WO2001074995A2 - Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001074995A2
WO2001074995A2 PCT/CN2001/000230 CN0100230W WO0174995A2 WO 2001074995 A2 WO2001074995 A2 WO 2001074995A2 CN 0100230 W CN0100230 W CN 0100230W WO 0174995 A2 WO0174995 A2 WO 0174995A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
mutant protein
ataxia
sequence
Prior art date
Application number
PCT/CN2001/000230
Other languages
English (en)
Chinese (zh)
Other versions
WO2001074995A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU89277/01A priority Critical patent/AU8927701A/en
Publication of WO2001074995A2 publication Critical patent/WO2001074995A2/fr
Publication of WO2001074995A3 publication Critical patent/WO2001074995A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention belongs to the field of biotechnology, and specifically, the present invention describes a new polypeptide, ataxia-capillary telangiectasia mutant protein 15, and a polynucleotide sequence encoding the polypeptide.
  • the invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Ataxia-telangiectasia is a recessive disorder of frequently chromosomal body. Symptoms are ataxia of the cerebellum, telangiectasia, a defective immune system, and susceptibility to malignant tumors (especially leukemia and lymphoma). Chromosomes are often broken and inverted. Chromosome 7 and chromosome 14 are often translocated. Other symptoms include premature aging and endocrine abnormalities. AT cells are more likely to die than normal cells when exposed to ionizing radiation. ⁇ Genome Res 1997 Jim; 7 (6): 592- 605 ⁇
  • Ataxia-capillary vasodilation is caused by mutations in ataxia-capillary telangiectasia mutation gene (ATM, mutated in A-T). This gene is located on chromosomes llq22-q23. ATM gene products play a role in the regulation of the cell cycle and also play a role in the response to DNA damage. A-T heterozygotes are susceptible to tumors, especially breast cancer in women. [Cancer Res 1996 Sep 15; 56 (18): 4130-3]
  • the human ataxia-telangiectasia mutant protein 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art. Identify more people involved in these processes ataxia-capillary Angiotensin mutein 15 protein, especially the amino acid sequence of this protein is identified. Isolation of the ataxia-capillary telangiectasia mutant protein 15 protein gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ataxia-capillary telangiectasia mutant protein 15.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human ataxia-capillary telangiectasia mutant protein 15.
  • Another object of the present invention is to provide a method for producing human ataxia-capillary telangiectasia mutant protein 15.
  • Another object of the present invention is to provide an antibody against the human ataxia-capillary telangiectasia mutant protein 15 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the ataxia-capillary telangiectasia mutant protein 15 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human ataxia-telangiectasia mutant protein 15.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • (C) A polynucleotide having at least 70% identity to the polynucleotide sequence of (a) or (b).
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID D NO: 1
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
  • the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ataxia-capillary telangiectasia mutein 15 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human ataxia-capillary telangiectasia mutant protein 15 in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of ataxia-capillary telangiectasia, breast cancer, various tumors, embryonic developmental disorders, growth disorders, immune diseases, Use of inflammation, hematopathy, HIV infection or other diseases caused by abnormal expression of human ataxia-telangiectasia mutant protein 15.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement means the replacement of a different amino acid or A nucleotide replaces one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human ataxia-capillary telangiectasia mutant protein 15 can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to human ataxia-capillary telangiectasia mutant protein 15.
  • Antagonist refers to an organism that can block or regulate human ataxia-capillary telangiectasia mutant protein 15 when combined with human ataxia-capillary telangiectasia mutant protein 15 Molecularly active or immunologically active molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human ataxia-capillary telangiectasia mutant protein 15.
  • Regular refers to a change in the function of human ataxia-capillary telangiectasia mutant protein 15 including an increase or decrease in protein activity, changes in binding properties, and human ataxia-capillary telangiectasia mutant protein 15. Any other biological, functional or immune change.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ataxia-capillary vasodilation using standard protein purification techniques.
  • Mutein 15 Essentially pure human ataxia-capillary telangiectasia mutant protein 15 produces a single main band on a non-reducing polyacrylamide gel. Human ataxia-capillary telangiectasia mutant protein 15 peptide The purity can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sout hern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGAU GN program (Lasergene software package, DNASTAR, Inc., Mad son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in erazumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human ataxia-telangiectasia mutant protein 15.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated means that the substance is separated from its original environment (if it is natural Natural material, the original environment is the natural environment).
  • natural Natural material the original environment is the natural environment.
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human ataxia-capillary telangiectasia mutant protein 15 refers to human ataxia-capillary telangiectasia mutant protein 15 which is substantially free of other proteins, lipids, and sugars naturally associated with it Or other substances.
  • Those skilled in the art can purify human ataxia-telangiectasia mutant protein 15 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human ataxia-capillary telangiectasia mutant protein 15 can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, ataxia-capillary telangiectasia mutant protein 15, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human ataxia-capillary telangiectasia mutant protein 15.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ataxia-capillary telangiectasia mutant protein 15 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (in) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
  • an additional amino acid sequence is fused into the mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • Polynucleotides of the invention are found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1462 bases in length and its open reading frame 1007-1258 encodes 139 amino acids.
  • this peptide is ataxia-capillary dilatation with human
  • the protein product of the mutated mutant gene has a similar expression profile, and it can be deduced that the human ataxia-capillary telangiectasia mutant protein 15 has similar functions to the protein product of the human ataxia-capillary telangiectasia mutant gene.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DM.
  • MA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or ( 2 ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the "acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleic acid fragments It can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ataxia-capillary telangiectasia mutant protein 15. The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human ataxia-telangiectasia mutant protein 15 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the leg sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-MA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of transcription of human ataxia-capillary telangiectasia mutant protein 15 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human ataxia-telangiectasia mutant protein 15 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (EL ISA). Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (EL ISA). Wait.
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human ataxia-capillary telangiectasia mutant protein 15 coding sequence, and the recombinant technology to produce A method of inventing the polypeptide.
  • a polynucleotide sequence encoding human ataxia-capillary vasodilatation mutant protein 15 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ataxia-capillary telangiectasia mutant protein 15 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant MA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, late on the origin of replication Polyoma enhancer and adenovirus enhancer on one side.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ataxia-capillary vasodilation mutant protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a gene containing the polynucleotide or the recombinant vector.
  • Engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl, the steps used are well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ataxia-capillary telangiectasia mutant protein 15 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide or variant
  • encoding human ataxia-telangiectasia mutant protein 15 of the present invention or a suitable host transformed or transduced with a recombinant expression vector containing the polynucleotide Cell
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, it can be separated by various separation methods using its physical, chemical and other properties. Isolate and purify the recombinant protein. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the protein product of the ataxia-capillary telangiectasia mutant protein 15 and the human ataxia-capillary telangiectasia mutant gene of the present invention.
  • the upper figure is a graph of the expression profile of the human ataxia-capillary vasodilation mutant protein 15.
  • the lower sequence is the graph of the expression profile of the protein product of the human ataxia-capillary vasodilation mutant gene.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human ataxia-telangiectasia mutant protein 15.
  • 15KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ⁇ fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Eimer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 062b09, was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • Example 2 Cloning of the gene encoding human ataxia-capillary telangiectasia mutant protein 15 by RT-PCR method Using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction to synthesize cDNA.
  • PCR amplification was performed with the following primers:
  • Primerl 5,-GAATGTGGTCATGTCATTTCTAGA -3, (SEQ ID NO: 3)
  • Priraer2 5,-AAAGCCAACATTTATTATATGTAC -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10mniol / L Tris-CI, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR (3-act in is the positive control and the template blank is the negative control.
  • the amplified product is purified using QIAGEN's kit, and the TA cloning kit is connected to the PCR vector (Invitrogen's product).
  • DNA The sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1462bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ataxia-capillary telangiectasia mutant protein 15 gene expression:
  • RNA extraction using a one-step method includes acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M acetic acid Sodium (pH4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 Volume) and the mixture was centrifuged to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the DNA probe used was the PCR amplified human ataxia-capillary telangiectasia mutant protein 15 coding region sequence (1007bp to 1258bp) shown in Figure 1.
  • a 32P-labeled probe (about 2 x 10 6 c P m / ral) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1 ° /. SDS at 55 ° C 30 min. Phosphor Imager was then used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human ataxia-telangiectasia mutant protein 15 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers was designed, The sequence is as follows:
  • Primer 3 5'- CCCCATATGATGGGAACTGGTTATTTTATTTTC —3, (Seq ID No: 5)
  • Primer4 5 a CCCGAATTCTTATCTTGAAGAGAGAAAACTG-3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ndel and BamH I restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28 b (+) (Novagen product, Cat. No. 69865.3).
  • the PCR reaction was performed using the pBS-0062b09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are as follows: a total volume of 50 ⁇ l contains 10 pg of pBS- 0062b09 plasmid, Primer-3 and Primer-4, and 1 J is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5CC using the calcium chloride method.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following human ataxia-telangiectasia mutant protein 15 specific peptides:
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • unhybridized probes are removed by a series of membrane washes.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences The column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • prehybridization solution 10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM).
  • Example 7 DNA Microarray Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of different full-length cDNAs were prepared as the target DM, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ !. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip.
  • the specific method steps have been variously reported in the literature, and the post-spotting processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5- Amino- propargy 2'- deoxyuridine 5'- triphate cou led to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech
  • Cy5dUTP 5- Amino- propargyl- 2'- deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA- Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Ataxia-Capillary telangiectasia is an autosomal recessive disorder with symptoms such as ataxia of the cerebellum, telangiectasia, defective immune system, and susceptibility to malignant tumors (especially leukemia and lymphoma).
  • Ataxia-Capillary vasodilation is caused by ataxia-Capillary telangiectasia mutation (ATM, mutated in A-T) mutation.
  • ATM gene products play a role in the regulation of the cell cycle and also play a role in the response to DNA damage.
  • A-T heterozygotes are susceptible to tumors, especially breast cancer in women.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the protein product of the human ataxia-telangiectasia mutant gene, and both have similar biological functions. It has a variety of important functions in the body, mainly regulating the physiological functions of various tissues and organs in the body such as the immune system, cell proliferation, cerebellum, capillaries, etc. Abnormal expression will cause abnormalities in the above-mentioned tissue cells and cause related diseases.
  • the abnormal expression of the human ataxia-capillary telangiectasia mutant protein 15 will produce various diseases, especially ataxia-capillary telangiectasia, breast cancer, various tumors, embryonic developmental disorders, Growth disorders, immune diseases, inflammation, these diseases include but are not limited to: Tumors of various tissues: breast cancer, stomach cancer, liver cancer, lung cancer, esophageal cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion,
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Immune diseases common variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, primary T lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome, systemic lupus erythematosus, rheumatoid arthritis,
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • the abnormal expression of the human ataxia-telangiectasia mutant protein 15 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially ataxia-capillary vasodilation, breast cancer, various tumors, and embryo development. Disorders, growth disorders, immune disorders, inflammation, certain hereditary, hematological diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ataxia-capillary telangiectasia mutant protein 15. Agonists enhance human ataxia-capillary vasodilator mutant protein 15 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human ataxia-capillary telangiectasia mutant protein 15 can be cultured with a labeled human ataxia-capillary telangiectasia mutant protein 15 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human ataxia-telangiectasia mutant protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human ataxia-capillary telangiectasia mutant protein 15 can bind to human ataxia-capillary telangiectasia mutant protein 15 and eliminate its function, or inhibit the production of the polypeptide, or with the polypeptide Binding of the active site prevents the polypeptide from performing biological functions can.
  • human ataxia-capillary vasodilatation mutant protein 15 can be added to the bioanalytical assay. The effect of this interaction is used to determine whether the compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human ataxia-capillary telangiectasia mutant protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 15 molecules of ataxia-telangiectasia mutant protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human ataxia-capillary telangiectasia mutant protein 15 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of human ataxia-capillary telangiectasia mutant protein 15 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human ataxia-telangiectasia mutant protein 15 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human ataxia-capillary telangiectasia mutant protein 15.
  • Anti-human ataxia-telangiectasia mutant protein 15 antibody can be used in immunohistochemical techniques to detect human ataxia-telangiectasia mutant protein 15 in biopsy specimens.
  • Monoclonal antibodies that bind to human ataxia-telangiectasia mutant protein 15 can also be labeled with radioactive isotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ataxia-capillary vasodilation Mutein 15 positive cells.
  • the antibodies in the present invention can be used to treat or prevent ataxia-capillary telangiectasia mutant eggs White 15 related diseases. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ataxia-telangiectasia mutant protein 15.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting human ataxia-capillary vasodilation mutant protein level 15.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • Human ataxia-capillary telangiectasia mutant protein 15 levels detected in the test can be used to explain the importance of human ataxia-capillary telangiectasia mutant protein 15 in various diseases and to diagnose human ataxia Dysregulation-A disease in which telangiectasia mutant protein 15 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human ataxia-capillary telangiectasia mutant protein 15 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by human ataxia-capillary telangiectasia mutant protein 15 expression or abnormal / inactive expression. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human ataxia-capillary telangiectasia mutant protein 15 to inhibit endogenous human ataxia-capillary telangiectasia mutant protein 1 5 active.
  • a variant human ataxia-telangiectasia mutant protein 15 may be a shortened human ataxia-telangiectasia mutant protein 15 that lacks a signaling domain, although it may interact with downstream substrates. Binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of ataxia-telangiectasia mutant protein 15.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 15 into cells .
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ataxia-capillary telangiectasia mutant protein 15 can be found in the existing literature (Sambrook, et al.).
  • a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 15 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit human ataxia-telangiectasia mutant protein 15 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific A. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • the daughter can be obtained by in vitro or in vivo transcription of the DNA sequence encoding the RM.
  • This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 15 can be used for diagnosis of diseases related to human ataxia-capillary telangiectasia mutant protein 15.
  • a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 15 can be used to detect the expression of human ataxia-capillary telangiectasia mutant protein 15 or human ataxia-capillary telangiectasia in a disease state Aberrant Expression of Mutant Protein 1-5.
  • a DNA sequence encoding human ataxia-capillary telangiectasia mutant protein 15 can be used to hybridize biopsy specimens to determine the expression of human ataxia-capillary telangiectasia mutant protein 15.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human ataxia-telangiectasia mutant protein 15 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human ataxia-telangiectasia mutant protein 15 transcription product.
  • Human ataxia-capillary telangiectasia mutant protein 15 mutations can also be used to diagnose human ataxia-capillary telangiectasia mutant protein 15-related diseases.
  • Human ataxia-capillary telangiectasia mutant protein 15 mutant forms include point mutations, translocations, deletions, recombinations and any other mutations compared to normal wild-type human ataxia-capillary telangiectasia mutant protein 1 5 DNA sequences Exception, etc. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • sublocalization can be achieved by a similar method using a set of fragments from a specific chromosome or a large number of genomic clones.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the cDNA or genomic sequence differences between the affected and the affected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and diseased individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ataxia-telangiectasia mutant protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ataxia-capillary vasodilator mutein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de mutation 15 de l'ataxie telangiectasie, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de l'ataxie telangiectasie, du cancer du sein, des tumeurs malignes, des troubles du développement de l'embryon, des troubles de la croissance, de maladies immunitaires, d'inflammations, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine de mutation 15 de l'ataxie telangiectasie.
PCT/CN2001/000230 2000-03-02 2001-02-26 Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide WO2001074995A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU89277/01A AU8927701A (en) 2000-03-02 2001-02-26 A novel polypeptide, human mutation protein 15 of the telangiectasy ataxia and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00111825 CN1311219A (zh) 2000-03-02 2000-03-02 一种新的多肽——人共济失调－毛细血管扩张症突变蛋白15和编码这种多肽的多核苷酸
CN00111825.0 2000-03-02

Publications (2)

Publication Number Publication Date
WO2001074995A2 true WO2001074995A2 (fr) 2001-10-11
WO2001074995A3 WO2001074995A3 (fr) 2002-06-06

Family

ID=4581721

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000230 WO2001074995A2 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311219A (fr)
AU (1) AU8927701A (fr)
WO (1) WO2001074995A2 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CLIN. GENET. vol. 55, no. 5, 1999, pages 289 - 304 *
HUM. MUTAT. vol. 10, no. 2, 1997, pages 100 - 107 *
INT. J. BIOCHEM. CELL. BIOL. vol. 31, no. 7, 1999, pages 735 - 740 *
J. CLIN. IMMUNOL. vol. 16, no. 5, 1996, pages 254 - 260 *

Also Published As

Publication number Publication date
CN1311219A (zh) 2001-09-05
AU8927701A (en) 2001-10-15
WO2001074995A3 (fr) 2002-06-06

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001038368A1 (fr) Nouveau polypeptide arn helicase 43 humain et polynucleotide codant ledit polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001078755A2 (fr) Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001075019A2 (fr) Nouveau polypeptide, proteine humaine de mutation 11 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001081386A1 (fr) Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide
WO2001075124A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 9, et polynucleotide codant pour ce polypeptide
WO2001064722A1 (fr) Nouveau polypeptide, proteine humaine 9 associee a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001081384A1 (fr) Nouveau polypeptide, laminine 16, et polynucleotide codant pour ce polypeptide
WO2001066585A1 (fr) Nouveau polypeptide, proteine humaine 10 regulant la protease, et polynucleotide codant pour ce polypeptide
WO2001070784A1 (fr) Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide
WO2001072795A1 (fr) Nouveau polypeptide, quinine reductase humaine 16, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP