WO2001083780A1 - Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001083780A1
WO2001083780A1 PCT/CN2001/000675 CN0100675W WO0183780A1 WO 2001083780 A1 WO2001083780 A1 WO 2001083780A1 CN 0100675 W CN0100675 W CN 0100675W WO 0183780 A1 WO0183780 A1 WO 0183780A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
sequence
phosphorylase
Prior art date
Application number
PCT/CN2001/000675
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU70441/01A priority Critical patent/AU7044101A/en
Publication of WO2001083780A1 publication Critical patent/WO2001083780A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1077—Pentosyltransferases (2.4.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/02—Pentosyltransferases (2.4.2)
    • C12Y204/02028—S-Methyl-5'-thioadenosine phosphorylase (2.4.2.28)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • a New Polypeptide Human Methionine Axylside Phosphorylase 37 and Polynucleotide Encoding the Polypeptide TECHNICAL FIELD
  • the present invention belongs to the field of biotechnology> Specifically, the present invention describes a novel polypeptide " ⁇ ⁇ thiothioadenosine phosphorylase 37, and a polynucleotide sequence encoding the polypeptide. The present invention also relates to the polynucleoside Preparation method and application of acid and polypeptide.Technical background
  • MTAP methylthio adenosine phosphorylase
  • Imbalanced translocations or gap deletions on 9 have very important effects in many tumor types, including severe lymphoblastic leukemia, glioma, melanoma, brain cancer, neck cancer, etc. (Mi telman, F., 1994). Deletion and loss of homozygosity of the DM sequence at position 9p occur in a large number of tumor types (Diaz, M. 0., Zieraan, S., Le Beau, MM et al, 1988; Diaz, M. 0., Rubin, CM, Harden, A. et al., 1990). Many 9p deleted cell lines and cases lack methylthio phosphorylase activity. In many cases, this deletion including the IFN gene cluster and the MTAP gene is gapped and submicroscopic. The deletion of the homologous IFN gene in the tumor cell line happened to cause the loss of MTAP enzyme activity, which proves that MTAP is closely linked to IFN, and the existence of the TSG gene was found between the two.
  • MTAP involves a purine supplementation pathway through which methionine is circulated to the purine nucleoside depot, and if MTAP occurs, the supplementation pathway is blocked.
  • the lack of MTAP in human malignant tumors has increased the selective ability of chemotherapeutic agents to kill MTAP negative cells.
  • this major difference between normal cells and malignant tumor cells can be used to design effective methods for glioma, lung cancer, and many other cancers.
  • the polypeptide of the present invention has 41% identity and 63% similarity with the above-mentioned methylthioadenosine phosphorylase, and contains a conserved sequence characteristic of the methylthioadenosine phosphorylase family, so this protein is considered to be
  • a new purine supplement pathway-associated enzyme has a biological function similar to methylthio adenosine phosphorylase and is named human methylthio.
  • Adenosine phosphorylase 37 As mentioned above, the human methylthioadenosine phosphorylase 37 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human thiothioadenosine phosphorylase 37.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human methylthioadenosine phosphorylase 37.
  • Another object of the present invention is to provide a method for producing human methylthioadenosine phosphorylase 37.
  • Another object of the present invention is to provide a polypeptide-human amidinothioadenosine phosphorylase directed against the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human methylthioadenosine phosphorylase 37.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human methylthioadenosine phosphorylase 37.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 308 to 1321 in SEQ ID NO: 1; and (b) a sequence having 1-1588 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human methylthioadenosine phosphorylase 37 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human methylthioadenosine phosphorylase 37 protein in vitro, which comprises detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental or immune disease, or other diseases caused by abnormal expression of human methylthioadenosine phosphorylase 37. .
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human thiothioadenosine phosphorylase 37, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human methylthioadenosine phosphorylase 37.
  • Antagonist refers to a biological or immunological activity that can block or modulate human methylthioadenosine phosphorylase 37 when combined with human methylthioadenosine phosphorylase 37 Molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human methylthioadenosine phosphorylase 37.
  • Regular refers to a change in the function of human methylthioadenosine phosphorylase 37, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of human methylthioadenosine phosphorylase 37 , Functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Matter. Those skilled in the art can purify human methylthioadenosine phosphorylase using standard protein purification techniques
  • Substantially pure human methylthioadenosine phosphorylase 37 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human methylthioadenosine phosphorylase 37 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGAUGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, D. G., and P. M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645). 0 "Similarity” refers to amino acids The degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between sequences.
  • Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and 1 ⁇ , which can specifically bind to the epitopes of human methylthioadenosine phosphorylase 37.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human methylthioadenosine phosphorylase 37 means that human methylthioadenosine phosphorylase 37 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human methylthioadenosine phosphorylase 37 using standard protein purification techniques. Essentially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human methylthioadenosine phosphorylase 37 polypeptide can be analyzed by amino acid sequence analysis.
  • the present invention provides a new polypeptide, human amidinothioadenosine phosphorylase 37, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of human methylthioadenosine phosphorylase 37.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human methylthioadenosine phosphorylase 37 of the present invention.
  • a segment, derivative, or analog may be: U) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may be also May not be encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (III) such a type in which it is mature A polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) is a polypeptide sequence (such as a leader sequence or secretion) formed by fusion of an additional amino acid sequence into a mature polypeptide Sequence or sequence used to purify this polypeptide).
  • a polypeptide sequence such as a leader sequence or secretion
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1588 bases in length and its open reading frame 308-1321 encodes 37 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 75% homology with methylthioadenosine phosphorylase. It can be concluded that the human methylthioadenosine phosphorylase 37 has methylthioadenosine phosphorylase. Similar structure and function.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not Change the function of the polypeptide it encodes.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 »/. SDS, 6 (TC; or (2) adding denaturant during hybridization, such as 50 ° / »( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.
  • Hybridization occurs only when the identity between the two sequences is at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide is shown in SEQ ID NO: 2 Mature peptides have the same biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human methylthioadenosine phosphorylase 37.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human methylthioadenosine phosphorylase 37 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cD libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) the determination of the transcript of human methylthioadenosine phosphorylase 37 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination. use.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human methylthioadenosine phosphorylase 37 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplifying DM / RM using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human methylthioadenosine phosphorylase 37 coding sequence, and that the present invention is produced by recombinant technology Said method of polypeptide.
  • a polynucleotide sequence encoding human methylthioadenosine phosphorylase 37 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • MSXND expression vectors expressed in mammalian cells lee and Na thans, J Bio Chem 2 6 3:. 3521, 1988
  • baculovirus-derived vectors for expression in insect cells in short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulators. Pieces.
  • Methods known to those skilled in the art can be used to construct an expression vector containing a DM sequence encoding human methylthioadenosine phosphorylase 37 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human methylthioadenosine phosphorylase 37 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide, a nucleotide or a recombinant vector Host cells.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human methylthioadenosine phosphorylase 37 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Methylthioadenosine phosphorylase is involved in the purine supplementation pathway through which methylthioadenylate is circulated to the purine nucleoside depot, and if MTAP occurs, the complementation pathway is blocked.
  • MTAP Methylthioadenosine phosphorylase
  • Unbalanced translocations or gap deletions on the chromosome's gene region encoding this enzyme have very important effects in many tumor types, including malignant lymphoblastic leukemia, glioma, melanoma, and brain cancer , Neck cancer, etc. Deletion of homozygosity and loss of homozygosity of the DNA sequence at position 9p occur in a large number of tumor types. Many 9p deleted cell lines and cases lack methylthio phosphorylase activity. And the deletion of the homologous IFN gene in the tumor cell line happened to cause the loss of MTAP enzyme activity, which proves that MTAP is more closely linked to IFN.
  • the polypeptide of the present invention is highly homologous to methylthioadenosine phosphorylase and contains characteristic sequences of the methylthioadenosine phosphorylase family, both of which have similar biological functions. It is involved in the purine replenishment pathway in the body, and methylthio adenosine phosphorylase can block the circulation of methyl adenylate in the purine supplementation pathway to the purine nucleoside reservoir. Its abnormal expression, especially its loss of activity, is closely related to the doubling period of human malignant tumor cell growth. It is closely related to the occurrence of a variety of malignant tumors such as lymphoblastic leukemia, glioma, melanoma, brain cancer, neck cancer, and lung cancer. Related and produce related diseases.
  • human methylthioadenosine phosphorylase 37 of the present invention will produce various diseases, especially various tumors, purine metabolism deficiency diseases, development disorders, inflammation, and immune diseases. These diseases include but not limited to:
  • Tumors of various tissues lymphoblastic leukemia, glioma, melanoma, neck cancer, lung cancer, gastric cancer, liver cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma , Astrocytoma, ependymal tumor, neurofibromatosis, colon cancer, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma Liposarcoma
  • congenital abortion congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, mental retardation, brain development disorder, Skin, fat and muscle dysplasia, bone and joint dysplasia, various metabolic defects, sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of human methylthioadenosine phosphorylase 37 of the present invention will also produce certain hereditary, bloody diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, purine metabolism defects, development disorders, inflammation, and immune diseases. , Some hereditary, hematological diseases, etc.
  • the invention also provides screening compounds to identify increasing (agonist) or repressing (antagonist) human sulfanyl groups.
  • Method of Pharmacy for Adenosine Phosphorylase 37 Agonists enhance biological functions such as human methylthioadenosine phosphorylase 37 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human methylthioadenosine phosphorylase 37 can be cultured with labeled human methylthioadenosine phosphorylase 37 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human methylthioadenosine phosphorylase 37 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human methylthioadenosine phosphorylase 37 can bind to human thiothioadenosine phosphorylase 37 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that The polypeptide cannot perform biological functions.
  • human methylthioadenosine phosphorylase 37 When screening compounds as antagonists, human methylthioadenosine phosphorylase 37 can be added to the bioanalytical assay. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human methylthioadenosine phosphorylase 37 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the molecule of human methylthioadenosine phosphorylase 37 should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human methylthioadenosine phosphorylase 37 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human methylthioadenosine phosphorylase 37 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human methylthioadenylation phosphorylase 37 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Inlay antibodies combining human constant regions and non-human-derived variable regions can be produced using conventional techniques (Morrison et al, PMS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human methylthioadenosine phosphorylase 37.
  • Antibodies against human methylthioadenosine phosphorylase 37 can be used in immunohistochemical techniques to detect human methylthioadenosine phosphorylase 37 in biopsy specimens.
  • Monoclonal antibodies that bind to human methylthioadenosine phosphorylase 37 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic
  • the cutting method is used to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human methylthioadenylate phosphorylase 37 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human methylthio adenosine phosphorylase 37 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human methylthioadenosine phosphorylase 37.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human methylthioadenosine phosphorylase 37.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human methylthioadenosine phosphorylase 37 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human methylthioadenosine phosphorylase 37 detected in the test can be used to explain the importance of human methylthioadenosine phosphorylase 37 in various diseases and to diagnose human methylthioadenosine phosphate Diseases in which enzyme 37 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human methylthioadenosine phosphorylase 37 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human methylthioadenosine phosphorylase 37.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human methylthioadenosine phosphorylase 37 to inhibit endogenous human methylthioadenosine phosphorylase 37 activity.
  • a variant human methylthioadenosine phosphorylase 37 may be a shortened human methylthioadenosine phosphorylase 37 lacking a signaling domain.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human methylthioadenosine phosphorylase 37.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human methylthioadenosine phosphorylase 37 into a cell.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding human methylthioadenosine phosphorylase 37 can be found in the literature (Sanib r00 k, e ta l.). Alternatively, a recombinant polynucleotide encoding human methylthioadenosine phosphorylase 37 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or first introducing the polynucleotide into a cell via a vector (such as a virus, phage, or plasmid) in vitro, The cells are then transplanted into the body and the like.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human methylthioadenosine phosphorylase 37 raRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained by any MA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis technology has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RM.
  • This DM sequence has been integrated downstream of the A polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human methylthioadenosine phosphorylase 37 can be used for the diagnosis of diseases related to human thiothioadenosine phosphorylase 37.
  • the polynucleotide encoding human methylthioadenosine phosphorylase 37 can be used to detect the expression of human methylthioadenosine phosphorylase 37 or the abnormal expression of human thiothioadenosine phosphorylase 37 in a disease state.
  • a DNA sequence encoding human methylthio adenosine phosphorylase 37 can be used to hybridize biopsy specimens to determine the expression status of human methylthio adenosine phosphorylase 37.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human methylthio adenosine phosphorylase 37 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the human methylthio adenosine phosphorylase 37 transcript.
  • Human methylthio adenosine phosphorylase 37 mutant forms include point mutations, translocations, deletions, recombination, and any other abnormalities compared to the normal wild type human methylthio adenosine phosphorylase 37 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome. In short, the PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct a chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human methylthioadenosine phosphorylase 37 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human methylthioadenosine phosphorylase 37 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elraer
  • the determined cDNA sequence was compared with the existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1343 ⁇ 0 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the sequence of the human methylthioadenosine phosphorylase 37 of the present invention and the protein sequence encoded by the same were analyzed using the Blas t program (Basic loca l al ignment search tool) [Al tschul, SF et al. L Mol. Biol. 1990; 215: 403-10], homology search was performed in Genbank, Switzerland and other databases.
  • the gene with the highest homology to the human methylthioadenosine phosphorylase 37 of the present invention is a known methylthioadenosine phosphorylase, and the protein encoded by the accession number of Genbank is 1132746. Protein homology results are shown in Figure 1. The two are highly homologous, with 41% identity; 63% similarity.
  • Example 3 Cloning of a gene encoding human methylthioadenosine phosphorylase 37 by RT-PCR method. Total fetal brain cells were used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. After the cassette was purified, PCR was performed using the following primers:
  • Primer2 5'- CATAGGCCGAGGCGGCCGACATGT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is 3 of SEQ ID NO: 1, a wall reverse sequence.
  • Amplification reaction conditions 50 ⁇ l reaction volume containing 50 legs of ol / LKCl, 10 ramol / L Tris-HCl P H8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DM polymerization Enzyme (Clontech).
  • the reaction was performed on a PB9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min 0
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1588bp shown in SEQ ID NO: 1.
  • Example 4 Analysis of human methylthioadenosine phosphorylase 37 gene expression by Northern blot method Total MA was extracted by one step method [Anal. Biochem 1987, 162, 156-159] 0 This method includes acid guanidine thiocyanate phenol-chloroform Extraction.
  • the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge.
  • the aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate.
  • the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was used for electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid ( ⁇ 7.0)-5 mM sodium acetate-ImM EDTA- 2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR amplified human methylthioadenosine phosphorylase 37 coding region sequence (308bp to 1321bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ral) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 ( ⁇ 7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1 ° /. SDS at 55 ° C for 30min. Then , Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human methylthioadenosine phosphorylase 37 Based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Pr imer3 5'- CCCCATATGATGATGGTGGCTTGGACTACGAAA -3, (Seq ID No: 5)
  • Pr imer4 5'- CCCGAATTCCTATAGAAAACCCACCAATTTCTT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively Points, followed by the coding sequences of the 5 ,, and 3 'ends of the gene of interest, respectively.
  • the Ndel and EcoRI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using pBS-1343fl 0 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-1343fl O plasmid, Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontecli) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
  • coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were screened by colony PCR method and sequenced. A positive clone ( ⁇ ET-1343 ⁇ 0) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-1343f 10) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and chromatography was performed using an His. Bind Quick Cartridge (product of Novagen) with an affinity chromatography column capable of binding 6 histidine (6His-Tag). A purified target protein, human methylthioadenosine phosphorylase 37, was obtained.
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the primary probe is compared with the region of its source sequence (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions, respectively. If the homology with the non-target molecular region is greater than 85% or there is If more than 15 consecutive bases are identical, the primary probe should generally not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une méthylthioadénosine phosphorylase humaine 37, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de toutes sortes de tumeurs, des anomalies du métabolisme de la purine, des troubles du développement, des inflammations, des maladies immunitaires, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la méthylthioadénosine phosphorylase humaine 37.
PCT/CN2001/000675 2000-04-29 2001-04-28 Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide WO2001083780A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU70441/01A AU7044101A (en) 2000-04-29 2001-04-28 A novel polypeptide, a human methylthioadenosine phosphorylase 37 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115549 CN1321765A (zh) 2000-04-29 2000-04-29 一种新的多肽——人甲硫基腺苷磷酸化酶37和编码这种多肽的多核苷酸
CN00115549.0 2000-04-29

Publications (1)

Publication Number Publication Date
WO2001083780A1 true WO2001083780A1 (fr) 2001-11-08

Family

ID=4584995

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000675 WO2001083780A1 (fr) 2000-04-29 2001-04-28 Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1321765A (fr)
AU (1) AU7044101A (fr)
WO (1) WO2001083780A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019126455A1 (fr) * 2017-12-21 2019-06-27 Board Of Regents, The University Of Texas System Déplétion d'adénosine et/ou de méthylthioadénosine, médiée par des enzymes
US11396647B2 (en) 2020-01-07 2022-07-26 Board Of Regents, The University Of Texas System Human methylthioadenosine/adenosine depleting enzyme variants for cancer therapy

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3548638A1 (fr) * 2016-12-01 2019-10-09 GlaxoSmithKline Intellectual Property Development Limited Procédés de traitement du cancer

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5180714A (en) * 1990-10-31 1993-01-19 Health Research, Inc. Adenosine compounds for the treatment of diseases caused by parasitic protozoa

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5180714A (en) * 1990-10-31 1993-01-19 Health Research, Inc. Adenosine compounds for the treatment of diseases caused by parasitic protozoa

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019126455A1 (fr) * 2017-12-21 2019-06-27 Board Of Regents, The University Of Texas System Déplétion d'adénosine et/ou de méthylthioadénosine, médiée par des enzymes
US11118167B2 (en) 2017-12-21 2021-09-14 Board Of Regents, The University Of Texas System Enzyme-mediated depletion of adenosine and/or methylthioadenosine
JP2022069441A (ja) * 2017-12-21 2022-05-11 ボード オブ リージェンツ，ザ ユニバーシティ オブ テキサス システム アデノシンおよび／またはメチルチオアデノシンの酵素媒介枯渇方法
JP7313497B2 (ja) 2017-12-21 2023-07-24 ボード オブ リージェンツ，ザ ユニバーシティ オブ テキサス システム アデノシンおよび／またはメチルチオアデノシンの酵素媒介枯渇方法
US11396647B2 (en) 2020-01-07 2022-07-26 Board Of Regents, The University Of Texas System Human methylthioadenosine/adenosine depleting enzyme variants for cancer therapy
US11591579B2 (en) 2020-01-07 2023-02-28 Board Of Regents, The University Of Texas System Human methylthioadenosine/adenosine depleting enzyme variants for cancer therapy

Also Published As

Publication number Publication date
CN1321765A (zh) 2001-11-14
AU7044101A (en) 2001-11-12

Similar Documents

Publication Publication Date Title
WO2002026973A1 (fr) Nouveau polypeptide, une ribonucleoproteine nucleaire heterogene humaine 32.01, et un polynucleotide codant ce polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2002002611A1 (fr) Nouveaux polypeptides, domaine de repetition 12 de recepteurs peptidiques de la motilite du sperme et proteine ribosomale l22, et polynucleotides codant ces polypeptides
WO2001068688A1 (fr) Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide
WO2001079279A1 (fr) Nouveau polypeptide, facteur humain associe au recepteur du facteur de necrose tumorale 16, et polynucleotide codant pour ce polypeptide
WO2001090369A1 (fr) Nouveau polypeptide, n-acetylgalactosamine transferase 28, et polynucleotide codant ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2002033077A1 (fr) Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2002026975A1 (fr) Nouveau polypeptide, proteine humaine 48-35.53 associee au rhomboide, et polynucleotide codant ce polypeptide
WO2001064727A1 (fr) Nouveau polypeptide, adenosinate cyclase soluble 25 de souris, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001055420A1 (fr) Nouveau polypeptide, site 27 actif de la famille rho des enzymes gtp, et polynucleotide codant pour ce polypeptide
WO2001047985A1 (fr) Nouveau polypeptide, proteine kinase c-13, et polynucleotide codant pour ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2002012507A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 29, et polynucleotide codant ce polypeptide
WO2002004500A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc fpm315-17, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP