleic acids |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4800159A (en) | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
| AU622104B2 (en) | 1987-03-11 | 1992-04-02 | Sangtec Molecular Diagnostics Ab | Method of assaying of nucleic acids, a reagent combination and kit therefore |
| IL86724A (en) | 1987-06-19 | 1995-01-24 | Siska Diagnostics Inc | Methods and kits for amplification and testing of nucleic acid sequences |
| CA1323293C (en) | 1987-12-11 | 1993-10-19 | Keith C. Backman | Assay using template-dependent nucleic acid probe reorganization |
| ATE92538T1 (de) | 1988-01-21 | 1993-08-15 | Genentech Inc | Verstaerkung und nachweis von nukleinsaeuresequenzen. |
| US6107023A (en) | 1988-06-17 | 2000-08-22 | Genelabs Technologies, Inc. | DNA amplification and subtraction techniques |
| EP0426756A4 (en) | 1988-07-26 | 1991-11-21 | Genelabs Incorporated | Rna and dna amplification techniques |
| US4932207A (en) | 1988-12-28 | 1990-06-12 | Sundstrand Corporation | Segmented seal plate for a turbine engine |
| US5043272A (en) | 1989-04-27 | 1991-08-27 | Life Technologies, Incorporated | Amplification of nucleic acid sequences using oligonucleotides of random sequence as primers |
| US5106727A (en) | 1989-04-27 | 1992-04-21 | Life Technologies, Inc. | Amplification of nucleic acid sequences using oligonucleotides of random sequences as primers |
| US6040138A (en) * | 1995-09-15 | 2000-03-21 | Affymetrix, Inc. | Expression monitoring by hybridization to high density oligonucleotide arrays |
| US5104792A (en) | 1989-12-21 | 1992-04-14 | The United States Of America As Represented By The Department Of Health And Human Services | Method for amplifying unknown nucleic acid sequences |
| AU672760B2 (en) | 1991-09-24 | 1996-10-17 | Keygene N.V. | Selective restriction fragment amplification: a general method for DNA fingerprinting |
| WO1993014217A1 (en) * | 1992-01-10 | 1993-07-22 | Life Technologies, Inc. | Use of predetermined nucleotides having altered base pairing characteristics in the amplification of nucleic acid molecules |
| KR100249110B1 (ko) * | 1992-05-06 | 2000-04-01 | 다니엘 엘. 캐시앙 | 핵산 서열 증폭 방법, 이에 이용되는 조성물 및 키트 |
| US5514545A (en) | 1992-06-11 | 1996-05-07 | Trustees Of The University Of Pennsylvania | Method for characterizing single cells based on RNA amplification for diagnostics and therapeutics |
| US5731171A (en) * | 1993-07-23 | 1998-03-24 | Arch Development Corp. | Sequence independent amplification of DNA |
| US5523204A (en) * | 1993-12-10 | 1996-06-04 | Becton Dickinson And Company | Detection of nucleic acids in cells by strand displacement amplification |
| US5710000A (en) | 1994-09-16 | 1998-01-20 | Affymetrix, Inc. | Capturing sequences adjacent to Type-IIs restriction sites for genomic library mapping |
| GB9422891D0 (en) | 1994-11-12 | 1995-01-04 | Univ Nottingham | Improvements in and relating to the amplification and identification of nucleotide sequences |
| JPH08173164A (ja) | 1994-12-22 | 1996-07-09 | Hitachi Ltd | Dna調製法 |
| US5565340A (en) | 1995-01-27 | 1996-10-15 | Clontech Laboratories, Inc. | Method for suppressing DNA fragment amplification during PCR |
| US5994058A (en) | 1995-03-20 | 1999-11-30 | Genome International Corporation | Method for contiguous genome sequencing |
| US5871820A (en) | 1995-04-06 | 1999-02-16 | General Electric Company | Protection of thermal barrier coating with an impermeable barrier coating |
| US5750341A (en) * | 1995-04-17 | 1998-05-12 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
| US5648245A (en) | 1995-05-09 | 1997-07-15 | Carnegie Institution Of Washington | Method for constructing an oligonucleotide concatamer library by rolling circle replication |
| US5814444A (en) | 1995-06-07 | 1998-09-29 | University Of Washington | Methods for making and using single-chromosome amplfication libraries |
| EP0951541B1 (en) | 1995-07-31 | 2005-11-30 | Urocor, Inc. | Biomarkers and targets for diagnosis, prognosis and management of prostate disease |
| US5631147A (en) * | 1995-09-21 | 1997-05-20 | Becton, Dickinson And Company | Detection of nucleic acids in cells by thermophilic strand displacement amplification |
| EP0880598A4 (en) * | 1996-01-23 | 2005-02-23 | Affymetrix Inc | RAPID EVALUATION OF NUCLEIC ACID ABUNDANCE DIFFERENCE, WITH A HIGH-DENSITY OLIGONUCLEOTIDE SYSTEM |
| ATE284891T1 (de) | 1996-02-14 | 2005-01-15 | Biomerieux Bv | Isolierung von einzelsträngigen nukleinsäuren |
| EP0910666B1 (en) * | 1996-05-02 | 2006-08-09 | Applera Corporation | Quantitation of rna transcripts using genomic dna as the internal amplification competitor |
| CA2234736A1 (en) | 1996-07-16 | 1998-01-22 | Periannan Senapathy | Method for contiguous genome sequencing |
| EP0835935A1 (en) * | 1996-10-03 | 1998-04-15 | Roche Diagnostics GmbH | Thermostable DNA Polymerase from Anaerocellum thermophilum |
| US6030814A (en) * | 1997-04-21 | 2000-02-29 | Epicentre Technologies Corporation | Reverse transcription method |
| US6124120A (en) | 1997-10-08 | 2000-09-26 | Yale University | Multiple displacement amplification |
| US5932451A (en) | 1997-11-19 | 1999-08-03 | Incyte Pharmaceuticals, Inc. | Method for unbiased mRNA amplification |
| DE19813317A1 (de) | 1998-03-26 | 1999-09-30 | Roche Diagnostics Gmbh | Verbessertes Verfahren zur Primer Extension Präamplifikations-PCR |
| US6232067B1 (en) * | 1998-08-17 | 2001-05-15 | The Perkin-Elmer Corporation | Adapter directed expression analysis |
| IL141749A0 (en) | 1998-09-18 | 2002-03-10 | Micromet Ag | Dna amplification of a single cell |
| US6506594B1 (en) * | 1999-03-19 | 2003-01-14 | Cornell Res Foundation Inc | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US6521428B1 (en) | 1999-04-21 | 2003-02-18 | Genome Technologies, Llc | Shot-gun sequencing and amplification without cloning |
| US6491752B1 (en) | 1999-07-16 | 2002-12-10 | Sumco Oregon Corporation | Enhanced n-type silicon material for epitaxial wafer substrate and method of making same |
| AU6387000A (en) | 1999-07-29 | 2001-02-19 | Genzyme Corporation | Serial analysis of genetic alterations |
| US6846626B1 (en) * | 1999-09-01 | 2005-01-25 | Genome Technologies, Llc | Method for amplifying sequences from unknown DNA |
| US6692918B2 (en) | 1999-09-13 | 2004-02-17 | Nugen Technologies, Inc. | Methods and compositions for linear isothermal amplification of polynucleotide sequences |
| US6271002B1 (en) | 1999-10-04 | 2001-08-07 | Rosetta Inpharmatics, Inc. | RNA amplification method |
| US6958225B2 (en) | 1999-10-27 | 2005-10-25 | Affymetrix, Inc. | Complexity management of genomic DNA |
| EP1276901A2 (en) * | 2000-01-13 | 2003-01-22 | Amsterdam Support Diagnostics B.V. | A universal nucleic acid amplification system for nucleic acids in a sample |
| US6379932B1 (en) | 2000-07-17 | 2002-04-30 | Incyte Genomics, Inc. | Single primer PCR amplification of RNA |
| US6713257B2 (en) * | 2000-08-25 | 2004-03-30 | Rosetta Inpharmatics Llc | Gene discovery using microarrays |
| WO2002020843A1 (en) * | 2000-09-06 | 2002-03-14 | Rutgers, The State University | A method for sequencing nucleic acid sequences without chain termination |
| EP1315799A2 (en) | 2000-09-08 | 2003-06-04 | bioMérieux BV | Attenuated hiv strains and use thereof |
| US6794141B2 (en) | 2000-12-22 | 2004-09-21 | Arcturus Bioscience, Inc. | Nucleic acid amplification |
| WO2002061140A2 (en) * | 2001-01-31 | 2002-08-08 | Ambion, Inc. | Competitive population normalization for comparative analysis of nucleic acid samples |
| WO2002065093A2 (en) | 2001-02-14 | 2002-08-22 | Baylor College Of Medicine | Methods and compositions of amplifying rna |
| MXPA02012739A (es) | 2001-03-09 | 2004-04-20 | Nugen Technologies Inc | Metodos y composiciones para amplificacion de secuencias de arn. |
| WO2002103054A1 (en) | 2001-05-02 | 2002-12-27 | Rubicon Genomics Inc. | Genome walking by selective amplification of nick-translate dna library and amplification from complex mixtures of templates |
| JP2002345466A (ja) | 2001-05-08 | 2002-12-03 | Takara Bio Inc | Dnaの増幅方法 |
| US6638722B2 (en) | 2001-06-13 | 2003-10-28 | Invitrogen Corporation | Method for rapid amplification of DNA |
| EP1275738A1 (en) | 2001-07-11 | 2003-01-15 | Roche Diagnostics GmbH | Method for random cDNA synthesis and amplification |
| EP1275734A1 (en) | 2001-07-11 | 2003-01-15 | Roche Diagnostics GmbH | Method for random cDNA synthesis and amplification |
| US20040175715A1 (en) | 2001-08-21 | 2004-09-09 | Burgoyne Leigh A. | Method and device for simultaneously molecularly cloning and polylocus profiling of genomes or genomes mixtures |
| US20040019005A1 (en) * | 2001-10-01 | 2004-01-29 | Jeffrey Van Ness | Methods for parallel measurement of genetic variations |
| JP2005535283A (ja) | 2001-11-13 | 2005-11-24 | ルビコン ゲノミクス インコーポレイテッド | ランダムフラグメント化により生成されたdna分子を用いたdna増幅および配列決定 |
| US20030211528A1 (en) * | 2002-03-12 | 2003-11-13 | Norman Iscove | Exponential amplification of sub-picogram nucleic acid samples with retention of quantitative representation |
| KR100545295B1 (ko) * | 2003-09-29 | 2006-01-24 | 현대모비스 주식회사 | 차량용 조향장치의 너클 어셈블리 |
| EP2380993B1 (en) | 2004-03-08 | 2015-12-23 | Rubicon Genomics, Inc. | Method for generating and amplifying DNA libraries for sensitive detection and analysis of DNA methylation |
| US8312249B1 (en) | 2008-10-10 | 2012-11-13 | Apple Inc. | Dynamic trampoline and structured code generation in a signed code environment |
| FR2957821B1 (fr) | 2010-03-24 | 2014-08-29 | Inst Francais Du Petrole | Nouvelle zone de regeneration du catalyseur divisee en secteurs pour unites catalytiques regeneratives |
-
2004
- 2004-03-08 EP EP04718499A patent/EP1604040B1/en not_active Expired - Lifetime
- 2004-03-08 US US10/795,667 patent/US7718403B2/en active Active
- 2004-03-08 WO PCT/US2004/006983 patent/WO2004081225A2/en not_active Ceased
- 2004-03-08 AT AT04718499T patent/ATE484598T1/de not_active IP Right Cessation
- 2004-03-08 DK DK10011482.6T patent/DK2374900T3/en active
- 2004-03-08 DK DK04718499.9T patent/DK1604040T3/da active
- 2004-03-08 JP JP2006509236A patent/JP4773338B2/ja not_active Expired - Lifetime
- 2004-03-08 DE DE602004029560T patent/DE602004029560D1/de not_active Expired - Lifetime
- 2004-03-08 EP EP10011482.6A patent/EP2374900B1/en not_active Expired - Lifetime
-
2006
- 2006-11-06 US US11/593,625 patent/US20070054311A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| None |
Cited By (171)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1721970A4 (en) * | 2004-03-03 | 2007-04-11 | Res Org Information & Systems | METHOD FOR GENERATING A GENERAL LIBRARY AND GENOMIBIBLE LABEL THEREOF |
| US7449297B2 (en) | 2005-04-14 | 2008-11-11 | Euclid Diagnostics Llc | Methods of copying the methylation pattern of DNA during isothermal amplification and microarrays |
| US10113202B2 (en) | 2007-09-17 | 2018-10-30 | Mdxhealth Sa | Method for determining the methylation status of the promoter region of the TWIST1 gene in genomic DNA from bladder cells |
| US9322065B2 (en) | 2007-09-17 | 2016-04-26 | Mdxhealth Sa | Methods for determining methylation of the TWIST1 gene for bladder cancer detection |
| EP3147375A1 (en) | 2007-09-17 | 2017-03-29 | MDxHealth SA | Novel markers for bladder cancer detection |
| KR101587664B1 (ko) | 2007-10-15 | 2016-01-21 | 시그마-알드리치 컴퍼니., 엘엘씨 | 축퇴 올리고뉴클레오티드 및 이의 용도 |
| EP2197894A4 (en) * | 2007-10-15 | 2011-07-06 | Sigma Aldrich Co | DISSOLVING OLIGONUCLEOTIDES AND ITS USES |
| KR20100074188A (ko) * | 2007-10-15 | 2010-07-01 | 시그마-알드리치컴퍼니 | 축퇴 올리고뉴클레오티드 및 이의 용도 |
| US20110171652A1 (en) * | 2009-01-06 | 2011-07-14 | Qimin You | Cross primingamplification of target nucleic acids |
| US8906621B2 (en) * | 2009-01-06 | 2014-12-09 | Qimin You | Cross priming amplification of target nucleic acids |
| WO2010102823A1 (en) | 2009-03-13 | 2010-09-16 | Oncomethylome Sciences Sa | Novel markers for bladder cancer detection |
| EP2464747B1 (fr) * | 2009-08-13 | 2019-04-10 | Ulrich Bockelmann | Procede de detection d'un adn circularise et utilisation de ce procede pour la detection de mutations |
| US12060607B2 (en) | 2009-12-15 | 2024-08-13 | Becton, Dickinson And Company | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US11970737B2 (en) | 2009-12-15 | 2024-04-30 | Becton, Dickinson And Company | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US12571038B2 (en) | 2009-12-15 | 2026-03-10 | Becton, Dickinson And Company | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US11993814B2 (en) | 2009-12-15 | 2024-05-28 | Becton, Dickinson And Company | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US12297487B2 (en) | 2010-04-05 | 2025-05-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11866770B2 (en) | 2010-04-05 | 2024-01-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11761030B2 (en) | 2010-04-05 | 2023-09-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12391980B2 (en) | 2010-04-05 | 2025-08-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11733238B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12297488B2 (en) | 2010-04-05 | 2025-05-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11732292B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays correlating target nucleic acid to tissue section location |
| US11767550B2 (en) | 2010-04-05 | 2023-09-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12391979B2 (en) | 2010-04-05 | 2025-08-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12234505B2 (en) | 2010-04-05 | 2025-02-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| WO2011131192A1 (en) * | 2010-04-22 | 2011-10-27 | Statens Serum Institut | New nucleotide sequence amplification method |
| US11788122B2 (en) | 2011-04-13 | 2023-10-17 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US11795498B2 (en) | 2011-04-13 | 2023-10-24 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| CN103890191A (zh) * | 2011-05-27 | 2014-06-25 | 哈佛大学校长及研究员协会 | 单细胞全基因组扩增方法 |
| US9617598B2 (en) | 2011-05-27 | 2017-04-11 | President And Fellows Of Harvard College | Methods of amplifying whole genome of a single cell |
| US10941396B2 (en) | 2012-02-27 | 2021-03-09 | Becton, Dickinson And Company | Compositions and kits for molecular counting |
| US11634708B2 (en) | 2012-02-27 | 2023-04-25 | Becton, Dickinson And Company | Compositions and kits for molecular counting |
| EP3428290A1 (en) * | 2012-07-26 | 2019-01-16 | Illumina, Inc. | Compositions and methods for the amplification of nucleic acids |
| US10870099B2 (en) | 2012-07-26 | 2020-12-22 | Illumina, Inc. | Compositions and methods for the amplification of nucleic acids |
| WO2014018093A1 (en) * | 2012-07-26 | 2014-01-30 | Illumina, Inc. | Compositions and methods for the amplification of nucleic acids |
| US12280350B2 (en) | 2012-07-26 | 2025-04-22 | Illumina, Inc. | Compositions and methods for the amplification of nucleic acids |
| USRE50065E1 (en) | 2012-10-17 | 2024-07-30 | 10X Genomics Sweden Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US9447476B2 (en) | 2012-10-18 | 2016-09-20 | Roche Molecular Systems, Inc. | Method for preventing high molecular weight products during amplification |
| EP2722403A1 (en) * | 2012-10-18 | 2014-04-23 | Roche Diagniostics GmbH | Method for preventing high molecular weight products during amplification |
| EP2722399A1 (en) * | 2012-10-18 | 2014-04-23 | Roche Diagniostics GmbH | Method for preventing high molecular weight products during amplification |
| US11821024B2 (en) | 2013-06-25 | 2023-11-21 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11753674B2 (en) | 2013-06-25 | 2023-09-12 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US10927419B2 (en) | 2013-08-28 | 2021-02-23 | Becton, Dickinson And Company | Massively parallel single cell analysis |
| US10954570B2 (en) | 2013-08-28 | 2021-03-23 | Becton, Dickinson And Company | Massively parallel single cell analysis |
| US11702706B2 (en) | 2013-08-28 | 2023-07-18 | Becton, Dickinson And Company | Massively parallel single cell analysis |
| US11618929B2 (en) | 2013-08-28 | 2023-04-04 | Becton, Dickinson And Company | Massively parallel single cell analysis |
| WO2016037537A1 (en) * | 2014-09-12 | 2016-03-17 | Tsinghua University | Method for constructing a sequencing library based on a single-stranded dna molecule and application thereof |
| CN105463585A (zh) * | 2014-09-12 | 2016-04-06 | 清华大学 | 基于单链dna分子构建测序文库的方法及其应用 |
| CN105463585B (zh) * | 2014-09-12 | 2018-04-20 | 清华大学 | 基于单链dna分子构建测序文库的方法及其应用 |
| US10400279B2 (en) | 2014-09-12 | 2019-09-03 | Tsinghua University | Method for constructing a sequencing library based on a single-stranded DNA molecule and application thereof |
| EP3208343A4 (en) * | 2014-10-13 | 2018-03-21 | BGI Shenzhen Co., Limited | Nucleic acid fragmentation method and sequence combination |
| US10344317B2 (en) | 2014-10-13 | 2019-07-09 | Mgi Tech Co., Ltd | Method and a sequence combination for producing nucleic acid fragments |
| EP3208344A4 (en) * | 2014-10-17 | 2018-05-30 | MGI Tech Co., Ltd. | Primer for nucleic acid random fragmentation and nucleic acid random fragmentation method |
| EP3262175A4 (en) * | 2015-02-25 | 2018-10-31 | Jumpcode Genomics, Inc. | Methods and compositions for in silico long read sequencing |
| US10968536B2 (en) | 2015-02-25 | 2021-04-06 | Jumpcode Genomics, Inc. | Methods and compositions for sequencing |
| USRE48913E1 (en) | 2015-02-27 | 2022-02-01 | Becton, Dickinson And Company | Spatially addressable molecular barcoding |
| US11535882B2 (en) | 2015-03-30 | 2022-12-27 | Becton, Dickinson And Company | Methods and compositions for combinatorial barcoding |
| WO2016156529A1 (en) * | 2015-03-31 | 2016-10-06 | Qiagen Gmbh | Efficiency improving ligation methods |
| US11739372B2 (en) | 2015-04-10 | 2023-08-29 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11390914B2 (en) | 2015-04-23 | 2022-07-19 | Becton, Dickinson And Company | Methods and compositions for whole transcriptome amplification |
| CN107849603A (zh) * | 2015-04-24 | 2018-03-27 | 阿提拉生物系统公司 | 利用有限核苷酸组成的引物扩增 |
| CN114250274A (zh) * | 2015-04-24 | 2022-03-29 | 阿提拉生物系统公司 | 利用有限核苷酸组成的引物扩增 |
| CN105602939A (zh) * | 2015-09-02 | 2016-05-25 | 序康医疗科技(苏州)有限公司 | 扩增dna的方法 |
| EP3346006A4 (en) * | 2015-09-02 | 2019-01-30 | Shanghai Xukang Medical Science&Technology Co., Ltd | METHOD FOR DNA AMPLIFICATION |
| US11041192B2 (en) | 2015-09-02 | 2021-06-22 | Shanghai Xukang Medical Science & Technology Co., Ltd | Method for amplifying DNA |
| US11332776B2 (en) | 2015-09-11 | 2022-05-17 | Becton, Dickinson And Company | Methods and compositions for library normalization |
| CN105506125A (zh) * | 2016-01-12 | 2016-04-20 | 上海美吉生物医药科技有限公司 | 一种dna的测序方法及一种二代测序文库 |
| US11339427B2 (en) | 2016-02-12 | 2022-05-24 | Jumpcode Genomics, Inc. | Method for target specific RNA transcription of DNA sequences |
| US12331351B2 (en) | 2016-05-31 | 2025-06-17 | Becton, Dickinson And Company | Error correction in amplification of samples |
| US11220685B2 (en) | 2016-05-31 | 2022-01-11 | Becton, Dickinson And Company | Molecular indexing of internal sequences |
| US10640763B2 (en) | 2016-05-31 | 2020-05-05 | Cellular Research, Inc. | Molecular indexing of internal sequences |
| US11525157B2 (en) | 2016-05-31 | 2022-12-13 | Becton, Dickinson And Company | Error correction in amplification of samples |
| US11782059B2 (en) | 2016-09-26 | 2023-10-10 | Becton, Dickinson And Company | Measurement of protein expression using reagents with barcoded oligonucleotide sequences |
| US11460468B2 (en) | 2016-09-26 | 2022-10-04 | Becton, Dickinson And Company | Measurement of protein expression using reagents with barcoded oligonucleotide sequences |
| US11467157B2 (en) | 2016-09-26 | 2022-10-11 | Becton, Dickinson And Company | Measurement of protein expression using reagents with barcoded oligonucleotide sequences |
| WO2018061674A1 (ja) | 2016-09-30 | 2018-04-05 | 富士フイルム株式会社 | 脊椎動物由来の単一細胞の塩基配列情報を取得する方法 |
| US11319583B2 (en) | 2017-02-01 | 2022-05-03 | Becton, Dickinson And Company | Selective amplification using blocking oligonucleotides |
| US12084712B2 (en) | 2017-06-05 | 2024-09-10 | Becton, Dickinson And Company | Sample indexing for single cells |
| US10676779B2 (en) | 2017-06-05 | 2020-06-09 | Becton, Dickinson And Company | Sample indexing for single cells |
| US10669570B2 (en) | 2017-06-05 | 2020-06-02 | Becton, Dickinson And Company | Sample indexing for single cells |
| US12371729B2 (en) | 2017-06-05 | 2025-07-29 | Becton, Dickinson And Company | Sample indexing for single cells |
| US11767557B2 (en) | 2017-12-07 | 2023-09-26 | Massachusetts Institute Of Technology | Single cell analyses |
| US11365409B2 (en) | 2018-05-03 | 2022-06-21 | Becton, Dickinson And Company | Molecular barcoding on opposite transcript ends |
| US12421548B2 (en) | 2018-05-03 | 2025-09-23 | Becton, Dickinson And Company | High throughput multiomics sample analysis |
| US12421547B2 (en) | 2018-05-03 | 2025-09-23 | Becton, Dickinson And Company | High throughput multiomics sample analysis |
| US11773441B2 (en) | 2018-05-03 | 2023-10-03 | Becton, Dickinson And Company | High throughput multiomics sample analysis |
| US12344892B2 (en) | 2018-08-28 | 2025-07-01 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12378607B2 (en) | 2018-08-28 | 2025-08-05 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12270077B2 (en) | 2018-08-28 | 2025-04-08 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US11639517B2 (en) | 2018-10-01 | 2023-05-02 | Becton, Dickinson And Company | Determining 5′ transcript sequences |
| US11932849B2 (en) | 2018-11-08 | 2024-03-19 | Becton, Dickinson And Company | Whole transcriptome analysis of single cells using random priming |
| US12529094B2 (en) | 2018-12-10 | 2026-01-20 | 10X Genomics, Inc. | Imaging system hardware |
| US11933957B1 (en) | 2018-12-10 | 2024-03-19 | 10X Genomics, Inc. | Imaging system hardware |
| US12404544B2 (en) | 2018-12-10 | 2025-09-02 | 10X Genomics, Inc. | Methods of capturing multiple analytes on a spatial array |
| US12180543B2 (en) | 2018-12-10 | 2024-12-31 | 10X Genomics, Inc. | Imaging system hardware |
| US11492660B2 (en) | 2018-12-13 | 2022-11-08 | Becton, Dickinson And Company | Selective extension in single cell whole transcriptome analysis |
| US11926867B2 (en) | 2019-01-06 | 2024-03-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11753675B2 (en) | 2019-01-06 | 2023-09-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11661631B2 (en) | 2019-01-23 | 2023-05-30 | Becton, Dickinson And Company | Oligonucleotides associated with antibodies |
| US12071617B2 (en) | 2019-02-14 | 2024-08-27 | Becton, Dickinson And Company | Hybrid targeted and whole transcriptome amplification |
| US11965213B2 (en) | 2019-05-30 | 2024-04-23 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| US12442045B2 (en) | 2019-05-30 | 2025-10-14 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| EP3994262A4 (en) * | 2019-06-26 | 2023-09-20 | Stratos Genomics Inc. | IMPROVEMENT OF THE POLYMERIZATION OF NUCLEIC ACIDS BY AROMATIC COMPOUNDS |
| CN114144520A (zh) * | 2019-06-26 | 2022-03-04 | 斯特拉托斯基因公司 | 通过芳香族化合物增强核酸聚合 |
| US11939622B2 (en) | 2019-07-22 | 2024-03-26 | Becton, Dickinson And Company | Single cell chromatin immunoprecipitation sequencing assay |
| WO2021028682A1 (en) * | 2019-08-12 | 2021-02-18 | Queen Mary University Of London | Methods for generating a population of polynucleotide molecules |
| US11773436B2 (en) | 2019-11-08 | 2023-10-03 | Becton, Dickinson And Company | Using random priming to obtain full-length V(D)J information for immune repertoire sequencing |
| US11702698B2 (en) | 2019-11-08 | 2023-07-18 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US11795507B2 (en) | 2019-12-23 | 2023-10-24 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US12241890B2 (en) | 2019-12-23 | 2025-03-04 | 10X Genomics, Inc. | Methods for generating barcoded nucleic acid molecules using fixed cells |
| US12566113B2 (en) | 2019-12-23 | 2026-03-03 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| US12117439B2 (en) | 2019-12-23 | 2024-10-15 | 10X Genomics, Inc. | Compositions and methods for using fixed biological samples |
| US11981965B2 (en) | 2019-12-23 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US12365942B2 (en) | 2020-01-13 | 2025-07-22 | 10X Genomics, Inc. | Methods of decreasing background on a spatial array |
| US12606859B2 (en) | 2020-01-13 | 2026-04-21 | Becton, Dickinson And Company | Cell capture using DU-containing oligonucleotides |
| US11649497B2 (en) | 2020-01-13 | 2023-05-16 | Becton, Dickinson And Company | Methods and compositions for quantitation of proteins and RNA |
| US12405264B2 (en) | 2020-01-17 | 2025-09-02 | 10X Genomics, Inc. | Electrophoretic system and method for analyte capture |
| US11732299B2 (en) | 2020-01-21 | 2023-08-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US11702693B2 (en) | 2020-01-21 | 2023-07-18 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US12297486B2 (en) | 2020-01-24 | 2025-05-13 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US12188010B2 (en) | 2020-01-29 | 2025-01-07 | Becton, Dickinson And Company | Barcoded wells for spatial mapping of single cells through sequencing |
| US12076701B2 (en) | 2020-01-31 | 2024-09-03 | 10X Genomics, Inc. | Capturing oligonucleotides in spatial transcriptomics |
| US12110541B2 (en) | 2020-02-03 | 2024-10-08 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US11898205B2 (en) | 2020-02-03 | 2024-02-13 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
| US12286673B2 (en) | 2020-02-05 | 2025-04-29 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US11732300B2 (en) | 2020-02-05 | 2023-08-22 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US12129516B2 (en) | 2020-02-07 | 2024-10-29 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| US12281357B1 (en) | 2020-02-14 | 2025-04-22 | 10X Genomics, Inc. | In situ spatial barcoding |
| US11891654B2 (en) | 2020-02-24 | 2024-02-06 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| US12153043B2 (en) | 2020-02-25 | 2024-11-26 | Becton, Dickinson And Company | Bi-specific probes to enable the use of single-cell samples as single color compensation control |
| US11773433B2 (en) | 2020-04-22 | 2023-10-03 | 10X Genomics, Inc. | Methods for spatial analysis using targeted RNA depletion |
| EP4397772A3 (en) * | 2020-04-24 | 2024-07-24 | Microsoft Technology Licensing, LLC | Homopolymer primers for amplification of polynucleotides created by enzymatic synthesis |
| WO2021216223A1 (en) * | 2020-04-24 | 2021-10-28 | Microsoft Technology Licensing, Llc | Homopolymer primers for amplification of polynucleotides created by enzymatic synthesis |
| US11702689B2 (en) | 2020-04-24 | 2023-07-18 | Microsoft Technology Licensing, Llc | Homopolymer primers for amplification of polynucleotides created by enzymatic synthesis |
| US11661625B2 (en) | 2020-05-14 | 2023-05-30 | Becton, Dickinson And Company | Primers for immune repertoire profiling |
| US12378594B2 (en) | 2020-05-14 | 2025-08-05 | Becton, Dickinson And Company | Primers for immune repertoire profiling |
| US11959130B2 (en) | 2020-05-22 | 2024-04-16 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US11866767B2 (en) | 2020-05-22 | 2024-01-09 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US12157913B2 (en) | 2020-06-02 | 2024-12-03 | Becton, Dickinson And Company | Oligonucleotides and beads for 5 prime gene expression assay |
| US12031177B1 (en) | 2020-06-04 | 2024-07-09 | 10X Genomics, Inc. | Methods of enhancing spatial resolution of transcripts |
| US11781130B2 (en) | 2020-06-08 | 2023-10-10 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US12060604B2 (en) | 2020-06-25 | 2024-08-13 | 10X Genomics, Inc. | Spatial analysis of epigenetic modifications |
| US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US12209280B1 (en) | 2020-07-06 | 2025-01-28 | 10X Genomics, Inc. | Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis |
| US11981960B1 (en) | 2020-07-06 | 2024-05-14 | 10X Genomics, Inc. | Spatial analysis utilizing degradable hydrogels |
| US11952627B2 (en) | 2020-07-06 | 2024-04-09 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US11932901B2 (en) | 2020-07-13 | 2024-03-19 | Becton, Dickinson And Company | Target enrichment using nucleic acid probes for scRNAseq |
| US12391940B2 (en) | 2020-07-31 | 2025-08-19 | Becton, Dickinson And Company | Single cell assay for transposase-accessible chromatin |
| US11981958B1 (en) | 2020-08-20 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using DNA capture |
| US11926822B1 (en) | 2020-09-23 | 2024-03-12 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
| US11739443B2 (en) | 2020-11-20 | 2023-08-29 | Becton, Dickinson And Company | Profiling of highly expressed and lowly expressed proteins |
| US12392771B2 (en) | 2020-12-15 | 2025-08-19 | Becton, Dickinson And Company | Single cell secretome analysis |
| US11873482B2 (en) | 2020-12-21 | 2024-01-16 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US12371688B2 (en) | 2020-12-21 | 2025-07-29 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US11959076B2 (en) | 2020-12-21 | 2024-04-16 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US12241060B2 (en) | 2020-12-21 | 2025-03-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US12203134B2 (en) | 2021-04-14 | 2025-01-21 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| US12365935B2 (en) | 2021-05-06 | 2025-07-22 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| US12071655B2 (en) | 2021-06-03 | 2024-08-27 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| US11753673B2 (en) | 2021-09-01 | 2023-09-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US11840724B2 (en) | 2021-09-01 | 2023-12-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| WO2023086880A1 (en) * | 2021-11-10 | 2023-05-19 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| US12275988B2 (en) | 2021-11-10 | 2025-04-15 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| US12195790B2 (en) | 2021-12-01 | 2025-01-14 | 10X Genomics, Inc. | Methods for improved in situ detection of nucleic acids and spatial analysis |
| EP4469605A4 (en) * | 2022-01-28 | 2026-01-21 | Flagship Pioneering Innovations Vi Llc | COMPOSITIONS AND METHODS OF PRODUCTION AND USE OF AN IMMORTALIZED BANK |
| WO2024083473A1 (de) * | 2022-10-19 | 2024-04-25 | Robert Bosch Gmbh | Verfahren und vorrichtung zur voramplifikation eines nukleinsäuregemisches |
| US12571029B1 (en) | 2022-11-09 | 2026-03-10 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of multiple analytes in a biological sample |
| WO2025210283A3 (en) * | 2024-04-05 | 2025-12-04 | 4Basebio Uk Ltd | Methods of amplifying dna and dna products with inhibitory regions |
| EP4628594A1 (en) * | 2024-04-05 | 2025-10-08 | 4basebio UK Ltd | Methods of amplifying dna and dna products with inhibitory regions |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1604040A2 (en) | 2005-12-14 |
| ATE484598T1 (de) | 2010-10-15 |
| EP1604040B1 (en) | 2010-10-13 |
| JP2006519621A (ja) | 2006-08-31 |
| EP2374900A1 (en) | 2011-10-12 |
| JP4773338B2 (ja) | 2011-09-14 |
| US7718403B2 (en) | 2010-05-18 |
| EP2374900B1 (en) | 2016-07-13 |
| WO2004081225A3 (en) | 2004-11-25 |
| US20040209298A1 (en) | 2004-10-21 |
| DK1604040T3 (da) | 2011-01-24 |
| DE602004029560D1 (de) | 2010-11-25 |
| HK1089485A1 (en) | 2006-12-01 |
| DK2374900T3 (en) | 2016-10-17 |
| US20070054311A1 (en) | 2007-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11492663B2 (en) | Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process | |
| EP2374900B1 (en) | Polynucleotides for the amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process | |
| US20040209299A1 (en) | In vitro DNA immortalization and whole genome amplification using libraries generated from randomly fragmented DNA | |
| EP3538662B1 (en) | Methods of producing amplified double stranded deoxyribonucleic acids and compositions and kits for use therein | |
| CN102066561B (zh) | 合成多核苷酸变体的方法 | |
| CN102803489B (zh) | 多核苷酸变体的组合自动化平行合成 | |
| EP3143139B1 (en) | Synthesis of double-stranded nucleic acids | |
| CN111356795A (zh) | 核酸的多重末端标记扩增 | |
| WO2000056877A1 (en) | Method for amplifying nucleic acid sequence | |
| EP1488001A2 (en) | METHODS FOR GENERATING DOUBLE STRANDED DNA COMPRISING A 3’ SINGLE STRANDED PORTION AND USES OF THESE COMPLEXES FOR RECOMBINATION | |
| US20240376531A1 (en) | Target Initiation and Amplification of Long DNA with Nuclease and Replisome Enzymes | |
| EP3891303A1 (en) | Methods for preparing cdna samples for rna sequencing, and cdna samples and uses thereof | |
| KR20230163386A (ko) | 증폭된 라이브러리에서 바람직하지 않은 단편을 선택적으로 고갈시키기 위한 차단 올리고뉴클레오티드 | |
| EP4347872B1 (en) | Oligo-modified nucleotide analogues for nucleic acid preparation | |
| HK1089485B (en) | Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006509236 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004718499 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004718499 Country of ref document: EP |