WO2001090171A1 - Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090171A1
WO2001090171A1 PCT/CN2001/000795 CN0100795W WO0190171A1 WO 2001090171 A1 WO2001090171 A1 WO 2001090171A1 CN 0100795 W CN0100795 W CN 0100795W WO 0190171 A1 WO0190171 A1 WO 0190171A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
human
human ribosomal
Prior art date
Application number
PCT/CN2001/000795
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU76247/01A priority Critical patent/AU7624701A/en
Publication of WO2001090171A1 publication Critical patent/WO2001090171A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human ribosomal SI I protein 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • the ribosome plays an important role in the cell, and it is the site of protein synthesis.
  • Complex and diverse proteins (approximately 70-90 types) are distributed on the ribosomes of eukaryotes, which are located on their large and small subunits, respectively.
  • the S11 protein is one of them. It is located on the small subunit of the ribosome and plays a very important role in the correct tRNA selection in the initial stage of protein synthesis.
  • the ribosomal protein S11 protein family contains the following conservative amino acid sequences: [LIVMF] —X— [GSTAC] — [LIVMF] —X (2) — [GSTAL] — X (0, 1) — [GSN] ⁇ [LIVMF] — X— [LIVM] — X (4) ⁇ [DEN] — X— T— P— X— [PA] ⁇ [STCH] — [DN].
  • the protein chain of the S11 family can be divided into 4 regions: A, B, C, D, A and C regions have partially lost their functional constraints during the evolution process; instead, B and D
  • the region remains highly conserved in the proteins of this family, and almost all of the conserved residues are located on these two segments. Even if the amino acid changes, it is replaced by a similar amino acid. Therefore, the B and D regions have an important influence on the structure and function of the S11 protein, while the C-terminus is not very important for the function of the entire chain, and is more involved in the stability of the protein structure.
  • the ribosomal S11 protein plays an important role in protein synthesis. During the synthesis process, the small ribosomal subunit must be continuously bound to and separated from tRNA, and the S11 protein can select the correct tRNA to bind to the small ribosomal subunit to avoid mismatches, which is directly related to the organism Passage stability.
  • human ribosomal SI I protein 12 protein regulates cell division and embryonic development. It plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more human ribosomal SII proteins involved in these processes. . Isolation of the new human ribosomal SII protein 12 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ribosomal S I I protein 12.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human ribosome S I I protein 12.
  • Another object of the present invention is to provide a method for producing human ribosome S I I protein 12.
  • Another object of the present invention is to provide antibodies against the human ribosomal S I I protein 12 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention—human ribosomal S I I protein 12.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human ribosomal S I I protein 12. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 1237-1563; and (b) a sequence of positions 1-1834 of SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ribosomal S I I protein 12 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human ribosomal SII protein 12 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ribosomal S I I protein 12.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of human ribosome SII protein 12 and human ribosome SII protein 9 according to the present invention.
  • the upper graph is a graph of the expression profile of human ribosomal SII protein 12, and the lower graph is the graph of expression profile of human ribosome SI I protein 9.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 1 1 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 means prostate
  • 21 means fetal heart
  • 22 means heart
  • 23 means muscle
  • 24 means testis
  • 25 means fetal thymus
  • 26 means thymus.
  • Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human ribosomal S I I protein 12.
  • 12kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or R, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with the human ribosomal SI I 12 protein, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human ribosomal S I I protein 12.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human ribosomal SI I 12 protein when bound to human ribosomal SI I 12 protein.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human ribosomal S I I protein 12.
  • Regular refers to a change in the function of human ribosome S I I protein 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human ribosome S I I protein 12.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality. Those skilled in the art can purify human ribosomal SI I protein 12 using standard protein purification techniques. The substantially pure human ribosomal SI I protein 12 produces a single main band on a non-reducing polyacrylamide gel. The purity of human ribosomal SI I protein 12 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks the distance between all pairs by Each group of sequences is arranged into clusters. Each cluster is then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percentage identity Jotun Hein measured between nucleic acid sequences can also Clus ter or a method well known in the art (He in J., (1990) Methods in enzymo logy 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? It can specifically bind to the epitope of human ribosomal SII protein 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human ribosomal S I I protein 12 means that human ribosomal S I I protein 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human ribosomal S I I protein 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ribosomal S I I protein 12 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide ⁇ ⁇ ribosomal SI I protein 12, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human ribosomal SII protein 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ribosome SII protein 12 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non- A conservative amino acid residue (preferably a conservative amino acid residue) substitution, and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more of the amino acid residues Each group is substituted by another group to include a substituent; or (II) a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such A type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence).
  • an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1834 bases in length and its open reading frame 1237-1563 encodes 108 amino acids.
  • this polypeptide has a similar expression profile with human ribosomal S I I protein 9, and it can be deduced that the human ribosomal S I I protein 12 has similar functions to human ribosomal S I I protein 9. .
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID D NO: 2 but different from the coding region sequence shown in SEQ ID D NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col 1, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ribosomal SI I protein 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ribosomal SI I protein 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cD sequences.
  • the standard method for isolating the cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecu lar Cloning, A Labora tory Manua 1, Cold Labor Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) D-DNA or DNA-R hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the human ribosomal SI I protein 12 transcript; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is any part of the polynucleotide of the present invention Homologous, at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human ribosomal SII protein 12 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human ribosome SII protein 12 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .
  • the polynucleotide sequence encoding the human ribosome SII protein 12 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ribosomal SII protein 12 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA Technology, D synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mol ecu lar Cloning, a Labora tory Manua l, Cold Spring Harbor Labora tory. New York, 1989).
  • the D sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ribosomal S I I protein 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the D sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the ( 12 method, the steps used are well known in the art.
  • MgCl 2 can be used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ribosomal SI I protein 12 (Sc ience, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human human ribosomal SII protein 12 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • Ribosomal protein S 11 is one of the proteins in the small subunit of the ribosome. It plays a very important role in the correct tRNA selection in the initial stage of protein synthesis. The S11 protein can select the correct tRNA to bind to small ribosomal subunits to avoid mismatches, which is directly related to the stability of the passage of the organism.
  • the abnormal expression of the human ribosomal SI I protein 12 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, and inflammation. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymus Tumor, Nasal and Sinus Tumors, Nasopharyngeal Carcinoma, Laryngeal Carcinoma, Tracheal Tumor, Pleural Mesothelioma, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma Embryonic developmental disorders: congenital abortion, cleft palate,
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • the abnormal expression of the human ribosomal SI I protein 12 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribosomal SI I protein 12.
  • Agonists enhance human ribosomal SI I protein 12 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human ribosome SI I protein 12 can be cultured with labeled human ribosome SI I protein 12 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human ribosomal SI I protein 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human ribosomal SII protein 12 can bind to human ribosomal SI I protein 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions .
  • human ribosomal SI I protein 12 can be added to a bioanalytical assay to determine whether a compound is a compound by measuring the effect of the compound on the interaction between human ribosomal SI I protein 12 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to human ribosomal SI I protein 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 12 molecules of human ribosomal S I I protein should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides Antibodies against the human ribosomal SII protein 12 epitope These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ribosomal SII protein 12 directly into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human ribosomal SII protein 12 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human ribosomal SII protein 12.
  • Antibodies against human ribosomal SII protein 12 can be used in immunohistochemical techniques to detect human ribosomal SII protein 12 in biopsy specimens.
  • Monoclonal antibodies that bind to human ribosomal SII protein 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ribosomal SII protein 12 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ribosome SII protein 12 positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to human ribosomal SII protein 12.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human ribosomal SII protein 12.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human ribosomal SII protein 12 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human ribosome SII protein 12 detected in the test can be used to explain the importance of human ribosome SII protein 12 in various diseases and to diagnose diseases in which human ribosome SII protein 12 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human ribosomal SII protein 12 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat human ribosomal SII protein 12 caused by non-expression or abnormal / inactive expression Cell proliferation, development, or metabolism is abnormal.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ribosome SII protein 12 to inhibit endogenous human ribosome SII protein 12 activity.
  • a variant human ribosomal SII protein 12 may be a shortened human ribosome SII protein 12, which lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human ribosomal SII protein 12.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ribosomal SII protein 12 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ribosomal SII protein 12 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human ribosomal SII protein 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human ribosomal SII protein 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human ribosome SII protein 12 can be used for the diagnosis of diseases related to human ribosome SII protein 12.
  • the polynucleotide encoding human ribosomal SII protein 12 can be used to detect the expression of human ribosome SII protein 12 or the abnormal expression of human ribosome SII protein 12 in a disease state.
  • the DNA sequence encoding human ribosomal SII protein 12 can be used to hybridize biopsy specimens to determine the expression status of human ribosomal SII protein 12.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human ribosomal SII protein 12 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human ribosomal SII protein 12 transcription products. Detection of mutations in the human ribosome SI I protein 12 gene can also be used to diagnose human ribosome SI I protein 12-related diseases.
  • Human ribosome SI I protein 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribosome SI I protein 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ribosomal SI I protein 12 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ribosomal SI I protein 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the pBSK (+) vector (Clontech), and then transformed into DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with an existing public D sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0470a03 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5, — TGCCCACGCAGTTGTCGTGAGGAT -3, (SEQ ID NO: 3)
  • Pr imer2 5'- TCCACTGTGGCCGAAGTTCAGCCC -3 '(SEQ ID NO: 4)
  • Pr iraerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions reaction volume containing 50 ⁇ 1 of 50mmol / L KCl, 10mmol / L Tr i s-HCl pH8 5, 1. 5mmol / L MgCl 2, 20 ( ⁇ mol / L dNTP, l Opmo. l Primer, 1U of Taq DNA polymerase (product of Clontech). Reaction was performed on a PE9600 DNA thermal cycler (Perk in-Elmer) for 25 cycles under the following conditions: 94.C 30sec; 55.C 30sec; 72 ° C 2min. At the same time during RT-PCR, (3-act in is used as a positive control and template blank is used as a negative control.
  • Amplification products were purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen (Products of the company).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1834bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human ribosomal SI I protein 12 gene expression
  • RNA extraction in one step [Ana l. Biochem 1987, 162, 156-159] This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25 mM sodium citrate, 0. 2M sodium acetate (. P H4 0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1), centrifuged after mixing with the water absorbing layer, was added isopropyl. Alcohol (0.8 volume) and the mixture was centrifuged to obtain R pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA containing 20 mM 3- (N-morpholino) propane Sulfonic acid (PH7. 0)-5mM sodium acetate-ImM EDTA- 2.2M formaldehyde on a 1.2% agarose gel for electrophoresis. Then transferred to a nitrocellulose membrane. Randomized primers with a- 32 P dATP 32 P-labeled DNA probe was prepared. The DNA probe used was the PCR-encoded human ribosomal SI I protein 12 coding region sequence (1237bp to 1563bp) shown in Figure 1.
  • the 32P-labeled probe ( About 2 ⁇ 10 6 cpm / ml) hybridized with the nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4. 4 )-5 ⁇ SSC- 5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager Perform analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human ribosomal SI I protein 12 Based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Pr imer3 5,-CCCCATATGATGAGGCCTCACCTGCACGTGTCT- 3, (Seq ID No: 5)
  • Pr imer 4 5,-CATGGATCCTCATGCCATGGCCCTTCTGTGGCA- 3, (Seq ID No: 6)
  • Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • PCR reaction was performed using the pBS-0470a03 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0470a03 containing 10pg, primer Pr imer- 3 and Pr imer- 4 are l Opmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
  • Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles.
  • Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E.
  • the following peptides specific to human ribosomal SI I protein 12 were synthesized using a peptide synthesizer (product of PE company): NH2- Met- Arg- Pro- Hi s- Leu- Hi s- Va l-Ser- Ala- Ser- Phe -Ser- Gly- Gly- Va l- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences Compare its homology with its complementary region. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After closing the bag, 68. C water bath for 2 hours.
  • prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Example 7 DM Microarray
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, refer to the documents DeRi si, JL, Lyer, V. & Brown, PO (1997) Sc ience 278, 680-686. And the documents Hel le, RA, Schema, M Chai. A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ .
  • the spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen), and another 1 J was separated by reverse transcription.
  • the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamac ia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl- 2'- deoxyur idine 5 '-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissues (or stimulated cell lines) with mRM, and purified them to prepare probes.
  • mRM for specific steps and methods, see:
  • the probes from the above two tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from Genera Scanning, USA), and the scanned images were analyzed by Imagene software (Biodi scovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine ribosomale SII 12, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine humaine ribosomale SII 12.
PCT/CN2001/000795 2000-05-16 2001-05-14 Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide WO2001090171A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU76247/01A AU7624701A (en) 2000-05-16 2001-05-14 A novel polypeptide-human robosomal sii protein 12 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115686A CN1323804A (zh) 2000-05-16 2000-05-16 一种新的多肽——人核糖体sii蛋白12和编码这种多肽的多核苷酸
CN00115686.1 2000-05-16

Publications (1)

Publication Number Publication Date
WO2001090171A1 true WO2001090171A1 (fr) 2001-11-29

Family

ID=4585130

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000795 WO2001090171A1 (fr) 2000-05-16 2001-05-14 Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1323804A (fr)
AU (1) AU7624701A (fr)
WO (1) WO2001090171A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994001570A1 (fr) * 1992-07-08 1994-01-20 Rhone-Poulenc Rorer S.A. Promoteur du gene de la proteine ribosomique rp28 de k. lactis et son utilisation
WO1999029341A2 (fr) * 1997-12-12 1999-06-17 Corixa Corporation PROCEDES PERMETTANT DE RENFORCER DES REPONSES IMMUNITAIRES DE PROTECTION AU MOYEN DE POLYPEPTIDES $i(LEISHMANIA)
WO2000028079A2 (fr) * 1998-11-09 2000-05-18 Gemini Genomics Ab Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994001570A1 (fr) * 1992-07-08 1994-01-20 Rhone-Poulenc Rorer S.A. Promoteur du gene de la proteine ribosomique rp28 de k. lactis et son utilisation
WO1999029341A2 (fr) * 1997-12-12 1999-06-17 Corixa Corporation PROCEDES PERMETTANT DE RENFORCER DES REPONSES IMMUNITAIRES DE PROTECTION AU MOYEN DE POLYPEPTIDES $i(LEISHMANIA)
WO2000028079A2 (fr) * 1998-11-09 2000-05-18 Gemini Genomics Ab Variation genetique associee a l'anemie aplasique, et applications diagnostiques et therapeutiques basees sur cette variation

Also Published As

Publication number Publication date
CN1323804A (zh) 2001-11-28
AU7624701A (en) 2001-12-03

Similar Documents

Publication Publication Date Title
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001046248A1 (fr) Nouveau polypeptide, proteine ribosomale s9 26, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001062782A1 (fr) Nouveau polypeptide, famille proteique 11 de la rhodopsine, et polynucleotide codant pour ce polypeptide
WO2001047998A1 (fr) Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide
WO2001046241A1 (fr) Nouveau polypeptide, proteine 12 gvpa, et polynucleotide codant pour ce polypeptide
WO2001087966A1 (fr) Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide
WO2001055427A1 (fr) Nouveau polypeptide, proteine humaine kelch 19, et polynucleotide codant pour ce polypeptide
WO2001048160A1 (fr) Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide
WO2001087967A1 (fr) Proteine s18-26 ribosomale, polypeptide humain, et polynucleotide la codant
WO2001075037A2 (fr) Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide
WO2001083683A2 (fr) Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001074895A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 12.1, et polynucleotide codant pour ce polypeptide
WO2001074998A2 (fr) Nouveau polypeptide, proteine humaine de regulation 10 de la serine proteinase, et polynucleotide codant pour ce polypeptide
WO2001055419A1 (fr) Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide
WO2001048199A1 (fr) Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide
WO2001078755A2 (fr) Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP