WO2001090169A1 - Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090169A1
WO2001090169A1 PCT/CN2001/000787 CN0100787W WO0190169A1 WO 2001090169 A1 WO2001090169 A1 WO 2001090169A1 CN 0100787 W CN0100787 W CN 0100787W WO 0190169 A1 WO0190169 A1 WO 0190169A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
nuclear antigen
pcna
cell nuclear
Prior art date
Application number
PCT/CN2001/000787
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU75642/01A priority Critical patent/AU7564201A/en
Publication of WO2001090169A1 publication Critical patent/WO2001090169A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • PCNA cell nuclear antigen
  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a proliferating cell nuclear antigen (PCNAU3), and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation of the polynucleotide and the polypeptide Method and application
  • DNA replication is a very complicated enzymatic process. It requires more than 30 kinds of enzymes and proteins. People often call these enzymes and proteins a replication system. Some of these enzymes and proteins combine together to form a so-called replica.
  • DNA polymerase III is the main polymerase that lengthens the DNA chain. DNA polymerase III is extremely complicated. It is known that its total enzyme contains 10 types and 22 subunits, and its composition is ⁇ 2 ⁇ 2 ⁇ 2 ⁇ 2 ⁇ 2 ⁇ , 2 ⁇ 2 ⁇ 2 ⁇ 4 .
  • PCNA Proliferating cell nuclear antigen
  • DNA polymerase is responsible for lead strand DNA replication.
  • PCNA is also involved in nucleotide excision repair (Kuriyan et al. J Mol. Bio 234: 915-925 (1993)).
  • PCNA is a structure-specific endonuclease with three to five exonuclease activities that contact the antigen nucleic acid, and is homologous to the endonucleotide repair factor.
  • the signature template of this family is two conserved regions located in the N-terminal part: [GA]-[LIVMF] -x-[LIVMA] -X- [SAV]-[LIVM] -D- ⁇ - [NSAE]- [HKR]-[VI] -x- [LY]-[VGA] — x— [LIVM] - ⁇ - [LIVM] - ⁇ (4) — F and [RKA] -C- [DE]-[RH] — X (3)-[LIVMF] -x (3)-[LIVM] -x- [SGAN]-[LIVMF] -xK- [LIVMF] (2), the second template is combined with DNA.
  • the polypeptide of the present invention contains a characteristic sequence template common to members of the proliferating cell nuclear antigen (PCNA) family and has similar biological functions. Therefore, the protein is considered to be a new member of the proliferating cell nuclear antigen (PCNA) family.
  • the polypeptide and its agonists, inhibitors, and antagonists can be used for diagnosis and prevention of diseases related to autoimmune diseases, cancer, graft-versus-host, and the like, and can also be used to regulate the activity of the immune system.
  • PCNA proliferating cell nuclear antigen
  • PCNA cell nuclear antigen
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • PCNA proliferating cell nuclear antigen
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a proliferating cell nuclear antigen (PCNA) 13.
  • PCNA proliferating cell nuclear antigen
  • Another object of the present invention is to provide a method for producing proliferating cell nuclear antigen (PCNA) 13.
  • PCNA proliferating cell nuclear antigen
  • Another object of the present invention is to provide an antibody against the polypeptide-proliferating cell nuclear antigen (PCNA) 13 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide-proliferating cell nuclear antigen (PCNA) 13 of the present invention.
  • PCNA polypeptide-proliferating cell nuclear antigen
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of proliferating cell nuclear antigen (PCNA) 13.
  • PCNA proliferating cell nuclear antigen
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 169-525 in SEQ ID NO: 1; and (b) having a sequence of 1-1226 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention.
  • the vector genetically engineered host cell includes a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the proliferating cell nuclear antigen (PCNA) 13 protein, which comprises utilizing the polypeptide of the invention.
  • PCNA proliferating cell nuclear antigen
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a proliferating cell nuclear antigen (PCNA) 13 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
  • PCNA proliferating cell nuclear antigen
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of proliferating cell nuclear antigen (PCNAU3).
  • PCNAU3 proliferating cell nuclear antigen
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to a different amino acid Or nucleotides replace one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” is a molecule that, when combined with proliferating cell nuclear antigen (PCNA) 13, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a proliferating cell nuclear antigen (PCNAU 3).
  • an “antagonist” or “inhibitor” refers to a molecule that, when combined with proliferating cell nuclear antigen (PCNA) 13, can block or regulate the biological or immunological activity of proliferating cell nuclear antigen (PCNA) 13.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to proliferating cell nuclear antigen (PCNA) 13.
  • Regular refers to changes in the function of proliferating cell nuclear antigen (PCNA) 13 including the increase or decrease in protein activity, changes in binding characteristics, and any other biological, functional, or immune properties of proliferating cell nuclear antigen (PCNA) 13. change.
  • Substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify proliferating cell nuclear antigen (PCNA) 13 using standard protein purification techniques.
  • a substantially pure proliferating cell nuclear antigen (PCNA) 13 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the proliferating cell nuclear antigen (PCNA) 13 polypeptide can be analyzed by amino acid sequence. '
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.).
  • the MEGALIGN program can be Methods such as the Clus ter method compare two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in erazuraology 183: 625-645) .
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of proliferating cell nuclear antigen (PCM) 13.
  • PCM proliferating cell nuclear antigen
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if natural Matter, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated proliferating cell nuclear antigen (PCNA) 1 3 means that proliferating cell nuclear antigen (PCNA) 13 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • PCNA proliferating cell nuclear antigen
  • Those skilled in the art can purify proliferating cell nuclear antigen (PCNA) 1 3 using standard protein purification techniques. Essentially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the proliferating cell nuclear antigen (PCNA) 13 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, a proliferating cell nuclear antigen (PCNAU 3), which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide A recombinant polypeptide is preferred.
  • the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Production.
  • polypeptides of the invention may be glycosylated, or may be non-glycosylated.
  • the polypeptides of the invention may also or may not include the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of proliferating cell nuclear antigen (PCNA) 13.
  • PCNA proliferating cell nuclear antigen
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the proliferating cell nuclear antigen (PCNAU 3) of the invention.
  • the analog or analog may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be Encoded by a genetic codon; or ( ⁇ ) such that a group on one or more amino acid residues is substituted with another group to include a substituent; or ( ⁇ ⁇ ) such that a mature polypeptide Fusion with another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or UV) a polypeptide sequence (such as a leader sequence or secretory sequence or The sequence used to purify this polypeptide or protease sequence) As described herein, such fragments, derivatives and classes Analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • Polynucleotides of the invention are found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1,226 bases in length, and its open reading frame (169-525) encodes 87 amino acids.
  • the polypeptide has a characteristic sequence of the proliferating cell nuclear antigen (OPNA) family, and it can be deduced that the proliferating cell nuclear antigen (PCNA) 13 has the structure and function represented by the proliferating cell nuclear antigen (PCNA) family.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA or artificially synthesized DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes . '
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50y «(v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding proliferating cell nuclear antigen (PCNA) 13.
  • PCNA proliferating cell nuclear antigen
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the proliferating cell nuclear antigen (PCM) 1 3 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridizing probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2 ) The antibodies of the expression library are screened to detect cloned polynucleotide fragments having common structural characteristics.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the proliferating cell nuclear antigen (the transcript of PCNAU3); (4) The protein product of gene expression is detected by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the proliferating cell nuclear antigen (PCNA) 13 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length cDNA sequence, The sequence needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a proliferating cell nuclear antigen (PCNA) 13 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • PCNA proliferating cell nuclear antigen
  • a polynucleotide sequence encoding a proliferating cell nuclear antigen (PCNA) 13 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • PCNA proliferating cell nuclear antigen
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a proliferating cell nuclear antigen (PCNA) 13 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP Fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a proliferating cell nuclear antigen (PCM) 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, M g Cl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant proliferating cell nuclear antigen (PCNA) 13 (Science, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant of human proliferating cell nuclear antigen (PCNAU 3) of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a comparison diagram of the homology of the proliferating cell nuclear antigen (PCNA) 13 of the present invention at 46-109 total amino acids at 63-109 and the amino acid sequence of the proliferating cell nuclear antigen (PCNA) family characteristic domain.
  • the upper sequence is the proliferating cell nuclear antigen (PCNA) 13 and the lower sequence is the characteristic domain of the proliferating cell nuclear antigen (PCNA) family.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated proliferating cell nuclear antigen (PCNA) 13. 13kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms CDM by reverse transcription.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the pBSK (+) vector (Clontech), and then transformed into DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • Example 2 Domain analysis of cDNA clones
  • the sequence of the proliferating cell nuclear antigen (PCM) 13 of the present invention and the protein sequence encoded by the same were subjected to a profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215 : 403-10], performing domain analysis in databases such as prosite.
  • the proliferating cell nuclear antigen (PCNA) 13 of the present invention is homologous with the domain proliferating cell nuclear antigen (PCNA) family at 63-109. The results of the homology are shown in FIG. 1 with a homology rate of 0.27 and a score of 12.58; the threshold value is 12.52.
  • Example 3 Cloning of a gene encoding proliferating cell nuclear antigen (PCNA) 13 by RT-PCR
  • CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction.
  • PCR amplification was performed with the following primers:
  • Primerl 5-CATCCTGAGAACTGAAATTGATCGC-3 '(SEQ ID NO: 3)
  • Primer2 5-ATAAAATTTTTGAATTTATGTTCAA-3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 ol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume , 1U Taq DM polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA Thermal Cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0 ⁇ -actin was set as positive at the time of RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was identical to the 1-1226bp shown in SEQ ID NO: 1.
  • Example 4 Analysis of the expression of proliferating cell nuclear antigen (PCNA) 13 gene by Northern blot:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] rempliThis method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid Sodium ( ⁇ 4.0 ⁇ ) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 Volume) and centrifuge the mixture to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the DNA probe used was the PCR-amplified proliferating cell nuclear antigen (PCNA) 13 coding region sequence (169bp to 525bp) shown in Figure 1.
  • PCNA proliferating cell nuclear antigen
  • Primer 3 5'— CCCCATATGATGCTCTGTCACCTTCAAAGGATGG— 3, (Seq ID No: 5)
  • Primer4 5'-CCCAAGCTTCTTCAACATGCCGCTTCTGTTCTTC-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and EcoRI digestion sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Nhel and EcoRI digestion sites correspond to the selectivity within the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the PCR reaction was performed using the pBS 1203b08 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are: ppg-1203b08 plasmid 10pg, primers in a total volume of 50 ⁇ 1]: ⁇ 1 "-3 and ⁇ 1 016]: -4 points in addition!
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles in total. Nhel and EcoRI were used to double the amplification product and plasmid pET-28 (+), respectively.
  • the ligation product was transformed into Escherichia coli DH5a by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 g / ml), The colony PCR method was used to screen positive clones and sequenced. The positive clones (pET-1203b08) with the correct sequence were selected and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • PCNA proliferating cell nuclear antigen
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods see: Avrameas, et al. Imniunochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. '
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred size of the probe ranges from 18 to 50 nucleotides; 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • DNA polymerase I I I is the main polymerase for DNA chain extension during DNA replication.
  • Proliferating cell nuclear antigen (PCNA) is involved in DNA replication by acting as a DNA polymerase del ta cofactor.
  • PCNA is also involved in nucleotide excision repair, a structure-specific endonuclease.
  • Members of this family can be used to regulate the activity of the immune system, are related to diseases such as autoimmune diseases, cancer, and can be used to treat diseases such as graft versus host.
  • Proliferating cell nuclear antigen (PCNA) -specific conserved sequences are required to form their active mot if.
  • the polypeptide of the present invention contains a characteristic sequence template common to members of the proliferating cell nuclear antigen (PCNA) family and has similar biological functions. Therefore, the protein is considered to be a new member of the proliferating cell nuclear antigen (PCNA) family.
  • abnormal expression of the specific proliferating cell nuclear antigen family protein mot if will cause abnormal function of the polypeptide containing the mot if of the present invention, resulting in abnormal DNA repair function and abnormal nucleotide excision repair, which in turn will Members of this family have abnormally regulated immune system activities and produce related diseases such as autoimmune diseases, cancer, and graft immune responses.
  • PCNA proliferating cell nuclear antigen
  • Immune diseases Graft immune rejection, transfusion reaction, systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre Syndrome, Common Variable Immunodeficiency Disease, Primary B Lymphocyte Immunodeficiency Disease, Acquired Immunodeficiency Syndrome
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, astrocytoma, ependymoma, glioblastoma, neurofibromas, colon Cancer, bladder cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma
  • Developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, mental retardation, brain development disorder, skin, fat and muscle development Adverse diseases, Bone and joint dysplasia, various metabolic defects, stunting, dwarfism, sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • PCNA proliferating cell nuclear antigen
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially graft immune rejection reactions, blood transfusion reactions, various tumors, developmental disorders, inflammation , Some hereditary, hematological diseases, etc.
  • the present invention also provides a method for screening compounds to identify agents that increase (agonist) or suppress (antagonist) proliferating cell nuclear antigen (PCMU 3).
  • Agonists enhance biological functions such as proliferating cell nuclear antigen (PCNA) 1 3 to stimulate cell proliferation, Antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • PCNA proliferating cell nuclear antigen
  • PCM proliferating cell nuclear antigen
  • PCM labeled proliferating cell nuclear antigen
  • Antagonists of proliferating cell nuclear antigen (PCNA) 1 3 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of proliferating cell nuclear antigen (PCNA) 1 3 can bind to proliferating cell nuclear antigen (PCNA) 1 3 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
  • proliferating cell nuclear antigen (PCM) 1 3 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between proliferating cell nuclear antigen (PCNA) 1 3 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to proliferating cell nuclear antigen (PCNA) 1 3 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the proliferating cell nuclear antigen (PCNA) 13 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against a proliferating cell nuclear antigen (PCNA) 13 epitope.
  • PCNA proliferating cell nuclear antigen
  • These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting proliferating cell nuclear antigen (PCM) 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • PCNA proliferating cell nuclear antigen
  • Techniques for preparing monoclonal antibodies to proliferating cell nuclear antigen (PCNA) 13 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the unique technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against proliferating cell nuclear antigen (PCNA) 13.
  • Antibodies against proliferating cell nuclear antigen (PCNA) 13 can be used in immunohistochemistry to detect proliferating cell nuclear antigen (PCNA) 13 in biopsy specimens.
  • Monoclonal antibodies that bind to proliferating cell nuclear antigen (PCNA) 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • proliferating cell nuclear antigen (PCNA) 13 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill proliferating cell nuclear antigen (PCNA) 13 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to proliferating cell nuclear antigen (PCNA) 13.
  • PCNA proliferating cell nuclear antigen
  • the proper dose of antibody can stimulate or block the production or activity of proliferating cell nuclear antigen (PCNA) 13.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of proliferating cell nuclear antigen (PCNA) 13 levels.
  • PCNA proliferating cell nuclear antigen
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of proliferating cell nuclear antigen (PCNA) 13 detected in the test can be used to explain the importance of proliferating cell nuclear antigen (PCNA) 13 in various diseases and to diagnose diseases in which proliferating cell nuclear antigen (PCNA) 13 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • PCNA 13 Polynucleotides encoding proliferating cell nuclear antigen (PCNA) 13 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of proliferating cell nuclear antigen (PCNA) 13. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant proliferating cell nuclear antigen (PCM) 13 to inhibit endogenous proliferating cell nuclear antigen (PCNA) 13 activity.
  • PCM proliferating cell nuclear antigen
  • a mutated proliferating cell nuclear antigen (PCNA) 13 may be a shortened proliferating cell nuclear antigen (PCNAU3) that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling activity. Therefore, the recombinant gene Therapeutic vectors can be used to treat diseases caused by abnormal expression or activity of proliferating cell nuclear antigen (PCNA) 13.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to treat A polynucleotide encoding a proliferating cell nuclear antigen (PCNA) 13 is transferred into the cell.
  • PCNA proliferating cell nuclear antigen
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense MA and DNA
  • ribozymes that inhibit proliferating cell nuclear antigen (PCNA) 13 raRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained by any RM or DNA synthesis technology. For example, solid-phase phosphate amide chemical synthesis technology has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding proliferating cell nuclear antigen (PCNA) 13 can be used for the diagnosis of diseases related to proliferating cell nuclear antigen (PCNA) 13.
  • Polynucleotides encoding PCNA 13 can be used to detect the expression of PCNA 13 or the abnormal expression of PCNA 13 in disease states.
  • the DNA sequence encoding proliferating cell nuclear antigen (PCM) 13 can be used to hybridize biopsy specimens to determine the expression status of proliferating cell nuclear antigen (PCNAU3.)
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, etc. These techniques and methods are all It is a published mature technology, and related kits are available from commercial sources.
  • PCM proliferating cell nuclear antigen
  • RT-PCR RNA-polymerase chain reaction
  • PCNA proliferating cell nuclear antigen
  • Detection of mutations in the proliferating cell nuclear antigen (PCM) 13 gene can also be used to diagnose proliferating cell nuclear antigen (PCNA) 13-related diseases.
  • Proliferating cell nuclear antigen (PCNA) 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type proliferating cell nuclear antigen (PCM) 13 DNA sequences. Mutations can be detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l an an inher tance in Man (available online with Johns Hopk ins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Proliferating cell nuclear antigen (PCNA) 1 3 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of proliferating cell nuclear antigen (PCNA) 1 3 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. '

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un antigène nucléaire de prolifération cellulaire (PCNA) 13, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment d'une réaction immunologique de rejet de greffe, de la réaction après transfusion, de certaines tumeurs, des troubles du développement, des inflammations, de certaines maladies héréditaires et de l'hémopathie. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant l'antigène nucléaire de prolifération cellulaire (PCNA) 13.
PCT/CN2001/000787 2000-05-19 2001-05-14 Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide WO2001090169A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU75642/01A AU7564201A (en) 2000-05-19 2001-05-14 A novel polypeptide- human proliferating cell nuclear antigen (pcna) 13 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115755.8 2000-05-19
CN00115755A CN1324823A (zh) 2000-05-19 2000-05-19 一种新的多肽——增殖细胞核抗原(pcna)13和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001090169A1 true WO2001090169A1 (fr) 2001-11-29

Family

ID=4585198

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000787 WO2001090169A1 (fr) 2000-05-19 2001-05-14 Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1324823A (fr)
AU (1) AU7564201A (fr)
WO (1) WO2001090169A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011104309A1 (fr) * 2010-02-24 2011-09-01 Institut National De La Sante Et De La Recherche Medicale (Inserm) Composés pour le traitement de l'inflammation et de la neutropénie

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007004654A1 (fr) * 2005-07-04 2007-01-11 Celestar Lexico-Sciences, Inc. Antigene pcna mutant
CN101671666B (zh) * 2009-09-25 2012-06-27 天津医科大学总医院 用于恶性肿瘤基因治疗的增殖和肿瘤细胞特异性基因操纵系统
CN103173418B (zh) * 2013-02-04 2015-04-22 天津三箭生物技术有限公司 小鼠抗人pcna单克隆抗体及分泌该单克隆抗体的杂交瘤细胞株

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6037520A (en) * 1994-12-07 2000-03-14 Goodwin Institute For Cancer Research Human breast carcinoma cell line capable of production of a spontaneously metastasizing tumor in animals for use in anticancer drug testing

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6037520A (en) * 1994-12-07 2000-03-14 Goodwin Institute For Cancer Research Human breast carcinoma cell line capable of production of a spontaneously metastasizing tumor in animals for use in anticancer drug testing

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011104309A1 (fr) * 2010-02-24 2011-09-01 Institut National De La Sante Et De La Recherche Medicale (Inserm) Composés pour le traitement de l'inflammation et de la neutropénie

Also Published As

Publication number Publication date
CN1324823A (zh) 2001-12-05
AU7564201A (en) 2001-12-03

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001098502A1 (fr) Nouveau polypeptide, arginase humaine 9, et polynucleotide codant ce polypeptide
WO2001085903A2 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2002026810A1 (fr) Nouveau polypeptide, substance proteique p125-77.22, et polynucleotide codant ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2002033077A1 (fr) Nouveau polypeptide, une proteine de regulation 10.01 etant associee au developpement humain et polynucleotide la codant
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001096572A1 (fr) Nouveau polypeptide, multi-cuivre oxydase 12, et polynucleotide codant ce polypeptide
WO2001088153A1 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2001094404A1 (fr) Nouveau polypeptide, facteur humain de retrotransposition l1 22, et polynucleotide codant ce polypeptide
WO2001083776A1 (fr) Nouveau polypeptide, hormone de croissance humaine 11, et polynucleotide codant pour ce polypeptide
WO2001094567A1 (fr) Nouveau polypeptide, transposase de la famille tc1/mariner humaine 11, et polynucleotide codant ce polypeptide
WO2001090373A1 (fr) Nouveau polypeptide, sous-unite de regulation 37 de la proteine phosphatase 4, et polynucleotide codant ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2002012323A1 (fr) Nouveau polypeptide, proteine secretrice 11 de la famille des hlyd, et polynucleotide codant ce polypeptide
WO2001064726A1 (fr) Nouveau polypeptide, formamido-pyrimidine-adn-gylcosylase 37, et polynucleotide codant pour ce polypeptide
WO2001081381A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une recombinase specifique au site, et polynucleotide codant pour ce polypeptide
WO2002000886A1 (fr) Nouveau polypeptide, hydroperoxyde reductase 9, et polynucleotide codant ce polypeptide
WO2002004631A1 (fr) Nouveau polypeptide, proteine 11 humaine associee a la transcription inverse orf2 du facteur l1, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP