WO2001068689A1 - Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001068689A1
WO2001068689A1 PCT/CN2001/000164 CN0100164W WO0168689A1 WO 2001068689 A1 WO2001068689 A1 WO 2001068689A1 CN 0100164 W CN0100164 W CN 0100164W WO 0168689 A1 WO0168689 A1 WO 0168689A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
subunit
inducible factor
human hypoxia
Prior art date
Application number
PCT/CN2001/000164
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU42222/01A priority Critical patent/AU4222201A/en
Publication of WO2001068689A1 publication Critical patent/WO2001068689A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human hypoxia-inducible factor la l pha subunit 13, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • hypoxia-inducible factor 1 protein complex is an important transcriptional regulatory factor in the transcription and expression of these proteins, which regulates the expression of these proteins in vivo, and The protein complex is also necessary for the cardiovascular development of the body and for maintaining the stability of the environment within the system.
  • an organism wants to transcribe and express various related proteins under hypoxic conditions, it first synthesizes a large number of hypoxia-inducible factor 1 protein complexes to regulate the expression of various genes [S. Morwenna Wood, Mi chael S. et a l. , 1998, J Biol. Chem., 273: 8360-8368] 0
  • Hypoxia-inducible factor 1 protein complex is constitutively expressed in organisms, and only expressed in cells with low oxygen content to regulate the expression of related genes.
  • the protein complex is composed of two bHLH proteins, and its constituent subunits will be rapidly catalyzed by ubiquitin-proteasomes in cells with normal oxygen content; and low oxygen and metal ions (such as cobalt, nickel, and magnesium) ), Iron chelates and various antioxidants can help maintain the stability and activity of protein complexes in vivo [V. Sr in i va s, X. Zhu eta l., 1998, J Bio l. Chem., 273: 18019-18022].
  • HIF1A is a gene encoding the hypoxia-inducible factor-1 protein complex alpha subunit. The protein encoded by this gene is involved in regulating the transcription of various hypoxia-expressed proteins in the body.
  • Iyer et al. Cloned a new HIF1A gene from humans, which has high homology with known HIF genes and has similar functions. Studies have found that the structure, function, and regulatory mechanism of HIF1A protein are also conservative in evolution.
  • hypoxia-inducible factor 1 complex and its subunit HIF1A play an important role in the expression and regulation of organism-related genes.
  • the mutation or abnormal expression of this protein will cause abnormalities in related genes and metabolic pathways in the organism, such as abnormal glucose metabolism pathways, abnormal development of the cardiovascular system, etc., and then cause various related diseases.
  • This protein is usually closely related to the occurrence of some cardiovascular development disorders, sugar metabolism disorders, internal environmental imbalances, chronic hypoxia and various related material metabolic disorders in the body.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of the human hypoxia-inducible factor la lpha subunit, so the functions of the two may also be similar.
  • the present invention is named la l pha subunit 13 of human hypoxia inducible factor.
  • the human hypoxia-inducible factor la lpha subunit 13 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, it has been necessary to identify more proteins in the field. Many human hypoxia-inducible factor la l pha subunit 13 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human hypoxia-inducible factor la l pha subunit 13 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs, so isolating its coding DNA is important. Object of the invention
  • An object of the present invention is to provide an isolated novel polypeptide, the human hypoxia-inducible factor la l pha subunit 13, and fragments, analogs, and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human hypoxia-inducible factor la l pha subunit 13.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human hypoxia-inducible factor la1 pha subunit 13.
  • Another object of the present invention is to provide a human hypoxia-inducible factor 1 a 1 pha directed against the polypeptide of the present invention.
  • Subunit 13 mimics, antagonists, agonists, inhibitors.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of human hypoxia-inducible factor l a l pha subunit 1 3.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 144 to 494 in SEQ ID NO: 1; and (b) a sequence having positions 1 to 1531 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human hypoxia-inducible factor la l pha subunit 13 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of the human hypoxia-inducible factor la l pha subunit 13 protein, which comprises detecting the polypeptide or a sequence encoding the polynucleotide in a biological sample. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of red blood cell diseases, blood diseases, cardiovascular diseases, substance metabolism disorders, various tumors, inflammation, immune diseases, development disorders, HIV infection Or use of other medicines caused by abnormal expression of human hypoxia-inducible factor la l pha subunit 13.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the human hypoxia inducible factor la l pha subunit 13 and human hypoxia inducible factor la l pha subunit.
  • the upper graph is a graph of the expression profile of the human hypoxia-inducible factor la l pha subunit 13
  • the lower graph is the graph of the expression profile of the human hypoxia-inducible factor la l pha subunit 13.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human hypoxia-inducible factor la l pha subunit 13. 13KDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bio activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human hypoxia-inducible factor lalpha subunit 13, can cause changes in the protein and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human hypoxia-inducible factor alpha 1 subunit 13.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human hypoxia-inducing factor lalpha subunit 13 when combined with human hypoxia-inducing factor lalpha subunit 13.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human hypoxia-inducing factor lalpha subunit 13.
  • Regular refers to changes in the function of human hypoxia-inducible factor lalpha subunit 13, including the increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of human hypoxia-inducible factor lalpha subunit 13. Or changes in immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human hypoxia-inducible factor lalpha subunit 13 using standard protein purification techniques.
  • the substantially pure human hypoxia inducible factor lalpha subunit 13 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human hypoxia-inducible factor lalpha subunit 13 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
  • the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
  • the Cluster method divides each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. Two amino acid sequences such as The percent identity between sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence ⁇
  • the number of residues in the sequence ⁇ -the number of spacer residues in the sequence-the number of spacer residues X in the sequence can also be determined by the Cluster method or by a method known in the art such as Jotun He in. in J., (1990) Me thods in enzymo logy 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human hypoxia-inducible factor la l pha subunit 13.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human hypoxia-inducing factor lal pha subunit 13 means that human hypoxia-inducing factor lal pha subunit 13 is substantially free of other proteins, lipids, sugars, or other Matter. Those skilled in the art can purify human hypoxia inducible factor lalpha subunit 13 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human hypoxia inducible factor lalpha subunit 13 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human hypoxia-inducible factor lalpha subunit 13, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human hypoxia-inducible factor lalpha subunit 13.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human hypoxia inducible factor lalpha subunit 13 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused to the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, and their derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1,531 bases, and its open reading frames 144-494 encode 116 amino acids.
  • this peptide has a similar expression profile to the human hypoxia-inducible factor lalpha subunit, and it can be deduced that the human hypoxia-inducible factor lalpha subunit 13 has a similar function to the human hypoxia-inducible factor lalpha subunit .
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region shown in SEQ ID NO: 1
  • the sequences are identical or degenerate variants.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human hypoxia-inducible factor l a lpha subunit 13.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human hypoxia-inducible factor la l pha subunit 13 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the human hypoxia-inducible factor lalpha subunit 13 transcript (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by the human hypoxia-inducible factor lalpha subunit 13 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using DNA technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain full-length cDNA Sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human hypoxia-inducible factor la l pha subunit 13 coding sequence, and the present invention is produced by recombinant technology Methods of the polypeptide.
  • a polynucleotide sequence encoding the human hypoxia-inducible factor la lpha subunit 13 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing the D sequence encoding the human hypoxia-inducible factor la l pha subunit 13 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, e. T. A. Mol. Clonal, a Labora tory Manua, Co. d. Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP Fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding the human hypoxia-inducible factor la lpha subunit 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human hypoxia-inducible factor la l pha subunit 13 (Sc ience, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • hypoxia-inducible factor 1 protein complex is an important transcriptional regulatory factor in the transcription and expression of these proteins, which regulates the expression of these proteins in vivo, and The protein complex is also necessary for the cardiovascular development of the body and for maintaining the stability of the environment within the system.
  • an organism wants to transcribe and express various related proteins under hypoxic conditions, it first synthesizes a large number of hypoxia-inducible factor 1 protein complexes to regulate the expression of various genes.
  • hypoxia-inducible factor 1 protein complexes are easily catalyzed by ubiquitin-proteasomes in cells with normal oxygen content, while hypoxia, metal ions (such as cobalt, nickel, magnesium, etc.) and iron chelation in the body Substances and various antioxidants can help maintain the stability and activity of protein complexes in the body.
  • the cloned human hypoxia inducible factor 1 protein complex subunit HIF1A protein is mainly responsible for regulating the transcription and expression of genes under various hypoxic conditions in the body, and plays a role in the development of the cardiovascular system of the organism and the maintenance of internal environment stability Important regulatory role.
  • the expression level of the protein complex subunit in the body is too low, which may cause the transcription inhibition of related genes, which may cause various related metabolic disorders.
  • the excessive expression may also be caused by chronic hypoxia in the body. main reason.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human hypoxia-inducible factor 1 alpha subunit, and both have similar biological functions. It acts on a class of hypoxia-induced factors in the body, such as erythropoietin, endothelin, glucose transporters and glycolytic enzymes, which are of great significance for regulating the expression of such proteins, and their abnormal expression is usually associated with the aforementioned tissue proteins. Physiological abnormalities, such as red blood cell disease, blood disease, cardiovascular disease, material metabolic disorder, and tumorigenesis are closely related.
  • the abnormal expression of the human hypoxia-inducible factor la l pha subunit 13 of the present invention will produce various diseases, especially red blood cell disease, blood disease, cardiovascular disease, material metabolic disorder, various tumors, and embryonic development disorders.
  • Disease, growth disorders, inflammation, immune diseases, these diseases include but are not limited to:
  • Hematopathy Aplastic Anemia, Myelopathic Anemia, Malignant Anemia, Erythrocytosis, Hereditary Oval Cytomegaly, Leukopenia and Agranulocytosis, Leukemia-Response, etc., Leukemia, Lymphoma, Idiopathic Thrombocytopenic purpura, thrombocytosis, disseminated intravascular coagulation cardiovascular disease: coronary heart disease, myocardial infarction, atherosclerosis Substance Metabolism Disorders: Isovalerate, Propionate, Methylmalonic Aciduria, Defective Combined Carboxylase, Glutaric Acid Type I, Phenylketonuria, Albinism, Ray-niney Syndrome , Congenital lactose intolerance, hereditary fructose intolerance, galactosemia, defective fructose metabolism, glycogen storage disease
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
  • Inflammation .. Chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the human hypoxia-inducible factor la l pha subunit 13 of the present invention will also produce certain hereditary, hematological diseases, and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially red blood cell diseases, blood diseases, cardiovascular diseases, substance metabolism disorders, various tumors. , Embryonic disorders, growth disorders, inflammation, immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the human hypoxia inducer la l pha subunit 13.
  • Agonists increase the human hypoxia-inducible factor la l pha subunit 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human hypoxia inducible factor la1 l pha subunit 13 can be cultured with labeled human hypoxia inducible factor la 1 l pha subunit 13 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human hypoxia-inducible factor la l pha subunit 13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human hypoxia-inducible factor la l pha subunit 13 can interact with human hypoxia The inducing factor lalpha subunit 13 binds and eliminates its function, or inhibits the production of the polypeptide, or binds to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • human hypoxia inducible factor lalpha subunit 13 When screening compounds as antagonists, human hypoxia inducible factor lalpha subunit 13 can be added to the bioanalytical assay by determining the effect of the compound on the interaction between human hypoxia inducible factor lalpha subunit 13 and its receptor. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human hypoxia-inducible factor lalpha subunit 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the human hypoxia-inducible factor lalpha subunit 13 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the human hypoxia-inducible factor lalpha subunit 13 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human hypoxia-inducible factor lalpha subunit 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies to human hypoxia-inducible factor lalpha subunit 13 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, and human B-cell hybridoma technology , EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human hypoxia inducible factor lalpha subunit 13.
  • Antibodies to human hypoxia-inducible factor lalpha subunit 13 can be used in immunohistochemical techniques to detect human hypoxia-inducible factor lalpha 13 in biopsy specimens.
  • Monoclonal antibodies that bind to human hypoxia-inducible factor lalpha subunit 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human hypoxia inducible factor lalpha subunit 13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human hypoxia-inducible factor lalpha subunit 13 Positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human hypoxia-inducible factor lalpha subunit 13. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human hypoxia-inducible factor lalpha subunit 13.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human hypoxia inducible factor lalpha subunit 13.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human hypoxia inducible factor lalpha subunit 13 detected in the test can be used to explain the importance of human hypoxia inducible factor lalpha subunit 13 in various diseases and to diagnose human hypoxia inducible factor lalpha subunit 13 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • human hypoxia-inducible factor lalpha subunit 13 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human hypoxia-inducible factor lalpha subunit 13.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human hypoxia-inducing factor lalpha subunit 13, in order to inhibit endogenous human hypoxia-inducing factor lalpha subunit 13 activity.
  • a mutated human hypoxia-inducible factor lalpha subunit 13 may be a shortened human hypoxia-inducible factor lalpha subunit 13, which lacks a signaling functional domain.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human hypoxia-inducible factor lalpha subunit 13.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the human hypoxia-inducible factor lalpha subunit 13 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding the human hypoxia inducible factor lalpha subunit 13 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human hypoxia inducible factor lalpha subunit 13 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human hypoxia-inducible factor lalpha subunit 13 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be encoded by The DNA sequence of the RNA is obtained by transcription in vitro or in vivo. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human hypoxia-inducible factor lalpha subunit 13 can be used for the diagnosis of diseases related to human hypoxia-inducible factor lalpha subunit 13.
  • the polynucleotide encoding human hypoxia-inducible factor lalpha subunit 13 can be used to detect the expression of human hypoxia-inducible factor lalpha subunit 13 or the abnormal expression of human hypoxia-inducible factor lalpha subunit 13 in a disease state.
  • the DM sequence encoding human hypoxia-inducing factor lalpha subunit 13 can be used to hybridize biopsy specimens to determine the expression of human hypoxia-inducing factor lalpha subunit 13.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • Human hypoxia inducible factor lalpha subunit 13 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of human hypoxia inducible factor lalpha subunit 13.
  • Human hypoxia-inducible factor lalpha subunit 13 gene mutations can also be used to diagnose human hypoxia-induced factor lalpha subunit 13-related diseases.
  • Human hypoxia-inducible factor lalpha subunit 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human hypoxia-inducible factor lalpha subunit 13 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include protozoa Position hybridization, chromosome pre-screening using hybrid flow sorting and pre-selection of hybridization to construct a chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human hypoxia inducible factor lalpha subunit 13 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human hypoxia inducible factor lalpha subunit 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit purchased from Clontech
  • Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) to determine the 5 'and 3' ends of all clones. Compare the determined cDNA sequence with the existing public DM sequence database (Genebank), It was found that the cDNA sequence of one of the clones 0285f05 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • Primerl 5 — TGCCCAAGCTGGTCTCAAAGTGCT -3, (SEQ ID NO: 3)
  • Primer2 5'- GACAGAATCTCCCTGTGTTGCCCA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10 mmol / L Tris-HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerization in a 50 ⁇ 1 reaction volume Enzyme (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72 ° C 2min 0 During RT-PCR, ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • Amplification products were purified using QIAGEN kits and TA The cloning kit was ligated to a pCR vector (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1531bp shown in SEQ ID NO: 1.
  • Example 3 Analysis of human hypoxia inducible factor lalpha subunit 13 gene expression by Northern blotting method Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidine thiocyanate phenol-chloroform extraction mention.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( ⁇ 7.4)-5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 minutes. Then, it was washed with Phosphor Imager was analyzed and quantified.
  • Example 4 In vitro expression, isolation and purification of recombinant human hypoxia inducible factor lalpha subunit 13 According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification Primers, the sequence is as follows:
  • Priraer3 5,-CCCCATATGATGTCAGGCACCATGCTTGTTGCT -3, (Seq ID No: 5)
  • Primer4 5,-CATGGATCCTCACCATGTTGGCCAGGTTTGTCT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0285f05 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0285f05 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET_28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5c by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were selected by colony PCR method and sequenced. The correct positive clone (PET-0285f05) Granules were transformed into E. coli BL21 (DE3) plySs (product of Novagen).
  • a peptide synthesizer (product of PE company) was used to synthesize the following human hypoxia-inducible factor la l pha subunit 13-specific peptides:
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all fix the polynucleotide sample to be tested on After filtering on the membrane, hybridization was performed using essentially the same procedure.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements for homology comparison of the regions, if the homology with the non-target molecular region is greater than 851 ⁇ 2 or there are more than 15 consecutive bases, the primary selection probe should generally not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene chip or gene micro-matrix (DM Mi croarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases, such as genetic diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to D to fix the slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5— Amino— propargyl— 2'— deoxyuridine 5'— triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 2'-deoxyuridine 5 '-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP 5— Amino— propargyl— 2'— deoxyuridine 5'— triphate coupled to Cy3 fluorescent dye (purchased from Amersham Pham
  • Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une 1alpha sous-unité 13 humaine du facteur adaptatif de l'hypoxie, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de l'érythropathie, de l'hémopathie, de l'angiocardiopathie, des troubles du métabolisme, de toutes sortes de tumeurs, des inflammations, des maladies immunitaires, des troubles du développement et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'1alpha sous-unité 13 humaine du facteur adaptatif de l'hypoxie.
PCT/CN2001/000164 2000-03-15 2001-02-26 Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide WO2001068689A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU42222/01A AU4222201A (en) 2000-03-15 2001-02-26 A novel polypeptide, human hypoxia-inducible factor 1 alpha subunit 13 and the polynucleotide encoding thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00114908.3 2000-03-15
CN 00114908 CN1313324A (zh) 2000-03-15 2000-03-15 一种新的多肽——人低氧诱导因子lalpha亚基13和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001068689A1 true WO2001068689A1 (fr) 2001-09-20

Family

ID=4584383

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000164 WO2001068689A1 (fr) 2000-03-15 2001-02-26 Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1313324A (fr)
AU (1) AU4222201A (fr)
WO (1) WO2001068689A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003074560A3 (fr) * 2002-03-05 2004-07-22 Angiogenetics Sweden Ab Residus critiques du facteur de transcription « -1alpha d'hypoxie inductible», produits et methodes associes
WO2006084210A3 (fr) * 2005-02-04 2007-04-19 Univ California San Diego Composes modulant le hif et methodes d'utilisation associees

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103007293B (zh) * 2012-12-30 2014-04-02 中国人民解放军第三军医大学第一附属医院 具有靶向性的多肽-基因复合物及其制备方法和应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
IYER N.V. ET AL.: "The human hypoxia-inducible factor 1alpha gene: HIF1A structure and evolutionary conservation", GENOMICS, vol. 52, no. 2, 1 September 1998 (1998-09-01), pages 159 - 165 *
SEMENZA G.L. ET AL.: "Assignment of the hypoxia-inducible factor 1alpha gene to a region of conserved synteny on mouse chromosome 12 and human chromosome 14q", GENOMICS, vol. 34, no. 3, 15 June 1996 (1996-06-15), pages 3948 - 3952 *
ZHONG H. ET AL.: "Overexpression of hypoxia-inducible factor 1alpha in common human cancers and their metastases", CANCER RES., vol. 59, no. 22, 15 November 1999 (1999-11-15), pages 5830 - 5835 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003074560A3 (fr) * 2002-03-05 2004-07-22 Angiogenetics Sweden Ab Residus critiques du facteur de transcription « -1alpha d'hypoxie inductible», produits et methodes associes
WO2006084210A3 (fr) * 2005-02-04 2007-04-19 Univ California San Diego Composes modulant le hif et methodes d'utilisation associees

Also Published As

Publication number Publication date
AU4222201A (en) 2001-09-24
CN1313324A (zh) 2001-09-19

Similar Documents

Publication Publication Date Title
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001068694A1 (fr) Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide
WO2001083688A2 (fr) Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001079430A2 (fr) Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide
WO2001072810A1 (fr) Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide
WO2001077165A1 (fr) Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001073008A1 (fr) Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide
WO2001081536A2 (fr) Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001048219A1 (fr) Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide
WO2001075029A2 (fr) Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001072788A1 (fr) Nouveau polypeptide, pterine-molybdene oxydoreductase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001072794A1 (fr) Nouveau polypeptide, helicase 16, et polynucleotide codant pour ce polypeptide
WO2001070960A1 (fr) Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP