WO2001064726A1 - Nouveau polypeptide, formamido-pyrimidine-adn-gylcosylase 37, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, formamido-pyrimidine-adn-gylcosylase 37, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001064726A1
WO2001064726A1 PCT/CN2001/000192 CN0100192W WO0164726A1 WO 2001064726 A1 WO2001064726 A1 WO 2001064726A1 CN 0100192 W CN0100192 W CN 0100192W WO 0164726 A1 WO0164726 A1 WO 0164726A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dna glycosylase
dna
sequence
Prior art date
Application number
PCT/CN2001/000192
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001244041A priority Critical patent/AU2001244041A1/en
Publication of WO2001064726A1 publication Critical patent/WO2001064726A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/02—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2) hydrolysing N-glycosyl compounds (3.2.2)
    • C12Y302/02023—DNA-formamidopyrimidine glycosylase (3.2.2.23)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2497—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing N- glycosyl compounds (3.2.2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a carboxamide-pyrimidine-DNA glycosylase 37, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • DNA is the carrier of genetic information. It requires extremely high fidelity, which not only depends on the perfection of the replication system, but also a repair system that can correct existing errors. In long-term evolution, organisms have evolved systems that can correct accidental replication errors and systems that can repair damage to DNA molecules caused by environmental factors and chemicals in the body.
  • cytosine in addition to uracil infiltration during DNA replication, cytosine can also be spontaneously deaminated and oxidized to uracil. Adenine can also be deaminated and oxidized to form hypoxanthine.
  • DNA glycosylases there are other base derivatives such as 2, 6-diamino-4-hydroxy-5N-methylformylaminopyrimidine (Fapy) and 7, 8-dihydro-8- Oxoguanine (8-OxoG), etc., have all been found to have corresponding DNA glycosylases.
  • DM glycosylase is widely present in almost all organisms. DNA glycosylases can be divided into two categories based on whether they have intrinsic AP endonuclease activity: no AP endonuclease activity and AP endonuclease activity.
  • Formamylpyrimidine-A glycosylase belongs to the second type of DNA glycosylase. It is an enzyme involved in DNA repair. It cuts out oxidative purine bases to release 2, 6 -Diamino-4-hydroxy-5N-methylformylaminopyrimidine (Fapy) and 7, 8-dihydro-8-oxoguanine (8-OxoG) residues. In addition to glycosylase activity, FPG is also able to excise DNA at the pentapurine site (AP site). FPG is a monomeric protein with a molecular weight of about 32Kd. Its active form requires binding to zinc.
  • the zinc-binding site is located at the C-terminal part of the protein, which contains four conserved and important cysteines, which are zinc ligands.
  • the conserved characteristic sequence template for this segment is: Cx (2, 4) -CX- [GTAQ ] -x- [IV]-x (7) -R- [GSTAN]-[STA] - ⁇ - [FYI 1 -C- x (2) -CQ 0 formamidopyrimidine-DM glycosylase for biological Physical survival is very important. If the genes of these enzymes are mutated, people's physical condition will be very poor, and they will be infected with various cancers and other diseases. Formamyl pyrimidine-DNA glycosylase repair mechanism is the same as uracil glycosylase.
  • the polypeptide of the present invention contains the above-mentioned conserved characteristic sequence template, and the polypeptide and its agonist inhibitor antagonist can be used for diagnosis and prevention of diseases such as cancer caused by DNA replication errors.
  • carboxamidopyrimidine-DNA glycosylase 37 protein plays an important role in important functions in the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, more needs to be identified in the art
  • the carboxamidopyrimidine-DNA glycosylase 37 protein involved in these processes, especially the amino acid sequence of this protein is identified.
  • Isolation of the neoformylpyrimidine-DNA glycosylase 37 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide, carboxamidopyrimidine-DNA glycosylase 37, and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding formamidopyrimidine-DNA glycosylase 37.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding formamidopyrimidine-DNA glycosylase 37.
  • Another object of the present invention is to provide a method for producing formamidopyrimidine-DNA glycosylase 37.
  • Another object of the present invention is to provide an antibody against the polypeptide-formamidopyrimidine-DNA glycosylase 37 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the polypeptide-formamide-pyrimidine-DNA glycosylase 37 of the present invention.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 48-1046 in SEQ ID NO: 1; and (b) a sequence having 1-2114 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; A method of preparing the polypeptide of the present invention by culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of formamidyl-pyrimidine-DNA glycosylase 37 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of formamidyl-pyrimidine-DNA glycosylase 37 protein, which comprises detecting the presence of said polypeptide or its encoding polynucleotide sequence in a biological sample. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for use in the treatment of cancer, developmental or immune diseases, or other medicaments caused by abnormal expression of formylpyrimidine-DM glycosylase 37 use.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to a different amino acid Or nucleotides replace one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunological activity refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with formamidopyrimidine-DNA glycosylase 37, can cause the protein to change and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind formylpyrimidine-DNA glycosylase 37.
  • Antagonist refers to a biological activity or immunity that can block or modulate formylpyrimidine-DNA glycosylase 37 when combined with formylpyrimidine-DNA glycosylase 37 Chemically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind formamide-pyrimidine-DNA glycosylase 37.
  • Regular is a change in the function of nailamidopyrimidine-DNA glycosylase 37, including an increase or decrease in protein activity, a change in binding properties, and any other biology of formamidopyrimidine-DNA glycosylase 37 Changes in nature, function, or immune properties.
  • substantially pure ' means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify formamidopyrimidine-DNA glycosylation using standard protein purification techniques. Enzyme 37. A substantially pure formamidopyrimidine-DNA glycosylase 37 produces a single main band on a non-reducing polyacrylamide gel. The purity of formamidopyrimidine-DNA glycosylase 37 polypeptide is available Amino acid sequence analysis.
  • “Complementary” or “complementary” refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • the sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”-the complementarity between two single strands can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid: the inhibition of such hybridization can be achieved by hybridization under conditions of reduced stringency (Southern blotting or Nor thern blot, etc.).
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.).
  • the MEGALIGN program can be Methods such as the Cluster method comparing two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the Cluster method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the antigenic determinant of formylpyrimidine-DNA glycosylase 37.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are the same as other substances existing in the natural state. It is separated and purified, and it is isolated and purified.
  • isolated formamidylpyrimidine-DNA glycosylase 37 is a nailnail aminopyrimidine-DNA glycosylase 37 that is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it .
  • Those skilled in the art can purify formamidopyrimidine-DNA glycosylase using standard protein purification techniques. 37.
  • a substantially pure polypeptide can produce a single main band on a non-reducing polyacrylamide gel.
  • Formamide Pyrimidine-DNA glycosylase 37 The purity of the polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, carboxamidopyrimidine-DNA glycosylase 37, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the present invention also includes fragments, derivatives and analogs of formamidopyrimidine-DNA glycosylase 37.
  • fragment As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of the formylpyrimidine-DNA glycosylase 37 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused to the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • an additional amino acid sequence is fused to the mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protea
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2114 bases in length and its open reading frame 48-1046 encodes 332 amino acids.
  • This polypeptide has a characteristic sequence of a carboxamidopyrimidine-DNA glycosylase family protein, and it can be deduced that the carboxamidopyrimidine-DNA glycosylase 37 has a formamide Structure and function.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding Coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 li co ll, 42 ° C, etc .; or (3) only the same between the two sequences Crosses occur only when the sex is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding formamidopyrimidine-DNA glycosylase 37.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding formylpyrimidine-DNA glycosylase 37 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolating double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DM sequence to obtain double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function: (3) determination of the formamide pyrimidine-DNA glycosylase 37 transcript (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the formamylpyrimidine-DNA glycosylase 37 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA FT segment can be separated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones to splice into a full-length cDNA.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a formamidopyrimidine-DNA glycosylase 37 coding sequence, and recombinant technology to produce the present invention.
  • a method of inventing the polypeptide is not limited to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a formamidopyrimidine-DNA glycosylase 37 coding sequence, and recombinant technology to produce the present invention.
  • a polynucleotide sequence encoding formylpyrimidine-DNA glycosylase 37 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain replication origins, promoters, marker genes, and translational regulatory elements.
  • the DNA sequence described in 1989 can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis.
  • promoters are: the lac or trp promoter of E. coli: the PL activator of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of the SV40 enhancer at the late side of the origin of replication, a polymorphic tumor enhancer at the late stage of replication, and an adenovirus enhancer.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • the polynucleotide encoding formylpyrimidine-DNA glycosylase 37 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower equinuclear cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • animal cells such as CH0, COS or Bowes melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing touch can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce a recombinant formamidopyrimidine-DNA glycosylase 37 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide can be coated in the cell, or expressed on the cell membrane, or secreted outside the cell. If necessary, it can be separated and purified by various separation methods using its physical, chemical and other properties.
  • Recombinant protein These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • Fig. 1 is a comparison diagram of amino acid sequences of the characteristic domains of the carboxamidopyrimidine-DNA glycosylase 37 and carboxamidopyrimidine-DNA glycosylase family proteins of the present invention.
  • FIG 2 is a polyacrylamide gel electrophoresis image of an isolated formamidopyrimidine-DNA glycosylase 37 (SDS-PAGE 37KDa is the molecular weight of the protein.
  • SDS-PAGE 37KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. Best way
  • Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • the poiy (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • Use Smart cDNA Cloning Kit purchased from Clontech. The 0 ⁇ fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0629f06 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the 0629f06 clone contains a full-length cDNA of 2114bp (as shown in Seq IDN0: 1), and has a 999bp open reading frame (0RF) from 48bp to 1046bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS_0629f 06 and the encoded protein was named formamidopyrimidine-DNA glycosylase 37.
  • Example 2 Domain analysis of cDNA clones
  • the sequence of the carboxamidopyrimidine-DNA glycosylase 37 of the present invention and the protein sequence encoded by the same are used by GCG
  • the profile scan program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] performs domain analysis in databases such as prosite.
  • the carboxamidopyrimidine-DNA glycosylase 37 of the present invention is homologous to the domain formamidopyrimidine-DNA glycosylase family proteins, and the results of the homology are shown in FIG. 1.
  • Example 3 Cloning of a gene encoding formamidopyrimidine-DNA glycosylase 37 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5'- GGTAGCGGTGCTGGGTCGGGCCGA -3 '(SEQ ID NO: 3)
  • Primer2 5'- GAGTAACAGTGAGCTTTATTTTCA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions A reaction volume of 50 ⁇ l contains 50 mmol / L KC1, 10 ⁇ l / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer , 1U of Taq DNA polymerase (C 1 on Tech).
  • the reaction was performed on a PE 9600 DNA thermal cycler (PerkinnElmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 2114 bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of the expression of formamylpyrimidine-DNA glycosylase 37 gene:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was used for electrophoresis on a 1.2% agarose gel containing 20raM 3_ (N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- 32 P dATP was used to prepare labeled DNA probes by random primer method. The DNA probe used was the PCR-amplified formamidopyrimidine-DNA glycosylase 37 coding region sequence (48bp to 1046bp) shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH 7.4) -5 x SSC- 5 x Denhardt's solution and 200 ⁇ ⁇ Zn1 salmon sperm DNA. After hybridization, place the filter in 1 x SSC-0.1% SDS at 55. C wash 30rain. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In Vitro Expression, Isolation and Purification of Recombinant Formamyl Pyrimidine-DM Glycosylase 37
  • Primer3 5'- CCCCATATGATGCCAGAAGGGCCGTTGGTGAGG -3 '(Seq ID No: 5) Prime ": 5'- CCCGAATTCTTAGGAGAACTGGCACTGCTCTGG -3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Mel and EcoRI restriction sites, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET28b (+) (Novagen, Cat. No. 69865.3) Enzyme site.
  • PCR was performed using pBS- 0629f06 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were: The total volume of 50 ⁇ 1 was 10 pg containing P BS-0629f 06 plasmid, Primer-3 and Primer- 4 are lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Nde I and EcoR I were used to expand The digestion product and the plasmid P ET-28 (+) were double-digested, and large fragments were separately recovered and ligated with T4 ligase.
  • the ligation product was transformed by the calcium chloride method of coliform bacteria DH5cx in kanamycin (final concentration 30 ⁇ ). after ⁇ / ⁇ 1) LB plates incubated overnight, by colony PCR screening method The positive clones were sequenced. The positive clones (pET-0629f06) with the correct sequence were selected. The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method. Kanamycin-containing (final concentration 30) ⁇ g / ml) of LB liquid medium, the host strain BL21 (pET-0629f06) was cultured at 37 ° C.
  • IPTG was added to a final concentration of 1 mol / L, and the culture was continued for 5 hours.
  • the body was sonicated and centrifuged to collect the supernatant. Chromatography was performed using an affinity column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
  • the target protein formamidopyrimidine-DNA glycosylase 37. After SDS-PAGE electrophoresis, a single band was obtained at 37 KDa ( Figure 2).
  • a peptide synthesizer (product of PE company) was used to synthesize the following formamide-pyrimidine-DNA glycosylase 37-specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. Imm Yaku chemistry, 1969; 6: 43. With 4mg of hemocyanin The peptide complex plus complete Freund's adjuvant was used to immunize the immune. After 15 days, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used as the ELI SA to determine the antibody titer in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home free serum.
  • Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • unhybridized probes are removed by a series of membrane washes.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (1Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Probel 1 3 ⁇ l Probel 0.10D / 10 ⁇ 1), add 2 ⁇ IKinase buffer, 8-10 uCi ⁇ - ⁇ - ⁇ + 2 ⁇ Kinase, to make up to a final volume of 20 ⁇ 1.
  • probe 1 can be used for qualitative and quantitative analysis.
  • the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Formamylpyrimidine-DNA glycosylase is an enzyme involved in DNA repair. It cuts out oxidative purine bases to release 2, 6-diamino-4-hydroxy-5N-methylformylaminopyrimidine (Fapy) And 7, 8-dihydro-8-oxoguanine (8-OxOG) residues. In addition to its glycosylase activity, FPG is also able to excise DNA within the pentapurine pyrimidine site (P site). The DNA repair ability of formylpyrimidine-DNA glycosylase ensures the fidelity of genetic information.
  • the polypeptide of the present invention is a polypeptide containing a characteristic sequence of the carboxamidopyrimidine-DNA glycosylase protein family. Abnormal expression of the polypeptide will lead to abnormal DNA repair function, abnormal endogenous activity of the AP site, and produce related disease.
  • the abnormal expression of the formamyl pyrimidine-DNA glycosylase 37 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, and immune diseases. These diseases include But not limited to:
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, vaginal atresia, neural tube defects, congenital hydrocephalus, iris defect, congenital glaucoma or cataract, congenital deafness
  • Growth disorders mental retardation, cerebral palsy, skin, fat, and muscular dysplasias such as congenital skin laxity, albinism, premature aging, congenital hypokeratosis, bone and joint dysplasias such as cartilage Hypoplasia, epiphyseal dysplasia, metabolic bone disease, various metabolic defects, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, fibroma, fibrosarcoma, Lipoma, liposarcoma, leiomyoma
  • Inflammation allergic reaction, bronchial asthma, adult respiratory distress syndrome, sarcoidosis, rheumatoid joints Inflammation, rheumatoid arthritis, osteoarthritis, dermatomyositis, urticaria, atopic dermatitis, polymyositis, Addison's disease, Graves' disease, intestinal emergency syndrome, chronic rhinitis, intracranial Granulomatosis, multiple scleroderma, pancreatitis, cholecystitis, chronic active hepatitis, myocarditis, cardiomyopathy, benign prostatic hyperplasia, cervicitis, various infectious inflammations
  • Immune diseases rheumatoid arthritis, chronic active hepatitis, post-infection myocarditis, systemic lupus erythematosus, scleroderma, acquired immunodeficiency syndrome, bronchial asthma, aspirin asthma, allergic rhinitis, diffuse Pulmonary interstitial fibrosis, hives, atopic dermatitis
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic developmental disorders, growth and development disorders, and immune diseases. , Some hereditary, hematological diseases, etc.
  • the invention also provides a method for screening compounds to identify agents that increase (agonist) or suppress (antagonist) formamidopyrimidine-DNA glycosylase 37. Agonist raises formamidopyrimidine-DNA glycosylase
  • mammalian cells or a membrane preparation expressing formamidopyrimidine-DNA glycosylase 37 can be cultured with labeled formamidopyrimidine-DNA glycosylase 37 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of formylpyrimidine-DNA glycosylase 37 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of formylpyrimidine-DNA glycosylase 37 can bind to formylpyrimidine-DNA glycosylase 37 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.
  • formamidopyrimidine-DNA glycosylase 37 can be added to the bioanalytical assay. Effect to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to formylpyrimidine-DNA glycosylase 37 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the formamyl pyrimidine-DNA glycosylase 37 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the formamidyl-pyrimidine-DNA glycosylase 37 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting formamide-pyrimidine-DNA glycosylase 37 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • a variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies of formylpyrimidine-DM glycosylase 37 include, but are not limited to, hybridoma technology (Kohler and Mil te in. Nature, 1975, 256: 495-497), triple tumor technology , Human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 685 1). The existing technology for producing single-chain antibodies (US Pat. No. 4946778) can also be used to produce single-chain antibodies against formamidopyrimidine-DM glycosylase 37.
  • Antibodies against formylpyrimidine-DNA glycosylase 37 can be used in immunohistochemistry to detect formylpyrimidine-DNA glycosylase 37 in biopsy specimens.
  • Monoclonal antibodies that bind formylpyrimidine-DNA glycosylase 37 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • formamylpyrimidine-DNA glycosylase 37 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the carboxamido pyrimidine-DNA glycosylation Enzyme 37 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to formamidopyrimidine-DNA glycosylase 37.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of formamidopyrimidine-DNA glycosylase 37.
  • the present invention also relates to a diagnostic test method for quantitative and localized detection of the level of formamidopyrimidine-DNA glycosylase 37.
  • These tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the levels of formylpyrimidine-DNA glycosylase 37 detected in the test can be used to explain the importance of formylpyrimidine-DNA glycosylase 37 in various diseases and to diagnose formamidopyrimidine- Diseases where DNA glycosylase 37 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding formylpyrimidine-DNA glycosylase 37 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by non-expression or abnormal / inactive expression of formamidyl-pyrimidine-DNA glycosylase 37.
  • Recombinant gene therapy vectors Body can be designed to express variant formamidopyrimidine-DNA glycosylase 37 to inhibit endogenous formamidopyrimidine-DNA glycosylase 37 activity.
  • a variant formamidopyrimidine-DNA glycosylase 37 may be a shortened formamidopyrimidine-DNA glycosylase 37 that lacks a signaling domain, although it can bind to a downstream substrate, However, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of formamyl pyrimidine-DNA glycosylase 37.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding formylpyrimidine-DNA glycosylase 37 into cells.
  • a method for constructing a heavy virus vector carrying a polynucleotide encoding a formamidopyrimidine-DNA glycosylase 37 can be found in the existing literature (Sambrook, etal.).
  • a recombinant polynucleotide encoding formylpyrimidine-DNA glycosylase 37 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RN A and DNA
  • ribozymes that inhibit formylpyrimidine-DNA glycosylase 37 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of diphosphonium phosphate bonds.
  • a polynucleotide encoding formylpyrimidine-DNA glycosylase 37 can be used to diagnose diseases related to formylpyrimidine-DNA glycosylation S
  • Polynucleotide encoding formylpyrimidine-DNA glycosylase 37 can be used to detect the expression of formylpyrimidine-DNA glycosylase 37 or formylaminopyridine-DNA glycosylase 37 in a disease state Abnormal expression.
  • the DNA sequence encoding formylpyrimidine-DNA glycosylase 37 can be used to hybridize biopsy specimens to determine the expression of formylpyrimidine-DNA glycosylase 37.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • kits can be obtained commercially from a part or all of the polynucleotides of the present invention and can be used as probes to be fixed on micro arrays or DNA chips (also known as " Gene chip ”) for differential expression analysis and basic diagnosis of genes in tissues.
  • RNA-Polymerase Chain Reaction (RT-PCR) with Formamyl Pyrimidine-DNA Glycosylase 37 Specific Primers In vitro amplification can also detect the transcription product of formamidopyrimidine-DNA glycosylase 37.
  • Detecting mutations in the carboxamidopyrimidine-DNA glycosylase 37 gene can also be used to diagnose carboxamidopyrimidine-DNA glycosylase 37-related diseases.
  • Forms of formylpyrimidine-DNA glycosylase 37 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type formylpyrimidine-DNA glycosylase 37 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • the important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as defects visible at the chromosomal level or detectable by cDNA sequence-based PCR Missing or transposing. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Formamylpyrimidine-DNA glycosylase 37 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of formamidopyrimidine-DNA glycosylase 37 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Abstract

L'invention concerne un nouveau polypeptide, une formamido-pyrimidine-ADN-gylcosylase 37, et un polynucleotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hymopathie, de l'infection par VIH, demaladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucleotide codant pour la formamido-pyrimidine-ADN-gylcosylase 37.
PCT/CN2001/000192 2000-03-02 2001-02-26 Nouveau polypeptide, formamido-pyrimidine-adn-gylcosylase 37, et polynucleotide codant pour ce polypeptide WO2001064726A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001244041A AU2001244041A1 (en) 2000-03-02 2001-02-26 A novel polypeptide, formamidopyrimidine-dna glycosylase 37 and the polynucleotide encoding thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111838.2 2000-03-02
CN 00111838 CN1311323A (zh) 2000-03-02 2000-03-02 一种新的多肽——甲酰胺基嘧啶－dna糖基化酶37和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001064726A1 true WO2001064726A1 (fr) 2001-09-07

Family

ID=4581734

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000192 WO2001064726A1 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, formamido-pyrimidine-adn-gylcosylase 37, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311323A (fr)
AU (1) AU2001244041A1 (fr)
WO (1) WO2001064726A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BOITEUX S. ET AL.: "Formamidopyrimidine-DNA glycosylase of escherichia coli: cloning and sequencing of the fpg structural gene and overproduction of the protein", EMBO J., vol. 6, no. 10, October 1987 (1987-10-01), pages 3177 - 3183 *
DE OLIVEIRA R. ET AL.: "Formamidopyrimidine DNA glycosylase in the yest saccharomyces cerevisiae", NUCLEIC ACIDS RES., vol. 22, no. 18, 11 September 1994 (1994-09-11), pages 3760 - 3764 *

Also Published As

Publication number Publication date
AU2001244041A1 (en) 2001-09-12
CN1311323A (zh) 2001-09-05

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001064726A1 (fr) Nouveau polypeptide, formamido-pyrimidine-adn-gylcosylase 37, et polynucleotide codant pour ce polypeptide
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001048167A1 (fr) Nouveau polypeptide, lipoxygenase 10, et polynucleotide codant pour ce polypeptide
WO2001048173A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001049724A1 (fr) Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001074876A1 (fr) Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide
WO2001073054A1 (fr) Nouveau polypeptide, dihydroorotase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001081593A1 (fr) Nouveau polypeptide, proteine humaine 20 contenant un domaine a structure de boite de paires appariees, et polynucleotide codant pour ce polypeptide
WO2001049853A1 (fr) Phosphoribosyle glycinamide synthase 9 et polynucleotide codant ce polypeptide
WO2001048001A1 (fr) Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide
WO2001047994A1 (fr) Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide
WO2001090373A1 (fr) Nouveau polypeptide, sous-unite de regulation 37 de la proteine phosphatase 4, et polynucleotide codant ce polypeptide
WO2001046425A1 (fr) Nouveau polypeptide, adn ligase 10, et polynucleotide codant pour ce polypeptide
WO2001048166A1 (fr) Nouveau polypeptide, ribonucleotide reductase 10, et polynucleotide codant pour ce polypeptide
WO2002000886A1 (fr) Nouveau polypeptide, hydroperoxyde reductase 9, et polynucleotide codant ce polypeptide
WO2001090184A1 (fr) Nouveau polypeptide, hormone de croissance 11, et polynucleotide codant ce polypeptide
WO2001047995A1 (fr) Nouveau polypeptide, dioxygenase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001055422A1 (fr) Nouveau polypeptide, proteine 47 de transport de sucre, et polynucleotide codant pour ce polypeptide
WO2001074875A1 (fr) Nouveau polypeptide, tyrosine kinase humaine 17, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP