WO2001075024A2 - Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001075024A2 WO2001075024A2 PCT/CN2001/000368 CN0100368W WO0175024A2 WO 2001075024 A2 WO2001075024 A2 WO 2001075024A2 CN 0100368 W CN0100368 W CN 0100368W WO 0175024 A2 WO0175024 A2 WO 0175024A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- related factor
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human NF-E2 related factor 1 3, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- Transcriptional regulatory factor NF-E2 is an important regulator of cytoplasmic specific expression of bilirubin deaminase gene cells. NF-E2 regulates the transcription and expression of related genes by combining with some specific cell-like genes in vivo.
- the NF-E2 protein consists of two subunits, P 4 5 and MafK.
- the subunit is a member of the CNC protein family, and its protein sequence contains a leucine zipper domain, which is a highly conserved sequence motif in the CNC protein family. This structural motif is contained in many mammalian transcription factors, which may be an important active center for proteins to exert normal physiological activities.
- the other component subunit of NF-E2 protein is composed of small Maf proteins. These proteins are members of the proto-oncogene protein family. Their mutations or abnormal expression may be closely related to tumors and cancers in related tissues in the body. Related.
- NF-E2 transcriptional regulators NF-E2
- the subunit of its small Maf protein contains a structural motif that recognizes a DNA fragment. It is called the Maf recognition element MARE and consists of the following conserved sequence fragments: TGCTGA (G / C) TCAGCA or TGCTGACGTCAGCA;
- NF-E2 The amino acid sequence of the protein also contains highly conserved sequence fragments as shown below: TGCTGA (G / C) TCA (T / C), the sequence fragment protein-DNA regulatory center that regulates protein-DNA binding activity.
- TGCTGA G / C
- TCA T / C
- the above two conserved sequence fragments work synergistically during protein interactions and regulate gene transcription and expression by binding to specific DNA.
- This protein is highly expressed in both B-cell and single-cell lines, which may be related to the expression of genes related to the immune system. Its abnormal expression may cause the related immune system to function abnormally, that is, trigger various related diseases.
- NF-E2 related factor 3 (Nrf 3). This gene encodes a 73KDa protein, which is a new component of the NF-E2 protein. Its amino acid sequence also contains the highly conserved leucine zipper domain of the CNC protein family. This gene is located at the 7P14-15 locus of the human chromosome and is similar to other members of the CNC protein family. These The proteins are distributed near the HOX gene cluster.
- NF-E2 related factor 3 (Nrf3) has similar structural characteristics and similar physiological functions as other members of the family.
- This protein has a high expression level in B cells and various single cell lines, and it may play an important regulatory role in the development and function of B cells.
- the mutation or abnormal expression of this protein will lead to abnormal development and function of related cells, which are usually closely related to the occurrence of various related immune system disorders, tumors and cancers of related tissues in the body.
- the human NF-E2 related factor 13 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these Process of the human NF-E2-related factor 13 protein, especially the amino acid sequence of this protein is identified. Isolation of the NF-E2-related factor 13 protein encoding genes for newcomers also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the diagnosis and / or treatment of a disease, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human NF-E2 related factor 13.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human NF-E2 related factor 13.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human NF-E2 related factor 1 3.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human NF-E2-related factor 1 3.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID D NO: 1
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human NF-E2 related factor 13 protein activity, which comprises utilizing the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human NF-E2 related factor 1 3 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection and immune diseases and various types of inflammation or other human NF-E2-related factors ⁇ Use of medicines for diseases caused by abnormalities.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human NF-E 2 related factor 1 3, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human NF-E2 related factor 1 3.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human NF-E2-related factor 13 when combined with human NF-E2-related factor 13.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that binds human NF-E 2 related factor 1 3.
- Regular refers to a change in the function of human NF-E2 related factor 1 3, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human NF-E2 related factor 1 3 Change of nature.
- substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human NF-E2-related factor 13 using standard protein purification techniques.
- a substantially pure human NF-E2 related factor 13 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human NF-E2 related factor 13 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Cluster method arranges groups of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences is calculated by the following formula: The number of matching residues between sequence A and sequence X X 100 The number of residues in sequence A-the interval residue in sequence A The number of spacer residues in radix-sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645 ).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine And alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b,) 2 and F V, which specifically binds to human NF-E2-related factor antigen determinant 13.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human NF-E2 related factor 1 3 means human NF-E2 related factor 1 3 is substantially free of other proteins, lipids, sugars or other substances naturally associated with it.
- Those skilled in the art can purify human NF-E2-related factors 1 3 using standard protein purification techniques.
- Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
- the purity of human NF-E2-related factor 1 3 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, a human NF-E2 related factor 1 3, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human NF-E2 related factor 1 3.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human NF-E2 related factor 1 3 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or UI) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- a mature polypeptide such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2497 bases in length and its open reading frame 1 368-1 724 encodes 118 amino acids.
- this peptide has a similar expression profile with human NF-E2 related factor 3, and it can be deduced that the human NF-E2 related factor 1 3 has similar functions as human NF-E2 related factor 3.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include c DNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is a polynucleotide A replacement form, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes.
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only the identity between the two sequences is at least Crosses occur at 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human NF-E2 related factor 13.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human NF-E2 related factor 13 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating a cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human NF-E2-related factor 13; ( 4) through immunological techniques or determination of biological activity, To detect gene-expressed protein products.
- the above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human NF-E2 related factor 13 gene.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human NF-E2 related factor 13 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.
- a polynucleotide sequence encoding human NF-E2 related factor 13 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- DNA containing human NF-E2-related factor 13 An expression vector of sequences and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human NF-E2 related factor 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human NF-E2 related factor 13 (Science, 1984; 224: 1431). Generally there are the following: Step:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- FIG. 1 is a comparison diagram of gene chip expression profiles of NF-E2 related factor 13 and human NF-E2 related factor 3 of the present invention.
- the upper graph is a graph of the expression profile of human NF-E2 related factor 13, and the lower graph is the graph of expression profile of human NF-E2 related factor 3.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates unstarved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 P A-
- 10 means ECV304 PMA +
- 1] means fetal liver
- 2 means normal liver
- 3 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 Indicates the spleen
- 20 indicates the prostate
- 21 indicates the fetal heart
- 22 indicates the heart
- 23 indicates muscle
- 24 indicates testes
- 25 indicates fetal thymus
- 26 indicates thymus.
- the figure shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human NF-E2 related factor 13. 13KDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene), and 2ug poly (A) mRNA was reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0450g01 was new DNA.
- the inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primer 1 5,-GGGGGGAGATGTCCTAACCCACTC -3, (SEQ ID NO: 3)
- Primer2 5,-TCACGTGGGTTACTTTTTAAAAAG-3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l of ol / L C1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U of Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72. C 2min.
- ⁇ -actin was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that PCR produced The DNA sequence of the product is identical to that of 1-2497bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human NF-E2-related factor 13 gene expression:
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the human NF-E2 related factor 13 coding region sequence (1368bp to 1724bp) amplified by PCR as shown in FIG. 1.
- Primer3 5,-CCCCATATGATGGGGTTTCACCATGTTGGCCAG -3, (Seq ID No: 5)
- Priraer4 5'- CATGGATCCTCACCTGAGGTTGGGAGTTCGAGG -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BaniHI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
- the Ndel and BaniHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
- the pBS-0450g01 plasmid containing the full-length target gene was used as a template for the PCR reaction.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0450g01 plasmid, P ⁇ ime ⁇ -3 and Prime ⁇ -4 were 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 niin, 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into bacillus DH5cc with calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following specific peptides of human NF-E2-related factor 1 3:
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes, and Incubation hybridizes the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and a Cartesian 7500 spotter (purchased from Cartesian, USA) was used to spot the glass medium. The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. Its specific method steps There have been many reports in the literature. The post-spotting processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5'- tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl- 2'- deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
- Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5'- tr iphate coupled to Cy3 fluorescent dye
- the probes from the two types of tissues and the chip were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000.
- the instrument purchased from General Scanning Company, USA
- the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immune diseases.
- Transcriptional regulatory factor NF-E2 is an important regulator of cytoplasmic specific expression of the bilirubin deaminase gene cell. NF-E2 regulates the transcription and expression of related genes by combining with certain cell-like genes in vivo. Mutations or abnormal expression of its constituent subunits may be closely related to the occurrence of tumors and cancers in related tissues in the body. In addition, NF-E2 protein is highly expressed in B cells and single cell lines, which may be related to the expression of genes related to the immune system. Its abnormal expression may cause the related immune system to function abnormally, which may cause various related diseases.
- NF-E2 belongs to the CNC protein family
- NF-E2 related factor 3 Nrf 3
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human NF-E2 related factor 3, and both have similar biological functions. It is involved in the transcriptional regulation of genes in the body, and is involved in the regulation of immune system function and cell proliferation and division. Its abnormal expression is usually closely related to embryonic developmental disorders, abnormal cell proliferation and division, inflammation and related tissue tumors and cancer. And produce related diseases.
- polypeptides of the present invention are homologous proteins and contain family-specific sequences, and both have similar biological functions. It has a variety of important functions in the body, regulating the transport of various proteins and substances in the body, and its abnormal expression is usually related to some disorders of substance metabolism disorders, disorders of protein metabolism disorders and related tissue tumors and cancer It is closely related and produces related diseases.
- the abnormal expression of the human NF-E2 related factor 13 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include but are not Limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, growth and development disorders: mental development Retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- the abnormal expression of the human NF-E2 related factor 1 3 of the present invention will also produce certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human NF-E2 related factors 1 3.
- Agonists enhance human NF-E2-related factors 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human NF-E2-related factor 13 can be cultured with labeled human NF-E2-related factor 13 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of human NF-E2 related factor 13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human NF-E2-related factor 1 3 can bind to human NF-E2-related factor 1 3 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
- human NF-E2-related factor 13 When screening compounds as antagonists, human NF-E2-related factor 13 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human NF-E2-related factor 13 and its receptor Whether it is an antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human NF-E2 related factors 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human NF-E2-related factor 13 molecules should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human NF-E2 related factor 13 epitope. These antibodies include (but are not limited to): many Cloned antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human NF-E2 related factor 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies against human NF-E2 related factor 13 include, but are not limited to, hybridoma technology (Kohlcr and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human NF-E2 related
- Antibodies against human NF-E2 related factor 13 can be used in immunohistochemical techniques to detect human NF-E2 related factor 13 in biopsy specimens.
- Monoclonal antibodies that bind to human NF-E2 related factor 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human NF-E2 related factors 13 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human NF-E2 related factor 13 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human NF-E2 related factor 13.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human NF-E2-related factor 13.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human NF-E2 related factor 13.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human NF-E2 related factor 13 detected in the test can be used to explain the importance of human NF-E2 related factor 13 in various diseases and to diagnose diseases in which human NF-E2 related factor 13 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human NF-E2 related factor 13 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human NF-E2-related factor 13.
- Recombinant gene therapy vectors (such as viral vectors) can be designed for expression Mutated human NF-E2 related factor 13 to inhibit endogenous human NF-E2 related factor 13 activity.
- a variant human NF-E2 related factor 13 may be a shortened human NF-E2 related factor 13 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human NF-E2 related factor 13.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human NF-E2-related factor 13 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human NF-E2 related factor 13 can be found in existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human NF-E2 related factor 13 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human NF-E2 related factor 13 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human NF-E2 related factor 13 can be used for the diagnosis of diseases related to human NF-E2 related factor 13.
- the polynucleotide encoding human NF-E2 related factor 13 can be used to detect the expression of human NF-E2 related factor 13 or the abnormal expression of human NF-E2 related factor 13 in a disease state.
- the DNA sequence encoding human NF-E2 related factor 13 can be used to hybridize biopsy specimens to determine the expression of human NF-E2 related factor 13.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
- Human NF-E2-related factor 13 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human NF-E2-related factor 13 transcription products.
- Human NF-E2 related factor 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human NF-E2 related factor 13 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, MendeHan Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human NF-E 2 related factor 1 3 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human NF-E 2 related factor 1 3 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU56051/01A AU5605101A (en) | 2000-03-22 | 2001-03-19 | A novel polypeptide, nf-e2-associated human factor 13 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115024.3 | 2000-03-22 | ||
CN00115024A CN1314383A (zh) | 2000-03-22 | 2000-03-22 | 一种新的多肽——人nf-e2相关因子13和编码这种多肽的多核苷酸 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075024A2 true WO2001075024A2 (fr) | 2001-10-11 |
WO2001075024A3 WO2001075024A3 (fr) | 2002-04-04 |
Family
ID=4584495
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000368 WO2001075024A2 (fr) | 2000-03-22 | 2001-03-19 | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1314383A (fr) |
AU (1) | AU5605101A (fr) |
WO (1) | WO2001075024A2 (fr) |
-
2000
- 2000-03-22 CN CN00115024A patent/CN1314383A/zh active Pending
-
2001
- 2001-03-19 AU AU56051/01A patent/AU5605101A/en not_active Abandoned
- 2001-03-19 WO PCT/CN2001/000368 patent/WO2001075024A2/fr active Application Filing
Non-Patent Citations (3)
Title |
---|
CHAN J.Y. ET AL.: 'Chromosomal localization of the human NF-E2 family of bZIP transcription factors by fluorescence in situ hybridization' HUM. GENET. vol. 95, no. 3, 1995, pages 265 - 269 * |
CLAVERIE J.M.: 'Identifying coding exons by similarity search: alu-derived and other potentially misleading protein sequences' GENOMICS vol. 12, no. 4, 1992, pages 838 - 841 * |
MOI P. ET AL.: 'Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region' PROC. NATL. ACAD. SCI. USA vol. 91, no. 21, 1994, pages 9926 - 9930 * |
Also Published As
Publication number | Publication date |
---|---|
CN1314383A (zh) | 2001-09-26 |
AU5605101A (en) | 2001-10-15 |
WO2001075024A3 (fr) | 2002-04-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001072790A1 (fr) | Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide | |
WO2001079424A2 (fr) | Nouveau polypeptide, facteur humaine de couplage d'atpase mitochondriale 6-10, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001072986A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001081395A1 (fr) | Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide | |
WO2001081537A2 (fr) | Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001081592A1 (fr) | Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide | |
WO2001074998A2 (fr) | Nouveau polypeptide, proteine humaine de regulation 10 de la serine proteinase, et polynucleotide codant pour ce polypeptide | |
WO2001071000A1 (fr) | Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001081536A2 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001070960A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001079430A2 (fr) | Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001048001A1 (fr) | Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide | |
WO2001079437A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide | |
WO2001066728A1 (fr) | Nouveau polypeptide, proteine humaine 11 du gene de reparation de mesappariement de l'adn, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |