WO2002020606A1 - Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle - Google Patents
Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle Download PDFInfo
- Publication number
- WO2002020606A1 WO2002020606A1 PCT/CN2001/001324 CN0101324W WO0220606A1 WO 2002020606 A1 WO2002020606 A1 WO 2002020606A1 CN 0101324 W CN0101324 W CN 0101324W WO 0220606 A1 WO0220606 A1 WO 0220606A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- hearing loss
- human hearing
- related protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human hearing loss related protein 38.39, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
- Senile hearing loss has a high incidence. It is a human disease caused by a combination of environmental and genetic factors. It is not similar to the comprehensive hearing loss phenotype.
- the 2-cM region from D7S582 to D7S 179 is related to the autosomal dominant inheritance of DFNA5 hearing impairment.
- the gene is about 60 kb long and contains 10 exons.
- the 5 'end of the gene has a non-coding region consisting of 57bp.
- the upstream of the start codon ATG is purine-position 3, but the downstream +4 position lacks guanine.
- the gene contains an open reading frame of 1488bp and encodes a protein of 496 amino acids.
- the novel polypeptide of the present invention has 35% homology and 54% similarity with the unknown human DFM5 protein at the protein level, and has similar structural characteristics with it, and thus is considered to be a new human DFNA5 protein, named as a peptide, has similar biological functions as known proteins. When it is expressed normally, it can maintain human hearing soundness. If it is overexpressed or gene fragments are lost, it will cause human hearing abnormality or loss, and the gene will be lost. l kb causes DFNA5 disease. In addition, it also plays a role in the diagnosis and treatment of related diseases.
- the human hearing loss related protein 38. 39 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more participation in the field has been identified These processes are related to the 38.39 protein of human hearing loss, and in particular the amino acid sequence of this protein is identified. Isolation of hearing loss-related protein 38. 39 protein encoding genes for newcomers also provides a basis for research to determine the role of this protein in health and disease states. This These proteins may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate their coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human hearing loss related protein 38.39.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human hearing loss related protein 38.39.
- Another object of the present invention is to provide a method for producing human hearing loss related protein 38.39.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-a human hearing loss related protein 38.39.
- Another object of the present invention is to provide a human hearing loss related protein directed to the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in human hearing loss-related protein 38.39.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 175-1224 in SEQ ID NO: 1; and (b) a sequence of 1-1279 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a screened protein that mimics, activates, antagonizes or inhibits human hearing loss.
- a method of a 39 protein-active compound comprising utilizing a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with human hearing loss-related protein 38.
- 39 protein which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human hearing loss-related proteins 38.39.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bio activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active means that natural, recombinant, or synthetic proteins and fragments thereof Ability to induce a specific immune response in a substance or cell and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human hearing loss-related protein 38.39, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to human hearing loss related protein 38.39.
- Antagonist refers to a molecule that, when combined with human hearing loss related protein 38.39, can block or regulate the biological or immunological activity of human hearing loss related protein 38.39.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human hearing loss related protein 38.39.
- Regular refers to a change in the function of human hearing loss-related protein 38.39, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological property, function, or immunity of human hearing loss-related protein 38.39 Change of nature.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human hearing loss related proteins using standard protein purification techniques 38.39. Basically pure human hearing loss related proteins 38. 39 A single main band can be generated on a non-reducing polyacrylamide gel. Human hearing loss related protein 38. 39 The purity of the polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higginis, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Clus ter method checks all pairs The distance between them arranges the groups of sequences into clusters. The clusters are then assigned in pairs or groups. Two amino acid sequences such as The percent identity between sequence A and sequence B is calculated by:
- Number of residues matching between sequence A and sequence 100 100 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in emzumo l ogy 183: 625-645) .
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? It can specifically bind to the epitope of human hearing loss related protein 38.39.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- the polynucleotides and polypeptides are not isolated and purified, but the same polynucleotides or polypeptides such as' separated from other substances in the natural state are isolated and purified. of.
- isolated human hearing loss related protein 38. 39 refers to human hearing loss related protein 38. 39 which is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. This Those skilled in the art can purify human hearing loss related proteins 38. 39 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human hearing loss related protein 38. 39 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, a hearing loss related protein 38.39, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
- polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
- the polypeptides of the invention may also include or exclude the initial methionine residue.
- the invention also includes fragments, derivatives and analogs of the human hearing loss related protein 38.39.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human hearing loss related protein 38.39 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1279 bases and its open reading frame of 175-1224 encodes 349 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 35% homology with human hearing loss related proteins, and it can be deduced that the human hearing loss related proteins 38. 39 have similar structures and functions as human hearing loss related proteins.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DM can be single-stranded or double-stranded.
- the DM can be a coding chain or a non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably 50 to 60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human hearing loss related protein 38.39.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human hearing loss related protein 38.39 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DNA sequence to obtain double-stranded DNA of the polypeptide.
- genomic MA is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of transcript 38.39 of human hearing loss-related protein; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the 38.39 gene expression of the human hearing loss-related protein can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDN A sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human hearing loss related protein 38.39 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding a human hearing loss related protein 38.39 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: a ⁇ promoter-based expression vector expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); a pMSXND expression vector expressed in mammalian cells ( Lee and Nathans, J Bio Chem.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human hearing loss related protein 38.39 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human hearing loss related protein 38.39 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- a prokaryotic cell such as a bacterial cell
- a lower eukaryotic cell such as a yeast cell
- a higher eukaryotic cell such as a mammalian cell.
- Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS, or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant human hearing loss related protein 38. 39 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Figure 1 is a comparison diagram of the amino acid sequence homology of the human hearing loss related protein 38.39 and human hearing loss related protein of the present invention.
- the upper sequence is human hearing loss related protein 38.39, and the lower sequence is human hearing loss related protein.
- Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human hearing loss related protein 38.39. 38.3 9 kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Dye terminate cycle reaction sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 147 03 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the sequence of the human hearing loss-related protein 38.39 of the present invention and the protein sequence encoded by the same are used by the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank and Swissport.
- Genbank Genbank
- the gene with the highest homology to the human hearing loss related protein 38.39 of the present invention is a known human hearing loss related protein, and its accession number encoded by Genbank is AF073309.
- the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 35; similarity of 54%.
- Example 3 Cloning of a gene encoding human hearing loss related protein 38.39 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l reaction volume containing 50 mniol / L KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers , 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -actin was also set as a positive control during RT-PCR And template blank is negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DM sequence analysis results showed that the DNA sequence of the PCR product was identical to l-1279bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human hearing loss-related protein 38.39 gene expression:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR-amplified human hearing loss related protein 38.39 coding region sequence (175bp to 1224bp) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25niM KH 2 P0 4 (pH7.4)-5 ⁇ SSC- 5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, place the filter in Wash in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant human hearing loss related protein 38.39
- Primer3 5, _CCCCATATGATGGAACGCTGGAGCTTTGTCAAG- 3, (Seq ID No: 5)
- Primer4 5'-CATGGATCCTTATTTCATCCTCTTGTGCCAAAT-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Mel and BamHI restriction sites, respectively, which The coding sequences of the 5 'and 3' ends of the gene of interest are respectively followed by Ndel and BamHI restriction sites corresponding to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Enzyme site.
- PCR was performed using the pBS-1474d03 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-1474d03 plasmid, Primer-3, and Primer-4 in a total volume of 50 ⁇ 1; 1 J was 10 pmol; Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
- the host bacteria BL21 (pET-1474d03) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L, and the culture was continued for 5 hours.
- the cells were collected by centrifugation, and broken by ultrasound. The supernatant was collected by centrifugation, and chromatography was performed using His.
- Polypeptide specific to 38.39 human hearing loss-related protein was synthesized using a peptide synthesizer (product of PE):
- C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. With 4mg of hemocyanin Peptide complex plus complete Freund's adjuvant was used to immunize rabbits. After 15 days, hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
- Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- Probes 1 3 ⁇ l Probe (0.1OD / 10 ⁇ 1), add 2 ⁇ IKinase buffer, 8-10 uCi ⁇ - 32 P- dATP + 2U Kinase, to make up to a final volume of 20 ⁇ 1.
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- Senile hearing loss has a high incidence. It is a human disease caused by a combination of environmental and genetic factors. It is not similar to the comprehensive hearing loss phenotype.
- the 2-cM region from D7S582 to D7S 179 is related to the autosomal dominant inheritance of DFNA5 hearing impairment.
- Van Laer L et al. Found an insertion / deletion mutant in the 7th intron of a gene expressed in the cochlea in this region, which does not affect the intron-exon boundary, but within this region Five GGG triplets are lost at the 3 'end of the intron, and this GGG triplet plays an important role in splicing large introns. This mutant causes early termination of translation of the open reading frame. This mutation causes non-comprehensive hearing impairment.
- novel polypeptide of the present invention is highly homologous to the known human DFNA5 protein and has similar structural characteristics to it.
- novel polypeptide of the present invention When the novel polypeptide of the present invention is normally expressed, it can maintain human hearing soundness. If it is overexpressed or a gene fragment is lost, it will cause human hearing abnormality or loss, especially senile hearing loss.
- the abnormal expression of the human hearing loss-related protein 38.39 of the present invention will cause various diseases, especially human hearing abnormalities or loss.
- diseases include but are not limited to: senile hearing loss, non-comprehensive hearing impairment, Congenital deafness, auricle deformity
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat senile hearing loss, non-comprehensive hearing impairment, congenital deafness, auricle deformity, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human hearing loss related protein 38.39.
- Agonists enhance human hearing loss-related proteins 38. 39 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing a human hearing loss related protein 38.39 can be cultured with the labeled human hearing loss related protein 38.39 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of human hearing loss-related protein 38.39 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human hearing loss related protein 38.39 can bind to human hearing loss related protein 38.39 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.
- human hearing loss related protein 38.39 When screening compounds as antagonists, human hearing loss related protein 38.39 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human hearing loss related protein 38.39 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Peptide molecules capable of binding to human hearing loss related proteins 38. 39 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 38.39 molecules of human hearing loss related proteins should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human hearing loss related protein 38.39 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced using human hearing loss-related protein 38. 39 by injecting directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing monoclonal antibodies against human hearing loss-related protein 38.39 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using well-known techniques (Morr i s on e t
- Antibodies against human hearing loss related protein 38. 39 can be used in immunohistochemical techniques to detect human hearing loss related protein 38. 39 in biopsy specimens.
- Monoclonal antibodies that bind to human hearing loss-related protein 38.39 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human hearing loss related proteins 38. 39 positive Cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human hearing loss-related protein 38.39.
- Administration of appropriate doses of antibodies can stimulate or block the production of 38.39 protein in human hearing loss or Active.
- the invention also relates to a diagnostic test method for quantifying and localizing 38.39 levels of human hearing loss-related protein.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human hearing loss-related protein 38.39 detected in the test can be used to explain the importance of human hearing loss-related protein 38.39 in various diseases and to diagnose human hearing loss-related protein 38.39. disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding the human hearing loss related protein 38.39 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by human hearing loss-related proteins 38. 39 due to non-expression or abnormal / inactive expression.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human hearing loss related proteins 38.39 to inhibit endogenous human hearing loss related proteins 38.39 activity.
- a mutant human hearing loss-related protein 38.39 may be a shortened human hearing loss-related protein 38.39 that lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human hearing loss related proteins.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a human hearing loss related protein 38.39 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human hearing loss related protein 38.39 can be found in existing literature
- a polynucleotide encoding the human hearing loss related protein 38.39 can be recombinantly packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit 38.39 mRM of human hearing loss related proteins are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis methods has been widely used.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. To increase the stability of nucleic acid molecules, they can be modified in a variety of ways. For example, if the sequence length on both sides is increased, the linkage between ribonucleosides should use phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding the human hearing loss related protein 38.39 can be used for the diagnosis of diseases related to the human hearing loss related protein 38.39.
- the polynucleotide encoding the human hearing loss related protein 38.39 can be used to detect the expression of the human hearing loss related protein 38.39 or the abnormal expression of the human hearing loss related protein 38.39 in a disease state.
- the DNA sequence encoding the human hearing loss related protein 38.39 can be used to hybridize biopsy specimens to determine the expression status of the human hearing loss related protein 38.39.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are available commercially.
- Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues .
- a microarray Ma croar ray
- a DNA chip also known as a "gene chip”
- Human hearing loss related protein 38.39 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human hearing loss related protein 38.39 transcript.
- Human hearing loss-related protein 38.39 mutations can also be used to diagnose human hearing loss-related protein 38.39-related diseases.
- Human hearing loss-related protein 38.39 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human hearing loss-related protein 38.39 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel i an
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human hearing loss related proteins 38. 39 are administered in amounts effective to treat and / or prevent specific indications.
- the amount and range of human hearing loss-related protein 38.39 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2002220453A AU2002220453A1 (en) | 2000-09-07 | 2001-09-03 | A new polypeptide- human hearing defect-related protein 38.39 and the polynucleotde encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00125066.3 | 2000-09-07 | ||
CN00125066A CN1341652A (zh) | 2000-09-07 | 2000-09-07 | 一种新的多肽——人听力损失相关蛋白38.39和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002020606A1 true WO2002020606A1 (fr) | 2002-03-14 |
Family
ID=4590866
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/001324 WO2002020606A1 (fr) | 2000-09-07 | 2001-09-03 | Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1341652A (fr) |
AU (1) | AU2002220453A1 (fr) |
WO (1) | WO2002020606A1 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2016131981A1 (fr) * | 2015-02-20 | 2016-08-25 | Institut Pasteur | Prévention et/ou traitement de la perte ou d'un déficit d'audition |
-
2000
- 2000-09-07 CN CN00125066A patent/CN1341652A/zh active Pending
-
2001
- 2001-09-03 WO PCT/CN2001/001324 patent/WO2002020606A1/fr active Application Filing
- 2001-09-03 AU AU2002220453A patent/AU2002220453A1/en not_active Abandoned
Non-Patent Citations (3)
Title |
---|
BALDWIN C.T. ET AL.: "Mutations in PAX3 associated with Waardenburg syndrome type I", HUM. MUTAT., vol. 3, no. 3, 1994, pages 205 - 211 * |
MEIRA L.B. ET AL.: "Manitoba aboriginal kindred with original cerebro-oculo- facio-skeletal syndrome has a mutation in the Cockayne syndrome group B (CSB) gene", AM. J. HUM. GENET., vol. 66, no. 4, April 2000 (2000-04-01), pages 1221 - 1228 * |
STEVENS K.E., KEM W.R., FREEDMAN R.: "Selective alpha 7 nicotinic receptor stimulation normalizes chronic cocaine-induced loss of hippocampal sensory inhibition in C3H mice", BIOL. PSYCHIATRY, vol. 46, no. 10, 15 November 1999 (1999-11-15), pages 1443 - 1450 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2016131981A1 (fr) * | 2015-02-20 | 2016-08-25 | Institut Pasteur | Prévention et/ou traitement de la perte ou d'un déficit d'audition |
US10751385B2 (en) | 2015-02-20 | 2020-08-25 | Institut Pasteur | Prevention and/or treatment of hearing loss or impairment |
US11679140B2 (en) | 2015-02-20 | 2023-06-20 | Institut Pasteur | Prevention and/or treatment of hearing loss or impairment |
Also Published As
Publication number | Publication date |
---|---|
AU2002220453A1 (en) | 2002-03-22 |
CN1341652A (zh) | 2002-03-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002026973A1 (fr) | Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide | |
WO2001038523A1 (fr) | Nouveau polypeptide, gene humain 14 lie a la surdite, et polynucleotide codant pour ce polypeptide | |
WO2001090169A1 (fr) | Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide | |
WO2002020606A1 (fr) | Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle | |
WO2001083780A1 (fr) | Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide | |
WO2001055404A1 (fr) | Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide | |
WO2001066730A1 (fr) | Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide | |
WO2001085903A2 (fr) | Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide | |
WO2001068688A1 (fr) | Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide | |
WO2001046240A1 (fr) | Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001046437A1 (fr) | Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide | |
WO2002026810A1 (fr) | Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001096572A1 (fr) | Nouveau polypeptide, multi-cuivre oxydase 12, et polynucleotide codant ce polypeptide | |
WO2001075055A2 (fr) | Nouveau polypeptide, quinine reductase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001048001A1 (fr) | Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001072787A1 (fr) | Nouveau polypeptide, facteur humain 10 induisant l'assemblage des peroxysomes, et polynucleotide codant pour ce polypeptide | |
WO2001079428A2 (fr) | Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001075051A2 (fr) | Nouveau polypeptide, proteine humaine 17 stag3 (antigene stromal), et polynucleotide codant pour ce polypeptide | |
WO2001048002A1 (fr) | Nouveau polypeptide, cytochrome b12, et polynucleotide codant pour ce polypeptide | |
WO2001048218A1 (fr) | Nouveau polypeptide, proteine muts 13, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001055427A1 (fr) | Nouveau polypeptide, proteine humaine kelch 19, et polynucleotide codant pour ce polypeptide | |
WO2001048199A1 (fr) | Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |