WO2001053492A1 - Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001053492A1 WO2001053492A1 PCT/CN2001/000022 CN0100022W WO0153492A1 WO 2001053492 A1 WO2001053492 A1 WO 2001053492A1 CN 0100022 W CN0100022 W CN 0100022W WO 0153492 A1 WO0153492 A1 WO 0153492A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- adenosylmethionine synthetase
- sequence
- adenosylmethionine
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, S-adenosylmethionine synthetase 31, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
- S-adenosylmethionine synthetase (Ado-Met_synt) is an enzyme that can catalyze the synthesis of S-adenosylmethionine (Ado-Met) and triphosphate (pppi) by methionine and ATP And it is also accompanied by the hydrolysis of pppi into ppi and pi, which plays a very important role in the normal cell function, and ATP and pppi can prevent the inactivation of the enzyme.
- Ado-Met_synt is an enzyme that can catalyze the synthesis of S-adenosylmethionine (Ado-Met) and triphosphate (pppi) by methionine and ATP And it is also accompanied by the hydrolysis of pppi into ppi and pi, which plays a very important role in the normal cell function, and ATP and pppi can prevent the inactivation of the enzyme.
- S-adenosylmethionine synthetase In bacteria, s-adenosylmethionine synthetase has only a single paraiodoanisole (gene metK), two in developing yeast (genes SAM1 and SAM2 respectively), and in plants And mammals usually contain a multi-gene family.
- the sequence of the S-adenosylmethionine synthetase family is more conservative. There are typically two highly conserved amino acid sequences. The first is a hexapeptide structure. , Which is the ATP binding sequence: Gly— Xaa— Gly— Xaa— Gly and Lys residues; the other is the most conserved, it is a nine-peptide structure rich in Gly. Except for the ATP-binding site of the enzyme in E. coli, other synthetases are very conserved. S-adenosylmethionine synthetase has almost the same number of amino
- S-adenosylmethionine synthetase contains four identical subunits. Each two subunits combine to form a spherical dimer. Each dimer has two active sites and is located in two subunits. In the middle of the group, ATP is hydrolyzed to ADP and Pi by this enzyme, and K + and Mg2 + are essential metal ions during the reaction. The conformation of the enzyme combined with ADP hardly changes, and Arg at the active site is very important for the separation of pppi from ATP and the localization of pppi at the active site.
- liver-specific and non-liver-specific (usually kidney) synthetases In mammals, there are two forms of S-adenosylmethionine synthetase, liver-specific and non-liver-specific (usually kidney) synthetases.
- Northern blot analysis showed that: normal liver only expressed liver-specific S-adenosylmethionine synthase activity, while HepG2 cells and HuH-7 cells only expressed non-specific S-adenosylmethionine synthetase activity, The lack of liver-specific S-adenosylmethionine synthetase is not due to a lack of a gene, but to a defective gene transcription.
- PT-PCR reverse transcription polymerase chain reaction
- S-adenosylmethionine synthase 31 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more involved in these processes.
- S-adenosylmethionine synthetase 31 protein particularly the amino acid sequence of this protein is identified.
- the isolation of the novel S-adenosylmethionine synthase 31 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- An object of the present invention is to provide an isolated novel polypeptide, S-adenosylmethionine synthetase 31, and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding S-adenosylmethionine synthetase 31.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding S-adenosylmethionine synthetase 31.
- Another object of the present invention is to provide a method for producing S-adenosylmethionine synthetase 31.
- Another object of the present invention is to provide an antibody against the polypeptide S-adenosylmethionine synthetase 31 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the S-adenosylmethionine synthetase 31 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of S-adenosylmethionine synthetase 31.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 301-4140 in SEQ ID NO: 1; and (b) a sequence having 1- in SEQ ID NO: 1 2883-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of S-adenosylmethionine synthetase 31 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of S-adenosylmethionine synthetase 31 protein in vitro, which comprises detecting the polypeptide in a biological sample or its coding polynucleotide sequence. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for the treatment of cancer, developmental or immune diseases, or other drugs caused by abnormal expression of S-adenosylmethionine synthetase 31. use.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with S-adenosylmethionine synthetase 31, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind S-adenosylmethionine synthetase 31.
- Antagonist refers to a biological activity or immunity that can block or modulate S-adenosylmethionine synthetase 31 when combined with S-adenosylmethionine synthetase 31 Chemically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind S-adenosylmethionine synthase 31.
- Regular refers to a change in the function of S-adenosylmethionine synthetase 31, including an increase or decrease in protein activity, a change in binding characteristics, and any other organism of S-adenosylmethionine synthetase 31 Changes in nature, function, or immunity.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify S-adenosylmethionine synthesis using standard protein purification techniques. Enzyme 31. A substantially pure S-adenosylmethionine synthetase 31 produces a single main band on a non-reducing polyacrylamide gel. The purity of the S-adenosylmethionine synthetase 31 polypeptide is available Amino acid sequence analysis.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou t he rn blot or Nor t he rn blot, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other specifically Sexual or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method arranges each group of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645). 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, Which specifically bind to the epitope of S-adenosylmethionine synthetase 31.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not in its natural environment Ingredients, they are still separate.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated S-adenosylmethionine synthetase 31 means that S-adenosylmethionine synthetase 31 is substantially free of other proteins, lipids, carbohydrates, or others that are naturally associated with it. substance. Those skilled in the art can purify S-adenosylmethionine synthetase 31 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the S-adenosylmethionine synthetase 31 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, S-adenosylmethionine synthetase 31, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of S-adenosylmethionine synthetase 31.
- fragment As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of the S-adenosylmethionine synthetase 31 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2883 bases and its open reading frame 304-1140 encodes 278 amino acids.
- This peptide With the characteristic sequence of a member of the adenosylmethionine synthase family, it can be deduced that the S-adenosylmethionine synthetase 31 has the scab and function represented by the adenosylmethionine synthase family member.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding S-adenosylmethionine synthetase 31.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding S-adenosylmethionine synthetase 31 of the present invention can be used in a variety of ways. Method to obtain.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of transcripts of S-adenosylmethionine synthetase 31 (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 5Q nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the S-adenosylmethionine synthetase 31 gene.
- ELISA enzyme-linked immunosorbent assay
- a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments can be used It is determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using the S-adenosylmethionine synthetase 31 coding sequence, and the present invention is produced by recombinant technology A method of inventing the polypeptide.
- a polynucleotide sequence encoding S-adenosylmethionine synthetase 31 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding S-adenosylmethionine synthetase 31 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide for selection
- selectable marker genes to provide for selection
- the phenotypic traits of transformed host cells such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
- GFP green fluorescent protein
- a polynucleotide encoding S-adenosylmethionine synthetase 31 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
- Host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S 2 or S f 9 animal cells
- animal cells such as CH0, COS or Bowes s melanoma Cells etc.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant S-adenosylmethionine synthetase 31 (Scence, 1984; 224: 14 31). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromat
- Fig. 1 is a comparison diagram of the amino acid sequences of functional domains of the S-adenosylmethionine synthetase 31 and members of the adenosylmethionine synthase family of the present invention.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated S-adenosylmethionine synthetase 31.
- 31KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- the present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.
- Example 1 Cloning of S-adenosylmethionine synthetase 31
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one clone 0591bl0 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- the 0591bl0 clone contains a full-length cDNA of 2883bp (as shown in Seq IDN0: l), and has a 837bp open reading frame (0RF) from 304bp to 1140bp, encoding a new protein (such as Seq ID NO: 2).
- This clone pBS-0591blO and the encoded protein was named S-adenosylmethionine synthetase 31.
- Example 2 Domain analysis of cDNA clones
- the sequence of the S-adenosylmethionine synthetase 31 and the protein sequence encoded by the invention are The profile scan program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] performs domain analysis in databases such as Prote. Present invention
- S-adenosylmethionine synthetase 31 is homologous to members of the domain adenosylmethionine synthase family, and the results of the homology are shown in FIG. Example 3: Cloning of a gene encoding S-adenosylmethionine synthetase 31 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- GGTGTTTTCATTTTCTCGTCTAAC -3 '(SEQ ID NO: 3)
- Primer2 5'- AAGGAATGTTTGAATTTTATTGTA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume , 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the l-2883bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of S-adenosylmethionine synthase 31 gene expression:
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- the 32P- labeled probe (approximately 2 X 10 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, place the filter on Wash in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant S-adenosylmethionine synthetase 31
- Primer3 5'- CATGCTAGCATGCCTCATGATGCAATTATCTTA -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTCAGACATTTTTCCTATTTCTCAG -3' (Seq ID No: 6)
- the Nhel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3) Enzyme site.
- a PCR reaction was performed using the pBS-0591M0 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing pBS- 0591bl0 plasmid 10pg, 3
- Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0591blO) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (Novagen) using the calcium chloride method.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Sou thern imprinting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 1 8-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Probes 1 3 ⁇ l Probe (0.1OD / 10 ⁇ 1), add 2 ⁇ IKinase buffer, 8-10 uCi y- 2 P-dATP + 2U Kinase, to make up to a final volume of 20 ⁇ 1.
- pre-hybridization solution 10xDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and a Cartesian 7500 spotter (purchased from Cartesian, USA) was used to spot the glass medium. The distance is 280 ⁇ !. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyur i dine 5'-tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue, using a fluorescent reagent
- Cy5dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:
- the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- Scanner purchased from General Scanning Company, USA
- the scanned image was processed by Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The point where the ratio is less than 0.5 and greater than 2 is considered. Genes with differential expression.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- S-adenosylmethionine synthetase can catalyze the synthesis of S-adenosylmethionine (Ado-Met) and triphosphate (pppi) by methionine and ATP.
- Ado-Met S-adenosylmethionine
- pppi triphosphate
- the hydrolysis of pppi into ppi and pi plays a very important role in normal cell function, and ATP and pppi can prevent enzyme inactivation.
- S-adenosylmethionine is an important methyl supplier of transmethylation and a supplier of propylamine in polyamine biosynthesis.
- liver-specific and non-liver-specific (usually kidney) synthetases are present in mammals. Normal liver only expresses liver-specific S-adenosylmethionine synthetase activity, while HepG2 cells and HuH-7 cells only express non-specific S-adenosylmethionine synthetase activity, liver-specific S-adenosyl
- the lack of aglycosylmethionine synthetase is not due to a lack of genes, but to a defective gene transcription.
- PT-PCR reverse transcription polymerase chain reaction
- the polypeptide of the present invention is a poly'peptide containing a characteristic sequence of the s-adenosylmethionine synthase family, and abnormal expression thereof will cause S-adenosylmethionine synthesis, transmethylation, and polyamine biosynthesis Abnormalities, especially in liver and kidney tissue, and related diseases such as liver and kidney disease, Parkinson's disease, and sulfur amino acid metabolism deficiency disease.
- the abnormal expression of the S-adenosylmethionine synthetase 31 of the present invention will produce various diseases, especially liver disease, kidney disease, Parkinson's disease, and sulfur-containing amino acid metabolism deficiency diseases. These diseases include but not limited to:
- Liver diseases viral hepatitis, cirrhosis such as biliary cirrhosis, pigmented cirrhosis, benign liver tumors, primary liver cancer, liver cysts, focal nodular hyperplasia
- Kidney Disease Glomerulonephritis, Nephrotic Syndrome, Tubuloacidosis', Interstitial Glomerulonephritis, Cortical Tubular Adenoma, Glomerular Cell Tumor, Polycystic Nephroma, Renal Cell Carcinoma, Nephrosarcoma-like carcinoma, papillary renal cell carcinoma, nephroblastoma
- Abnormal expression of the S-adenosylmethionine synthetase 31 of the present invention will also produce certain hereditary, immune system diseases, and the like.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of diseases, for example, it can treat various diseases, especially liver disease, kidney disease, Parkinson's disease, sulfur-containing amino acid metabolism deficiency disease, Certain hereditary, immune system diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) S-adenosylmethionine synthetase 3 1.
- Agonists increase S-adenosylmethionine synthetase 3 1 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing S-adenosylmethionine synthetase 31 can be cultured with labeled S-adenosylmethionine synthetase 31 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of S-adenosylmethionine synthetase 31 include antibodies, compounds, receptor deletions, and the like that have been screened.
- the antagonist of S-adenosylmethionine synthetase 31 can bind to S-adenosylmethionine synthetase 3 1 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Dot binding prevents the polypeptide from functioning biologically.
- S-adenosylmethionine synthetase 31 can be added to the bioanalytical assay, by measuring the compound between S-adenosylmethionine synthetase 3 1 and its receptor. The effects of interactions determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Able to interact with S-adenosylmethionine synthase 3 1 The bound polypeptide molecules can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the S-adenosylmethionine synthetase 31 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the S-adenosylmethionine synthetase 31 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting S-adenosylmethionine synthase 31 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like.
- Techniques for preparing monoclonal antibodies to S-adenosylmethionine synthetase 31 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, EBV-hybridoma technology, etc.
- Inlay antibodies that combine human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U. S. Pat No. 4946778, can also be used to produce single chain antibodies against S-adenosylmethionine synthase 31.
- Antibodies against S-adenosylmethionine synthetase 31 can be used in immunohistochemical techniques to detect S-adenosylmethionine synthetase 31 in biopsy specimens.
- Monoclonal antibodies that bind to S-adenosylmethionine synthetase 31 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as S-adenosylmethionine synthetase 31.
- High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill S-adenosylmethionine synthesis Enzyme 31 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to S-adenosylmethionine synthetase 31.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of S-adenosylmethionine synthetase 31.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of S-adenosylmethionine synthase 31.
- diagnostic test method for quantitatively and locally detecting the level of S-adenosylmethionine synthase 31.
- These tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of S-adenosylmethionine synthase 31 detected in the test can be used to explain the importance of S-adenosylmethionine synthetase 31 in various diseases and to diagnose S-adenosine A Diseases where methionine synthase 31 works Sick.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding S-adenosylmethionine synthetase 31 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of S-adenosylmethionine synthase 31.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant S-adenosylmethionine synthetase 31 to inhibit endogenous S-adenosylmethionine synthetase 31 activity.
- a variant S-adenosylmethionine synthetase 31 may be a shortened S-adenosylmethionine synthetase 31 lacking a signaling domain, although it can bind to a downstream substrate, However, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of S-adenosylmethionine synthetase 31.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
- a recombinant viral vector carrying a polynucleotide encoding S-adenosylmethionine synthetase 31 can be found in the existing literature (Samb rook, et al.).
- a recombinant polynucleotide encoding S-adenosylmethionine synthetase 31 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides that inhibit S-adenosylmethionine synthetase 31 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme that specifically breaks down specific RNAs Like RNA molecules, the mechanism of action is that the ribozyme molecule and the complementary target RNA specifically hybridize and perform endonucleation.
- Antisense RNA and DNA and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as solid phase The technology of phosphate amide chemical synthesis for oligonucleotide synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of the DM sequence encoding the RNA. This DNA sequence has been integrated into the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding S-adenosylmethionine synthetase 31 can be used for the diagnosis of diseases related to S-adenosylmethionine synthetase 31.
- a polynucleotide encoding S-adenosylmethionine synthase 31 can be used to detect the expression of S-adenosylmethionine synthetase 31 or S-adenosylmethionine synthesis in a disease state Abnormal expression of enzyme 31.
- a DNA sequence encoding S-adenosylmethionine synthetase 31 can be used to hybridize biopsy specimens to determine the expression of S-adenosylmethionine synthetase 31.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
- S-adenosylmethionine synthetase 31 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of S-adenosylmethionine synthetase 31.
- RT-PCR RNA-polymerase chain reaction
- S-adenosylmethionine synthetase 31 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type S-adenosylmethionine synthetase 31 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- S-adenosylmethionine synthetase 31 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of S-adenosylmethionine synthetase 31 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001229960A AU2001229960A1 (en) | 2000-01-21 | 2001-01-15 | A novel polypeptide, s-adenosylmethionine synthetase 31 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00111474 CN1307103A (zh) | 2000-01-21 | 2000-01-21 | 一种新的多肽——s-腺苷甲硫氨酸合成酶31和编码这种多肽的多核苷酸 |
CN00111474.3 | 2000-01-21 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001053492A1 true WO2001053492A1 (fr) | 2001-07-26 |
Family
ID=4581384
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000022 WO2001053492A1 (fr) | 2000-01-21 | 2001-01-15 | Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1307103A (fr) |
AU (1) | AU2001229960A1 (fr) |
WO (1) | WO2001053492A1 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106831994A (zh) * | 2017-03-15 | 2017-06-13 | 艾比玛特医药科技(上海)有限公司 | 一种s‑腺苷蛋氨酸合成酶的单克隆抗体及其应用 |
-
2000
- 2000-01-21 CN CN 00111474 patent/CN1307103A/zh active Pending
-
2001
- 2001-01-15 AU AU2001229960A patent/AU2001229960A1/en not_active Abandoned
- 2001-01-15 WO PCT/CN2001/000022 patent/WO2001053492A1/fr active Application Filing
Non-Patent Citations (5)
Title |
---|
DATABASE GENBANK [online] 1 November 1999 (1999-11-01), Database accession no. AF173559 * |
DATABASE GENBANK [online] 4 December 1993 (1993-12-04), Database accession no. S66038 * |
GENOME RES, vol. 8, no. 11, November 1998 (1998-11-01), pages 1097 - 1108 * |
MOL. PLANT MICROBE INTERACT., vol. 6, no. 4, 1993, pages 495 - 506 * |
SCIENCE, vol. 275, no. 5303, 21 February 1997 (1997-02-21), pages 1051 - 1052 * |
Also Published As
Publication number | Publication date |
---|---|
AU2001229960A1 (en) | 2001-07-31 |
CN1307103A (zh) | 2001-08-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001053492A1 (fr) | Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide | |
WO2001055404A1 (fr) | Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide | |
WO2001066707A1 (fr) | Nouveau polypeptide, serine protease humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001072983A1 (fr) | Nouveau polypeptide, peroxydase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001046430A1 (fr) | Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide | |
WO2001066575A1 (fr) | Nouveau polypeptide, actine 49, et polynucleotide codant pour ce polypeptide | |
WO2001079434A2 (fr) | Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001075125A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001085923A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide | |
WO2001046409A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide | |
WO2001070795A1 (fr) | Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001070994A1 (fr) | Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001049732A1 (fr) | Nouveau polypeptide, transglutaminase 10, et polynucleotide codant pour ce polypeptide | |
WO2001046253A1 (fr) | Nouveau polypeptide, calcitonine 11, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001047995A1 (fr) | Nouveau polypeptide, dioxygenase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001070779A1 (fr) | Nouveau polypeptide, proteine humaine 12 de type cdc4, et polynucleotide codant pour ce polypeptide | |
WO2001047993A1 (fr) | Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide | |
WO2001075007A2 (fr) | Nouveau polypeptide, tyrosinase 15, et polynucléotide codant pour ce polypeptide | |
WO2001048219A1 (fr) | Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide | |
WO2001068685A1 (fr) | Nouveau polypeptide, proteine humaine propre au sperme em1, em6-48, et polynucleotide codant pour ce polypeptide | |
WO2001047982A1 (fr) | Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |