WO2001078755A2 - Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001078755A2
WO2001078755A2 PCT/CN2001/000272 CN0100272W WO0178755A2 WO 2001078755 A2 WO2001078755 A2 WO 2001078755A2 CN 0100272 W CN0100272 W CN 0100272W WO 0178755 A2 WO0178755 A2 WO 0178755A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
mutant protein
ataxia
human ataxia
Prior art date
Application number
PCT/CN2001/000272
Other languages
English (en)
Chinese (zh)
Other versions
WO2001078755A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU46310/01A priority Critical patent/AU4631001A/en
Publication of WO2001078755A2 publication Critical patent/WO2001078755A2/fr
Publication of WO2001078755A3 publication Critical patent/WO2001078755A3/fr

Links

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, ataxia-capillary telangiectasia mutant protein 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Ataxia-telangiectasia is a recessive disorder of frequently chromosomal body. Symptoms are ataxia of the cerebellum, telangiectasia, a defective immune system, and susceptibility to malignant tumors (especially leukemia and lymphoma). Chromosomes are often broken and inverted. Chromosome 7 and chromosome 14 are often translocated. Other symptoms include premature aging and endocrine abnormalities. AT cells are more likely to die than normal cells when exposed to ionizing radiation. [Genome Res 1997 Jim; 7 (6): 592- 605]
  • Ataxia-Capillary vasodilation is caused by mutations in the ataxia-capillary telangiectasia mutation gene (ATM, mutated in A-T). This gene is located on chromosomes llq22-q23. ATM gene products play a role in the regulation of the cell cycle and also play a role in the response to DNA damage. A-T heterozygotes are susceptible to tumors, especially breast cancer in women. [Cancer Res 1996 Sep 15; 56 (18): 4130-3]
  • ATM positions So far, hundreds of mutations in ATM positions have been discovered. Some of these mutations can reduce the symptoms of A-T.
  • the role of the ATM gene is not yet clear, but it is likely to protect cells from ionizing radiation and other radiation-like agents.
  • the expression of ATM genes in tissue culture cells can reverse the susceptibility of A-T to radiation.
  • the human ataxia-telangiectasia mutant protein 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art. Identification of more ataxia-telangiectasia mutant protein 9 proteins involved in these processes, especially the amino acid sequence of this protein. Newcomers Isolation of the gene encoding telangiectasia telangiectasia mutant protein 9 also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 9.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human ataxia-capillary telangiectasia mutant protein 9.
  • Another object of the present invention is to provide a method for producing human ataxia-telangiectasia mutant protein 9.
  • Another object of the present invention is to provide an antibody against the human ataxia-telangiectasia mutant protein 9 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of ataxia-capillary telangiectasia mutant protein 9 against the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human ataxia-telangiectasia mutant protein 9.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 772-1 to 026 in SEQ ID NO: 1; and (b) a sequence having 1- in SEQ ID NO: 1 1 158-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ataxia-capillary telangiectasia mutein 9 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human ataxia-capillary telangiectasia mutant protein 9 protein in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of ataxia-telangiectasia, breast cancer, various tumors, embryonic disorders, growth disorders, immune diseases, Use of inflammation, hematopathy, HIV infection, or other diseases caused by abnormal expression of human ataxia-telangiectasia mutant protein 9.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Biological activity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • the term “immunologically active” refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human ataxia-capillary telangiectasia mutant protein 9, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human ataxia-capillary telangiectasia mutant protein 9.
  • Antagonist refers to a biological activity that blocks or regulates human ataxia-capillary vasodilatation mutant protein 9 when combined with human ataxia-capillary vasodilation mutant protein 9. Or immunologically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human ataxia-capillary telangiectasia mutant protein 9.
  • Regular refers to a change in the function of human ataxia-capillary telangiectasia mutant protein 9, including any increase or decrease in protein activity, changes in binding characteristics, and any of the human ataxia-capillary telangiectasia mutant protein 9. Changes in other biological, functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ataxia-telangiectasia mutant protein 9 using standard protein purification techniques. Essentially pure human ataxia-capillary telangiectasia mutant protein 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of human ataxia-telangiectasia mutant protein 9 can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides that are base-paired under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” may be complementary to the complementary sequence "G -A-C-T "binding.
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sout hern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGAL I GN program (La sergenes of tware package, DNASTAR, Inc., Mad Son Wis.). MEGAL IGN The program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method checks the The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
  • the percent identity between nucleic acid sequences can also be determined by Cluster method or by methods known in the art such as Jo t un He in (He in J., (1990) Methods in emzumo logy 183: 625-645) 0 ""Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human ataxia-capillary telangiectasia mutant protein 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • Polynucleoside in its natural state Acids and polypeptides are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances in their natural state.
  • isolated human ataxia-capillary telangiectasia mutant protein 9 refers to human ataxia-capillary telangiectasia mutant protein 9 which is substantially free of other proteins, lipids, and sugars naturally associated with it. Or other substances.
  • Those skilled in the art can purify human ataxia-telangiectasia mutant protein 9 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human ataxia-telangiectasia mutant protein 9 can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, ataxia-capillary telangiectasia mutant protein 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives, and analogs of human ataxia-capillary telangiectasia mutant protein 9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ataxia-capillary telangiectasia mutant protein 9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
  • the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as Leader sequences or secretory sequences or sequences used to purify this polypeptide or protease sequences)
  • such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ II) NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1158 bases in length and its open reading frame 772-1026 encodes 84 amino acids.
  • this polypeptide has a similar expression profile to the protein product of the human ataxia-capillary telangiectasia mutant gene, and it can be inferred that the human ataxia-capillary telangiectasia Mutated protein 9 has a similar function to the protein product of the human ataxia-telangiectasia mutant gene.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° / ° F i co ll, 421: etc .; or (3) only in two sequences
  • the hybridization occurs when the identity between at least 95% and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 And active.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. More than nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ataxia-capillary telangiectasia mutant protein 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ataxia-telangiectasia mutant protein 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or MA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human ataxia-capillary telangiectasia mutant protein 9 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of detecting human ataxia-capillary telangiectasia mutant protein 9 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and coupling immunosorbent assay (ELISA). .
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • the polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al.
  • Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain the full-length CDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using human ataxia-capillary telangiectasia mutant protein 9 coding sequence, and the recombinant technology to produce the present invention.
  • a method of inventing the polypeptide is a method of inventing the polypeptide.
  • a polynucleotide sequence encoding human ataxia-capillary vasodilatation mutant protein 9 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ataxia-capillary telangiectasia mutant protein 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or tr P promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
  • Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a gene containing the polynucleotide or the recombinant vector.
  • Engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase, and treated with the ( 12 method, the steps used are well known in the art.
  • MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ataxia-capillary telangiectasia mutant protein 9 (Science, 1984; 224: 1431). Generally there are the following steps :
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include but Not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography , High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography , High performance liquid chromat
  • FIG. 1 is a comparison diagram of gene chip expression profiles of the protein product of the ataxia-capillary telangiectasia mutant protein 9 and the human ataxia-capillary telangiectasia mutant gene of the present invention.
  • the upper graph is a graph of the expression profile of the human ataxia-capillary vasodilation mutant protein 9
  • the lower sequence is the graph of the expression profile of the protein product of the human ataxia-capillary vasodilation mutant gene.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human ataxia-telangiectasia mutant protein 9.
  • 9KDa is the molecular weight of the protein.
  • the arrow points to the isolated protein band.
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to orient the 00 ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Eimer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0138g08 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0138g08 clone contains a full-length cDNA of 1158bp (as shown in Seq IDNO: 1), and a 255bp open reading frame (0RF) from 772bp to 1026bp, encoding a new protein (such as Seq ID NO: 2).
  • This clone pBS-0138g08 and the encoded protein was named human ataxia-capillary telangiectasia mutant protein 9.
  • Example 2 Cloning of the gene encoding human ataxia-capillary telangiectasia mutant protein 9 by RT-PCR method Using fetal brain cell total RNA as a template, oligo-dT as a primer for reverse transcription reaction to synthesize cDM, and Qiagene's After purification of the kit, PCR amplification was performed with the following primers:
  • Primer 1 5 GCCTAGAGATAGGAAAATAGTCAG —3, (SEQ ID NO: 3)
  • Primer2 5 — GATTCACTTCATATGTTTATGTAT —3, (SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 ramol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a 50 ⁇ 1 reaction volume, 1U of Taq DNA polymerase (C 1 on te ch).
  • the reaction was performed on a PE 9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1158 bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ataxia-telangiectasia mutant protein 9 gene expression:
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • the DNA probe used was the PCR amplified human ataxia-telangiectasia mutant protein 9 coding region sequence (772bp to 1026bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 503 ⁇ 4 formamide-25mM KH 2 PO 4 (pH7.4)-5 x SSC-5 x Denhardt, s solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human ataxia-telangiectasia mutant protein 9 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers is designed, and the sequences are as follows:
  • Primer3 5,-CATGCTAGCATGCCCCTTCTCACTACTTTTGTG -3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCACAGGCTTCCCTCTGGAGAGAA-3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0138g08 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: 10 pg of P BS-0138g08 plasmid, Primer-3, and Primer-4 were included in a total volume of 50 ⁇ 1; j was lOpmol, Advantage polymerase Mix (Clontecli) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH50C using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1), positive clones were screened by colony PCR method and sequenced. A positive clone ( P ET-0138g08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) P lySs (product of Novagen) using the calcium chloride method.
  • the host strain BL21 (pET-0138g08) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). Purified human ataxia-capillary telangiectasia mutant protein 9 was purified.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following human ataxia-telangiectasia mutant protein 9 specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Immunize the patient with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant. After 15 days, use the hemocyanin polypeptide complex and incomplete Freund's adjuvant to boost immunity once.
  • a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum.
  • Protein A-Sepharose was used to isolate total IgG from antibody-positive home free serum.
  • the peptide was bound to a fluorine bromide-activated Seph ar0S e4B column, and the total IgG Anti-peptide antibodies were isolated.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human ataxia-capillary telangiectasia mutant protein 9.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • unhybridized probes are removed by a series of membrane washes.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used; 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • DNA purification and ethanol precipitation Steps 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (1 0xDenhardt's; 6xSSC, 0.1 mg / ml) was added.
  • CT DNA (calf thymus DNA).
  • Gene chip or gene microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high density of a large number of target gene fragments. It is arranged on a carrier such as slope glass and silicon, and then the data is compared and analyzed by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently, and with high throughput.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between points. The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip.
  • Cartesian 7500 spotter purchased from Cartesian Company, USA
  • Total mRNA was extracted from the human mixed tissue and specific tissues (or stimulated cell lines) of the body by a single method, and the niRNA was purified using the Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP 5- Amino- propargy 2'-deoxyuridine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech
  • Cy3dUTP 5- Amino- propargy 2'-deoxyuridine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech
  • Cy5dUTP 5- Amino- propargyl- 2'-deoxyuridine
  • the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA- Ecv304 cell line, starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Ataxia-Capillary telangiectasia is an autosomal recessive disorder with symptoms such as ataxia of the cerebellum, telangiectasia, defective immune system, and susceptibility to malignant tumors (especially leukemia and lymphoma).
  • Ataxia-capillary vasodilation is caused by ataxia-capillary telangiectasia mutation gene (ATM, mutated in A-T) mutation.
  • ATM gene products play a role in the regulation of the cell cycle and also play a role in the response to DNA damage.
  • A-T heterozygotes are susceptible to tumors, especially breast cancer in women.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of the protein product of the human ataxia-telangiectasia mutant gene, and both have similar biological functions. It has a variety of important functions in the body, mainly regulating the physiological functions of various tissues and organs in the body such as the immune system, cell proliferation, cerebellum, capillaries, etc. Abnormal expression will cause abnormalities in the above-mentioned tissue cells and cause related diseases.
  • the abnormal expression of the human ataxia-capillary telangiectasia mutant protein 9 will produce various diseases, especially ataxia-capillary telangiectasia, breast cancer, various tumors, embryonic developmental disorders, Growth disorders, immune diseases, inflammation, these diseases include but are not limited to:
  • Tumors of various tissues breast cancer, stomach cancer, liver cancer, lung cancer, esophageal cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Neurofibromas, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Immune diseases common variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, primary T lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome, systemic lupus erythematosus, rheumatoid arthritis,
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Abnormal expression of the human ataxia-telangiectasia mutant protein 9 of the present invention will also produce certain genetic and hematological diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially ataxia-capillary vasodilation, breast cancer, various tumors, and embryo development. Disorders, growth disorders, immune disorders, inflammation, certain hereditary, hematological diseases, etc.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ataxia-capillary telangiectasia mutant protein 9. Agonists increase human ataxia-capillary vasodilator mutein 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation such as various cancers.
  • mammalian cells or a membrane preparation expressing human ataxia-capillary telangiectasia mutant protein 9 can be cultured with a labeled human ataxia-capillary telangiectasia mutant protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human ataxia-telangiectasia mutant protein 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human ataxia-telangiectasia mutant protein 9 can bind to human ataxia-telangiectasia mutant protein 9 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.
  • Human ataxia-capillary telangiectasia mutations can be screened for compounds that are antagonists Protein 9 was added to the bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human ataxia-telangiectasia mutant protein 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human ataxia-capillary telangiectasia mutant protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human ataxia-capillary telangiectasia mutant protein 9 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human ataxia-capillary telangiectasia mutant protein 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by human ataxia-capillary telangiectasia mutant protein 9 directly injected into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human ataxia-telangiectasia mutant protein 9 include, but are not limited to, hybridoma technology (Kohler and Milste in. Nature, 1975, 256: 495-497), triple tumor technology , Human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human ataxia-capillary telangiectasia mutant protein 9.
  • Anti-human ataxia-telangiectasia mutant protein 9 antibodies can be used in immunohistochemistry to detect human ataxia-telangiectasia mutant protein 9 in biopsy specimens.
  • Monoclonal antibodies that bind to human ataxia-telangiectasia mutant protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ataxia-capillary vasodilation Mutein 9 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human ataxia-capillary telangiectasia mutant protein 9.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ataxia-telangiectasia mutant protein 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human ataxia-capillary telangiectasia mutant protein 9 level. These tests are well known in the art and include FI SH assays and radioimmunoassays.
  • Human ataxia-capillary telangiectasia mutant protein 9 levels detected in the test can be used to explain the importance of human ataxia-capillary telangiectasia mutant protein 9 in various diseases and to diagnose human ataxia Dysregulation-A disease in which telangiectasia mutant protein 9 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human ataxia-telangiectasia mutant protein 9 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the absence or abnormal / inactive expression of human ataxia-telangiectasia mutant protein 9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human ataxia-capillary telangiectasia mutant protein 9 to inhibit endogenous human ataxia-capillary telangiectasia mutant protein 9 activity.
  • a variant human ataxia-capillary telangiectasia mutant protein 9 may be a shortened, human ataxia-capillary telangiectasia mutant protein 9 that lacks a signaling domain, although it may interact with downstream substrates. Binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of ataxia-telangiectasia mutant protein 9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • telangiectasia mutant protein 9 can be used to transfer a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 9 into cells .
  • mutein polynucleotides 9 recombinant viral vectors can be found in existing literature (Sambrook, e tal.).
  • a polynucleotide encoding human ataxia-telangiectasia mutant protein 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human ataxia-telangiectasia mutant protein 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in various ways, such as increasing the sequence length on both sides, and applying thiophosphates to the ribonucleoside linkages. Bond or peptide bond instead of phosphodiester bond.
  • a polynucleotide encoding human ataxia-capillary telangiectasia mutant protein 9 can be used for diagnosis of diseases related to human ataxia-capillary telangiectasia mutant protein 9.
  • Polynucleotides encoding human ataxia-capillary telangiectasia mutant protein 9 can be used to detect the expression of human ataxia-capillary telangiectasia mutant protein 9 or human ataxia-capillary telangiectasia in the disease state Abnormal Expression of Mutein 9.
  • the DNA sequence encoding human ataxia-telangiectasia mutant protein 9 can be used to hybridize biopsy specimens to determine the expression of human ataxia-telangiectasia mutant protein 9.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (M i croa rr ay) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis. Human ataxia-telangiectasia mutant protein 9 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human ataxia-telangiectasia mutant protein 9 transcription products.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the ataxia-telangiectasia mutant protein 9 gene can also be used to diagnose human ataxia-telangiectasia mutant protein 9-related diseases.
  • Human ataxia-telangiectasia mutant protein 9 mutant forms include point mutations, translocations, deletions, recombinations and any other abnormalities compared to normal wild-type human ataxia-telangiectasia mutant protein 9 DNA sequence Wait. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization.
  • the mutation may affect the expression of the protein, so the Nor thern blot and Western blot can be used to indirectly determine whether the gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • the important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35 bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c library. Fluorescent in situ hybridization (FI SH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FI SH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l ian Inher i tance in Man (available online with Johns Hopk ins University Welch Med i cal Med Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with a cDNA-based PC'R. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ataxia-telangiectasia mutant protein 9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ataxia-capillary vasodilator mutein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine de mutation 9 de l'ataxie-télangiectasie, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de l'ataxie-télangiectasie, du cancer du sein, de toutes sortes de tumeurs, des troubles du développement de l'embryon, des troubles de développement et croissance, des maladies immunitaires, des inflammations, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine de mutation 9 de l'ataxie-télangiectasie.
PCT/CN2001/000272 2000-03-02 2001-02-26 Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide WO2001078755A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU46310/01A AU4631001A (en) 2000-03-02 2001-02-26 A novel polypeptide, a human ataxia-telangiectasia mutation protein 9 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111804.8 2000-03-02
CN 00111804 CN1311209A (zh) 2000-03-02 2000-03-02 一种新的多肽——人共济失调-毛细血管扩张症突变蛋白9和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001078755A2 true WO2001078755A2 (fr) 2001-10-25
WO2001078755A3 WO2001078755A3 (fr) 2002-02-07

Family

ID=4581700

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000272 WO2001078755A2 (fr) 2000-03-02 2001-02-26 Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1311209A (fr)
AU (1) AU4631001A (fr)
WO (1) WO2001078755A2 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CLIN. GENET. vol. 55, no. 5, 1999, pages 289 - 304 *
HUM. MUTAT. vol. 10, no. 2, 1997, pages 100 - 107 *
INT. J. BIOCHEM. CELL BIOL. vol. 31, no. 7, 1999, pages 735 - 740 *
J. CLIN. IMMUNOL. vol. 16, no. 5, 1996, pages 254 - 260 *

Also Published As

Publication number Publication date
WO2001078755A3 (fr) 2002-02-07
CN1311209A (zh) 2001-09-05
AU4631001A (en) 2001-10-30

Similar Documents

Publication Publication Date Title
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001068684A1 (fr) Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001074869A1 (fr) Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide
WO2001078755A2 (fr) Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001070965A1 (fr) Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001075019A2 (fr) Nouveau polypeptide, proteine humaine de mutation 11 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001079433A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 13, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001075025A2 (fr) Nouveau polypeptide, thyroglobuline humaine 9, et polynucleotide codant pour ce polypeptide
WO2001081392A1 (fr) Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide
WO2001064732A1 (fr) Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide
WO2001075037A2 (fr) Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide
WO2001075102A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 13, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001077286A2 (fr) Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide
WO2001072821A1 (fr) Nouveau polypeptide, thyroglobuline humaine 12, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase in:

Ref country code: JP