WO2001047971A1 - Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001047971A1
WO2001047971A1 PCT/CN2000/000618 CN0000618W WO0147971A1 WO 2001047971 A1 WO2001047971 A1 WO 2001047971A1 CN 0000618 W CN0000618 W CN 0000618W WO 0147971 A1 WO0147971 A1 WO 0147971A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
anion exchange
exchange protein
protein
Prior art date
Application number
PCT/CN2000/000618
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Ltd. Shanghai filed Critical Biowindow Gene Development Ltd. Shanghai
Priority to AU19882/01A priority Critical patent/AU1988201A/en
Publication of WO2001047971A1 publication Critical patent/WO2001047971A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, an anion exchange protein 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique
  • Anion exchange is an intracellular transport function that affects cell pH and cell volume.
  • Anion exchange proteins are a family of proteins composed of functionally related proteins. The protein family has the above-mentioned anion exchange function and mainly maintains the levels of two major anions in the cell: chloride and bicarbonate ions.
  • the most representative anion exchange protein is the band 3 protein, which is an anion membrane glycoprotein of red blood cells.
  • the band 3 protein has approximately 900 amino acids, of which there is a cytoplasmic N-terminal domain of approximately 400 amino acids and a hydrophobic C 'terminus of approximately 400 amino acids containing at least 10 transmembrane regions.
  • the cytoplasmic domain with the 3 protein provides the binding site for cytoskeleton proteins, while the complete membrane domain is responsible for the transport of anions.
  • Band 3 proteins are specific to cell-like cells. At least two proteins that are structurally and functionally similar to band-3 proteins are now found in non-cell-like tissues. These two proteins are AE2 and AE3. AE2 and AE3 are very similar in structure to the band 3 protein, with the main difference being the 300 amino acid residues extended by the N-terminal domain.
  • the first characteristic pattern is a conserved sequence of four positively charged bundles located at the C-terminus of the cytoplasmic domain, just before the transmembrane segment of the first complete domain.
  • the second characteristic pattern is the very conserved sequence of the fifth transmembrane fragment. This conserved sequence includes a lysine, which is the covalent binding site of DIDS, which is an inhibitor of anion exchange proteins.
  • Anion exchange proteins enable red blood cells to act as a bicarbonate carrier produced by respiration, allowing carbon dioxide to be transported from various tissues to the lungs in the form of bicarbonate.
  • the anion exchange protein can regulate the pH of the posterior capillaries.
  • the anion exchange protein 9 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more anion exchange protein 9 proteins involved in these processes, especially The amino acid sequence of this protein was identified. Isolation of the new anion exchange protein 9 protein encoding gene also provides a basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding an anion exchange protein 9.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding an anion exchange protein 9.
  • Another object of the present invention is to provide a method for producing anion exchange protein 9.
  • Another object of the present invention is to provide an antibody against the polypeptide-anion exchange protein 9 of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the anion exchange protein 9 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to an anion exchange protein 9 abnormality.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1 346 to 1591 in SEQ ID NO: 1; and (b) a sequence having 1 in SEQ ID NO. ⁇ 1 -2485-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention.
  • the vector genetically engineered host cell includes a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of anion exchange protein 9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of anion exchange protein 9 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a mutation in a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of anion exchange protein 9.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement means the replacement of a different amino acid or A nucleotide replaces one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with anion exchange protein 9, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the anion exchange protein 9.
  • Antagonist refers to a molecule that, when combined with anion exchange protein 9, can block or regulate the biological or immunological activity of anion exchange protein 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind anion exchange protein 9.
  • Regular refers to a change in the function of anion exchange protein 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of the anion exchange protein 9.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify the anion exchange protein 9 using standard protein purification techniques.
  • the substantially pure anion exchange protein 9 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of the anion exchange protein 9 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244) 0 The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences C lus ter method or by methods known in the art (Hein J., (1990) Methods in emzumo logy 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to the anion exchanger 9 antigenic determinants.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are the same as other substances existing in the natural state. It is separated and purified, and it is isolated and purified.
  • isolated anion exchange protein 9 means that the anion exchange protein 9 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify the anion exchange protein 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the anion exchange protein 9 peptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide _ _ anion exchange protein 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of anion exchange protein 9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the anion exchange protein 9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2485 bases in length and its open reading frame of 1346-1591 encodes 81 amino acids.
  • This polypeptide has the characteristic sequence of the anion exchange protein characteristic sequence, and it can be deduced that the anion exchange protein 9 has the structure and function represented by the anion exchange protein characteristic sequence.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide can be the same as the coding region sequence shown in SEQ ID NO: 1 This is a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F icol 1, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding anion exchange protein 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the anion exchange protein 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences Is the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of anion exchange protein 9 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of the anion exchange protein 9 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or directly using an anion exchange protein 9 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • the polynucleotide sequence encoding the anion exchange protein 9 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Ros enberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression expressed in mammalian cells Vectors (Lee and Na thans, JBio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding an anion exchange protein 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Mo l ecul ar Cl on ing, a Labora tory Manua l, co ld Spr ing Harbor Labora t ory. New York, 1989 ).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding an anion exchange protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • insect cells such as flies S2 or Sf 9
  • animal cells such as CH0, COS or Bowes s melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: & (: Treatment Step 12, the used well known in the art alternative is to use MgC l 2.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection and electroporation , Liposome packaging, etc.
  • polynucleotide sequence of the present invention can be used to express or produce a recombinant anion exchange protein 9 (Scence, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of the amino acid sequence homology of anion exchange protein 9 of the present invention at a total of 46 amino acids from 15 to 60 and the characteristic sequence domain of the anion exchange protein.
  • the upper sequence is anion exchange protein 9 and the lower sequence is an anion exchange protein characteristic sequence domain.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of anion exchange protein 9 isolated.
  • 9KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • the sequence of the anion exchange protein 9 of the present invention and the protein sequence encoded by the anion exchange protein 9 were profiled using the GCG profile scan program (Basiclocal Alignment search tool) [Altschul, SF et al.
  • the anion exchange protein 9 of the present invention is homologous with the domain anion exchange protein characteristic sequence at 15-60, and the homology result is shown in FIG. 1 with a homology rate of 0.34 and a score of 15.49; the threshold value is 15.12.
  • Example 3 Cloning of a gene encoding anion exchange protein 9 by RT-PCR CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5'— CAAAGACAGAAAAGCCGAAGGAAA— 3 '(SEQ ID NO: 3)
  • Primer2 5-GAGCATGCAATTTTTTATTGTTTT-3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a reaction volume of 50 ⁇ 1 , 1U of Taq DNA polymerase (C 1 on Tech).
  • the reaction was performed on a PE 9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2485bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of anion exchange protein 9 gene expression:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant anion exchange protein 9
  • Primer 3 5'- CCCCATATGATGCGGGGAGGGCTGGTGACCTCC- 3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCCTATAAATATTTATTAGTACCTAT- 3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
  • the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • the PCR reaction was performed using the pBS-0009e02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS- 0009e02 plasmid, primers Primer-3 and Primer- 4 points, and 1 J is 10 pmol, Advantage polymerase Mix
  • Cycle parameters 94 ° C 20s, 60 ° C 30s, 68. C 2 mill, a total of 25 cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into Ca. bacillus DH5 ⁇ by the calcium chloride method.
  • a peptide synthesizer (product of PE) was used to synthesize the following anion exchange protein 9-specific peptides: NH 2 -Met-Arg-Gly-Gly-Leu-Val-Thr-Ser-Val-Gly-Leu-Tyr-Val- Gly-Asn- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - "P-dATP) is prepared.
  • pre-hybridization solution 10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immunity. Epidemic diseases, etc.
  • Anion exchange is an intracellular transport function that affects cell pH and cell volume.
  • Anion exchange proteins are a family of proteins composed of functionally related proteins. The protein family has the aforementioned anion exchange function and mainly maintains the levels of two major anions in the cell: chloride and bicarbonate ions.
  • Anion exchange protein family-specific conserved sequences are required to form their active mot i f.
  • anion exchange proteins allow red blood cells to act as a bicarbonate carrier produced by respiration, allowing carbon dioxide to be transported from various tissues to the lungs as bicarbonate.
  • anion exchange proteins can regulate the pH of the posterior capillaries.
  • anion exchange proteins play important roles in the filtration of renal glomeruli, the reabsorption of inorganic salts in renal tubules, and the transport of hepatocyte materials.
  • the abnormal expression of the specific anion exchange protein mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormal bicarbonate ion transport, and further causing abnormal capillary PH values.
  • Renal glomerular filtration and abnormal renal salt reabsorption process can also cause abnormal liver cell mass transport and produce related diseases such as metabolic acidosis, metabolic alkalosis, edema, water poisoning, bile stasis Cirrhosis, cholangitis, biliary cirrhosis, primary biliary cirrhosis, etc.
  • abnormal expression of the anion exchange protein 9 of the present invention will produce various diseases, especially metabolic acidosis, metabolic alkalosis, edema, water poisoning, hyperkalemia, hypokalemia, hypernatremia , Hyponatremia, cholestatic cirrhosis, cholangitis, biliary cirrhosis, primary biliary cirrhosis, hypertension, etc.
  • Abnormal expression of the anion exchange protein 9 of the present invention will also cause certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially metabolic acidosis, metabolic alkalosis, edema, water poisoning, and hyperkalemia.
  • diseases especially metabolic acidosis, metabolic alkalosis, edema, water poisoning, and hyperkalemia.
  • hypokalemia hypernatremia, hyponatremia, cholestatic cirrhosis, cholangitis biliary cirrhosis, primary biliary cirrhosis, hypertension, certain hereditary, blood diseases And immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) anion exchange protein 9.
  • Agonists increase biological functions such as anion exchange protein 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing anion exchange protein 9 can be cultured with labeled anion exchange protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Anion exchange protein 9 antagonists include screened antibodies, compounds, receptor deletions and classes Like things. Anion exchange protein 9 antagonists can bind to anion exchange protein 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • anion exchange protein 9 When screening compounds as antagonists, anion exchange protein 9 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between anion exchange protein 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to anion exchange protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9 molecules of anion exchange protein should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the anion exchange protein 9 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting anion exchange protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies for anion exchange protein 9 include, but are not limited to, hybridoma technology (Kohler and Milstei. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morri et al, PNAS, 1985, 81: 685 1).
  • Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single chain antibodies against anion exchange protein 9.
  • Antibodies to anion exchange protein 9 can be used in immunohistochemistry to detect anion exchange protein 9 in biopsy specimens.
  • Monoclonal antibodies that bind to anion exchange protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • anion exchange protein 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange.
  • This hybrid antibody can be used to kill anion exchange protein 9 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to anion exchange protein 9. Administration of an appropriate dose of antibody can stimulate or block the production or activity of anion exchange protein 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of anion exchange protein 9 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of anion exchange protein 9 detected in the test can be used to explain the importance of anion exchange protein 9 in various diseases and to diagnose diseases in which anion exchange protein 9 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding anion exchange protein 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by anion exchange protein 9 expression or abnormal / inactive expression.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated anion exchange protein 9 to inhibit endogenous anion exchange protein 9 activity.
  • a variant anion exchange protein 9 may be a shortened anion exchange protein 9 lacking a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of anion exchange protein 9.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding anion exchange protein 9 into a cell.
  • viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding anion exchange protein 9 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding anion exchange protein 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit anion exchange protein 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA and DNA and ribozymes are available. Any of the RM or DM synthesis techniques, such as solid-phase phosphate amide chemical synthesis, have been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond rather than the phosphate Ester bond.
  • the polynucleotide encoding anion exchange protein 9 can be used for the diagnosis of diseases related to anion exchange protein 9.
  • the polynucleotide encoding anion exchange protein 9 can be used to detect the expression of anion exchange protein 9 or the abnormal expression of anion exchange protein 9 in a disease state.
  • the DNA sequence encoding anion exchange protein 9 can be used to hybridize biopsy specimens to determine the expression of anion exchange protein 9.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array (Microcroix) or a DM chip (also called a "gene chip"), and used to analyze the differential expression analysis of genes and genes in tissue diagnosis.
  • Anion-exchange protein 9 specific primers can also be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect anion exchange protein 9 transcripts.
  • Detection of mutations in the anion exchange protein 9 gene can also be used to diagnose anion exchange protein 9-related diseases.
  • Anion exchange protein 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type anion exchange protein 9 DNA sequences. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones and metaphase chromosomes allows precise chromosomal localization in one step.
  • FI SH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendeian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Anion exchange protein 9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of anion exchange protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine d'échange anionique 9, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine d'échange anionique 9.
PCT/CN2000/000618 1999-12-24 2000-12-18 Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide WO2001047971A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19882/01A AU1988201A (en) 1999-12-24 2000-12-18 A novel polypeptide - anion exchange protein 9 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99125759 CN1301730A (zh) 1999-12-24 1999-12-24 一种新的多肽——阴离子交换蛋白9和编码这种多肽的多核苷酸
CN99125759.6 1999-12-24

Publications (1)

Publication Number Publication Date
WO2001047971A1 true WO2001047971A1 (fr) 2001-07-05

Family

ID=5284169

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000618 WO2001047971A1 (fr) 1999-12-24 2000-12-18 Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1301730A (fr)
AU (1) AU1988201A (fr)
WO (1) WO2001047971A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997026537A1 (fr) * 1996-01-19 1997-07-24 Research Corporation Technologies, Inc. Methodes pour diagnostiquer la maladie d'alzheimer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997026537A1 (fr) * 1996-01-19 1997-07-24 Research Corporation Technologies, Inc. Methodes pour diagnostiquer la maladie d'alzheimer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ARCH. PATHOL. LAB. MED., vol. 118, no. 7, July 1994 (1994-07-01), pages 702 - 704 *
NIPPON RINSHO, vol. 50, no. 9, September 1992 (1992-09-01), pages 2069 - 2076 *

Also Published As

Publication number Publication date
AU1988201A (en) 2001-07-09
CN1301730A (zh) 2001-07-04

Similar Documents

Publication Publication Date Title
WO2001047971A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001053495A1 (fr) Nouveau polypeptide, ferrodexine 10, et polynucleotide codant pour ce polypeptide
WO2001047983A1 (fr) Nouveau polypeptide, facteur de liberation de la corticotrophine 13, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001049858A1 (fr) NOUVEAU POLYPEPTIDE, η-GLUTAMYL TRANSPEPTIDASE 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001055412A1 (fr) Nouveau polypeptide, phosphoenolpyruvate carboxylase 81, et polynucleotide codant pour ce polypeptide
WO2001040483A1 (fr) Nouveau polypeptide, lipoproteine humaine 105 contenant un domaine de cytochrome c, et polynucleotide codant pour ce polypeptide
WO2001049726A1 (fr) Nouveau polypeptide, recepteur du peptide natriuretique humain 18, et polynucleotide codant pour ce polypeptide
WO2001072983A1 (fr) Nouveau polypeptide, peroxydase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001048207A1 (fr) Nouveau polypeptide, hormone parathyroidienne 9, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001094593A1 (fr) Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001047993A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001055422A1 (fr) Nouveau polypeptide, proteine 47 de transport de sucre, et polynucleotide codant pour ce polypeptide
WO2001083776A1 (fr) Nouveau polypeptide, hormone de croissance humaine 11, et polynucleotide codant pour ce polypeptide
WO2001040288A1 (fr) Nouveau polypeptide, uteroglobine humaine 13, et polynucleotide codant pour ce polypeptide
WO2001046424A1 (fr) Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide
WO2001070994A1 (fr) Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001081534A2 (fr) Nouveau polypeptide, oxydoreductase 2fe-2s humaine 12, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP