WO2001055422A1 - Nouveau polypeptide, proteine 47 de transport de sucre, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine 47 de transport de sucre, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001055422A1 WO2001055422A1 PCT/CN2001/000049 CN0100049W WO0155422A1 WO 2001055422 A1 WO2001055422 A1 WO 2001055422A1 CN 0100049 W CN0100049 W CN 0100049W WO 0155422 A1 WO0155422 A1 WO 0155422A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- sugar transporter
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-to-sugar transporter 47, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
- sugar uptake is the most important.
- most mammalian tissues, except the liver could only passively take up glucose through diffusion, relying on concentration differences inside and outside the cell membrane.
- Proteins that can complete sugar transport have now been found on the membranes of many cells.
- hormones, insulin, etc. can also play a regulatory role.
- the proteins that complete sugar transport are structurally similar, so they are collectively referred to as the sugar transporter family.
- this sugar transporter protein is encoded by the GLUT1-GLUT7 genes and is widely present in many tissues and cells in the body.
- sugar transport is under fast or slow hormonal regulation with tissue specificity. For example, when insulin levels increase, muscle tissue and adipose tissue increase significantly. Insulin can increase the liver's utilization of glucose. .
- the complete sugar transporter contains 12 transmembrane regions (M1-Mil), and has two identical conserved G-R- [KR] domains, so it can be inferred that it contains six transmembrane domains during evolution. Membrane proteins are copied.
- the first G-R- [KR] domain is located between the M2 and M3 transmembrane regions, while the second is located between the M8 and M9 transmembrane regions.
- the sugar transporter is a hydrophobic protein, and its structure contains alterable hydrophobic and hydrophilic regions. There is a huge hydrophobic loop between the transmembrane regions M6 and M7.
- the polypeptide of the present invention has the basic structural characteristics of a sugar transporter and belongs to the sugar transporter family. In the body, it controls the control of glucose molecules in and out of the cell to maintain a balanced glucose content inside the cell.
- the out-of-control function can lead to dysregulation of cell nutrition metabolism, causing abnormalities in many tissues and organs.
- sugar transporter 47 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more sugar transporter 47 proteins involved in these processes, especially Is to identify the amino acid sequence of this protein.
- New sugar transporter 47 protein The isolation of the coding genes also provides the basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Disclosure of invention
- An object of the present invention is to provide an isolated novel polypeptide-sugar transporter 47 and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a sugar transporter 47. It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding a sugar transporter 47.
- Another object of the present invention is to provide a method for producing a sugar transporter 47.
- Another object of the present invention is to provide an antibody against the polypeptide-sugar transporter 47 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-monosaccharide transporter 47 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in sugar transporter 47.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 02 to 1 391 in SEQ ID NO: 1; and (b) a sequence having 1 in SEQ ID NO: 1 -235 3-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a screen for mimicking, activating, antagonizing or inhibiting the activity of the sugar transporter 47 protein.
- a method of compounds comprising utilizing a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a sugar transporter 47 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample. The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of sugar transporter 47.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- Antagonist refers to a protein that, when combined with sugar transporter 47, Molecules that are active in this protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the sugar transporter 47.
- Antagonist refers to a molecule that, when combined with sugar transporter 47, can block or regulate the biological or immunological activity of sugar transporter 47.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind sugar transporter 47.
- Regular refers to a change in the function of sugar transporter 47, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of sugar transporter 47.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify sugar transporter 47 using standard protein purification techniques.
- the substantially pure sugar transporter 47 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the sugar transporter 47 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cl uster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:
- nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in L, (1990) Methods in emzumo ogy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? It can specifically bind to the epitope of sugar transporter 47.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated sugar transporter 47 means that sugar transporter 47 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify sugar transporter 47 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the sugar transporter 47 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide _ _ sugar transporter 47, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, A recombinant polypeptide is preferred.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the sugar transporter 47.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the sugar transporter 47 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such that one or more of the amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ )
- a type in which a mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- IV a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a total nucleotide sequence of 2353 bases and its open reading frame of 102-1391 encodes 429 amino acids. This polypeptide has the characteristic sequence of the sugar transporter family, and it can be deduced that the sugar transporter 47 has the structure and function represented by the sugar transporter family.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DM forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- the DM can be a coding chain or a non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6G ° C; or (2) added during hybridization Use a denaturant, such as 50 ° /. (V / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) only the identity between the two sequences is at least 95%, and more preferably 97% Only when the above hybridization occurs.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding sugar transporter 47.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the sugar transporter 47 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- CDNA library is constructed in a conventional method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989) 0 may be obtained commercially available cDNA library such as cDNA library from Clontech is different.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the transcript of sugar transporter 47; (4) by Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product for detecting the expression of the sugar transporter 47 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, a host cell genetically engineered using the vector of the present invention or directly using a sugar transporter 47 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- the polynucleotide sequence encoding the sugar transporter 47 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct recombinant expression vectors.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding the sugar transporter 47 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, e. T. A. Mo l ecu l a r C l on ing, a Labora tory Manua l, co l d Harbor Labora tory. New York, 1989).
- the DNAcl sequence can be operably linked to a suitable promoter of an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of an enhancer sequence into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a sugar transporter 47 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- 3 ⁇ 4 competent cells such as Escherichia coli host is a prokaryote
- DNA uptake can be harvested after exponential growth phase, treated with CaC l 2 method used in the step are well known in the art.
- the alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- 3 ⁇ 4 The host is a eukaryotic organism, and the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce a recombinant sugar transporter 47 (Science, 1 984; 224: 14 31). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Figure 1 is a comparison of the amino acid sequences of the sugar transporter 47 and the functional domains of the sugar transporter family of the present invention.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated sugar transporter 47.
- 47KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0861d08 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- the results show that the 0861d08 clone contains a full-length cDNA of 2353bp (as shown in Seq IDN0: 1), and has a 1290bp open reading frame (0RF) from 102bp to 1391bp, encoding a new protein (such as Seq ID NO: 2).
- This clone pBS-0861d08 and the encoded protein was named sugar transporter 47.
- Example 2 Domain analysis of cDNA clones
- the sequence of the sugar transporter 47 of the present invention and the protein sequence encoded by the same are used in a profile scan program (Basiclocal Alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10 ], Perform domain analysis in databases such as prote.
- the sugar transporter 47 of the present invention is homologous to the domain sugar transporter family, and the homology results are shown in FIG. 1.
- Example 3 Cloning of the gene encoding sugar transporter 47 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
- PCR amplification was performed with the following primers:
- Primer2 5'- TGTGCAGTGTTTTAATTTATCCAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L C1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DM polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- Amplification products were purified using QIAGEN kits and TA The cloning kit was ligated to a pCR vector (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2353bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of the expression of the sugar transporter 47 gene:
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate ( P 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- the 32P- labeled probe (about 2x l0 6 c P m / ml ) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM H 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant sugar transporter 47
- Priraer3 5'- CATGCTAGCATGGAGGAGGAGGATGAGGAAGCG -3 '(Seq ID No: 5)
- Primer 4 5'- CATGGATCCCTAAGAAACACAGGCAATGAAGAA -3' (Seq ID No: 6)
- These two primers contain Nhel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the PCR reaction was performed using pBS-0861d08 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ l contains 10 pg of pBS-0861d08 plasmid, primers Primer-3 and Primer-4, and 1 J is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5CX using the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. Select positive clones with the correct sequence (pET-0861d08) to transform the recombinant plasmid into the large intestine by calcium chloride method Bacillus BL21 (DE3) p lySs (product of Novagen).
- the host strain BL21 (pET-0861d08) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to the final concentration lmmo l / L , Continue to cultivate for 5 hours.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation, and the supernatant was collected by centrifugation.
- Product was chromatographed to obtain the purified protein sugar transporter 47.
- Polypeptide synthesizer (product of PE company) was used to synthesize the following polypeptides specific for sugar transporter 47:
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. I. Unochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- 'Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods, etc., all of which are used to fix the polynucleotide sample to be tested on the filter and then hybridize using substantially the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is loaded And synthetic polymers.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0. lrag / ml was added).
- CT DNA (calf thymus DNA).
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- the sugar transporter family is found on the membranes of many cells and they are able to complete sugar transport.
- the glycotransporter family is regulated by hormones such as insulin.
- hormones such as insulin.
- sugar transport is under fast or slow hormonal regulation with tissue specificity. For example, when insulin levels increase, muscle tissue and adipose tissue increase significantly. Insulin can increase the liver's utilization of glucose. .
- the polypeptide of the present invention is a polypeptide containing a characteristic sequence of the sugar transporter family. Abnormal expression of the polypeptide will cause abnormal glucose molecules in and out of the cell to affect the internal and external glucose balance of the cell, thereby dysregulating the nutritional metabolism of cells and causing related diseases. .
- the abnormal expression of the sugar transporter 47 of the present invention will produce various diseases, especially disorders of glucose metabolism.
- diseases include, but are not limited to: diabetes, diabetes-related diseases, organic acidemia such as propionic acidemia, Isovaleric acid, glutaric acid type I
- Abnormal expression of the sugar transporter 47 of the present invention will also cause certain hereditary, immune system diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, For example, it can treat various diseases, especially disorders of glucose metabolism, certain hereditary, immune system diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the sugar transporter 4 7.
- Agonists enhance biological functions such as sugar transporter 47 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing sugar transporter 47 can be cultured with labeled sugar transporter 47 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of sugar transporter 47 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of sugar transporter 47 can bind to sugar transporter 47 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- sugar transporter 47 When screening compounds as antagonists, sugar transporter 47 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between sugar transporter 47 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to sugar transporter 47 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 47 molecules of sugar transporter protein should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a sugar transporter 47 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting sugar transporter 47 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to sugar transporter 47 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1 975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
- the chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Mor ri son etal, PNAS, 1985, 81: 6851) 0 only some technical production of single chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against sugar transporter 47.
- Antibodies against sugar transporter 47 can be used in immunohistochemistry to detect sugar transporter 47 in biopsy specimens.
- Monoclonal antibodies that bind to sugar transporter 47 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- High sugar transporter 47 Affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill sugar transporter 47 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to sugar transporter 47.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of sugar transporter 47.
- the invention also relates to a diagnostic test method for quantitative and localized detection of sugar transporter 47 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. Sugar transporter 47 levels measured in the test can be used to explain the importance of sugar transporter 47 in various diseases and to diagnose diseases in which sugar transporter 47 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding sugar transporter 47 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of sugar transporter 47.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated sugar transporter 47 to inhibit endogenous sugar transporter 47 activity.
- a variant sugar transporter 47 may be a shortened sugar transporter 47 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of sugar transporter 47.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a sugar transporter 47 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a sugar transporter 47 can be found in the existing literature (Sambrook, et al.).
- Another recombinant polynucleotide encoding a sugar transporter 47 can be packaged and transferred into liposomes. Into the cell.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit the sugar transporter 47 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can pass through the DNA encoding the RNA The sequences are obtained by in vitro or in vivo transcription.
- This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- Polynucleotides encoding sugar transporter 47 are useful in the diagnosis of diseases related to sugar transporter 47.
- the polynucleotide encoding sugar transporter 47 can be used to detect the expression of sugar transporter 47 or the abnormal expression of sugar transporter 47 in a disease state.
- the DNA sequence encoding sugar transporter 47 can be used to hybridize biopsy specimens to determine the expression of sugar transporter 47.
- Hybridization techniques include Sout hern blotting, Nor t hern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (M i croa rr ay) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues Genetic diagnosis.
- Transcription products of sugar transporter 47 can also be detected by RNA-polymerase chain reaction (RT-PCR) in vitro amplification using sugar transporter 47-specific primers.
- Sugar transporter 47 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type sugar transporter 47 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.
- sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- the important first step is to locate these DNA sequences on the chromosome
- PCR primers (preferably 1 to 35 bp) are prepared based on cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization (FI SH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- Verma et al. Human Chromos ome s: a Manual of Basic Techniques, Pergamon Press, New York (1988).
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Glucose transporter 47 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and range of sugar transporters 47 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU29985/01A AU2998501A (en) | 2000-01-26 | 2001-01-15 | Novel polypeptide---sugar transporter protein 47 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00111500 CN1306971A (zh) | 2000-01-26 | 2000-01-26 | 一种新的多肽——糖转运蛋白47和编码这种多肽的多核苷酸 |
CN00111500.6 | 2000-01-26 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001055422A1 true WO2001055422A1 (fr) | 2001-08-02 |
Family
ID=4581410
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000049 WO2001055422A1 (fr) | 2000-01-26 | 2001-01-15 | Nouveau polypeptide, proteine 47 de transport de sucre, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1306971A (fr) |
AU (1) | AU2998501A (fr) |
WO (1) | WO2001055422A1 (fr) |
-
2000
- 2000-01-26 CN CN 00111500 patent/CN1306971A/zh active Pending
-
2001
- 2001-01-15 WO PCT/CN2001/000049 patent/WO2001055422A1/fr active Application Filing
- 2001-01-15 AU AU29985/01A patent/AU2998501A/en not_active Abandoned
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [online] 27 May 1999 (1999-05-27), NELSON J. ET AL., Database accession no. AAC25800 * |
DATABASE GENBANK [online] 7 May 1999 (1999-05-07), AHN Y.H. ET AL., Database accession no. S68362 * |
Also Published As
Publication number | Publication date |
---|---|
CN1306971A (zh) | 2001-08-08 |
AU2998501A (en) | 2001-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002051867A1 (fr) | Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide | |
WO2002026972A1 (fr) | Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide | |
WO2001090169A1 (fr) | Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide | |
WO2001047968A1 (fr) | Nouveau polypeptide, hexokinase 12, et polynucleotide codant pour ce polypeptide | |
WO2001055422A1 (fr) | Nouveau polypeptide, proteine 47 de transport de sucre, et polynucleotide codant pour ce polypeptide | |
WO2001046240A1 (fr) | Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001085903A2 (fr) | Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide | |
WO2001047983A1 (fr) | Nouveau polypeptide, facteur de liberation de la corticotrophine 13, et polynucleotide codant pour ce polypeptide | |
WO2002026809A1 (fr) | Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide | |
WO2001096572A1 (fr) | Nouveau polypeptide, multi-cuivre oxydase 12, et polynucleotide codant ce polypeptide | |
WO2001049858A1 (fr) | NOUVEAU POLYPEPTIDE, η-GLUTAMYL TRANSPEPTIDASE 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001049724A1 (fr) | Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide | |
WO2001064733A1 (fr) | Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001087953A1 (fr) | Nouveau polypeptide, galactokinase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001074876A1 (fr) | Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001055412A1 (fr) | Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide | |
WO2002020606A1 (fr) | Nouveau polypeptide, la proteine humaine 38.39 liee aux defauts d'audition, et polynucleotide codant pour elle | |
WO2001066575A1 (fr) | Nouveau polypeptide, actine 49, et polynucleotide codant pour ce polypeptide | |
WO2001046424A1 (fr) | Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide | |
WO2002038605A1 (fr) | Nouveau polypeptide, recepteur olfactif 27.61, et polynucleotide codant ce polypeptide | |
WO2001047971A1 (fr) | Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide | |
WO2001049723A1 (fr) | Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide | |
WO2002020585A1 (fr) | Nouveau polypeptide, suppresseur de la transmission de signaux par la cytokine socs-5-29, et polynucleotide codant ce polypeptide | |
WO2001055418A1 (fr) | Nouveau polypeptide, unite de repetition hexapeptidique humaine 20, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
NENP | Non-entry into the national phase |
Ref country code: JP |